A high-sensitivity detection kit and method for Cordyceps sinensis powder spores

Abstract

The invention discloses a high-sensitivity detection kit and method for Cordyceps sinensis powder rod spore, and relates to the field of molecular biology. The key points of its technical solution are: including an outer nest primer for the first round of PCR amplification, the outer nest primer is at least one of ITS1F / ITS4R, ITS5F / ITS2R, and NS3F / NS6R primer pairs; and, an inner nest primer for the second round of PCR amplification, the inner nest primer is at least one of 2HA0-powder rod spore-F / R and 5HAO-powder rod spore-F / R primer pairs. The present invention adopts nested PCR technology, and the detection sensitivity is significantly improved compared with the traditional detection kit, and is particularly suitable for trace detection; the whole detection process only needs electrophoresis running gel detection to determine whether there is powder rod spore contamination, without the need for sequencing identification, with high sensitivity, wide sampling types, and convenient detection advantages.

Description

Technical Field

[0001] The invention relates to the field of molecular biology, and more specifically, to a high-sensitivity detection kit and a detection method for Cordyceps sinensis spores. Background Art

[0002] Acanthosporium is the most common companion fungus of Cordyceps sinensis and one of the main diseases of Cordyceps sinensis. Acanthosporium is widely distributed and has a wide variety of host species. It can usually cause large-scale death of Cordyceps sinensis, seriously hindering the development of the Cordyceps sinensis industry.

[0003] At present, the detection of the pathogen of Psoralea corymbosa is mainly carried out by plate culture through screening culture medium, and then judged by colony morphology. This method is time-consuming and usually requires several days of culture before observation; it also requires high experience of the tester, and requires accurate judgment of the difference between Psoralea corymbosa and other filamentous fungi, which is highly subjective; in addition, since the environment that needs to detect the contamination of Psoralea corymbosa is mostly soil samples and insect bodies themselves, the sample composition is complex, and other microbial backgrounds in the soil and symbiotic bacteria in the insect body often interfere with the experimental results and affect the sensitivity of the experiment; in addition, some detections of Psoralea corymbosa pathogens are carried out through PCR amplification technology, but the detection process has the problem that the detection sensitivity needs to be further improved and can only be detected on a single sample, so its promotion and application are greatly limited.

[0004] Therefore, how to research and design a highly sensitive detection kit and method for Cordyceps sinensis spores is an issue that we urgently need to solve. Summary of the invention

[0005] In order to solve the deficiencies in the prior art, the present invention aims to provide a highly sensitive detection kit and method for Cordyceps sinensis spores.

[0006] The above technical objectives of the present invention are achieved through the following technical solutions:

[0007] In a first aspect, a high-sensitivity detection kit for Cordyceps sinensis spores is provided, the kit comprising:

[0008] An outer nest primer for the first round of PCR amplification, wherein the outer nest primer is at least one of the primer pairs ITS1F / ITS4R, ITS5F / ITS2R, and NS3F / NS6R;

[0009] The sequences of the ITS1F / ITS4R primer pair are shown in SEQ ID NO.1 and SEQ ID NO.2;

[0010] The sequences of the ITS5F / ITS2R primer pair are shown in SEQ ID NO.3 and SEQ ID NO.4;

[0011] The sequences of the NS3F / NS6R primer pair are shown in SEQ ID NO.5 and SEQ ID NO.6;

[0012] and, inner nest primers for the second round of PCR amplification, wherein the inner nest primers are at least one of the primer pairs 2HA0-Powdered Coccomycetes-F / R and 5HAO-Powdered Coccomycetes-F / R;

[0013] The sequences of the 2HA0-Powdered Cocinatus-F / R primer pair are shown in SEQ ID NO.7 and SEQ ID NO.8;

[0014] The sequences of the 5HAO-Phenacoccus spp.-F / R primer pair are shown in SEQ ID NO.9 and SEQ ID NO.10.

