Aav-based anti-angiogenic gene delivery system and uses thereof
By constructing transgenic expression cassettes and gene delivery systems using codon-optimized nucleic acid molecules and modified AAV capsid proteins, the problems of broad-spectrum infectivity and multiple injections of AAV vectors have been solved, enabling highly efficient treatment of retinal diseases and cancer.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-07-30
- Publication Date
- 2026-03-27
AI Technical Summary
Existing AAV vectors have broad-spectrum infectivity, leading to off-target tissue delivery, adverse reactions, and repeated injections cause pain to patients. They are also difficult to deliver multiple angiogenesis inhibitors simultaneously.
By using codon-optimized nucleic acid molecules encoding angiostatin and endostatin, combined with a modified AAV capsid protein, a transgenic expression cassette and gene delivery system were constructed to achieve specific targeted delivery to the retina. The transgenic expression cassette uses a Furin protease sequence + linker peptide + 2A sequence to separate protein expression.
It achieves higher levels of anti-angiogenic protein expression, improves the efficacy of treating retinal diseases and cancer, reduces adverse reactions, and avoids the pain of multiple injections.
Smart Images

Figure CN113564187B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present disclosure relates to a nucleic acid molecule encoding angiostatin, a transgene expression cassette comprising the nucleic acid molecule, and a gene delivery system comprising the transgene expression cassette. BACKGROUND
[0002] Pathological neovascularization occurs in a large number of retinal diseases and affects millions of people worldwide each year. For example, about 300 million people worldwide, especially those over 60 years of age, suffer from age-related macular degeneration (AMD), which is the leading cause of blindness in the elderly (Klein R, Peto T, et al., Am J Ophthalmol (2004) 137(3):486-95; Friedman DS, O’Colmain BJ, et al., Arch Ophthalmol (2004) 122(4):564-72; AI-Zamil WM, et al., Clin Interv Aging (2017):28860733). AMD is characterized by progressive retinal damage under the action of various factors. Among them, a severe form of AMD is called wet AMD, choroidal neovascularization (CNV) gradually expands throughout the retina, and due to the fragility of the blood vessel wall, its internal contents are prone to leakage, which further destroys the integrity of the retinal structure and hinders visual function. Similar neovascular problems, i.e., neovascular hemorrhage and scarring, are also prevalent in diabetic retinopathy (DR) and retinopathy of prematurity (ROP), which occur in diabetic patients and newborns, respectively.
[0003] In addition, excessive neovascularization occurs during tumor development to facilitate the supply of oxygen and nutrients to cancer cells. First, neovascularization can be induced from pre-existing vascular networks and infiltrate tumor tissue; second, tumor cells can recruit endothelial progenitor cells to form a secondary vasculature; third, tumor cells aggregate around pre-existing blood vessels and organize endothelial cells in a tubular manner to produce new vasculature (Jain RK, Science (2005) 307(5706):58-62; Carmeliet P, et al., Nature (2011) 473(7347):298-307; Majidpoor J, et al., Cell Oncol. 2021).
[0004] The above pathological conditions indicate the importance of anti-angiogenesis in treating retinal diseases and cancers. Vascular endothelial growth factor (VEGF) is a key factor that triggers the growth of new blood vessels in these diseases. Anti-VEGF approaches have attracted extensive attention. Endostatin is a 20 kD fragment produced from the C-terminal of collagen XVIII, and angiostatin is a Kringle domain-containing protein produced by proteolytic cleavage of plasminogen. Both of them exhibit excellent anti-angiogenic activity and antagonize the biological effects of VEGF. In the past decade, these two angiogenesis inhibitors have been widely used in the treatment of retinal diseases and cancers to inhibit the formation of new blood vessels (O'Reilly MS et al., Cell (1994) 79(2): 315-28; O'Reilly MS et al., Cell (1997) 88(2): 277-85; Patent Nos. US 9707304 B2 and US 2004 / 0156828 A1). Therefore, in order to achieve better therapeutic effect on retinal diseases and cancers, it is also desirable to obtain endostatin-encoding sequences and angiostatin-encoding sequences with higher expression levels.
[0005] Adeno-associated virus (AAV) has low pathogenicity and the ability to stably express proteins in various organ tissues, which makes AAV have obvious advantages in the field of gene therapy and is suitable for delivering therapeutic genes. However, wild-type AAV serotypes usually infect multiple tissues / organs of mammals in a broad spectrum, have extensive tissue targeting, and cause gene delivery to off-target tissues, thereby exacerbating adverse reactions. The capsid proteins of AAV particles not only regulate the assembly of AAV during replication, but also promote the interaction of the virus with receptors on the plasma membrane and entry into target cells. Studies have shown that the tissue tropism and cell transformation efficiency of AAV vectors are mainly determined by their capsids. In view of this, in order to achieve better therapeutic effect, it is desirable to make suitable modifications to the AAV capsid proteins to obtain AAV vectors with organ (e.g., eye) specificity.
[0006] In addition, due to the inconvenience and pain caused to patients by repeated injections, repeated administration of angiogenesis inhibitors is undesirable. Therefore, it is desirable to obtain a gene delivery system that can simultaneously deliver two or more angiogenesis inhibitors. SUMMARY
[0007] To solve the above technical problems, in a first aspect, the present disclosure provides a nucleic acid molecule encoding angiostatin, the nucleotide sequence of which has at least 80% identity, preferably at least 85%, 90%, 95%, 99% or 100% identity, to the nucleotide sequence shown in SEQ ID NO: 16 or SEQ ID NO: 18.
[0008] In one embodiment, the nucleic acid molecule comprises a nucleotide sequence as set forth in SEQ ID NO: 16 or SEQ ID NO: 18. In a preferred embodiment, the nucleotide sequence of the nucleic acid molecule is as set forth in SEQ ID NO: 16 or SEQ ID NO: 18.
[0009] The nucleic acid molecule encoding angiostatin of the present disclosure comprises a codon-optimized human or murine angiostatin-encoding nucleic acid sequence, which has a higher expression level of angiostatin compared to the original human or murine angiostatin-encoding nucleic acid sequence without codon optimization.
[0010] In a second aspect, the present disclosure provides a nucleic acid molecule encoding endostatin, the nucleotide sequence of which has at least 80% identity, preferably at least 85%, 90%, 95%, 99% or 100% identity, to the nucleotide sequence as set forth in SEQ ID NO: 15 or SEQ ID NO: 17.
[0011] In one embodiment, the nucleic acid molecule comprises a nucleotide sequence as set forth in SEQ ID NO: 15 or SEQ ID NO: 17. In a preferred embodiment, the nucleotide sequence of the nucleic acid molecule is as set forth in SEQ ID NO: 15 or SEQ ID NO: 17.
[0012] The nucleic acid molecule encoding endostatin of the present disclosure comprises a codon-optimized human or murine endostatin-encoding nucleic acid sequence, which has a higher expression level of endostatin compared to the original human or murine endostatin-encoding nucleic acid sequence without codon optimization.
[0013] In a third aspect, the present disclosure provides a transgene expression cassette comprising: a promoter, a nucleic acid molecule according to the first aspect, a bGH polyA.
[0014] In one embodiment, the promoter is selected from the group consisting of: CB promoter, CAG promoter, EF1 promoter, ubiquitin promoter, T7 promoter, SV40 promoter, VP16, VP64 promoter, Tuj1 promoter, GFAP promoter, vimentin promoter, RPE65 promoter, VMD2 promoter, synapsin promoter, VGAT promoter, DAT promoter, TH promoter and osteocalcin promoter; preferably, the promoter is a CB promoter.
[0015] In one embodiment, the transgene expression cassette further comprises: a signal peptide, such as SP signal peptide, ALB signal peptide and PLS signal peptide; and / or two ITRs at both ends, each of which is independently a normal ITR or a shortened ITR peptide.
[0016] In one embodiment, the nucleotide sequence encoding endostatin and / or the nucleotide sequence encoding angiostatin is tagged with an oligopeptide tag, such as Flag, 6xHis, 2xHA, and Myc.
[0017] In one preferred embodiment, the transgene expression cassette further comprises: a nucleotide sequence encoding one or more therapeutic proteins, which is different from angiostatin; preferably, the therapeutic protein is a protein having an anti-angiogenic effect; more preferably, the therapeutic protein is endostatin, such as endostatin encoded by the nucleic acid molecule encoding angiostatin according to the second aspect.
[0018] In one preferred embodiment, the transgene expression cassette further comprises a linker sequence. In one preferred embodiment, the linker sequence is a Furin protease sequence + a linker peptide + a 2A sequence, such as P2A, T2A, or F2A. The use of such a linker sequence can better separate the expression and secretion of two or more proteins (such as endostatin and angiostatin).
[0019] In one embodiment, the nucleotide sequence of the transgene expression cassette is as shown in SEQ ID NO: 9 or SEQ ID NO: 11.
[0020] In the fourth aspect, the present disclosure provides a gene delivery system, comprising: the transgene expression cassette according to the third aspect and an AAV capsid protein.
[0021] In one embodiment, the above-mentioned AAV capsid protein is a natural AAV capsid protein or an artificially engineered AAV capsid protein. In one preferred embodiment, the above-mentioned AAV is selected from: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV-DJ, AAV-DJ8, AAV-DJ9, AAVrh8, AAVrh8R, and AAVrh10.
[0022] In one embodiment, the amino acid sequence of the above-mentioned AAV capsid protein is as shown in SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 14.
[0023] The transgene expression cassette and the gene delivery system of the present disclosure can express a higher level of anti-angiogenic proteins (endostatin and / or angiostatin), and can achieve a better therapeutic effect on retinal diseases and cancer. In addition, in the case where the transgene expression cassette comprises a nucleotide sequence encoding endostatin and a nucleotide sequence encoding angiostatin, the gene delivery system of the present disclosure can achieve the simultaneous delivery of two or more angiogenesis inhibitors.
[0024] In a fifth aspect, the present disclosure provides use of the transgene expression cassette according to the third aspect or the gene delivery system according to the fourth aspect in the preparation of a medicament for treating a disease with neovascularization as a major pathological mechanism or inducing factor.
[0025] In a sixth aspect, the present disclosure provides a medicament comprising: the transgene expression cassette according to the third aspect or the gene delivery system according to the fourth aspect; and an excipient. In one embodiment, the medicament is used for treating a disease with neovascularization as a major pathological mechanism or inducing factor.
[0026] In one embodiment, the disease is a retinal disease or cancer, such as age-related macular retinal degeneration, diabetic retinal disease, and other retinal damage caused by strong light; lung cancer, liver cancer, kidney cancer, thyroid cancer, prostate cancer, kidney cancer, breast cancer, colorectal cancer, cervical cancer, leukemia, lymphoma, melanoma and glioblastoma.
[0027] In a seventh aspect, the present disclosure provides a method for treating a retinal disease or cancer, comprising administering a therapeutically effective amount of the medicament according to the ninth aspect to a subject in need.
[0028] In one embodiment, the medicament is administered by a systemic route or a local route, such as intravenous administration, intramuscular administration, subcutaneous administration, oral administration, topical contact, intraperitoneal administration and intralesional administration. In a preferred embodiment, the medicament is administered locally to the eye, such as by intravitreal injection, subretinal injection or suprachoroidal injection.
[0029] In an eighth aspect, the present disclosure provides an engineered AAV capsid protein, wherein the amino acid sequence of the AAV capsid protein is as shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 14.
[0030] In a ninth aspect, the present disclosure provides a nucleic acid molecule encoding the AAV capsid protein according to the eighth aspect. In one embodiment, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 13.
[0031] The above-mentioned engineered AAV capsid protein of the present disclosure can be used to produce a novel AAV vector, thereby carrying out related research on the novel AAV vector or being used for disease treatment. The novel AAV vector packaging the engineered AAV capsid protein has good retinal tissue targeting, lower toxic side effects and better safety potential, and can be applied to the prevention, diagnosis and treatment of eye-related diseases.
[0032] Accordingly, in a tenth aspect, the present disclosure provides an AAV vector comprising the AAV capsid protein according to the eighth aspect.
[0033] In one embodiment, the AAV vector further comprises an exogenous polynucleotide comprising a nucleotide sequence encoding a therapeutic protein. In one embodiment, the therapeutic protein is a protein having an anti-angiogenic effect. In one embodiment, the therapeutic protein is endostatin and / or angiostatin.
[0034] In one embodiment, the exogenous polynucleotide comprises a nucleotide sequence encoding endostatin; preferably, the nucleotide sequence is set forth in SEQ ID NO: 15 or SEQ ID NO: 17.
[0035] In one embodiment, the exogenous polynucleotide comprises a nucleotide sequence encoding angiostatin; preferably, the nucleotide sequence is set forth in SEQ ID NO: 16 or SEQ ID NO: 18. BRIEF DESCRIPTION OF DRAWINGS
[0036] Figure 1A Images showing GFP signals of AAV5, AAV8, AAV9, AAVH15, AAVXL32 and AAVT13 in mouse retinas.
[0037] Figure 1B Images showing GFP signals of AAV5, AAV8, AAV9, AAVH15, AAVXL32 and AAVT13 in mouse retinas. Figure 1A 3D reconstruction of the GFP signal fluorescence images shown. GCL: ganglion cell layer; IPL: inner plexiform layer; INL: inner nuclear layer; OPL: outer plexiform layer; ONL: outer nuclear layer; RPE: retinal pigment epithelium.
[0038] Figure 1C Images showing relative GFP fluorescence signal intensity of different AAV serotypes relative to AAV5. n = 4 mice / group, ***p < 0.001.
[0039] Figure 2 Images showing retinal sections of mice transduced with AAV8, AAV9, AAVH15 and AAVT13. GFP, DAPI and cone cell marker (S-opsin) / RPE marker (RPE65) are shown. GFP signal reaching the photoreceptor layer is indicated by white arrows.
[0040] Figure 3A Schematic diagram of B36, B110 and B111 expression cassettes.
[0041] Figure 3BWestern blot results showing the expression and secretion of endostatin and angiostatin from B110 and B111 expression cassettes in HEK293 and Huh7 culture supernatants. Plasmid encoding GFP was used as a control.
[0042] Figure 3C B110 expression cassette (comprising codon-optimized human endostatin and human angiostatin-encoding sequences) and B111 expression cassette (comprising codon-optimized murine endostatin and murine angiostatin-encoding sequences) compared to the original non-codon-optimized human or murine endostatin-encoding nucleic acid sequences. Left panel: Western blot results. Right panel: Quantitative statistics of relative expression levels; n=3, ***p<0.001, t-test.
[0043] Figure 3D B110 expression cassette (comprising codon-optimized human endostatin and human angiostatin-encoding sequences) and B111 expression cassette (comprising codon-optimized murine endostatin and murine angiostatin-encoding sequences) compared to the original non-codon-optimized human or murine angiostatin-encoding nucleic acid sequences. Left panel: Western blot results. Right panel: Quantitative statistics of relative expression levels; n=3, ***p<0.001, t-test.
[0044] Figure 4A AAV H15 containing GFP (hereinafter referred to as H15-GFP) was used to infect HUVECs at a multiplicity of infection (MOI) of 1 x 105 5 , 1 x 105 4 , and 1 x 105 3 vg / cell. Images taken 3 days post-viral infection. Top panel: GFP fluorescence; bottom panel: bright field. Scale bar: 100 pm.
[0045] Figure 4B Quantification of the percentage of GFP-positive HUVEC cells.
[0046] Figure 4C Western blot analysis of the conditioned media from HUVECs infected with H15-GFP, H15-B110 (AAV H15 packaging B110 expression cassette), and H15-B111 (AAV H15 packaging B111 expression cassette) at a MOI of 1 x 105 5 vg / cell.
[0047] Figure 4D H15-GFP, H15-B36 (AAV H15 packaging B36 expression cassette), H15-B110, and H15-B111 particles were used to infect HUVECs at a MOI of 1 x 105 5 and 1 x 105 4Photographs of HUVECs infected with MOI of vg / cell. Scale bar: 200 pm.
[0048] Figure 4E Quantification of HUVEC tube formation (tube length per unit area (mm 2 ) is shown. n = 5 cell wells. **p < 0.01, ***p < 0.001, t-test.
[0049] Figure 4F Quantification of HUVEC tube formation (branch point number per unit area (mm 2 ) is shown. n = 5 cell wells. **p < 0.01, ***p < 0.001, t-test.