[0015] In a second aspect, a highly sensitive method for detecting Cordyceps sinensis spores is provided, comprising the following steps:

[0016] Using at least one of the outer nest primer pairs as described in claim 1 as an outer nest primer and the extracted total nucleic acid of the sample as a reaction template, a 25ul reaction system is prepared to perform a first round of PCR amplification;

[0017] Using at least one of the inner nest primer pairs as described in claim 1 as the inner nest primer and the product of the first round of PCR amplification as the template, a 25 ul reaction system is prepared to perform a second round of PCR amplification;

[0018] The second round of PCR amplification products were subjected to electrophoresis detection. If a band was obtained, it indicated that the sample contained Acanthosporium, otherwise it did not.

[0019] Furthermore, the first round of PCR amplification conditions are specifically as follows: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 25 s, annealing at 60°C for 35 s, extension at 72°C for 60 s, 37 cycles; extension at 72°C for 5 min, and finally storage at 4°C.

[0020] Furthermore, the second round of PCR amplification conditions are as follows: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 25 s, annealing at 57.3°C for 35 s, extension at 72°C for 60 s, 37 cycles; extension at 72°C for 5 min, and finally storage at 4°C.

[0021] Furthermore, the 25ul reaction system includes: 22ul of PCR mix; 0.5ul of upstream and downstream primers; and 2ul of DNA template.

[0022] Furthermore, the PCR reaction mix includes: 0.18 mM deoxynucleotides; 1.8 mM magnesium chloride; 60.3 mM potassium chloride; 18.9 mM Tris-HCl; 0.6% glycerol; 5% dimethyl sulfoxide; 2.5% formamide; 5% betaine; and nuclease-free water is used as solvent.

[0023] Furthermore, the total nucleic acid of the sample is at least one of soil sample nucleic acid and tissue sample nucleic acid.

[0024] Furthermore, the steps of extracting nucleic acid from soil samples are as follows:

[0025] A. Weigh 1g of soil, put it into a mortar, pour in an appropriate amount of liquid nitrogen, and grind it immediately; then pour in an appropriate amount of liquid nitrogen and grind it, repeat 3 times, until the soil particles are ground into powder;

[0026] B. Place 13.5 ml of extraction buffer, 50 μl of proteinase K and 5 g of soil in a 50 ml centrifuge tube and place in a 37°C constant temperature shaker at 225 r / min. -1 Oscillating for 30 min; extraction buffer includes: 0.1 mol / L phosphate, pH 8.0; 0.1 mol / L EDTA, pH 8.0; 0.1 mol / L Tris-HCl, pH 8.0; 1.5 mol / L NaCl; 1.0% CTAB; proteinase K concentration is 10 g / L;

[0027] C. Add 1.5 ml of 20% SDS, mix gently, heat in a 65℃ water bath for 2 hours, and shake gently every 15-30 minutes; 5000 r·min -1 Centrifuge for 10 minutes, transfer the supernatant to a new 50ml centrifuge tube; add 4.5ml of extraction buffer to the original centrifuge tube, shake the slurry, add 0.5ml of 20% SDS, and place in a 65℃ water bath for 15 minutes. Centrifuge at the same centrifugal speed for 10 minutes, and combine the supernatant with the original supernatant; repeat this step once more;

[0028] D. Mix the supernatant with an equal amount of chloroform in a centrifuge tube and centrifuge at 5000 r / min -1 Centrifuge for 20 min; collect the supernatant and add 0.6 times the volume of isopropanol, let stand at room temperature for 1 h; 12000 r·min at 25°C -1 Centrifuge for 20 minutes, pour out the supernatant, dry it, add 500 μl of deionized water to dissolve the DNA and impurities adhering to the wall of the centrifuge tube, and collect it in a 1.5 ml microcentrifuge tube.

[0029] Furthermore, the steps of extracting nucleic acid from tissue samples are:

[0030] a. Take 0.5g or 0.5ml3 The tissue material was washed with double distilled water and dried with filter paper;

[0031] b. Cut the tissue material into pieces of about 1 cm and put them into a pre-cooled porcelain mortar;

[0032] c. Add liquid nitrogen to cool rapidly and grind into fine powder;

[0033] d. Add 2.5 ml of extraction buffer to a 5 ml centrifuge tube and incubate at 60°C for 1 hour;

[0034] e. Centrifuge at 15000 rpm for 10 minutes and transfer the supernatant into another new centrifuge tube;