[0050] Figure 5A A diagram of a mouse model of laser-induced neovascularization is shown. C57BL / 6 mice were intravitreally injected with 2 x 10 10 vg / eye of AAV particles with H15 capsid and packaged with B36, B110, or B111 expression cassettes (referred to as Laser-B36, Laser-B110, Laser-B111, respectively). Fourteen days after virus injection, mice were treated with laser-induced CNV model, and 12 days later, fluorescein angiography (FFA) and immunofluorescence (IF) were performed.
[0051] Figure 5B Fluorescence images of retinal section staining showing activated retinal astrocytes and Muller cells (GFAP) and blood vessels (IB4) are shown. Top: Fluorescein angiography. Bottom: Laser-induced lesions. Scale bar: 1 mm.
[0052] Figure 5C Fluorescence images of retinal section staining showing activated retinal astrocytes and Muller cells (GFAP) and blood vessels (IB4) are shown. Top: Fluorescein angiography. Bottom: Laser-induced lesions. Scale bar: 1 mm.
[0053] Figure 5D Quantification of laser-induced CNV cluster area is shown. *p < 0.05, **p < 0.01, ***p < 0.001, n = 5 eyes / group, one-way ANOVA.
[0054] Figure 5E Quantification of laser-induced CNV cluster area is shown. *p < 0.05, **p < 0.01, ***p < 0.001, n = 5 eyes / group, one-way ANOVA.
[0055] Figure 5FLaser-induced lesion size is shown. *p < 0.05, **p < 0.01, ***p < 0.001, n = 5 eyes / group, one-way ANOVA.
[0056] Figure 5G Glia membrane coverage % calculated by the ratio of GFP-positive glia membrane area to total field area is shown. *p < 0.05, **p < 0.01, ***p < 0.001, n = 5 eyes / group, one-way ANOVA.
[0057] Figure 6A A mouse model of laser-induced neovascularization is shown. C57BL / 6 mice were intravitreally injected with 2 x 10 9 vg / eye of AAV particles with AAVT13 capsid and packaged with B36, B110, or B111 expression cassettes (referred to as Laser-B36, Laser-B110, Laser-B111, respectively). Fourteen days after virus injection, mice were subjected to laser-induced CNV model, and 12 days later, fluorescein angiography (FFA) was performed.
[0058] Figure 6B Laser-induced neovascularization and scarring are shown. Top: fluorescein angiography. Bottom: laser-induced lesion. Scale bar: 1 mm.
[0059] Figure 6C Quantification of neovascularization is shown. *p < 0.05, **p < 0.01, n = 7 eyes / group.
[0060] Figure 6D Quantification of laser-induced lesion area is shown. *p < 0.05, **p < 0.01, n = 7 eyes / group.
[0061] Figure 7A A flow chart of tumor transplantation in mice is shown.
[0062] Figure 7B Representative tumor images at day 21 after cell implantation and AAV treatment are shown. Dotted circles mark the tumor location under the right front limb.
[0063] Figure 7C Quantitative results of tumor size are shown. Tumor volume was calculated by the formula V = 0.5 x L x W2. V: tumor volume; L: tumor length; W: tumor width. ***p < 0.001, n = 3 mice / group. Two-way ANOVA.
[0064] Figure 8 A nucleic acid sequence encoding AAVH15 capsid protein (SEQ ID NO: 1) is shown.
[0065] Figure 9Amino acid sequence of AAV H15 capsid protein (SEQ ID NO: 2) is shown.
[0066] Figure 10 Nucleic acid sequence encoding AAV T13 capsid protein (SEQ ID NO: 3) is shown.
[0067] Figure 11 Amino acid sequence of AAV T13 capsid protein (SEQ ID NO: 4) is shown.
[0068] Figure 12 Nucleotide sequence of CB promoter (SEQ ID NO: 5) is shown.
[0069] Figure 13 Nucleotide sequence of bGH POLYA (SEQ ID NO: 6) is shown.
[0070] Figure 14 Nucleotide sequence of B36 expression cassette (SEQ ID NO: 7) is shown.
[0071] Figure 15 Amino acid sequence of protein product of B36 expression cassette (SEQ ID NO: 8) is shown.
[0072] Figure 16 Nucleotide sequence of B110 expression cassette (SEQ ID NO: 9) is shown.
[0073] Figure 17 Amino acid sequence of protein product of B110 expression cassette (SEQ ID NO: 10) is shown.
[0074] Figure 18 Nucleotide sequence of B111 expression cassette (SEQ ID NO: 11) is shown.
[0075] Figure 19 Amino acid sequence of protein product of B111 expression cassette (SEQ ID NO: 12) is shown.
[0076] Figure 20 Nucleic acid sequence encoding AAV XL32 capsid protein (SEQ ID NO: 13) is shown.
[0077] Figure 21 Amino acid sequence of AAV XL32 capsid protein (SEQ ID NO: 14) is shown.
[0078] Figure 22 Codon-optimized human endostatin-encoding nucleic acid sequence (SEQ ID NO: 15) is shown.
[0079] Figure 23Codon-optimized human endostatin-encoding nucleic acid sequence (SEQ ID NO: 16) is shown.
[0080] Figure 24 Codon-optimized murine endostatin-encoding nucleic acid sequence (SEQ ID NO: 17) is shown.
[0081] Figure 25 Codon-optimized murine endostatin-encoding nucleic acid sequence (SEQ ID NO: 17) is shown.
[0082] Figure 26 Codon-optimized murine endostatin-encoding nucleic acid sequence (SEQ ID NO: 17) is shown.
[0083] Figure 27 Codon-optimized murine endostatin-encoding nucleic acid sequence (SEQ ID NO: 17) is shown.
[0084] Figure 28 Codon-optimized murine endostatin-encoding nucleic acid sequence (SEQ ID NO: 17) is shown.
[0085] Figure 29 Codon-optimized murine endostatin-encoding nucleic acid sequence (SEQ ID NO: 17) is shown. DETAILED DESCRIPTION
[0086] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which this disclosure belongs.
[0087] Unless otherwise indicated, the nucleic acid or polynucleotide sequences set forth herein are in the single-stranded form, in the 5' to 3' direction, from left to right. Nucleotides and amino acids provided herein are in the format recommended by the IUPAC IUB Biochemical Nomenclature Commission, using either the one-letter or three-letter codes for amino acids.
[0088] Unless otherwise indicated, "polynucleotide" is a synonym for "nucleic acid" and refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides, that comprise these nucleotides in any combination or order. Polynucleotides can include a modified nucleotide, such as a methylated or restricted nucleotide and nucleotide analogs.
[0089] In this document, the terms "comprise," "have," "include," and "contain" are to be construed as open-ended terms (i.e., meaning "including, but not limited to").
[0090] In the present text, the terms "patient" and "subject" are used interchangeably and in their conventional sense to refer to an organism, including humans and non-human animals (e.g., rodents or other mammals), suffering from or susceptible to a condition that can be prevented or treated by administration of a medicament of the present disclosure.
[0091] In one embodiment, the subject is a non-human animal (e.g., chimpanzees and other ape and monkey species; farm animals, such as cows, sheep, pigs, goats, and horses; domesticated mammals, such as dogs and cats; laboratory animals including rodents, such as mice, rats, and guinea pigs; avians, including poultry, game birds, and birds of prey, such as chickens, turkeys and other fowl, ducks, geese, and the like). In one embodiment, the subject is a mammal. In one embodiment, the subject is a human.
[0092] In the present text, the term "treatment" includes: (1) inhibiting the condition, disease, or disorder, i.e., arresting, reducing, or delaying the development of the disease or its recurrence or at least one clinical or subclinical symptom thereof; or (2) relieving the disease, i.e., causing regression of the condition, disease, or disorder or at least one of its clinical or subclinical symptoms.
[0093] In the present text, the term "therapeutically effective amount" refers to a dosage that produces the therapeutic effect for which it is administered. For example, a therapeutically effective amount of a medicament suitable for treating an ocular disease can be an amount that is capable of preventing or ameliorating one or more symptoms associated with the ocular disease.
[0094] In the present text, the term "amelioration" refers to an improvement in a symptom associated with a disease and can refer to an improvement in at least one parameter that measures or quantifies the symptom.
[0095] In the present text, the term "preventing" a condition, disease, or disorder includes preventing, delaying, or reducing the incidence and / or likelihood of the appearance of at least one clinical or subclinical symptom of a condition, disease, or disorder developing in a subject who can be suffering from or susceptible to the condition, disease, or disorder but has not yet experienced or displayed a clinical or subclinical symptom of the condition, disease, or disorder.
[0096] In the present text, the term "local administration" or "local route" refers to a mode of administration that has a local effect.
[0097] In the present text, the terms "transduction", "transfection", and "transformation" refer to the process of delivering a foreign nucleic acid into a host cell followed by transcription and translation of the polynucleotide product, which includes the use of recombinant viruses to introduce a foreign polynucleotide into a host cell.
[0098] In the present text, the term "gene delivery" refers to the introduction of a foreign polynucleotide into a cell for gene transfer, including targeting, binding, uptake, transport, replicon integration, and expression.
[0099] In the present context, the term "gene expression" or "expression" refers to the process of transcription, translation and post-translational modification of a gene to produce its RNA or protein product.
[0100] In the present context, the term "infection" refers to the process by which a virus or viral particle comprising a polynucleotide component delivers the polynucleotide into a cell and produces its RNA and protein products, and can also refer to the process of replication of the virus in a host cell.
[0101] In the present context, the term "targeting" refers to the preferential entry of a virus into some cells or tissues and then further expression of the viral genome or sequences carried by the recombinant transgene in the cell.
[0102] In the present context, the term "vector" refers to a macromolecule or series of macromolecules that encapsulate a polynucleotide that facilitates the delivery of the polynucleotide to a target cell in vitro or in vivo. Classes of vectors include, but are not limited to, plasmids, viral vectors, liposomes, and other gene delivery vehicles. The polynucleotide to be delivered is sometimes referred to as an "expression cassette" or "transgene cassette," which can comprise, but is not limited to, a coding sequence for certain proteins or synthetic polypeptides that can enhance, inhibit, attenuate, protect, trigger, or prevent certain biological and physiological functions, coding sequences of interest in vaccine development (e.g., polynucleotides that express proteins, polypeptides, or peptides suitable for eliciting an immune response in a mammal), coding sequences for RNAi materials (e.g., shRNA, siRNA, antisense oligonucleotides), or optional biological markers.
[0103] In the present context, the term "oligopeptide" refers to a polymer of fewer than 20 amino acids linked by peptide bonds. The terms "polypeptide" and "protein" are used synonymously herein to refer to polymers consisting of more than 20 amino acids. These terms also encompass synthetic or artificial amino acid polymers.
[0104] In the present context, the terms "expression cassette," "transgene cassette," and "transgene expression cassette" are used interchangeably to refer to a polynucleotide fragment that encodes a particular protein, polypeptide, or RNAi element, which can be cloned into a plasmid vector.
[0105] In some embodiments, the "cassette" can also be packaged into an AAV particle and used as a viral genome to deliver the transgene product into a target cell. The "cassette" can also include other regulatory elements, such as specific promoters / enhancers, polyA, regulatory introns, etc., to enhance or attenuate expression of the transgene product.
[0106] In one embodiment, in addition to the sequence encoding the protein product, the transgene cassette also contains a number of regulatory elements to enable packaging of the transgene into the virus, such as the normal ITR of 145 bp, a shortened ITR of about 100 bp in length. In some embodiments, the transgene cassette also contains polynucleotide elements for controlling expression of the protein product, such as an origin of replication, a polyadenylation signal, an internal ribosome entry site (IRES) or 2A signal (e.g., P2A, T2A, F2A), a promoter, and an enhancer (e.g., a CMV promoter with vertebrate beta-actin, beta-globin, or beta-globin regulatory elements or other hybrid CMV promoters (referred to as CB and CAG promoters), an EF1 promoter, a hypoxia response element, a ubiquitin promoter, a T7 promoter, an SV40 promoter, a VP16 or VP64 promoter). The promoters and enhancers can be activated by chemicals or hormones (e.g., doxycycline or tamoxifen) to ensure gene expression at a specific point in time. In addition, the promoters and enhancers can be natural or artificial or chimeric sequences, i.e., prokaryotic or eukaryotic sequences.
[0107] In some preferred embodiments, the inducible regulatory elements for gene expression can be tissue or organ specific promoters or enhancers, including but not limited to: promoters specific to various types of retinal cells, such as ganglion cell specific promoters (e.g., Tujl promoter), astrocyte and Muller cell specific promoters (e.g., GFAP or vimentin promoter), and retinal pigment epithelium specific promoters (e.g., RPE65 or VMD2 promoter); promoters specific to various types of ocular neurons (e.g., synapsin, VGAT, DAT, TH promoters); and promoters specific to osteoblast lineage (e.g., osteocalcin promoter), liver, pancreas, spleen, and lung cancer cell specific promoters.
[0108] In this document, the term “inverted terminal repeat (ITR)” includes any AAV viral terminal repeat or synthetic sequence that forms a hairpin structure and functions as a cis element to mediate viral replication, packaging, and integration. The ITRs herein include, but are not limited to, those from AAV types 1-11 (terminal repeat sequences from avian AAV, bovine AAV, canine AAV, equine AAV, and ovine AAV). In addition, the AAV terminal repeat sequence does not have to be a native terminal repeat sequence as long as the terminal repeat sequence is useful for viral replication, packaging, and integration.
[0109] In this document, the term “cis element” refers to a transgene cassette that is packaged in an AAV particle and expressed in a target cell to produce a protein product with a therapeutic effect.
[0110] In the present context, the term "codon-optimized" refers to a polynucleotide sequence that has been modified from its native form. Such modifications result in one or more base pair differences, with or without changes in the corresponding amino acid sequence, that can enhance or inhibit expression of the gene and / or cellular response to the modified polynucleotide sequence.
[0111] As known to those skilled in the art, AAV capsid proteins contain VP1, VP2 and VP3 proteins, which undergo transcription and translation processes at the start codon inside the VP1 protein, i.e., the VP1 sequence contains VP2 and VP3 sequences. The present disclosure provides the amino acid sequence of the VP1 protein of the AAV capsid.
[0112] In one embodiment, the AAV capsid protein can be any AAV serotype capsid protein, including native AAV capsid proteins (e.g., native capsid proteins of types 1-11 AAV, avian AAV, bovine AAV, canine AAV, equine AAV and ovine AAV) and other artificially engineered AAV capsid proteins (e.g., artificially engineered capsid proteins of types 1-11 AAV, avian AAV, bovine AAV, canine AAV, equine AAV and ovine AAV). The genomic sequences, ITR sequences, Rep and Cap proteins of different AAV serotypes are known in the art. These sequences can be found in the literature or in public databases, such as the GenBank database.
[0113] In one embodiment, the present disclosure provides a therapeutic tool with anti-angiogenic effect, which can be used to treat a variety of diseases with related pathological mechanisms, including but not limited to: neovascular retinopathies (e.g., AMD, ROP, DR) and eye damage caused by intense light or other causes. In addition, the therapeutic tool of the present disclosure can also treat a variety of types of cancer in which angiogenesis promotes tumor growth and metastasis, such as lung cancer, liver cancer, kidney cancer, thyroid cancer, prostate cancer, kidney cancer, breast cancer, colorectal cancer, cervical cancer, leukemia, lymphoma, melanoma and glioblastoma.
[0114] In one embodiment, the protein product of the therapeutic tool (e.g., transgene expression cassette) includes a protein with anti-angiogenic effect, such as but not limited to Aflibercept, a recombinant VEGF soluble receptor (produced by Rengeron Pharmaceuticals, which can inhibit neovascularization), anti-VEGF antibodies (e.g., bevacizumab, ranibizumab and brolucizumab), other anti-angiogenic proteins or polypeptides (e.g., endostatin, angiostatin, platelet factor 4, pigment epithelium-derived factor), fibroblast growth factor (FGF) inhibitors, metalloproteinase inhibitor BB94.