[0035] f. Add equal volumes of chloroform:isoamyl alcohol (24:1), mix and extract until the water emulsion melts;

[0036] j. Centrifuge at 15000 rpm for 10 minutes;

[0037] h. Transfer the supernatant into another new centrifuge tube;

[0038] i. Add 2 / 3 volume of pre-cooled isopropanol, keep warm at -20℃ for 30min-1h, slowly mix the DNA into flocculent form and fold out;

[0039] j. Centrifuge at 15000 rpm for 10 minutes and discard the supernatant;

[0040] k. Wash the DNA precipitate twice with 70% ethanol;

[0041] l. Add 400ul TE buffer to dissolve DNA.

[0042] Furthermore, the tissue sample is any one of plants, insects, and microorganisms.

[0043] Compared with the prior art, the present invention has the following beneficial effects:

[0044] 1. The present invention adopts nested PCR technology, and the detection sensitivity is significantly improved compared with the traditional detection kit, which is particularly suitable for trace detection; the entire detection process only needs electrophoresis gel detection to determine whether there is aconite contamination, without sequencing identification, and has the advantages of high sensitivity, wide sampling types, and convenient detection;

[0045] 2. Compared with traditional colony culture, the present invention has the characteristics of short cycle, low pollution, high sensitivity, etc., and compared with traditional fungus identification effect, it has the characteristics of good specificity, low confusion with Cordyceps fungus, high detection sensitivity, etc.;

[0046] 3. Compared with traditional detection kits, the present invention has a low false positive rate and a higher sensitivity for mixed samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] The drawings described herein are used to provide a further understanding of the embodiments of the present utility model, constitute a part of this application, and do not constitute a limitation of the embodiments of the present utility model. In the drawings:

[0048] Figure 1 is a schematic diagram of electrophoresis results in an embodiment of the present invention;

[0049] Figure 2 It is a schematic diagram of sensitivity detection results in an embodiment of the present invention. DETAILED DESCRIPTION

[0050] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The illustrative embodiments of the present invention and their description are only used to explain the present invention and are not intended to limit the present invention.

[0051] Example 1: A highly sensitive detection kit for Cordyceps sinensis spores, the kit comprising outer nest primers for a first round of PCR amplification and inner nest primers for a second round of PCR amplification.

[0052] The outer nest primer is at least one of the primer pairs ITS1F / ITS4R, ITS5F / ITS2R, and NS3F / NS6R; the sequence of the ITS1F / ITS4R primer pair is shown in SEQ ID NO.1 and SEQ ID NO.2; the sequence of the ITS5F / ITS2R primer pair is shown in SEQ ID NO.3 and SEQ ID NO.4; the sequence of the NS3F / NS6R primer pair is shown in SEQ ID NO.5 and SEQ ID NO.6. As a preferred embodiment, the outer nest primer has three primer pairs of ITS1F / ITS4R, ITS5F / ITS2R, and NS3F / NS6R at the same time.

[0053] The nucleotide sequences of the outer nest primers are shown in the following table:

[0054] Primer name Sequence (5'-3') ITS1F TCCGTAGGTGAACCTGCGG ITS4R TCCTCCGCTTATTGATATGC ITS5F GGAAGTAAAAGTCGTAACAAGG ITS2R GCTGCGTTCTTCATCGATGC NS3F GCAAGTCTGGTGCCAGCAGCC NS6R GCATCACAGACCTGTTATTGCCTC

[0055] The inner nest primer is at least one of the primer pairs 2HA0-Powdered Coccidium-F / R and 5HAO-Powdered Coccidium-F / R; the sequences of the primer pair 2HA0-Powdered Coccidium-F / R are shown in SEQ ID NO.7 and SEQ ID NO.8; the sequences of the primer pair 5HAO-Powdered Coccidium-F / R are shown in SEQ ID NO.9 and SEQ ID NO.10. As a preferred embodiment, the inner nest primer has both the primer pairs 2HA0-Powdered Coccidium-F / R and 5HAO-Powdered Coccidium-F / R.

[0056] The nucleotide sequences of the inner nest primers are shown in the following table:

[0057] Primer name Sequence (5'-3') 2HA0-Powdered Coccomycetes-F GCCTGCGGAGGGATCATTA 2HA0-Powdered Coccomycetes-R CAGAAGTCGGGGGTTTTACG 5HA0-Powdered Coccomycetes-F CCTATCGTTGCTTCGGC 5HA0-Powdered Coryneformis-R AAGTTCAGCGGGTATTCCT

[0058] Embodiment 2: A highly sensitive detection method for Cordyceps sinensis spores, comprising the following steps:

[0059] S1: Using the three outer nest primer pairs described in Example 1 as outer nest primers and the extracted total nucleic acid of the sample as the reaction template, a 25ul reaction system was prepared for the first round of PCR amplification;

[0060] S2: using the two inner nest primer pairs described in Example 1 as inner nest primers and the product of the first round of PCR amplification as a template, a 25 ul reaction system was prepared for the second round of PCR amplification;

[0061] S3: The second round of PCR amplification products are subjected to electrophoresis detection. If a band is obtained, it indicates that the sample contains Acanthosporium, otherwise it does not.

[0062] Example 3: PRC amplification

[0063] (1) The specific steps of the first round of PCR amplification are:

[0064] 1) After the components required for the PCR reaction are prepared, preheat at 95°C for 3 minutes on a PCR instrument to fully denature the template DNA and then enter the amplification cycle;

[0065] 2) In each cycle, the template was first denatured at 94°C for 25 seconds, and then the temperature was lowered to 60°C for 35 seconds to allow the primers to fully anneal to the template;

[0066] 3) Maintain at 72°C for 60 seconds to allow the primer to extend on the template and synthesize DNA, completing one cycle;

[0067] 4) Repeat the cycle 37 times to accumulate a large amount of amplified DNA fragments;

[0068] 5) Finally, keep at 72°C for 5 min to allow the product to be fully extended and store at 4°C.

[0069] (2) The specific steps of the second round of PCR amplification are:

[0070] 1) After the components required for the PCR reaction are prepared, preheat at 95°C for 3 minutes on a PCR instrument to fully denature the template DNA and then enter the amplification cycle;

[0071] 2) In each cycle, the temperature was first kept at 94°C for 25 seconds to denature the template, and then the temperature was lowered to 57.3°C for 35 seconds to allow the primers to fully anneal to the template;

[0072] 3) Maintain at 72°C for 60 seconds to allow the primer to extend on the template and synthesize DNA, completing one cycle;

[0073] 4) Repeat the cycle 37 times to accumulate a large amount of amplified DNA fragments;

[0074] 5) Finally, keep at 72°C for 5 min to allow the product to be fully extended and store at 4°C.

[0075] The 25ul reaction system includes: 22ul PCR mix; 0.5ul each of upstream and downstream primers; 2ul DNA template.

[0076] The PCR reaction mix includes: 0.18 mM deoxynucleotide, 1.8 mM magnesium chloride, 60.3 mM potassium chloride, 18.9 mM Tris-HCl, 0.6% glycerol, 5% dimethyl sulfoxide, 2.5% formamide, 5% betaine, and nuclease-free water as solvent.

[0077] Example 4: Extraction of total nucleic acid from samples

[0078] The total nucleic acid of the sample is soil sample nucleic acid, tissue sample nucleic acid or both.

[0079] The steps for extracting nucleic acid from soil samples are as follows:

[0080] A. Weigh 1g of soil, put it into a mortar, pour in an appropriate amount of liquid nitrogen, and grind it immediately; then pour in an appropriate amount of liquid nitrogen and grind it, repeat 3 times, until the soil particles are ground into powder;

[0081] B. Place 13.5 ml of extraction buffer, 50 μl of proteinase K and 5 g of soil in a 50 ml centrifuge tube and place in a 37°C constant temperature shaker at 225 r / min. -1 Oscillating for 30 min; extraction buffer includes: 0.1 mol / L phosphate, pH 8.0; 0.1 mol / L EDTA, pH 8.0; 0.1 mol / L Tris-HCl, pH 8.0; 1.5 mol / L NaCl; 1.0% CTAB; proteinase K concentration is 10 g / L;