[0115] In one embodiment, the protein product of the therapeutic tool (e.g., transgene expression cassette) further comprises antibodies with anti-tumor, such as anti-PD-1 antibodies (e.g., Nivolumab, Pembrolizumab, Cemiplimab) and PD-L1 antibodies (e.g., Avelumab, Atezolizumab), anti-CTLA-4 antibodies (e.g., Ipilimumab), anti-CGRP antibodies (e.g., Fremanezumab, Galcanezumab, Erenumab), anti-HER2 antibodies (e.g., Trastuzumab, Pertuzumab), and anti-EGFR antibodies (e.g., Cetuximab, Panitumumab, Necitumumab).
[0116] In some embodiments, AAV viral particles having AAV H15 capsid proteins (SEQ ID NO: 2) exhibit more efficient retinal transduction efficiency compared to wild-type (WT) serotypes, suitable for delivery of genes expressing anti-angiogenic proteins.
[0117] In some embodiments, AAV viral particles having AAV T13 capsid proteins (SEQ ID NO: 4) exhibit more efficient retinal transduction efficiency compared to wild-type (WT) serotypes, suitable for delivery of genes expressing anti-angiogenic proteins.
[0118] In some embodiments, AAV viral particles having AAV XL32 capsid proteins (SEQ ID NO: 14) exhibit more efficient retinal transduction efficiency compared to wild-type (WT) serotypes, suitable for delivery of genes expressing anti-angiogenic proteins.
[0119] In one embodiment, the transgene expression cassette encoding an angiogenesis inhibitor comprises a CB promoter sequence (SEQ ID NO: 5), a bGH polyadenylation (polyA) sequence (SEQ ID NO: 6), and a codon-optimized human endostatin sequence (SEQ ID NO: 15) with an N-terminal ALB signal peptide and inserted introns within the coding sequence to enhance protein expression, thus forming a B36 expression cassette (SEQ ID NO: 7). The B36 expression cassette is flanked by a normal ITR and a shortened ITR to enable packaging of the B36 expression cassette as a self-complementary AAV vector into AAV particles.
[0120] In one embodiment, the transgene expression cassette encoding angiogenesis inhibitors includes a CB promoter sequence (SEQ ID NO: 5), a bGH polyA sequence (SEQ ID NO: 6), codon-optimized human endostatin and codon-optimized human angiostatin sequences with N-terminal SP signal peptide (SEQ ID NO: 15 and SEQ ID NO: 16), the coding sequences of which are connected by a Furin protease sequence (Lys-Arg-Lys-Arg-Arg) + a linker peptide (Ser-Gly-Ser-Gly) + a F2A sequence, thus forming a B110 expression cassette (SEQ ID NO: 9). The B110 expression cassette also contains two ITRs, which enable the expression cassette to be packaged into AAV viral particles as a single-stranded AAV vector.
[0121] In one embodiment, the transgene expression cassette encoding angiogenesis inhibitors includes a CB promoter sequence (SEQ ID NO: 5), a bGH polyA sequence (SEQ ID NO: 6), codon-optimized human endostatin and codon-optimized human angiostatin sequences with N-terminal SP signal peptide (SEQ ID NO: 15 and SEQ ID NO: 16), the coding sequences of which are connected by a Furin protease sequence (Lys-Arg-Lys-Arg-Arg) + a linker peptide (Ser-Gly-Ser-Gly) + a F2A sequence, thus forming a B110 expression cassette (SEQ ID NO: 9). The B110 expression cassette also contains two ITRs, which enable the expression cassette to be packaged into AAV viral particles as a single-stranded AAV vector.
[0122] In some embodiments, anti-angiogenic AAV particles are produced by triple plasmid (plasmid 1: cis-element plasmid; plasmid 2: AAV Rep / Cap plasmid; plasmid 3: helper plasmid) transfection of HEK293 cells.
[0123] In one embodiment, to produce AAV particles with therapeutic functions, triple plasmid transfection of HEK293 cells is performed as follows: plasmid 1: cis-element plasmid with ITR (e.g., B36, B110, and B111 expression cassettes); plasmid 2: AAV Rep / Cap plasmid with capsid protein (e.g., AAVH15, AAVT13, and AAVXL32 capsid proteins) coding sequences; plasmid 3: helper plasmid with adenovirus components that can promote replication, assembly, and packaging of AAV virions. In one embodiment, AAV particles produced by HEK293 cells are purified by affinity chromatography and iodixanol density gradient ultracentrifugation (Xiao X et al., J Virol (1998) 72(3):2224-32).
[0124] One skilled in the art can use known standard methods to produce recombinant and synthetic polypeptides or proteins thereof, design nucleic acid sequences, produce transformed cells, construct recombinant AAV mutants, engineer capsid proteins, package vectors expressing AAV Rep and / or Cap sequences, and transiently or stably transfect packaging cells. These techniques are known to those of skill in the art. See, e.g., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., (Cold Spring Harbor, N.Y., 1989).
[0125] In some embodiments, the gene delivery system of the present disclosure is used to assist in cell transplantation therapy. Specifically, AAV particles with transgenes can be used to transduce various types of cells in vitro to generate stable cell lines expressing protein products, which can then be introduced in vivo for therapeutic purposes. The types of cells include, but are not limited to, endothelial cells, myoblasts, fibroblasts, astrocytes, Muller cells, oligodendrocytes, microglia, rod and cone cells, neurons, hematopoietic stem cells, monocytes, granulocytes, lymphocytes, osteoclasts, and macrophages.
[0126] In one embodiment, the cells used for transplantation are autologous cells of the subject, which allow for in vitro culturing. The principles and techniques for introducing or transplanting cells into a subject are known to those of skill in the art.
[0127] In one embodiment, AAV particles are harvested from the culture medium and lysate of HEK293 cells. Purification methods such as affinity chromatography, ion exchange chromatography, cesium chloride and iodixanol gradient ultracentrifugation. Chemicals or reagents related to AAV production and purification include, but are not limited to: chemicals or reagents for cell culture (e.g., components of cell culture medium, including bovine, equine, goat, chicken or other vertebrate serum, glutamine, glucose, sucrose, sodium pyruvate, phenol red; antibiotics, such as penicillin, kanamycin, streptomycin, tetracycline); chemicals or reagents for cell lysis, polynucleotide precipitation, or ultracentrifugation (e.g., Triton X-100, NP-40, sodium deoxycholate, sodium dodecyl sulfate, domiphen bromide, sodium dodecyl salicylate, sodium chloride, magnesium chloride, calcium chloride, barium chloride, nitrate, potassium chloride, ammonium chloride, ammonium persulfate, ammonium sulfate, PEG-20, PEG-40, PEG-400, PEG-2000, PEG-6000, PEG-8000, PEG-20000, Tris-HCl, Tris-acetate, manganese chloride, phosphate, bicarbonate, cesium chloride, methanol, ethanol, glycerol, iodixanol, isopropanol, butanol, anisase, DNase I, RNase); affinity column materials (e.g., AAVX affinity resin, heparan sulfate proteoglycan and mucin resin, other materials related to AAV-specific antibodies); ion exchange chromatography materials and acids, bases, and organics contained in wash buffers (e.g., hydrochloric acid, sulfuric acid, acetic acid, formic acid, nitric acid, urea, acetone, chloroform, acetonitrile, trifluoroacetic acid, sodium hydroxide, potassium hydroxide, barium hydroxide, ammonium hydroxide, Tris base or other organic amines, poloxamer 188, Tween 20, Tween 40, Tween 80, guanidine hydrochloride).
[0128] In one embodiment, the protein product encoded by the transgene cassette is linked to an oligopeptide tag (e.g., Flag, 6xHis, 2xHA, Myc) that facilitates purification of the protein product. Those skilled in the art understand techniques and procedures related to protein purification. Briefly, the transgene plasmid is transfected into eukaryotic cells (e.g., HEK293 and CHO cells), and then the protein of interest is collected by affinity chromatography. For example, Flag-M2 resin beads are commonly used to specifically attract Flag-tagged proteins, which are then eluted with 3xFlag soluble oligopeptide. Nickel-nitrilotriacetic acid (Ni-NTA) columns can also be used to reversibly bind, and then specifically purify, 6xHis-tagged proteins.
[0129] In one embodiment, the AAV vectors of the present disclosure can be loaded with an exogenous polynucleotide for delivery of a gene into a target cell. Thus, the AAV vectors of the present disclosure can be used to deliver a nucleic acid to a cell in vitro or in vivo.
[0130] In one embodiment, the exogenous polynucleotide delivered by the AAV vector encodes a polypeptide that functions as a reporter (i.e., a reporter protein). Reporter proteins are used to indicate cells that have been successfully infected by the AAV. These reporter proteins include, but are not limited to, green fluorescent protein (GFP), beta-galactosidase, alkaline phosphatase, luciferase, and chloramphenicol acetyltransferase.
[0131] In one embodiment, the exogenous polynucleotide delivered by the AAV vector to a target cell encodes a native protein for therapeutic use, which is codon-optimized or not codon-optimized.
[0132] In one embodiment, the exogenous polynucleotide delivered by the AAV vector to a target cell encodes a synthetic polypeptide.
[0133] In one embodiment, the AAV vector or transgene expression cassette or gene delivery system of the present disclosure is made into a pharmaceutical preparation (e.g., injection, tablet, capsule, powder, eye drop) for administration to a human or other mammal. The pharmaceutical preparation further comprises other ingredients, such as pharmaceutical excipients, water-soluble or organic solvents (e.g., water, glycerol, ethanol, methanol, isopropyl alcohol, chloroform, phenol, or polyethylene glycol), salts (e.g., sodium chloride, potassium chloride, phosphate, acetate, bicarbonate, Tris-HCl, and Tris-acetate), dissolution-delaying agents (e.g., paraffin), surfactants, antimicrobial agents, liposomes, lipoplexes, immunosuppressants (e.g., cortisone, prednisone, cyclosporine), non-steroidal anti-inflammatory drugs (NSAIDs, e.g., aspirin, ibuprofen, acetaminophen) microspheres, hard matrices, semi-solid carriers, nanospheres, or nanoparticles. In addition, the pharmaceutical preparation can be delivered by inhalation, systemic, or local (e.g., intravenous, subcutaneous, intraocular, intravitreal, subretinal, suprachoroidal, parenteral, intramuscular, intracerebroventricular, oral, intraperitoneal, and intrathecal) administration in a single dose or multiple doses.
[0134] In one embodiment, the present disclosure provides a medicament comprising the AAV vector or transgene expression cassette or gene delivery system of the present disclosure and an excipient. The medicament of the present disclosure can be used to transduce cells in vitro or transduce mammals (e.g., rodents, primates, and humans) in vivo, thereby treating various diseases, such as ocular diseases.
[0135] In the present context, the ocular disease is selected from the group consisting of inherited dystrophy of the retina, glaucoma, glaucoma optic neuropathy, age-related macular degeneration, refractive errors, dry eye, inherited dystrophy of ocular inflammation, ocular inflammation, uveitis, orbital inflammation, cataract, allergic conjunctivitis, diabetic retinopathy, macular edema, corneal edema, keratoconus, proliferative vitreoretinopathy (fibrosis), retinal periph- eral fibrosis, central serous chorioretinopathy, vitreoretinopathy, vitreomacular traction and vitreous hemorrhage. In one embodiment, the ocular disease involves a deterioration of the eye and / or visual function.
[0136] In one embodiment, treating the ocular disease means improving visual acuity, contrast visual acuity, color vision and visual field of the patient receiving the treatment.
[0137] The present disclosure is further described in detail by way of reference to the following drawings and examples. The following examples are intended to illustrate but not limit the scope of the present disclosure. The experimental methods in the examples, for which specific conditions are not mentioned, are performed according to the conventional conditions known in the art, or according to the conditions suggested by the manufacturers.
[0138] Examples
[0139] Example 1: Retinal affinity of AAVH15, AAVXL32, and AAVT13
[0140] AAVT13 capsid (SEQ ID NO: 4) was constructed by replacing the N-terminal region of VP1, VP2 (amino acids 1-203) of AAV8 with the N-terminal region of AAV5 (amino acids 1-192) with a point mutation site G257R and connecting to the AAV5 capsid protein sequence. DNA shuffling experiments were performed to construct AAVH15 capsid protein (SEQ ID NO: 2) and AAVXL32 capsid protein (SEQ ID NO: 14).
[0141] The retinal tropism of the modified AAV serotypes (AAVH15, AAVXL32 and AAVT13) was investigated by intravitreal injection of AAV particles expressing GFP protein in C57BL / 6 mice using WT serotypes AAV5, 8 and 9 as controls. The dose of 2x10 9 vg / eye of each AAV serotype carrying GFP gene was injected intravitreally into C57BL / 6 mice. The images of GFP signal taken 3 weeks after injection are shown in Figure 1A The dose of 2x10 9 vg / eye of each AAV serotype carrying GFP gene was injected intravitreally into C57BL / 6 mice. The images of GFP signal taken 3 weeks after injection are shown in Figure 2 The dose of 2x10
[0142] The results showed that the retinal GFP fluorescence levels in the AAVH15 and AAVT13 groups were significantly higher than those in the AAV5, 8, and 9 groups. Figure 1A ), approximately 10-12 times higher ( Figure 1C ***p<0.001, n=4 eyes / group). The retinal GFP fluorescence level in the AAVXL32 group was also significantly higher than that in the AAV5, 8, and 9 groups ( Figure 1A ), about 5 times higher ( Figure 1C (***p<0.001, n=4 eyes / group). This demonstrates that, compared to wild-type AAV, AAVH15, AAVXL32, and AAVT13 exhibit significantly increased retinal affinity and transduction efficiency.
[0143] Furthermore, despite intravitreal administration, the modified serum types AAVH15 and AAVT13 were still able to diffuse into the photoreceptor layer and even the retinal pigment epithelium (RPE). Figure 1B and Figure 2 The results showed that serum AAVH15 and AAVT13 were significantly superior to AAV5, 8, and 9. This indicates that serum AAVH15 and AAVT13 have stronger retinal affinity and can deliver genes to all layers of the retina.
[0144] Example 2: Expression of codon-optimized human and murine endostatin-encoding nucleic acid sequences
[0145] In this embodiment, the inventors compared the protein expression capabilities of B110 and B111, which contain codon-optimized endostatin-encoding nucleic acid sequences, with those of plasmids constructed from uncodon-optimized endostatin-encoding nucleic acid sequences (which also carry Flag and HA tags).
[0146] HEK293 cells were transfected with plasmids B110 and B111, and the expression of endostatin in cell lysates was detected by Western blotting. Human and mouse endostatin conjugates without codon optimization served as control groups (original human and original mouse). Endostatin protein expression in each group relative to the original human group was quantitatively analyzed.
[0147] like Figure 3C As shown, the endostatin protein expression levels of the B110 and B111 expression cassettes were significantly higher than those of the uncodon-optimized control group. Quantitative statistical results of the relative protein expression levels showed that the endostatin protein expression levels of the B110 and B111 expression cassettes were 4-6 times higher than those of the uncodon-optimized sequences. Figure 3C (See right figure). The above results demonstrate that the codon-optimized human and murine endostatin-coding nucleic acid sequences of this disclosure have significant advantages in expression compared to the original natural protein-coding sequences.
[0148] Example 3: Expression of codon-optimized human and murine angiostatin-encoding nucleic acid sequences
[0149] In this example, the inventors compared the protein expression ability of B110 and B111 containing codon-optimized angiostatin-encoding nucleic acid sequences with plasmids constructed from non-codon-optimized angiostatin-encoding nucleic acid sequences (also carrying Flag and HA tags).
[0150] HEK293 cells were transfected with B110 and B111 plasmids, and then the expression of angiostatin in cell lysates was detected by Western blotting. Human and murine angiostatin without codon optimization were constructed into plasmids as control groups (original human, original murine). The angiostatin protein expression of each group relative to the original human group was quantitatively analyzed.
[0151] As shown in Figure 3D , the angiostatin protein expression levels of B110 and B111 expression cassettes were significantly higher than those of the non-codon-optimized control groups. The quantitative analysis of the relative expression levels of proteins showed that the angiostatin protein expression levels of B110 and B111 expression cassettes were increased by about 4 times Figure 3D compared with the non-codon-optimized sequences (right panel). The above results showed that the codon-optimized human and murine angiostatin-encoding nucleic acid sequences of the present disclosure had a significant advantage in expression compared with the original natural protein-encoding sequences.