[0082] C. Add 1.5 ml of 20% SDS, mix gently, heat in a 65℃ water bath for 2 hours, and shake gently every 15-30 minutes; 5000 r·min -1 Centrifuge for 10 minutes, transfer the supernatant to a new 50ml centrifuge tube; add 4.5ml of extraction buffer to the original centrifuge tube, shake the slurry, add 0.5ml of 20% SDS, and place in a 65℃ water bath for 15 minutes. Centrifuge at the same centrifugal speed for 10 minutes, and combine the supernatant with the original supernatant; repeat this step once more;

[0083] D. Mix the supernatant with an equal amount of chloroform in a centrifuge tube and centrifuge at 5000 r / min -1 Centrifuge for 20 min; collect the supernatant and add 0.6 times the volume of isopropanol, let stand at room temperature for 1 h; 12000 r·min at 25°C -1 Centrifuge for 20 minutes, pour out the supernatant, dry it, add 500 μl of deionized water to dissolve the DNA and impurities adhering to the wall of the centrifuge tube, and collect it in a 1.5 ml microcentrifuge tube.

[0084] The steps for extracting nucleic acid from tissue samples are as follows:

[0085] a. Take 0.5g or 0.5ml 3 The tissue material was washed with double distilled water and dried with filter paper;

[0086] b. Cut the tissue material into pieces of about 1 cm and put them into a pre-cooled porcelain mortar;

[0087] c. Add liquid nitrogen to cool rapidly and grind into fine powder;

[0088] d. Add 2.5 ml of extraction buffer to a 5 ml centrifuge tube and incubate at 60°C for 1 hour;

[0089] e. Centrifuge at 15000 rpm for 10 minutes and transfer the supernatant into another new centrifuge tube;

[0090] f. Add equal volumes of chloroform and isoamyl alcohol (24:1), mix and extract until the solution is in the form of a water emulsion; both chloroform and isoamyl alcohol are analytically pure;

[0091] j. Centrifuge at 15000 rpm for 10 minutes;

[0092] h. Transfer the supernatant into another new centrifuge tube;

[0093] i. Add 2 / 3 volume of pre-cooled isopropanol, keep warm at -20℃ for 30min-1h, slowly mix the DNA into flocculent form and fold out;

[0094] j. Centrifuge at 15000 rpm for 10 minutes and discard the supernatant;

[0095] k. Wash the DNA precipitate twice with 70% ethanol;

[0096] l. Add 400ul TE buffer to dissolve DNA.

[0097] It should be noted that the tissue sample can be any one of plants, insects, and microorganisms.

[0098] Example 5: Experimental verification

[0099] 1. Electrophoresis test results

[0100] like Figure 1 The electrophoresis test has good specificity, and no bands can be amplified in samples without Psoralea corymbosa, and no false positive results are detected. At the same time, the detection kit also has good applicability and can detect Psoralea corymbosa from soil, plant and insect samples.

[0101] in, Figure 1 In A: a2 and a5 are the amplification bands of 2HA0-Agonycospora primers and 5HA0-Agonycospora primers respectively, and the detected samples are all soil samples containing Agonycospora; b1: soil samples without Agonycospora; b2: plant tissue without Agonycospora; b3: insect tissue without Agonycospora. Figure 1 In B: a2 is the amplification result of 2HA0-Powdered Coccidia primers, a5 is the amplification sequence of 2HA0-Powdered Coccidia primers and the comparison result 5HA0-Powdered Coccidia primer amplification result, and soil samples, plant samples and insect samples containing Powdered Coccidia are detected respectively.

[0102] The sequence amplified by 2HA0-Isaria fumosorosea primers and the alignment results are shown in Table 1. The sequencing results were compared with the database and the similarity with Isaria fumosorosea strain FFJC 27 (GeneBank ID: KF876832.1) reached 99.37%.

[0103] Table 1 2HA0-Powdered Coccothraustes primer amplification sequence and alignment results

[0104]

[0105] The sequence amplified by 5HA0-Isaria fumosorosea primers and the alignment results are shown in Table 2. The sequencing results were compared with the database and the similarity with Isaria fumosorosea strain 512-A (GeneBank ID: MK163754.1) reached 99.36%.