[0152] Example 4: Novel transgene expression cassettes expressing endostatin and angiostatin
[0153] To more stably express anti-angiogenic polypeptides, self-complementary and single-chain AAVs were used. As shown in Figure 3A , the B36 transgene cassette was constructed by adding an ALB signal peptide to the N-terminus of the codon-optimized human endostatin sequence, which enhances the expression and secretion of endostatin protein, and inserting an intron inside it. The CB promoter was used to promote protein expression, and the bGH polyA sequence was used to stop mRNA transcription. The B36 transgene cassette was flanked by a normal ITR and a shortened ITR, so that the expression cassette could be packaged into AAV particles as a self-complementary AAV vector.
[0154] In addition, single-chain AAV transgene expression cassettes B110 and B111 that can express and release endostatin and angiostatin simultaneously were also designed. As shown in Figure 3AAs shown, the B110 cassette includes: two normal ITR sequences, a CB promoter (SEQ ID NO: 5), a codon-optimized human endostatin sequence (SEQ ID NO: 15), a codon-optimized human angiostatin sequence (SEQ ID NO: 16), and a bGH polyA tail (SEQ ID NO: 6). The SP signal peptide is used to control the secretion of endostatin and angiostatin to the extracellular. The coding sequences of the two proteins are connected by a linker containing a Furin protease sequence (KRKRR) + a linker (SGSG) + a F2A sequence, so as to better separate the expression of endostatin and angiostatin during translation. In addition, Flag tags and 2xHA tags are carried on endostatin and angiostatin, so that endostatin and angiostatin can be prepared and purified based on tag-dependent affinity chromatography. For example, commercial Flag M2 magnetic beads (Sigma-Aldrich, item number M8823) can be used for purification of Flag-labeled proteins.
[0155] Similarly, the B111 expression cassette is constructed in a similar manner to B110, with the difference that codon-optimized murine endostatin (SEQ ID NO: 17) and codon-optimized murine angiostatin (SEQ ID NO: 18) are used, and P2A is used instead of F2A for better separation of the expression and secretion of the two proteins.
[0156] The B110 and B111 plasmids are transfected into HEK293 cells and Huh7 cells. After 48 hours, the expression levels of endostatin protein and angiostatin protein in the culture medium are detected by Western blotting. The results are shown in Figure 3B As shown, both the B110 and B111 expression cassettes achieve significant expression of endostatin protein and angiostatin protein. It can be seen that endostatin and angiostatin are successfully expressed and secreted by transfection of the B110 and B111 plasmids, and the B110 and B111 expression cassettes achieve stable expression of the two proteins at the same time.
[0157] Example 5: Inhibition of HUVEC tube formation by novel AAV-mediated delivery of anti- neovascularization proteins
[0158] The production process of anti-angiogenic AAV particles was initiated by transfecting B36, B110, B111 cis-element plasmids, AAVH15 capsid plasmid and adenovirus helper plasmid with 0.2-5 mg / ml PEI, and terminated with 10-35 g / L CDM4 solution in one quarter of the volume of cell culture medium. HEK293 cells were lysed 40-80 hours after transfection, and then the polynucleotides were removed. The supernatant with AAV particles was loaded into AAVX affinity column, and then eluted. The eluted AAV particles were subjected to iodixanol gradient ultracentrifugation, and concentrated to a certain volume for use.
[0159] The transduction efficiency of AAVH15 in HUVEC cells was tested. According to the expression of GFP protein, about 87% of HUVEC cells were infected by AAVHH15 at MOI of 1 x 10 5 vg / cell; the cell transduction rate of AAV decreased to 45.8% at MOI of 1 x 10 4 vg / cell. Figure 4A and Figure 4B When the MOI was reduced to 1 x 10 3 vg / cell, about 10.9% of HUVEC cells showed obvious GFP fluorescence signal.
[0160] As shown in Figure 4C , the HUVEC cells transduced by AAVH15 successfully released endostatin and angiostatin into the conditioned medium.
[0161] HUVEC cells were infected with AAVH15 carrying B36, B110 and B111 expression cassettes (referred to as H15-B36, H15-B110 and H15-B111, respectively) at MOI of 1 x 10 5 and 1 x 10 4 vg / cell. The cells were harvested and transferred to 24-well plates coated with Matrigel for pre-incubation for 45 minutes for tube formation, and images were taken after 6 hours, as shown in Figure 4D . The tube length and branch point number per unit area (mm 2 ) were analyzed by Image J. The results showed that the tube length and branch point number of cells infected with H15-B36, H15-B110 and H15-B111 were significantly reduced compared with the control group (H15-GFP) Figure 4E and Figure 4F . The above results showed that H15-B36, H15-B110 and H15-B111 viral vectors can inhibit the tube formation of HUVEC.
[0162] Example 6: AAV-mediated expression of endostatin and angiostatin inhibits retinal neovascularization and glial cell proliferationFigure 5A
[0163] 2×10 10 AAV particles, administered via intravitreal injection at a dose of vg / eye, were injected into C57BL / 6 mice. These AAV particles possessed an H15 capsid and encapsulated B36, B110, or B111 expression cassettes (referred to as laser-B36, laser-B110, and laser-B111, respectively). Figure 5B As shown, a laser-induced CNV model was established in mice 14 days after viral injection, followed by fluorescein angiography (FFA) and immunofluorescence (IF) 12 days later.
[0164] The results showed that after AAVH15-mediated endostatin and angiostatin treatment, the size of laser-induced CNV clusters was reduced by approximately 75%. Figure 5D and Figure 5B As shown), and the number of CNV clusters has also decreased (as shown). Figure 5E and Figure 5B Simultaneously, AAVH15-mediated angiogenesis inhibition accelerated the recovery of laser-induced lesions. Twelve days after laser-induced retinal injury, compared to the untreated control group (laser model), the lesion volume in different treatment groups was reduced by approximately 50-75%. Figure 5F and Figure 5C To further investigate the cellular mechanisms, the retina was co-stained with the vascular marker IB4 and the retinal glial cell marker GFAP. In a healthy retina, astrocytes or Müller cells surround the blood vessels, showing a clear network. Figure 5G Following laser-induced injury, activated retinal glial cells, including astrocytes and Müller cells, accumulate, forming a glial scar membrane closely associated with CNV clusters. AAVH15-mediated release of endostatin and angiostatin significantly improved retinal condition. Figure 6A As shown, the area covered by the glial cell membrane decreased sharply from 29.9% to about 12% (***p<0.001), indicating inhibition of glial cell proliferation. Therefore, treatment with AAV (which has an H15 capsid and encapsulates B36, B110, or B111 expression cassettes) can reduce angiogenesis and retinal glial proliferation.
[0165] In addition, the therapeutic effect of low-dose AAV particles was investigated. 2 × 10⁻⁶ particles were injected intravitreally into C57BL / 6 mice. 9 AAV particles (vg / eye) with AAVT13 capsids and packaged with B36, B110, and B111 transgenic expression cassettes. For example... Figure 6B to Figure 6DAs shown, a laser-induced CNV model was established in mice 14 days after viral injection, followed by fluorescein angiography (FFA) and immunofluorescence (IF) 12 days later.
[0166] The results show that, Example 7: Inhibition of tumor growth by AAV-mediated expression of endostatin and angiostatin As shown, smaller CNV clusters and laser-induced lesions were observed in the B36 and B111 treatment groups compared with the untreated control group (laser model) (*p<0.05, **p<0.01, n=7 eyes / group), indicating that low-dose AAVT13-mediated expression of endostatin and angiostatin improves angiogenesis and lesion-induced scarring.
[0167] Figure 7A
[0168] To investigate the role of the AAV gene delivery system in cancer therapy, Hepa1-6 mouse liver cancer cells, along with AAVH15 (H15-B36 and H15-B111) carrying B36 and B111 transgenic cassettes, were subcutaneously injected into CByJ.Cg-Foxn1nu / J mice with systemic T cell and partial B cell defects caused by the Foxn1 gene mutation. Figure 7B As shown, Hepa1-6 cells (ATCC CRL-1830) grown in culture dishes were digested with 0.05% trypsin, centrifuged at 800 rpm for 5 minutes, and then resuspended in PBS for mouse injection. 2 × 10⁻⁶ cells were subcutaneously injected into CByJ.Cg-Foxn1nu / J mice (Jackson Laboratory Stock No. 000711). 6 Hepa1-6 cells and 1×10 11 A mixture of AAVH15 (packaged with B36 and B111 expression cassettes, respectively) was administered. Tumor size was measured at 7, 14, and 21 days post-implantation. Mice injected with Hepa1-6 cells and AAV encoding GFP (AAVH15) served as controls.
[0169] like Figure 7C and As observed in the study, on day 14 following cancer cell implantation and treatment with H15-B36 and H15-B111, tumor volume was significantly reduced in the B36 and B111 treatment groups compared to control mice. On day 21 post-treatment, the mean tumor volumes in the B36 and B111 treatment groups were 211.3 and 75.9 mm, respectively. 2 Smaller than the control group (mean tumor volume 2240 mm). 2 One-tenth of the total. These results indicate that AAVH15-mediated endostatin and angiostatin expression have a significant inhibitory effect on tumor growth.
[0170] While the disclosure has been illustrated and described in detail in the drawings and foregoing description, the same or similar techniques can readily be employed in other embodiments and the specific embodiments disclosed are not to be taken in a limiting sense. Numerous modifications and variations are possible in light of the above teachings without departing from the spirit and scope of the present disclosure. SEQUENCE LISTING <110> Shanghai Sunsmart Pharmaceutical Technology Co., Ltd. <120> AAV-based anti-angiogenic gene delivery system and uses thereof <130> PCNCNN218532G <160> 22 <170> PatentIn version 3.5 <210> 1 <211> 2214 <212> DNA <213> Artificial Sequence <220> <223> AAVH15 coding sequence <400> 1 atggctgccg atggttatct tccagattgg ctcgaggaca acctctctga gggcattcgc 60 gagtggtggg acctgaaacc tggagccccg aaacccaaag ccaaccagca aaagcaggac 120 aacggccggg gtctggtgct tcctggctac aagtacctcg gacccttcaa cggactcgac 180 aagggggagc cggtcaacgc agcagacgcg gcggccctcg agcacgacaa ggcctacgac 240 cagcagctca aagcgggtga caatccgtac ctgcggtata accacgccga cgccgagttt 300 caggagcgtc tgcaagaaga tacgtctttt gggggcaacc tcgggcgagc agtcttccag 360 GCGAAGAAGA GGTTCTCGAA CCTTTTGGTC TGGTTGAGGA AGGTGCTAAG ACGGCTCCT 420 GGAAAGAAAC GTCCGGTAGA GCAGTCGCAC AAGAGCCAG ACTCCTCCTC GGGCATCGGC 480 AAGACAGGCC AGCAGCCCAC TAAAAAGAGA CTCAATTTTG GTCAGACTGG CGACTCAGAG 540 TCAGTCCCAG ACCCTCAACC TCTCGGAGAA CCTCCAGCAA CCCCCGCTGC TGTGGGACCT 600 ACTACAATGG CTACAGGCAG TGGCGCACCA ATGGCAGACA ATAAACGAGG GTGCCGACGG 660 GTGGGTAATG CCTCAGGAAA TTGGCATTGC GATTCCACAT GGCTGGGCAC AGAGTCACT 720 ACCACCAGCA CCCGAACATG GGCCCTGCCA CCTACAACAA CCACCTCTAC AAGCAAATC 780 TCCAACAGCA CATCTGGAGG ATCTTCAATA GACAACGCCT ACTTCGGTAC AGCACCCCC 840 TGGGGGTATT TTGATTTCAA CAGATTCCAC TGCCACTTTT CACCACGTGA CTGGCAGCGA 900 CTCATCAACA ACAATTGGGG ATTCCGGCCC AAGAGACTCA ACTTCAAACT CTTCAACATC 960 CAAGTCAAGG AGGTCACTAC GAATGACGGC GTTACGACCA TCGCTAATAA CCTTACCAG 1020 ACGGTTCAAG TCTTCTCGGA CTCGGAGTAC CAGTTGCCGT ACgtcctcgg ctctgcgcac 1080 cagggctgcc tccctccgtt cccggcggac gtgttcatga ttccgcaata cggctacctg 1140 acgctcaaca atggcagcca ggcagtggga cggtcatcct tttactgcct ggaatatttc 1200 ccatcgcaga tgctgagaac gggcaacaac tttaccttca gctacacctt cgaggacgtg 1260 cctttccaca gcagctacgc gcacagccag agcctggacc ggctgatgaa tcctctcatc 1320 gaccagtacc tgtattacct gaacaact caaaatcagt ccggaagtgc ccaaaacaag 1380 gacttgctgt ttagccgtgg gtctccagct ggcatgtctg ttcagcccaa aaactggcta 1440 cctggaccct gttatcggca gcagcgcgtt tctaaaacaa aaacagacaa caacaacagc 1500 aactttacct ggactggtgc ttcaaaatat aacctcaatg ggcgtgaatc catcatcaac 1560 cctggcactg ctatggcctc acaaagac gacaaagaca agttctttcc catgagcggt 1620 1680 attacagacg aaggaaat caaagccact aaccccgtgg ccaccgaaag atttgggacc 1740 gtggcagtca atctccagag cagcagcaca gaccctgcga ccggagatgt gcatgttatg 1800 ggagccttac ctggaatggt gtggcaagat agagacgtgt acctgcaggg tcccatttgg 1860 gccaaaattc ctcacacaga tggacacttt cacccgtctc ctcttatggg cggctttgga 1920 ctcaagaacc cgcctcctca gatcctcatc aaaaacacgc ctgttcctgc gaatcctccg 1980 gcagagtttt cggctacaaa gtttgcttca ttcatcaccc agtattccac aggacaagtg 2040 agcgtggaga ttgaatggga gctgcagaaa gaaaacagca agcgctggaa tcccgaagtg 2100 cagtacacat ccaattatgc aaaatctgcc aacgttgatt ttactgtgga caacaatgga 2160 ctttatactg agcctcgccc cattggcacc cgttacctca cccgtcccct gtaa 2214 <210> 2 <211> 737 <212> PRT <213> Artificial Sequence <220> <223> AAVH15 Amino Acid Sequence <400> 2 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro 20 25 30 Lys Ala Asn Gln Gln Lys Gln Asp Asn Gly Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro 115 120 125 Phe Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly 145 150 155 160 Lys Thr Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175 Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro 180 185 190 Ala Thr Pro Ala Ala Val Gly Pro Thr Thr Met Ala Thr Gly Ser Gly 195 200 205 Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala 210 215 220 Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255 Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270 Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285 Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300 Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile 305 310 315 320 Gln Val Lys Glu Val Thr Thr Asn Asp Gly Val Thr Thr Ile Ala Asn 325 330 335 Asn Leu Thr Ser Thr Val Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu 340 345 350 Pro Tyr Val Leu Gly Ser Ala His Gin Gly Cys Leu Pro Pro Phe Pro 355 360 365 Ala Asp Val Phe Met lie Pro Gin Tyr Gly Tyr Leu Thr Leu Asn Asn 370 375 380 Gly Ser Gin Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Gin Tyr Phe 385 390 395 400 Pro Ser Gin Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr 405 410 415 Phe Gin Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gin Ser Leu 420 425 430 Asp Arg Leu Met Asn Pro Leu lie Asp Gin Tyr Leu Tyr Tyr Leu Asn 435 440 445 Arg Thr Gin Asn Gin Ser Gly Ser Ala Gin Asn Lys Asp Leu Leu Phe 450 455 460 Ser Arg Gly Ser Pro Ala Gly Met Ser Val Gin Pro Lys Asn Trp Leu 465 470 475 480 Pro Gly Pro Cys Tyr Arg Gin Gin Arg Val Ser Lys Thr Lys Thr Asp 485 490 495 Asn Asn Asn Ser Asn Phe Thr Trp Thr Gly Ala Ser Lys Tyr Asn Leu 500 505 510 Asn Gly Arg Glu Ser Ile Ile Asn Pro Gly Thr Ala Met Ala Ser His 515 520 525 Lys Asp Asp Lys Asp Lys Phe Phe Pro Met Ser Gly Val Met Ile Phe 530 535 540 Gly Lys Glu Ser Ala Gly Ala Ser Asn Thr Ala Leu Asp Asn Val Met 545 550 555 560 Ile Thr Asp Glu Glu Glu Ile Lys Ala Thr Asn Pro Val Ala Thr Glu 565 570 575 Arg Phe Gly Thr Val Ala Val Asn Leu Gln Ser Ser Ser Thr Asp Pro 580 585 590 Ala Thr Gly Asp Val His Val Met Gly Ala Leu Pro Gly Met Val Trp 595 600 605 Gln Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro 610 615 620 His Thr Asp Gly His Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly 625 630 635 640 Leu Lys Asn Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro 645 650 655 Ala Asn Pro Pro Ala Glu Phe Ser Ala Thr Lys Phe Ala Ser Phe Ile 660 665 670 Thr Gin Tyr Ser Thr Gly Gin Val Ser Val Glu lie Glu Trp Glu Leu 675 680 685 Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Val Gin Tyr Thr Ser 690 695 700 Asn Tyr Ala Lys Ser Ala Asn Val Asp Phe Thr Val Asp Asn Asn Gly 705 710 715 720 Leu Tyr Thr Glu Pro Arg Pro lie Gly Thr Arg Tyr Leu Thr Arg Pro 725 730 735 Leu <210> 3 <211> 2205 <212> DNA <213> Artificial Sequence <220> <223> AAVT13 coding sequence <400> 3 atggctgccg atggttatct tccagattgg ctcgaggaca acctctctga gggcattcgc 60 gagtggtggg cgctgaaacc tggagccccg aagcccaaag ccaaccagca aaagcaggac 120 gacggccggg gtctggtgct tcctggctac aagtacctcg gacccttcaa cggactcgac 180 aagggggagc ccgtcaacgc ggcggacgca gcggccctgg agcacgacaa ggcctacgac 240 cagcagctgc aggcgggtga caatccgtac ctgcggtata accacgccga cgccgagttt 300 caggagcgtc tgcaagaaga tacgtctttt gggggcaacc tcgggcgagc agtcttccag 360 gccaagaagc gggttctcga acctctcggt ctggttgagg aaggcgctaa gacggctcct 420 ggaaagaaga gaccggtaga gccatcaccc cagcgttctc cagactcctc tacgggcatc 480 ggcaagaaag gccaacagcc cgccagaaaa agactcaatt ttggtcagac tggcgactca 540 gagtcagttc cagaccctca acctctcgga gaacctccag cagcgccctc tggtgtggga 600 cctaatacaa tgtctgcggg aggtggcggc ccattgggcg acaataacca aggtgccgat 660 ggagtgggca atgcctcggg agattggcat tgcgattcca cgtggatggg ggacagagtc 720 gtcaccaagt ccacccgaac ctgggtgctg cccagctaca acaaccacca gtaccgagag 780 atcaaaagcg gctccgtcga cagaagcaac gccaacgcct actttggata cagcaccccc 840 tgggggtact ttgactttaa ccgcttccac agccactgga gcccccgaga ctggcaaaga 900 ctcatcaaca actactgggg cttcagaccc cggtccctca gagtcaaaat cttcaacatt 960 caagtcaaag aggtcacggt gcaggactcc accaccacca tcgccaacaa cctcacctcc 1020 accgtccaag tgtttacgga cgacgactac cagctgccct acgtcgtcgg caacgggacc 1080 gagggatgcc tgccggcctt ccctccgcag gtctttacgc tgccgcagta cggttacgcg 1140 acgctgaacc gcgacaacac agaaaatccc accgagagga gcagcttctt ctgcctagag 1200 tactttccca gcaagatgct gagaacgggc aacaactttg agtttaccta caactttgag 1260 gaggtgccct tccactccag cttcgctccc agtcagaacc tcttcaagct ggccaacccg 1320 ctggtggacc agtacttgta ccgcttcgtg agcacaaata acactggcgg agtccagttc 1380 aacaagaacc tggccgggag atacgccaac acctacaaaa actggttccc ggggcccacg 1440 ggccgaaccc agggctggaa cctgggctcc ggggtcaacc gcgccagtgt cagcgccttc 1500 gccacgacca ataggatgga gctcgagggc gcgagttacc aggtgccccc gcagccgaac 1560 ggcatgacca acaacctcca gggcagcaac acctatgccc tggagaacac tatgatcttc 1620 aacagccagc cggcgaaccc gggcaccacc gccacgtacc tcgagggcaa catgctcatc 1680 accagcgaga gcgagacgca gccggtgaac cgcgtggcgt acaacgtcgg cgggcagatg 1740 gccaccaaca accagagctc caccactgcc cccgcgaccg gcacgtacaa cctccaggaa 1800 atcgtgcccg gcagcgtgtg gatggagagg gacgtgtacc tccaaggacc catctgggcc 1860 aagatcccag agacgggggc gcactttcac ccctctccgg ccatgggcgg attcggactc 1920 aaacacccac cgcccatgat gctcatcaag aacacgcctg tgcccggaaa tatcaccagc 1980 ttctcggacg tgcccgtcag cagcttcatc acccagtaca gcaccgggca ggtcaccgtg 2040 gagatggagt gggagctcaa gaaggaaaac tccaagaggt ggaacccaga gatccagtac 2100 acaaacaact acaacgaccc ccagtttgtg gactttgccc cggacagcac cggggaatac 2160 agaaccacca gacctatcgg aacccgatac cttacccgac ccctt 2205 <210> 4 <211> 735 <212> PRT <213> Artificial Sequence <220> <223> AAVT13 Amino Acid Sequence <400> 4 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly lie Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Lys Pro 20 25 30 Lys Ala Asn Gin Gin Lys Gin Asp Asp Gly Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gin Leu Gin Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gin Glu Arg Leu Gin Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gin Ala Lys Lys Arg Val Leu Glu Pro 115 120 125 Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Glu Pro Ser Pro Gin Arg Ser Pro Asp Ser Ser Thr Gly lie 145 150 155 160 Gly Lys Lys Gly Gin Gin Pro Ala Arg Lys Arg Leu Asn Phe Gly Gin 165 170 175 Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gin Pro Leu Gly Glu Pro 180 185 190 Pro Ala Ala Pro Ser Gly Val Gly Pro Asn Thr Met Ser Ala Gly Gly 195 200 205 Gly Gly Pro Leu Gly Asp Asn Asn Gin Gly Ala Asp Gly Val Gly Asn 210 215 220 Ala Ser Gly Asp Trp His Cys Asp Ser Thr Trp Met Gly Asp Arg Val 225 230 235 240 Val Thr Lys Ser Thr Arg Thr Trp Val Leu Pro Ser Tyr Asn Asn His 245 250 255 Gln Tyr Arg Glu Ile Lys Ser Gly Ser Val Asp Arg Ser Asn Ala Asn 260 265 270 Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285 Phe His Ser His Trp Ser Pro Arg Asp Trp Gin Arg Leu Ile Asn Asn 290 295 300 Tyr Trp Gly Phe Arg Pro Arg Ser Leu Arg Val Lys Ile Phe Asn Ile 305 310 315 320 Gln Val Lys Glu Val Thr Val Gin Asp Ser Thr Thr Thr Ile Ala Asn 325 330 335 Asn Leu Thr Ser Thr Val Gin Val Phe Thr Asp Asp Asp Tyr Gin Leu 340 345 350 Pro Tyr Val Val Gly Asn Gly Thr Glu Gly Cys Leu Pro Ala Phe Pro 355 360 365 Pro Gin Val Phe Thr Leu Pro Gin Tyr Gly Tyr Ala Thr Leu Asn Arg 370 375 380 Asp Asn Thr Glu Asn Pro Thr Glu Arg Ser Ser Phe Phe Cys Leu Glu 385 390 395 400 Tyr Phe Pro Ser Lys Met Leu Arg Thr Gly Asn Asn Phe Glu Phe Thr 405 410 415 Tyr Asn Phe Glu Glu Val Pro Phe His Ser Ser Phe Ala Pro Ser Gin 420 425 430 Asn Leu Phe Lys Leu Ala Asn Pro Leu Val Asp Gin Tyr Leu Tyr Arg 435 440 445 Phe Val Ser Thr Asn Asn Thr Gly Gly Val Gin Phe Asn Lys Asn Leu 450 455 460 Ala Gly Arg Tyr Ala Asn Thr Tyr Lys Asn Trp Phe Pro Gly Pro Thr 465 470 475 480 Gly Arg Thr Gin Gly Trp Asn Leu Gly Ser Gly Val Asn Arg Ala Ser 485 490 495 Val Ser Ala Phe Ala Thr Thr Asn Arg Met Glu Leu Glu Gly Ala Ser 500 505 510 Tyr Gln Val Pro Pro Gln Pro Asn Gly Met Thr Asn Asn Leu Gln Gly 515 520 525 Ser Asn Thr Tyr Ala Leu Glu Asn Thr Met Ile Phe Asn Ser Gln Pro 530 535 540 Ala Asn Pro Gly Thr Thr Ala Thr Tyr Leu Glu Gly Asn Met Leu Ile 545 550 555 560 Thr Ser Glu Ser Glu Thr Gln Pro Val Asn Arg Val Ala Tyr Asn Val 565 570 575 Gly Gly Gln Met Ala Thr Asn Asn Gln Ser Ser Thr Thr Ala Pro Ala 580 585 590 Thr Gly Thr Tyr Asn Leu Gln Glu Ile Val Pro Gly Ser Val Trp Met 595 600 605 Glu Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro Glu 610 615 620 Thr Gly Ala His Phe His Pro Ser Pro Ala Met Gly Gly Phe Gly Leu 625 630 635 640 Lys His Pro Pro Pro Met Met Leu Ile Lys Asn Thr Pro Val Pro Gly 645 650 655 Asn Ile Thr Ser Phe Ser Asp Val Pro Val Ser Ser Phe Ile Thr Gin 660 665 670 Tyr Ser Thr Gly Gin Val Thr Val Glu Met Glu Trp Glu Leu Lys Lys 675 680 685 Glu Asn Ser Lys Arg Trp Asn Pro Glu He Gin Tyr Thr Asn Asn Tyr 690 695 700 Asn Asp Pro Gin Phe Val Asp Phe Ala Pro Asp Ser Thr Gly Glu Tyr 705 710 715 720 Arg Thr Thr Arg Pro He Gly Thr Arg Tyr Leu Thr Arg Pro Leu 725 730 735 <210> 5 <211> 772 <212> DNA <213> Artificial Sequence <220> <223> CB Promoter Nucleotide Sequence <400> 5 acgcgtggta cctctggtcg ttacataact tacggtaaat ggcccgcctg gctgaccgcc 60 caacgacccc gcccattgac gtcaataatg acgtatgttc ccatagtaac gccaataggg 120 actttccatt gacgtcaatg ggtggagtat ttacggtaaa ctgcccactt ggcagtacat 180 caagtgtatc atatgccaag tacgccccct attgacgtca atgacggtaa atggcccgcc 240 tggcattatg cccagtacat gaccttatgg gactttccta cttggcagta catctactcg 300 aggccacgtt ctgcttcact ctccccatct cccccccctc cccaccccca attttgtatt 360 tatttatttt ttaattattt tgtgcagcga tgggggcggg gggggggggg gggggggcgc 420 gcgccaggcg gggcggggcg gggcgagggg cggggcgggg cgaggcggag aggtgcggcg 480 gcagccaatc agagcggcgc gctccgaaag tttcctttta tggcgaggcg gcggcggcgg 540 cggccctata aaaagcgaag cgcgcggcgg gcgggagcgg gatcagccac cgcggtggcg 600 gccctagagt cgatcgagga actgaaaaac cagaaagtta actggtaagt ttagtctttt 660 tgtcttttat ttcaggtccc ggatccggtg gtggtgcaaa tcaaagaact gctcctcagt 720 ggatgttgcc tttacttcta ggcctgtacg gaagtgttac ttctgctcta aa 772 <210> 6 <211> 208 <212> DNA <213> Artificial Sequence <220> <223> bGH POLYA nucleotide sequence <400> 6 CTGTGCCTTC TAGTTGCCAG CCACTGTTTG TTTGCCCCTC CCCCCTGCCT TCCTTGACCC 60 TGGAAGGTGC CACTCCCACT GTCCTTTCCT AATAAAATGA GGAAATTGCA TC GCATTGTC 120 TGAGTAGGTG TCATTCTATT CTGGGGGGTG GGGTGGGGCA GGACAGCAAG GGGGAGGATT 180 GGGAAGACAA TAGCAGGATG CTGGGGAG 208 <210> 7 <211> 2142 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of B36 expression cassette <400> 7 CTGCgcgctc gctcgctcac tgaggccgcc cgggcaaagc ccgggcgtcg ggcgaccttt 60 GGTCGCCCgg cctcagtgag cgagcgagcg cgcagagagg gagtggaatt cacgcgtggt 120 ACGATCTGAA TTCGTTACAA TTCACGCgtg gtacctctgg tcgttacata acttacggta 180 AATGGCCCgc ctggctgacc gcccaacgac cccgcccatt gacgtcaata atgacgtatg 240 TTCCCATAGT AACGCCAAT AGGGACTTTCC ATTGACGTCA ATGGGTGGAG TATTTACGGT 300 AAACTGCCCA CTTGGCAGTA CATCAAGTGT ATCATATGCC AAGTACGCCC CCTATTGACG 