[0106] Table 2 5HA0-Powdered Coccomycetes primer amplification sequence and alignment results

[0107]

[0108] 2. Sensitivity verification of the powdery mildew test kit

[0109] The sensitivity evaluation was conducted by mixing 1 ml of a suspension of Psoralea corylifolia at different concentrations with 10 g of soil sample. The band was still detectable after mixing 1 ml of a suspension of Psoralea corylifolia at a concentration of 50 cells / ml with 10 g of soil.

[0110] The sensitivity of the kit for detecting the powdery mildew spores is as follows Figure 2 As shown, 2: indicates the use of 2HA0-powderyrhizobium primers for amplification; 5: indicates the use of 5HA0-powderyrhizobium primers for amplification; 2-1: 1 ml of a 10 5 Amplification results after mixing 10g soil with 1ml of 10 / ml powdered Coryneformis suspension; 2-2: Mix 1ml of 10 4 Amplification results after mixing 10g soil with 1ml of 10 / ml suspension of Psoralea coryneformis; 2-3: Mix 1ml of 10 3 Amplification results after mixing 10g soil with 1ml of 10 / ml powdered Coryneformis suspension; 2-4: Mix 1ml of 10 2 Amplification results after mixing 10g soil with 1ml of 50 1 The amplification results were obtained by mixing a suspension of Psoralea coryneformis with 10 g of soil; the tests of 5-1 to 5-5 were the same as above.

[0111] Through experimental verification, it is found that the nested PCR technology used in the present invention has significantly improved detection sensitivity compared with traditional detection kits, and is particularly suitable for trace detection; the entire detection process only requires electrophoresis gel detection to determine whether there is powder stick spore contamination, and there is no need for sequencing identification, which has the advantages of high sensitivity, wide sampling types, and convenient detection. In addition, compared with traditional colony culture, it has the characteristics of short cycle, not easy to be polluted, and high sensitivity, and compared with traditional fungal identification effects, it has good specificity, is not easy to be confused with Cordyceps fungi, and has high detection sensitivity; in addition, compared with traditional detection kits, the present invention has a low false positive rate and a high sensitivity for mixed samples.

[0112] The specific implementation methods described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific implementation method of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A highly sensitive detection kit for Cordyceps sinensis spores, characterized in that: The kit comprises: An outer nest primer for the first round of PCR amplification, wherein the outer nest primer is at least one of the primer pairs ITS1F / ITS4R and ITS5F / ITS2R; The sequences of the ITS1F / ITS4R primer pair are shown in SEQ ID NO.1 and SEQ ID NO.2; The sequences of the ITS5F / ITS2R primer pair are shown in SEQ ID NO.3 and SEQ ID NO.4; and, inner nest primers for the second round of PCR amplification, the inner nest primers being 5HAO-Powdered Coccomycetes-F / R primer pair; The sequences of the 5HAO-Phenacoccus spp.-F / R primer pair are shown in SEQ ID NO.9 and SEQ ID NO.

10.

2. A highly sensitive detection method for Cordyceps sinensis spores, characterized in that: The following steps are involved: Using at least one of the outer nest primer pairs as described in claim 1 as an outer nest primer and the extracted total nucleic acid of the sample as a reaction template, a 25ul reaction system is prepared to perform a first round of PCR amplification; Using the inner nest primer pair as described in claim 1 as the inner nest primer and the product of the first round of PCR amplification as the template, a 25ul reaction system is prepared to carry out the second round of PCR amplification; The second round of PCR amplification products were subjected to electrophoresis detection. If a band was obtained, it indicated that the sample contained Acanthosporium, otherwise it did not.

3. A highly sensitive detection method for Cordyceps sinensis spores according to claim 2, characterized in that: The conditions of the first round of PCR amplification were as follows: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 25 s, annealing at 60°C for 35 s, extension at 72°C for 60 s, 37 cycles; extension at 72°C for 5 min, and storage at 4°C.

4. A highly sensitive detection method for Cordyceps sinensis spores according to claim 2, characterized in that: The conditions of the second round of PCR amplification were as follows: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 25 s, annealing at 57.3°C for 35 s, extension at 72°C for 60 s, 37 cycles; extension at 72°C for 5 min, and storage at 4°C.