360 TCAATGACGG TAAATGGCCC GCCTGGCATT ATGCCCAGTA CATGACCTTA TGGGACTTTC 420 CTACTTGGCA GTACATCTAC TCGAGGCCAC GTTCTGCTTC ACTCTCCCCA TCTCCCCCCC 480 CTCCCCACCC CAATTTTGTA TTTATTTATT TTTTATATTT TTGTGCAGCG ATGGGGG 540 GGGGGGGGGG GGGGGGGGGG CGC 60 GGGC 660 TATGGCGAGG C 720 C 780 T 840 AAATCAAAGA CTGCTCCTC 900 T 960 AATGGGTCA 1020 GAGACTTCCA GCCTGTGCTG CATCTGGTGG CCCTGAAC 1080 gaggcatcag aggggctgac ttccagtgct tccagcaggt gagtatctca gggatccaga 1140 catggggata tgggaggtgc ctctgatccc agggctcact gtgggtctct ctgttcacag 1200 gccagagctg ttggactggc tggaaccttc agagccttcc tgagcagcag actgcaggac 1260 ctgtacagca ttgtcagaag ggcagacaga gctgctgtgc ccattgtgaa cctgaaggat 1320 gaactgctgt tccctagctg ggaagccctg ttctctggct ctgagggacc tctgaaacct 1380 ggggccagaa tcttcagctt tgatggcaag gatgtgctga gacaccccac ctggcctcag 1440 aaatctgtgt ggcatggctc tgaccccaat ggcagaaggc tgacagagtc ctactgtgaa 1500 acttggagaa cagaggcccc atctgccaca ggccaggcca gttcacttct tggaggtaga 1560 ctgctgggcc agtctgcagc ctcttgtcac catgcctaca ttgtgctgtg cattgagaac 1620 agcttcatga cagccagcaa gtgaaagctt atcaggtgag tggcgggccc tgagctgggg 1680 ggcgggggtg ttggctctgg aggctgggtc tgagcgtaat tttgcacccc cgcgtccctg 1740 caggataccg tcgactagag ctcgctgatc agcctcgact gtgccttcta gttgccagcc 1800 atctgttgtt tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt 1860 cctttcctaa taaaatgagg aaattgcatc gcattgtctg agtaggtgtc attctattct 1920 ggggggtggg gtggggcagg acagcaaggg ggaggattgg gaagacaata gcaggcatgc 1980 tggggagaga tcgatctagg aacccctagt gatggagttg gccactccct ctctgcgcgc 2040 tcgctcgctc actgaggccg cccgggcaaa gcccgggcgt cgggcgacct ttggtcgccc 2100 ggcctcagtg agcgagcgag cgcgcagaga gggagtggcc aa 2142 <210> 8 <211> 201 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of B36 protein product <400> 8 Met Lys Trp Val Thr Phe Ile Ser Leu Leu Phe Leu Phe Ser Ser Ala 1 5 10 15 Tyr Ser His Ser His Arg Asp Phe Gln Pro Val Leu His Leu Val Ala 20 25 30 Leu Asn Ser Pro Leu Ser Gly Gly Met Arg Gly Ile Arg Gly Ala Asp 35 40 45 Phe Gin Cys Phe Gin Gin Ala Arg Ala Val Gly Leu Ala Gly Thr Phe 50 55 60 Arg Ala Phe Leu Ser Ser Arg Leu Gin Asp Leu Tyr Ser Ile Val Arg 65 70 75 80 Arg Ala Asp Arg Ala Ala Val Pro Ile Val Asn Leu Lys Asp Glu Leu 85 90 95 Leu Phe Pro Ser Trp Glu Ala Leu Phe Ser Gly Ser Glu Gly Pro Leu 100 105 110 Lys Pro Gly Ala Arg Ile Phe Ser Phe Asp Gly Lys Asp Val Leu Arg 115 120 125 His Pro Thr Trp Pro Gin Lys Ser Val Trp His Gly Ser Asp Pro Asn 130 135 140 Gly Arg Arg Leu Thr Glu Ser Tyr Cys Glu Thr Trp Arg Thr Glu Ala 145 150 155 160 Pro Ser Ala Thr Gly Gin Ala Ser Ser Leu Leu Gly Gly Arg Leu Leu 165 170 175 Gly Gin Ser Ala Ala Ser Cys His His Ala Tyr Ile Val Leu Cys Ile 180 185 190 Glu Asn Ser Phe Met Thr Ala Ser Lys 195 200 <210> 9 <211> 3450 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of B110 expression cassette <400> 9 ctgcgcgctc gctcgctcac tgaggccgcc cgggcaaagc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct tgtagttaat gattaacccg ccatgctact tatctacgta gccatgctct 180 aggaagatcg gaattctcta gaacgcgtgg tacctctggt cgttacataa cttacggtaa 240 atggcccgcc tggctgaccg cccaacgacc ccgcccattg acgtcaataa tgacgtatgt 300 tcccatagta acgccaatag ggactttcca ttgacgtcaa tgggtggagt atttacggta 360 aactgcccac ttggcagtac atcaagtgta tcatatgcca agtacgcccc ctattgacgt 420 caatgacggt aaatggcccg cctggcatta tgcccagtac atgaccttat gggactttcc 480 tacttggcag tacatctact cgaggccacg ttctgcttca ctctccccat ctcccccccc 540 tccccacccc caattttgta tttatttatt ttttaattat tttgtgcagc gatgggggcg 600 gggggggggg gggggcgcgc gccaggcggg gcggggcggg gcgaggggcg gggcggggcg 660 aggcggaaag gtgcggcggc agccaatcaa agcggcgcgc tccgaaagtt tccttttatg 720 gcaaggcggc ggcggcggcg gccctataaa aagcaaaccg cgcggcgggc gggagcggga 780 tcagccaccg cggtggcggc ctaaagtcga cgaggaactg aaaaaccaga aagttaactg 840 gtaagttaag tctttttgtc ttttatttca ggtcccggat ccggtggtgg tgcaaatcaa 900 agaactgctc ctcagtggat gttgccttta cttctaggcc tgtacggaag tgttacttct 960 gctctaaaag ctgcggaatt gtacccgcgg ccggccgcca ccatgtggtg gcgtctgtgg 1020 tggctgctgt tgctgctgct tctgctgtgg cctatggtct gggctgacta caaagacgat 1080 gacgacaagc acagccacag agacttccag cctgtgctgc atctggtggc cctgaactct 1140 ccactgagtg gtggcatgag aggcatcaga ggggctgact tccagtgctt ccagcaggcc 1200 agagctgttg gactggctgg aaccttcaga gccttcctga gcagcagact gcaggacctg 1260 tacagcattg tcagaagggc agacagagct gctgtgccca ttgtgaacct gaaggatgaa 1320 ctgctgttcc ctagctggga agccctgttc tctggctctg agggacctct gaaacctggg 1380 gccagaatct tcagctttga tggcaaggat gtgctgagac accccacctg gcctcagaaa 1440 tctgtgtggc atggctctga ccccaatggc agaaggctga cagagtccta ctgtgaaact 1500 tggagaacag aggccccatc tgccacaggc caggccagtt cacttcttgg aggtagactg 1560 ctgggccagt ctgcagcctc ttgtcaccat gcctacattg tgctgtgcat tgagaacagc 1620 ttcatgacag ccagcaagag aaagcggaga agcggatctg gcgcccctgt gaaacagacc 1680 ctgaacttcg acctgctgaa gctggctggc gacgtggaaa gcaaccctgg acctatgtgg 1740 tggcggctct ggtggttgtt gctccttctc ctgctgctct ggcccatggt ttgggccaac 1800 cggaagtcca gcatcatcat ccgcatgcgc gacgtggtgc tgttcgagaa gaaggtgtac 1860 ctgagcgagt gcaagaccgg caacggcaag aactacagag gcaccatgag caagaccaag 1920 aacggcatca cctgtcagaa gtggtccagc acaagccctc acagacccag attcagcccc 1980 gccacacatc caagcgaagg cctggaagag aactactgca gaaaccccga caacgaccct 2040 caaggccctt ggtgctacac caccgatcct gagaagagat acgactactg cgacatcctg 2100 gaatgcgaag aggaatgcat gcactgcagc ggcgagaact acgacggcaa gatctccaag 2160 accatgagcg gactggaatg ccaggcttgg gacagccagt ctcctcacgc tcacggctac 2220 atccccagca agttccccaa caagaacctg aagaagaatt actgtcggaa ccccgaccgc 2280 gagctgaggc cttggtgttt taccacagat ccaaacaagc gctgggagct gtgcgacatc 2340 cccagatgca caacccctcc acctagcagc ggccctacct accaatgtct gaaaggcacc 2400 ggcgagaatt accggggcaa tgtggctgtg accgtgtccg gccatacctg ccaacattgg 2460 agcgcccaga cacctcacac acacaacaga acccctgaga acttcccctg caagaatctg 2520 gacgaaaact actgtaggaa tcccgatggc aagagggccc catggtgtca caccaccaac 2580 agccaagtcc gctgggagta ctgcaagatc cccagctgtg atagcagccc cgtgtctaca 2640 gaacagctgg cccctacagc tcctcctgag ctgacacctg tggtgcagga ttgctatcac 2700 ggcgacggcc agtcctatag aggcacaagc agcaccacca caaccggcaa gaagtgccag 2760 agctggtcct ccatgacacc ccaccggcac cagaaaaccc cagaaaacta ccccaatgcc 2820 ggcctgacca tgaactattg ccggaatcct gacgccgaca aaggcccctg gtgtttcaca 2880 actgacccca gcgtcagatg ggaatactgt aatctgaaga agtgcagcgg caccgaggcc 2940 tctgttgttg ctcctcctcc ttacccatac gatgttcctg actatgcggg ctatccctat 3000 gacgtcccgg actatgcata aatgcacttc gaattaaacc gctgatcagc ctcgactgtg 3060 ccttctagtt gccagccatc tgttgtttgc ccctcccccg tgccttcctt gaccctggaa 3120 ggtgccactc ccactgtcct ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt 3180 aggtgtcatt ctattctggg gggtggggtg gggcaggaca gcaaggggga ggattgggaa 3240 gacaatagca ggcatgctgg ggactcgagt agataagtag catggcgggt taatcattaa 3300 ctacaaggaa cccctagtga tggagttggc cactccctct ctgcgcgctc gctcgctcac 3360 tgaggccggg cgaccaaagg tcgcccgacg cccgggcttt gcccgggcgg cctcagtgag 3420 cgagcgagcg cgcagcctta attaacctaa 3450 <210> 10 <211> 672 <212> PRT <213> Artificial Sequence <220> <223> B110 protein product amino acid sequence <400> 10 Met Trp Trp Arg Leu Trp Trp Leu Leu Leu Leu Leu Leu Leu Leu Trp 1 5 10 15 Pro Met Val Trp Ala Asp Tyr Lys Asp Asp Asp Asp Lys His Ser His 20 25 30 Arg Asp Phe Gln Pro Val Leu His Leu Val Ala Leu Asn Ser Pro Leu 35 40 45 Ser Gly Gly Met Arg Gly Ile Arg Gly Ala Asp Phe Gln Cys Phe Gln 50 55 60 Gln Ala Arg Ala Val Gly Leu Ala Gly Thr Phe Arg Ala Phe Leu Ser 65 70 75 80 Ser Arg Leu Gln Asp Leu Tyr Ser Ile Val Arg Arg Ala Asp Arg Ala 85 90 95 Ala Val Pro Ile Val Asn Leu Lys Asp Glu Leu Leu Phe Pro Ser Trp 100 105 110 Glu Ala Leu Phe Ser Gly Ser Glu Gly Pro Leu Lys Pro Gly Ala Arg 115 120 125 Ile Phe Ser Phe Asp Gly Lys Asp Val Leu Arg His Pro Thr Trp Pro 130 135 140 Gln Lys Ser Val Trp His Gly Ser Asp Pro Asn Gly Arg Arg Leu Thr 145 150 155 160 Glu Ser Tyr Cys Glu Thr Trp Arg Thr Glu Ala Pro Ser Ala Thr Gly 165 170 175 Gln Ala Ser Ser Leu Leu Gly Gly Arg Leu Leu Gly Gln Ser Ala Ala 180 185 190 Ser Cys His His Ala Tyr Ile Val Leu Cys Ile Glu Asn Ser Phe Met 195 200 205 Thr Ala Ser Lys Arg Lys Arg Arg Ser Gly Ser Gly Ala Pro Val Lys 210 215 220 Gln Thr Leu Asn Phe Asp Leu Leu Lys Leu Ala Gly Asp Val Glu Ser 225 230 235 240 Asn Pro Gly Pro Met Trp Trp Arg Leu Trp Trp Leu Leu Leu Leu Leu 245 250 255 Leu Leu Leu Trp Pro Met Val Trp Ala Asn Arg Lys Ser Ser Ile Ile 260 265 270 Ile Arg Met Arg Asp Val Val Leu Phe Glu Lys Lys Val Tyr Leu Ser 275 280 285 Glu Cys Lys Thr Gly Asn Gly Lys Asn Tyr Arg Gly Thr Met Ser Lys 290 295 300 Thr Lys Asn Gly lie Thr Cys Gin Lys Trp Ser Ser Thr Ser Pro His 305 310 315 320 Arg Pro Arg Phe Ser Pro Ala Thr His Pro Ser Glu Gly Leu Glu Glu 325 330 335 Asn Tyr Cys Arg Asn Pro Asp Asn Asp Pro Gin Gly Pro Trp Cys Tyr 340 345 350 Thr Thr Asp Pro Glu Lys Arg Tyr Asp Tyr Cys Asp lie Leu Glu Cys 355 360 365 Glu Glu Glu Cys Met His Cys Ser Gly Glu Asn Tyr Asp Gly Lys lie 370 375 380 Ser Lys Thr Met Ser Gly Leu Glu Cys Gin Ala Trp Asp Ser Gin Ser 385 390 395 400 Pro His Ala His Gly Tyr lie Pro Ser Lys Phe Pro Asn Lys Asn Leu 405 410 415 Lys Lys Asn Tyr Cys Arg Asn Pro Asp Arg Glu Leu Arg Pro Trp Cys 420 425 430 Phe Thr Thr Asp Pro Asn Lys Arg Trp Glu Leu Cys Asp lie Pro Arg 435 440 445 Cys Thr Thr Pro Pro Pro Pro Ser Ser Gly Pro Thr Tyr Gin Cys Leu Lys 450 455 460 Gly Thr Gly Glu Asn Tyr Arg Gly Asn Val Ala Val Thr Val Ser Gly 465 470 475 480 His Thr Cys Gin His Trp Ser Ala Gin Thr Pro His Thr His Asn Arg 485 490 495 Thr Pro Gin Asn Phe Pro Cys Lys Asn Leu Asp Glu Asn Tyr Cys Arg 500 505 510 Asn Pro Asp Gly Lys Arg Ala Pro Trp Cys His Thr Thr Asn Ser Gin 515 520 525 Val Arg Trp Glu Tyr Cys Lys lie Pro Ser Cys Asp Ser Ser Pro Val 530 535 540 Ser Thr Glu Gin Leu Ala Pro Thr Ala Pro Pro Gin Leu Thr Pro Val 545 550 555 560 Val Gin Asp Cys Tyr His Gly Asp Gly Gin Ser Tyr Arg Gly Thr Ser 565 570 575 Ser Thr Thr Thr Thr Gly Lys Lys Cys Gin Ser Trp Ser Ser Met Thr 580 585 590 Pro His Arg His Gin Lys Thr Pro Gin Asn Tyr Pro Asn Ala Gly Leu 595 600 605 Thr Met Asn Tyr Cys Arg Asn Pro Asp Ala Asp Lys Gly Pro Trp Cys 610 615 620 Phe Thr Thr Asp Pro Ser Val Arg Trp Glu Tyr Cys Asn Leu Lys Lys 625 630 635 640 Cys Ser Gly Thr Glu Ala Ser Val Val Ala Pro Pro Pro Tyr Pro Tyr 645 650 655 Asp Val Pro Asp Tyr Ala Gly Tyr Pro Tyr Asp Val Pro Asp Tyr Ala 660 665 670 <210> 11 <211> 3255 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of B111 expression cassette <400> 11 ctgcgcgctc gctcgctcac tgaggccgcc cgggcaaagc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct tgtagttaat gattaacccg ccatgctact tatctacgta gccatgctct 180 aggaagatcg gaattctcta gaacgcgtgg tacctctggt cgttacataa cttacggtaa 240 atggcccgcc tggctgaccg cccaacgacc ccgcccattg acgtcaataa tgacgtatgt 300 tcccatagta acgccaatag ggactttcca ttgacgtcaa tgggtggagt atttacggta 360 aactgcccac ttggcagtac atcaagtgta tcatatgcca agtacgcccc ctattgacgt 420 caatgacggt aaatggcccg cctggcatta tgcccagtac atgaccttat gggactttcc 480 tacttggcag tacatctact cgaggccacg ttctgcttca ctctccccat ctcccccccc 540 tccccacccc caattttgta tttatttatt ttttaattat tttgtgcagc gatgggggcg 600 gggggggggg gggggcgcgc gccaggcggg gcggggcggg gcgaggggcg gggcggggcg 660 aggcggaaag gtgcggcggc agccaatcaa agcggcgcgc tccgaaagtt tccttttatg 720 gcaaggcggc ggcggcggcg gccctataaa aagcaaaccg cgcggcgggc gggagcggga 780 tcagccaccg cggtggcggc ctaaagtcga cgaggaactg aaaaaccaga aagttaactg 840 gtaagttaag tctttttgtc ttttatttca ggtcccggat ccggtggtgg tgcaaatcaa 900 agaactgctc ctcagtggat gttgccttta cttctaggcc tgtacggaag tgttacttct 960 tcccatagta acgccaatag ggactttcca ttgacgtcaa tgggtggagt atttacggta 360gctctaaaag ctgcggaatt gtacccgcgg ccggccgcca ccatgtctgc acttctgatc 1020 ctagctcttg ttggagctgc agttgctgac tacaaagacg atgacgacaa gcacacccac 1080 caggatttcc agcctgtgct gcatctggtg gccctgaaca cacctctgtc tggcggcatg 1140 agaggcatca gaggcgccga cttccagtgt ttccagcagg ctagagctgt gggcctgagc 1200 ggaaccttca gagccttcct gtctagcaga ctgcaggacc tgtacagcat cgtgcggaga 1260 gccgatagag gcagcgtgcc aatcgtgaac ctgaaggacg aggtgctgag ccctagctgg 1320 gactctctgt ttagcggctc tcagggacag ctgcagcctg gcgctagaat cttcagcttc 1380 gacggcaggg acgtgctgag acatcctgcc tggcctcaga aatctgtgtg gcacggctct 1440 gatcctagcg gcagacggct gatggaaagc tactgcgaga catggcggac cgagacaaca 1500 ggcgctacag gacaggcaag ctctctgctg agtggcagac tgctggaaca gaaggccgcc 1560 agctgtcaca acagctacat cgtgctgtgc atcgagaaca gcttcatgac cagcttcagc 1620 aagagaaagc ggagaagcgg atctggcgcc acgaacttct ctctgttaaa gcaagcagga 1680 GACGTGGAAG AAAACCCGGT CCgATGTCTGC ACTTCTGATC CTAGCTCTT GTGGAGCT 1740 GCAGTTGCTG TGTACCTGAG CGAGTGCAAG ACAGGATCG GCAACGGCTA CAGAGGCACC 1800 ATGAGCAGGA CAAAGTCTGG CGTGGCCTGT CAGAGTGAG GGCGCTACAT TTCCTCACGT G 1860 CCCAACTACA GCCCCAGCAC ACACCCTAAC GAAGGCCTGG AAGAGAACT ACTGCAGAAC 1920 CCCGACAACG ACGAGCAAGG CCCTTGGTGC TACACCACCG ATCCTGACAA GAGATAcgAC 1980 TACTGCAACA TCCCCGAGTG CgAAGAGGAAT GcatGTACTG CAGCGGCGAG AAGTACGAG 2040 GGCAAGATCA GCAAGACCAT GAGCGGCCTG GATTGTCAGG CCTGGGACTC TCAGTCTCCT 2100 CACGCTCACG GCTACATCCC CGCTAAGTTC CCCAGCAAGA CCTGAAGATG AATTACTGT 2160 AGGAACCCCT GACGGCGAGC CAGACCATGG TGCTTCACAA CAGACCCCAC CAAGAGATGG 2220 GAGTACTGTG ACATCCCCAG ATGCACCACAC CTCCACCACC TCCATCTCCA ACCTACCAG 2280 TGCCTGAAAG GCAGAGCGAG AACTACCggG CACAGTGTCG TGACCgTGTC GGCAAG 2340 ACATGCCAGC GTTGGAGCGA GCAGACACCC CACAGACACA ATAGAACCCC TGAGAAGTTC 2400 2460 tgttatacca cagacagcca gctgcgctgg gagtattgcg agatccctag ctgcgagagc 2520 agcgcctctc ctgaccagag cgattcttct gtgcctcctg aggaacagac acccgtggtg 2580 caagagtgct accagtctga cggccagagc tacaggggca caagcagcac aaccatcacc 2640 ggcaagaagt gccagagctg ggccgctatg ttccctcacc ggcactctaa gacacccgag 2700 aactttccag acgccggcct cgagatgaac tattgccgga atcctgatgg cgaacaaggc 2760 ccctggtacc catacgatgt tcctgactat gcgggctatc cctatgacgt cccggactat 2820 gcataaatgc acttcgaatt aaaccgctga tcagcctcga ctgtgccttc tagttgccag 2880 ccatctgttg tttgcccctc ccccgtgcct tccttgaccc tggaaggtgc cactccact 2940 gtcctttcct ataaatga ggaaattgca tcgcattgtc tgagtaggtg tcattctatt 3000 ctgggggtg gggtggggca ggacagcaag gggaggatt gggaacaa tagcaggcat 3060 gctggggact cgagtagata agtagcatgg cgggttaatc attaactaca aggaacccct 3120 agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc 3180 aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag 3240 ccttaattaa cctaa 3255 <210> 12 <211> 607 <212> PRT <213> Artificial Sequence <220> <223> B111 protein product amino acid sequence <400> 12 Met Ser Ala Leu Leu Ile Leu Ala Leu Val Gly Ala Ala Val Ala Asp 1 5 10 15 Tyr Lys Asp Asp Asp Asp Lys His Thr His Gln Asp Phe Gln Pro Val 20 25 30 Leu His Leu Val Ala Leu Asn Thr Pro Leu Ser Gly Gly Met Arg Gly 35 40 45 Ile Arg Gly Ala Asp Phe Gln Cys Phe Gln Gln Ala Arg Ala Val Gly 50 55 60 Leu Ser Gly Thr Phe Arg Ala Phe Leu Ser Ser Arg Leu Gln Asp Leu 65 70 75 80 Tyr Ser Ile Val Arg Arg Ala Asp Arg Gly Ser Val Pro Ile Val Asn 85 90 95 Leu Lys Asp Glu Val Leu Ser Pro Ser Trp Asp Ser Leu Phe Ser Gly 100 105 110 Ser Gln Gly Gln Leu Gln Pro Gly Ala Arg Ile Phe Ser Phe Asp Gly 115 120 125 Arg Asp Val Leu Arg His Pro Ala Trp Pro Gln Lys Ser Val Trp His 130 135 140 Gly Ser Asp Pro Ser Gly Arg Arg Leu Met Glu Ser Tyr Cys Glu Thr 145 150 155 160 Trp Arg Thr Glu Thr Thr Gly Ala Thr Gly Gln Ala Ser Ser Leu Leu 165 170 175 Ser Gly Arg Leu Leu Glu Gln Lys Ala Ala Ser Cys His Asn Ser Tyr 180 185 190 Ile Val Leu Cys Ile Glu Asn Ser Phe Met Thr Ser Phe Ser Lys Arg 195 200 205 Lys Arg Arg Ser Gly Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln 210 215 220 Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Met Ser Ala Leu Leu Ile 225 230 235 240 Leu Ala Leu Val Gly Ala Ala Val Ala Val Tyr Leu Ser Glu Cys Lys 245 250 255 Thr Gly lie Gly Asn Gly Tyr Arg Gly Thr Met Ser Arg Thr Lys Ser 260 265 270 Gly Val Ala Cys Gin Lys Trp Gly Ala Thr Phe Pro His Val Pro Asn 275 280 285 Tyr Ser Pro Ser Thr His Pro Asn Glu Gly Leu Glu Glu Asn Tyr Cys 290 295 300 Arg Asn Pro Asp Asn Asp Glu Gin Gly Pro Trp Cys Tyr Thr Thr Asp 305 310 315 320 Pro Asp Lys Arg Tyr Asp Tyr Cys Asn lie Pro Glu Cys Glu Glu Glu 325 330 335 Cys Met Tyr Cys Ser Gly Glu Lys Tyr Glu Gly Lys lie Ser Lys Thr 340 345 350 Met Ser Gly Leu Asp Cys Gin Ala Trp Asp Ser Gin Ser Pro His Ala 355 360 365 His Gly Tyr lie Pro Ala Lys Phe Pro Ser Lys Asn Leu Lys Met Asn 370 375 380 Tyr Cys Arg Asn Pro Asp Gly Glu Pro Arg Pro Trp Cys Phe Thr Thr 385 390 395 400 Asp Pro Thr Lys Arg Trp Glu Tyr Cys Asp lie Pro Arg Cys Thr Thr 405 410 415 Pro Pro Pro Pro Pro Ser Pro Thr Tyr Gln Cys Leu Lys Gly Arg Gly 420 425 430 Glu Asn Tyr Arg Gly Thr Val Ser Val Thr Val Ser Gly Lys Thr Cys 435 440 445 Gln Arg Trp Ser Glu Gln Thr Pro His Arg His Asn Arg Thr Pro Glu 450 455 460 Asn Phe Pro Cys Lys Asn Leu Glu Glu Asn Tyr Cys Arg Asn Pro Asp 465 470 475 480 Gly Glu Thr Ala Pro Trp Cys Tyr Thr Thr Asp Ser Gln Leu Arg Trp 485 490 495 Glu Tyr Cys Glu Ile Pro Ser Cys Glu Ser Ser Ala Ser Pro Asp Gln 500 505 510 Ser Asp Ser Ser Val Pro Pro Glu Glu Gln Thr Pro Val Val Gln Glu 515 520 525 Cys Tyr Gln Ser Asp Gly Gln Ser Tyr Arg Gly Thr Ser Ser Thr Thr 530 535 540 Ile Thr Gly Lys Lys Cys Gln Ser Trp Ala Ala Met Phe Pro His Arg 545 550 555 560 His Ser Lys Thr Pro Glu Asn Phe Pro Asp Ala Gly Leu Glu Met Asn 565 570 575 Tyr Cys Arg Asn Pro Asp Gly Asp Lys Gly Pro Trp Tyr Pro Tyr Asp 580 585 590 Val Pro Asp Tyr Ala Gly Tyr Pro Tyr Asp Val Pro Asp Tyr Ala 595 600 605 <210> 13 <211> 2214 <212> DNA <213> Artificial Sequence <220> <223> AAVXL32 coding sequence <400> 13 atggctgccg atggttatct tccagattgg ctcgaggaca acctctctga gggcattcgc 60 gagtggtggg cgctgaaacc tggagccccg aagcccaaag ccaaccagca aaagcaggac 120 gacggccggg gtctggtgct tcctggctac aagtacctcg gacccttcaa cggactcgac 180 aagggggagc ccgtcaacgc ggcggacgca gcggccctcg agcacgacaa ggcctacgac 240 cagcagctgc aggcgggtga caatccgtac ctgcggtata accacgccga cgccgagttt 300 caggagcgtc tgcaagaaga tacgtctttt gggggcaacc tcgggcgagc agtcttccag 360 gccaagaagc gggttctcga acctctcggt ctggttgagg aaggcgctaa gacggctcct 420 gccaagaagc gggttctcga acctctcggt ctggttgagg aaggcgctaa gacggctcct 420ggaaagaaga gaccggtaga gccatcaccc cagcgttctc cagactcctc tacgggcatc 480 ggcaagaaag gccaacagcc cgccagaaaa agactcaatt ttggtcagac tggcgactca 540 gagtcagttc cagaccctca acctctcgga gaacctccag cagcgccctc tggtgtggga 600 cctaatacaa tggcttcagg cggtggcgca ccaatggcag acaataacga aggcgccgac 660 ggagtgggta atgcctcagg aaattggcat tgcgattcca catggctggg cgacagagtc 720 atcaccacca gcacccgaac atgggccttg cccacctata acaaccacct ctacaagcaa 780 atctccagtg cttcaacggg ggccagcaac gacaaccact acttcggcta cagcaccccc 840 tgggggtatt ttgatttcaa cagattccac tgccatttct caccacgtga ctggcagcga 900 ctcatcaaca acaattgggg attccggccc aagagactca acttcaagct cttcaacatc 960 caagtcaagg aggtcacgac gaatgatggc gtcacgacca tcgctaataa ccttaccagc 1020 acggttcaag tcttctcgga ctcggagtac cagttgccgt acgtcctcgg ctctgcgcac 1080 cagggctgcc tccctccgtt cccggcggac gtgttcatga ttccgcaata cggctacctg 1140 acgctcaaca atggcagcca agccgtggga cgttcatcct tttactgcct ggaatatttc 1200 ccttctcaga tgctgagaac gggcaacaac tttaccttca gctacacctt tgaggaagtg 1260 cctttccaca gcagctacgc gcacagccag agcctggacc ggctgatgaa tcctctcatc 1320 gaccagtacc tgtattacct gaagaact cagaatcagt ccggaagtgc ccaaaaaag 1380 gacttgctgt ttagccgtgg gtctccagct ggcatgtctg ttcagcccaa aaactggcta 1440 cctggaccct gttaccggca gcagcgcgtt tctaaaacaa aaacagacaa caacaacagc 1500 aactttacct ggactggtgc ttcaaaatat aacctcaatg ggcgtgaatc catcatcaac 1560 cctggcactg ctatggcctc acaaagac gacaaagaca agttctttcc catgagcggt 1620 1680 atcacagacg aaggaaat caaagccact aaccccgtgg ccaccgaaag atttggact 1740 gtggcagtca atctccagag cagcagcaca gaccctgcga ccggagatgt gcatgttatg 1800 ggagccttac ctggaatggt gtggcaagac agagacgtat acctgcaggg tcctatttgg 1860 gccaaaattc ctcacacgga tggacacttt cacccgtctc ctctcatggg cggctttgga 1920 cttaagcacc cgcctcctca gatcctcatc aaaaacacgc ctgttcctgc gaatcctccg 1980 gcagagtttt cggctacaaa gtttgcttca ttcatcaccc agtattccac aggacaagtg 2040 agcgtggaga ttgaatggga gctgcagaaa gaaaacagca aacgctggaa tcccgaagtg 2100 cagtatacat ctaactatgc aaaatctgcc aacgttgatt ttactgtgga caacaatgga 2160 ctttatactg agcctcgccc cattggcacc cgttacctca cccgtcccct gtaa 2214 <210> 14 <211> 737 <212> PRT <213> Artificial Sequence <220> <223> AAVXL32 Amino Acid Sequence <400> 14 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Lys Pro 20 25 30 Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Gln Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro 115 120 125 Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile 145 150 155 160 Gly Lys Lys Gly Gln Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln 165 170 175 Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro 180 185 190 Pro Ala Ala Pro Ser Gly Val Gly Pro Asn Thr Met Ala Ser Gly Gly 195 200 205 Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn 210 215 220 Ala Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val 225 230 235 240 lie Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His 245 250 255 Leu Tyr Lys Gin lie Ser Ser Ala Ser Thr Gly Ala Ser Asn Asp Asn 260 265 270 His Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285 Phe His Cys His Phe Ser Pro Arg Asp Trp Gin Arg Leu lie Asn Asn 290 295 300 Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn lie 305 310 315 320 Gin Val Lys Gin Val Thr Thr Asn Asp Gly Val Thr Thr lie Ala Asn 325 330 335 Asn Leu Thr Ser Thr Val Gin Val Phe Ser Asp Ser Gin Tyr Gin Leu 340 345 350 Pro Tyr Val Leu Gly Ser Ala His Gin Gly Cys Leu Pro Pro Phe Pro 355 360 365 Ala Asp Val Phe Met Ile Pro Gin Tyr Gly Tyr Leu Thr Leu Asn Asn 370 375 380 Gly Ser Gin Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Gin Tyr Phe 385 390 395 400 Pro Ser Gin Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr 405 410 415 Phe Gin Gin Val Pro Phe His Ser Ser Tyr Ala His Ser Gin Ser Leu 420 425 430 Asp Arg Leu Met Asn Pro Leu Ile Asp Gin Tyr Leu Tyr Tyr Leu Asn 435 440 445 Arg Thr Gin Asn Gin Ser Gly Ser Ala Gin Asn Lys Asp Leu Leu Phe 450 455 460 Ser Arg Gly Ser Pro Ala Gly Met Ser Val Gin Pro Lys Asn Trp Leu 465 470 475 480 Pro Gly Pro Cys Tyr Arg Gin Gin Arg Val Ser Lys Thr Lys Thr Asp 485 490 495 Asn Asn Asn Ser Asn Phe Thr Trp Thr Gly Ala Ser Lys Tyr Asn Leu 500 505 510 Asn Gly Arg Gin Ser Ile Ile Asn Pro Gly Thr Ala Met Ala Ser His 515 520 525 Lys Asp Asp Lys Asp Lys Phe Phe Pro Met Ser Gly Val Met Ile Phe 530 535 540 Gly Lys Glu Ser Ala Gly Ala Ser Asn Thr Ala Leu Asp Asn Val Met 545 550 555 560 Ile Thr Asp Glu Glu Glu Ile Lys Ala Thr Asn Pro Val Ala Thr Glu 565 570 575 Arg Phe Gly Thr Val Ala Val Asn Leu Gln Ser Ser Ser Thr Asp Pro 580 585 590 Ala Thr Gly Asp Val His Val Met Gly Ala Leu Pro Gly Met Val Trp 595 600 605 Gln Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro 610 615 620 His Thr Asp Gly His Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly 625 630 635 640 Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro 645 650 655 Ala Asn Pro Pro Ala Glu Phe Ser Ala Thr Lys Phe Ala Ser Phe Ile 660 665 670 Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu 675 680 685 Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Val Gin Tyr Thr Ser 690 695 700 Asn Tyr Ala Lys Ser Ala Asn Val Asp Phe Thr Val Asp Asn Asn Gly 705 710 715 720 Leu Tyr Thr Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Pro 725 730 735 Leu <210> 15 <211> 549 <212> DNA <213> Artificial Sequence <220> <223> Codon-optimized human endostatin-encoding nucleic acid sequence <400> 15 cacagccaca gagacttcca gcctgtgctg catctggtgg ccctgaactc tccactgagt 60 ggtggcatga gaggcatcag aggggctgac ttccagtgct tccagcaggc cagagctgtt 120 ggactggctg gaaccttcag agccttcctg agcagcagac tgcaggacct gtacagcatt 180 gtcagaaggg cagacagagc tgctgtgccc attgtgaacc tgaaggatga actgctgttc 240 cctagctggg aagccctgtt ctctggctct gagggacctc tgaaacctgg ggccagaatc 300 cctagctggg aagccctgtt ctctggctct gagggacctc tgaaacctgg ggccagaatc 300ttcagctttg atggcaagga tgtgctgaga caccccacct ggcctcagaa atctgtgtgg 360 catggctctg accccaatgg cagaaggctg acagagtcct actgtgaaac ttggagaaca 420 gaggccccat ctgccacagg ccaggccagt tcacttcttg gaggtagact gctgggccag 480 tctgcagcct cttgtcacca tgcctacatt gtgctgtgca ttgagaacag cttcatgaca 540 gccagcaag 549 <210> 16 