5. A highly sensitive detection method for Cordyceps sinensis spores according to claim 2, characterized in that: The 25ul reaction system includes: 22ul of PCR mix; 0.5ul of upstream and downstream primers; and 2ul of DNA template.

6. A highly sensitive detection method for Cordyceps sinensis spores according to claim 5, characterized in that: The PCRmix comprises: 0.18 mM deoxynucleotide, 1.8 mM magnesium chloride, 60.3 mM potassium chloride, 18.9 mM Tris-HCl, 0.6% glycerol, 5% dimethyl sulfoxide, 2.5% formamide, 5% betaine, and nuclease-free water as solvent.

7. A highly sensitive detection method for Cordyceps sinensis spores according to claim 2, characterized in that: The total nucleic acid of the sample is at least one of soil sample nucleic acid and tissue sample nucleic acid.

8. A highly sensitive detection method for Cordyceps sinensis spores according to claim 7, characterized in that: The steps for extracting nucleic acid from the soil sample are as follows: A. Weigh 1g of soil, put it into a mortar, pour in an appropriate amount of liquid nitrogen, and grind it immediately; then pour in an appropriate amount of liquid nitrogen and grind it, repeat 3 times, until the soil particles are ground into powder; B. Place 13.5 ml of extraction buffer, 50 μl of proteinase K and 5 g of soil in a 50 ml centrifuge tube and place in a 37°C constant temperature shaker at 225 r / min. -1 Oscillating for 30 min; extraction buffer includes: 0.1 mol / L phosphate, pH 8.0; 0.1 mol / L EDTA, pH 8.0; 0.1 mol / L Tris-HCl, pH 8.0; 1.5 mol / L NaCl; 1.0% CTAB; proteinase K concentration is 10 g / L; C. Add 1.5 ml of 20% SDS, mix gently, heat in a 65℃ water bath for 2 hours, shake gently every 15-30 minutes; 5000 r·min -1 Centrifuge for 10 minutes, transfer the supernatant to a new 50ml centrifuge tube; add 4.5ml of extraction buffer to the original centrifuge tube, shake the slurry, add 0.5ml of 20% SDS, and place in a 65℃ water bath for 15 minutes. Centrifuge at the same centrifugal speed for 10 minutes, and combine the supernatant with the original supernatant; repeat this step once more; D. Mix the supernatant with an equal amount of chloroform in a centrifuge tube and centrifuge at 5000 r / min -1 Centrifuge for 20 min; collect the supernatant and add 0.6 times the volume of isopropanol, let stand at room temperature for 1 h; 12000 r·min at 25°C -1 Centrifuge for 20 minutes, pour out the supernatant, dry it, add 500 μl of deionized water to dissolve the DNA and impurities adhering to the wall of the centrifuge tube, and collect it in a 1.5 ml microcentrifuge tube.

9. A highly sensitive detection method for Cordyceps sinensis spores according to claim 7, characterized in that: The steps of extracting nucleic acid from tissue samples are as follows: a. Take 0.5g or 0.5ml 3 The tissue material was washed with double distilled water and dried with filter paper; b. Cut the tissue material into pieces of about 1 cm and put them into a pre-cooled porcelain mortar; c. Add liquid nitrogen to cool rapidly and grind into fine powder; d. Add 2.5 ml of extraction buffer to a 5 ml centrifuge tube and incubate at 60°C for 1 hour; e. Centrifuge at 15000 rpm for 10 minutes and transfer the supernatant into another new centrifuge tube; f. Add equal volumes of chloroform:isoamyl alcohol (24:1), mix and extract until the water emulsion melts; j. Centrifuge at 15000 rpm for 10 minutes; h. Transfer the supernatant into another new centrifuge tube; i. Add 2 / 3 volume of pre-cooled isopropanol, keep warm at -20℃ for 30min-1h, slowly mix the DNA into flocculent form and fold out; j. Centrifuge at 15000 rpm for 10 minutes and discard the supernatant; k. Wash the DNA precipitate twice with 70% ethanol; l. Add 400ul TE buffer to dissolve DNA.

10. A highly sensitive detection method for Cordyceps sinensis spores according to claim 7, characterized in that: The tissue sample is any one of plants, insects and microorganisms.

Images