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> Codon-optimized human angiostatin-encoding nucleic acid sequence <400> 16 aaccggaagt ccagcatcat catccgcatg cgcgacgtgg tgctgttcga gaagaaggtg 60 tacctgagcg agtgcaagac cggcaacggc aagaactaca gaggcaccat gagcaagacc 120 aagaacggca tcacctgtca gaagtggtcc agcacaagcc ctcacagacc cagattcagc 180 cccgccacac atccaagcga aggcctggaa gagaactact gcagaaaccc cgacaacgac 240 cctcaaggcc cttggtgcta caccaccgat cctgagaaga gatacgacta ctgcgacatc 300 ctggaatgcg aagaggaatg catgcactgc agcggcgaga actacgacgg caagatctcc 360 aagaccatga gcggactgga atgccaggct tgggacagcc agtctcctca cgctcacggc 420 tacatcccca gcaagttccc caacaagaac ctgaagaaga attactgtcg gaaccccgac 480 cgcgagctga ggccttggtg ttttaccaca gatccaaaca agcgctggga gctgtgcgac 540 atccccagat gcacaacccc tccacctagc agcggcccta cctaccaatg tctgaaaggc 600 accggcgaga attaccgggg caatgtggct gtgaccgtgt ccggccatac ctgccaacat 660 tggagcgccc agacacctca cacacacaac agaacccctg agaacttccc ctgcaagaat 720 ctggacgaaa actactgtag gaatcccgat ggcaagaggg ccccatggtg tcacaccacc 780 aacagccaag tccgctggga gtactgcaag atccccagct gtgatagcag ccccgtgtct 840 acagaacagc tggcccctac agctcctcct gagctgacac ctgtggtgca ggattgctat 900 cacggcgacg gccagtccta tagaggcaca agcagcacca ccacaaccgg caagaagtgc 960 cagagctggt cctccatgac accccaccgg caccagaaaa ccccagaaaa ctaccccaat 1020 gccggcctga ccatgaacta ttgccggaat cctgacgccg acaaaggccc ctggtgtttc 1080 acaactgacc ccagcgtcag atgggaatac tgtaatctga agaagtgcag cggcaccgag 1140 gcctctgttg ttgctcctcc tcct 1164 <210> 17 <211> 552 <212> DNA <213> Artificial Sequence <220> <223> Codon-optimized murine endostatin-encoding nucleic acid sequence <400> 17 cacacccacc aggatttcca gcctgtgctg catctggtgg ccctgaacac acctctgtct 60 ggcggcatga gaggcatcag aggcgccgac ttccagtgtt tccagcaggc tagagctgtg 120 ggcctgagcg gaaccttcag agccttcctg tctagcagac tgcaggacct gtacagcatc 180 gtgcggagag ccgatagagg cagcgtgcca atcgtgaacc tgaaggacga ggtgctgagc 240 cctagctggg actctctgtt tagcggctct cagggacagc tgcagcctgg cgctagaatc 300 ttcagcttcg acggcaggga cgtgctgaga catcctgcct ggcctcagaa atctgtgtgg 360 cacggctctg atcctagcgg cagacggctg atggaaagct actgcgagac atggcggacc 420 ttcagcttcg acggcaggga cgtgctgaga catcctgcct ggcctcagaa atctgtgtgg 360 cacggctctg atcctagcgg cagacggctg atggaaagct actgcgagac atggcggacc 420 GAGAACAACAG GCGCTACAGG ACAGGCAAGC TCTCTGCTGA GTGGCAGACT GCTGGAACAG 480 AAGGCCGCCA GCTGTCACAA CAGCTACATC GTGCTGTCAT CGAGAACAGC TTCA TGA CC 540 AGCTTCAGCA AG 552 <210> 18 <211> 1017 <212> DNA <213> Artificial Sequence <220> <223> Codon-optimized murine angiostatin-encoding nucleic acid sequence <400> 18 GTGTACCTGA GCGAGTGCAA GACAGGCA TC GGCAACGGCT ACAGAGGCAC CATGAGCAGG 60 ACAAAGTCTG GC GT GGCCTG TC AGAAGT GGGGC GCTAC ATTTCCCTCAC GT G CCC AACT AC 120 AGCCCCAGCA CACACCCTAA CGAAGGCCTG GAAGAGAACT ACTGCAGAAA CCCGACAAC 180 GACGAGCAAG GCCCTTGGTG CTACACCACC GATCCTGACA AGAGATACGA CTACTGCAAC 240 ATCCCCGAGT GC GAAGAGGA ATG CATGTAC TGCAGC GGC GAGAAGTAC GAGGGCAAG ATC 300 AGCAAGACCA TGAGC GGCCT GGATTGTCA GGCCT GGGACTC TCAGTCTCCT CACGCTCAC 360 GGCTACATCC CCGCTAAGTT CCCCAGCAAG AACCTGAAGA TGAATTACTG TAGGAACCCCT 420 GACGGCGAGCCCAGACC ATGGTGCTTCACAACAGACCCCACCAAGAGATGGAGTACTGT 480 GACATCCCCAGATGCACCACACCTCCACCACCTCCATCTCCAACCTACCA GTGCCTGAAA 540 GGCAGAGGCGAGA ACTACC GGGGCACAGTG TCTGTGACCGTGTC TGGCAAGACATGCCAG 600 CGTTGGAGCGAGCAGACACCCCACAGACACAATAGAACCCTGAGA ACTTCCCCTGCAA A 660 AACCTCGAGGAAA ACTACTGCCAATCCAGACGGCGAGACAGCCCCATGGTGTATACC 720 ACAGACAGCCAGCTGCGCTGGGAGTATTGCGAGATCCCTAGCTGCGAGAGCAGCGCCTCT 780 CCTGACCAGAGCGATTCTTCTGTGCCTCCTGAGGAACAGACACCCGTGGTGCAAGAGTGC 840 TACCAGTCTGACGGCCAGAGCTACAGGGGCA CAAGCAGCAC AACC ATCACCGGCAAGAAG 900 TGCCAGAGCTGGGCCGCTATGTTCCCTCACCGGCAC TCTAAGACACCCGAGA ACTTTCCA 960 GACGCCGGCCTCGAGATGAACTATTGCCGGAATCCTGATGGCGACA AAGGCCCTGG 1017 <210> 19 <211> 549 <212> DNA <213> Artificial Sequence <220> <223> Original (non-codon optimized) human endostatin-encoding nucleic acid sequence <400> 19 cacagccacc gcgacttcca gccggtgctc cacctggttg cgctcaacag ccccctgtca 60 ggcggcatgc ggggcatccg cggggccgac ttccagtgct tccagcaggc gcgggccgtg 120 gggctggcgg gcaccttccg cgccttcctg tcctcgcgcc tgcaggacct gtacagcatc 180 gtgcgccgtg ccgaccgcgc agccgtgccc atcgtcaacc tcaaggacga gctgctgttt 240 cccagctggg aggctctgtt ctcaggctct gagggtccgc tgaagcccgg ggcacgcatc 300 ttctcctttg acggcaagga cgtcctgagg caccccacct ggccccagaa gagcgtgtgg 360 catggctcgg accccaacgg gcgcaggctg accgagagct actgtgagac gtggcggacg 420 gaggctccct cggccacggg ccaggcctcc tcgctgctgg ggggcaggct cctggggcag 480 agtgccgcga gctgccatca cgcctacatc gtgctctgca ttgagaacag cttcatgact 540 gcctccaag 549 <210> 20 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> Original (non-codon optimized) human angiostatin-encoding nucleic acid sequence <400> 20 aacaggaagt cctccataat cattaggatg agagatgtag ttttatttga aaagaaagtg 60 tatctctcag agtgcaagac tgggaatgga aagaactaca gagggacgat gtccaaaaca 120 aaaaatggca tcacctgtca aaaatggagt tccacttctc cccacagacc tagattctca 180 cctgctacac acccctcaga gggactggag gagaactact gcaggaatcc agacaacgat 240 ccgcaggggc cctggtgcta tactactgat ccagaaaaga gatatgacta ctgcgacatt 300 cttgagtgtg aagaggaatg tatgcattgc agtggagaaa actatgacgg caaaatttcc 360 aagaccatgt ctggactgga atgccaggcc tgggactctc agagcccaca cgctcatgga 420 tacattcctt ccaaatttcc aaacaagaac ctgaagaaga attactgtcg taaccccgat 480 agggagctgc ggccttggtg tttcaccacc gaccccaaca agcgctggga actttgtgac 540 atcccccgct gcacaacacc tccaccatct tctggtccca cctaccagtg tctgaaggga 600 acaggtgaaa actatcgcgg gaatgtggct gttaccgtgt ccgggcacac ctgtcagcac 660 tggagtgcac agacccctca cacacataac aggacaccag aaaacttccc ctgcaaaaat 720 ttggatgaaa actactgccg caatcctgac ggaaaaaggg ccccatggtg ccatacaacc 780 aacagccaag tgcggtggga gtactgtaag ataccgtcct gtgactcctc cccagtatcc 840 acggaacaat tggctcccac agcaccacct gagctaaccc ctgtggtcca ggactgctac 900 catggtgatg gacagagcta ccgaggcaca tcctccacca ccaccacagg aaagaagtgt 960 cagtcttggt catctatgac accacaccgg caccagaaga ccccagaaaa ctacccaaat 1020 gctggcctga caatgaacta ctgcaggaat ccagatgccg ataaaggccc ctggtgtttt 1080 accacagacc ccagcgtcag gtgggagtac tgcaacctga aaaaatgctc aggaacagaa 1140 gcgagtgttg tagcacctcc gcct 1164 <210> 21 <211> 552 <212> DNA <213> Artificial Sequence <220> <223> Original (non-codon optimized) murine endostatin-encoding nucleic acid sequence <400> 21 catactcatc aggactttca gccagtgctc cacctggtgg cactgaacac ccccctgtct 60 ggaggcatgc gtggtatccg tggagcagat ttccagtgct tccagcaagc ccgagccgtg 120 gggctgtcgg gcaccttccg ggctttcctg tcctctaggc tgcaggatct ctatagcatc 180 gtgcgccgtg ctgaccgggg gtctgtgccc atcgtcaacc tgaaggacga ggtgctatct 240 cccagctggg actccctgtt ttctggctcc cagggtcaac tgcaacccgg ggcccgcatc 300 ttttcttttg acggcagaga tgtcctgaga cacccagcct ggccgcagaa gagcgtatgg 360 cacggctcgg accccagtgg gcggaggctg atggagagtt actgtgagac atggcgaact 420 gaaactactg gggctacagg tcaggcctcc tccctgctgt caggcaggct cctggaacag 480 aaagctgcga gctgccacaa cagctacatc gtcctgtgca ttgagaatag cttcatgacc 540 tctttctcca aa 552 <210> 22 <211> 1017 <212> DNA <213> Artificial Sequence <220> <223> Original (non-codon optimized) murine angiostatin-encoding nucleic acid sequence <400> 22 gtgtatctgt cagaatgtaa gaccggcatc ggcaacggct acagaggaac catgtccagg 60 acaaagagtg gtgttgcctg tcaaaagtgg ggtgccacgt tcccccacgt acccaactac 120 tctcccagta cacatcccaa tgagggacta gaagagaact actgtaggaa cccagacaat 180 gatgaacaag ggccttggtg ctacactaca gatccggaca agagatatga ctactgcaac 240 attcctgaat gtgaagagga atgcatgtac tgcagtggag aaaagtatga gggcaaaatc 300 tccaagacca tgtctggact tgactgccag gcctgggatt ctcagagccc acatgctcat 360 ggatacatcc ctgccaaatt tccaagcaag aacctgaaga tgaattattg ccacaaccct 420 gacggggagc caaggccctg gtgcttcaca acagacccca ccaaacgctg ggaatactgt 480 gacatccccc gctgcacaac acccccgccc ccacccagcc caacctacca atgtctgaaa 540 ggaagaggtg aaaattaccg agggaccgtg tctgtcaccg tgtctgggaa aacctgtcag 600 cgctggagtg agcaaacccc tcataggcac aacaggacac cagaaaattt cccctgcaaa 660 aatctggaag agaactactg ccggaaccca gatggagaaa ctgctccctg gtgctatacc 720 actgacagcc agctgaggtg ggagtactgt gagattccat cctgcgagtc ctcagcatca 780 ccagaccagt cagattcctc agttccacca gaggagcaaa cacctgtggt ccaggaatgc 840 taccagagcg atgggcagag ctatcggggt acatcgtcca ctaccatcac agggaagaag 900 tgccagtcct gggcagctat gtttccacac aggcattcga agaccccaga gaacttccca 960 gatgctggct tggagatgaa ctactgcagg aacccggatg gtgacaaggg cccttgg 1017
Claims
1. A gene delivery system comprising: a transgene expression cassette and an AAV capsid protein, the transgene expression cassette comprises: a CB promoter, an endostatin coding sequence with an N-terminal SP signal peptide or a PLS signal peptide, an angiostatin coding sequence with an N-terminal SP signal peptide or a PLS signal peptide, a bGH polyA; the endostatin coding sequence is as shown in SEQ ID NO: 15 or SEQ ID NO: 17; the angiostatin coding sequence is as shown in SEQ ID NO: 16 or SEQ ID NO: 18; the endostatin coding sequence and the angiostatin coding sequence are connected by a connecting sequence, and the connecting sequence is a Furin protease sequence + a connecting peptide + a 2A sequence, the amino acid sequence of the AAV capsid protein is as shown in SEQ ID NO:
4.
2. The gene delivery system of claim 1, wherein, the transgene expression cassette further comprises two ITRs at both ends, and each of the two ITRs is independently a normal ITR or a shortened ITR peptide.
3. The gene delivery system of claim 1, wherein, The endostatin coding sequence and / or the angiostatin coding sequence are provided with an oligopeptide tag.
4. The gene delivery system of claim 3, wherein, The oligopeptide tag is selected from Flag, 6×His, 2×HA and Myc.
5. The gene delivery system of claim 1, wherein, The 2A sequence is selected from P2A, T2A or F2A.
6. The gene delivery system according to any one of claims 1 to 5, wherein, The nucleotide sequence of the transgene expression cassette is as shown in SEQ ID NO: 9 or SEQ ID NO:
11.
7. Use of the gene delivery system of any one of claims 1 to 6 in the preparation of a medicament for treating a disease with neovascularization as a major pathological mechanism or inducing factor.
8. A medicament comprising: the gene delivery system of any one of claims 1 to 6, and an excipient.
9. The medicament according to claim 8, wherein, The medicament is used for treating a disease with neovascularization as a major pathological mechanism or inducing factor.
10. The medicament according to claim 9, wherein, The disease is a retinal disease or a cancer.
11. The medicament according to claim 10, wherein, The retinal disease includes age-related retinal maculopathy, diabetic retinopathy, retinal damage caused by strong light; the cancer includes lung cancer, liver cancer, kidney cancer, thyroid cancer, prostate cancer, kidney cancer, breast cancer, colorectal cancer, cervical cancer, leukemia, lymphoma, melanoma and glioblastoma.
12. The medicament according to any one of claims 8 to 11, wherein, The medicament is administered by a systemic route or a local route.
13. The medicament according to any one of claims 8 to 11, wherein, The medicament is administered intravenously, intramuscularly, subcutaneously, orally, locally, intraperitoneally and intralesionally.
14. The medicament according to any one of claims 8 to 11, wherein, The medicament is locally administered to the eye.
15. The medicament according to claim 14, wherein, The medicament is locally administered to the eye by intravitreal injection, subretinal injection or suprachoroidal injection. The medicament is locally administered to the eye by intravitreal injection, subretinal injection or suprachoroidal injection.
Citation Information
Patent Citations
Adeno-associated virus mediated B7.1 vaccination synergizes with angiostatin to eradicate disseminated liver metastatic cancers
US20040156828A1
Materials and methods for the treatment of pathological neovascularization in the eye
US9707304B2
Synthetic liver-tropic adeno-associated virus capsids and uses thereof
CN112566923A
Directed Evolution and In Vivo Panning of Virus Vectors
US20110104120A1