Humanized and variant TGF-β1 specific antibodies and methods and uses thereof

Abstract

The present invention provides antibodies that bind to TGF-β1, particularly humanized antibodies and variant antibodies and fragments thereof, which recognize human and mouse TGF-β1, particularly they preferentially bind to TGF-β1, including they do not recognize or bind to TOP-β2 or TOP-β3. The humanized antibodies and variant antibodies provided can be used to diagnose and treat conditions associated with activated or elevated TGF-β1, including cancer, and for regulating immune cells and immune responses, including immune responses to cancer or cancer antigens, and for fibrotic conditions. Anti-TGF-β1 antibodies, their variable region or CDR domain sequences, and fragments thereof can also be used in lymphoid cell-mediated therapies, including T cell-mediated therapies, and / or in combination with chemotherapy, immunomodulators, or anticancer agents and / or with other antibodies or fragments thereof. Specific antibodies are exemplified herein, including antibodies 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG, and 13A1-EH.

Description

Technical Field

[0001] The present invention relates to specific binding members, particularly antibodies, particularly humanized antibodies and variant antibodies and fragments thereof, which bind to transforming growth factor β1 (TGF-β1), particularly recognizing human and mouse TGF-β1, preferentially binding to TGF-β1 relative to binding to TGF-β2 or TGF-β3. The humanized antibodies and variant antibodies can be used for the diagnosis and treatment of conditions associated with activated or elevated TGF-β1, including cancer, and for regulating immune cells and immune responses, including immune responses to cancer or cancer antigens. Antibodies, their variable region or CDR domain sequences, and fragments thereof can also be used in lymphoid cell-mediated therapies, including T cell-mediated therapies, and / or for therapies in combination with chemotherapy, radiotherapy, immunomodulators, cancer vaccines, cancer antigens or anticancer agents and / or with other antibodies or fragments. Background Art

[0002] The transforming growth factor β (TGF-β) family forms a group of three isoforms: TGF-β1, TGF-β2, and TGF-β3, whose structures are formed by interconnected dimeric polypeptide chains. The pleiotropic and redundant functions of the TGF-β family are involved in controlling many aspects and effects of cell function in all tissues of the human body, including proliferation, differentiation, and migration (Poniatowski LA et al., 2015, Mediators Inflamm, 2015; 137823). Although the isoforms are similar in sequence (the TGF-β3 active domain shares 86% similarity with TGF-β1 and 91% similarity with TGF-β2), protein crystal structure and NMR studies have shown that the TGF-β3 active domain is different from TGF-β1. Comparison of the structures of TGF-β3 and TGF-β2 (Schlunegger MP, Grütter MG, 1992, Nature 358:430-434; Daopin S, Piez KA, Ogawa Y, Davies DR, 1992, Science 257:369-373) reveals an almost identical central core, with differences in the conformation of the N-terminal α-helix and the β-sheet loop (Mittl PR1, Priestle JP, Cox DA, McMaster G, Cerletti N, Grütter MG, 1996, Protein Science July 5(7):1261-1271).

[0003] In most cells, three types of cell surface proteins mediate TGF-β signaling: TGF-β receptors I (TβRI), II (TβRII), and III (TβRIII) (Cheifetz S, Like B, Massagué J, J Biol Chem. 1986 Jul 25; 261(21): 9972-8). The biologically active form of TGF-β is a dimer held together by hydrophobic interactions and, in most cases, by intersubunit disulfide bonds. The dimeric structure of these ligands suggests that they function by bringing together paired type I and type II receptors to form heterotetrameric receptor complexes (Sun PD, Davies DR, Annu Rev Biophys Biomol Struct. 1995; 24: 269-91). Binding of TGF-β to the extracellular domains of both receptors also induces the proper conformation of the intracellular kinase domain. These receptors undergo reversible post-translational modifications (phosphorylation, ubiquitination, and sumoylation) that regulate receptor stability and availability as well as SMAD and non-SMAD pathway activation.

[0004] Phosphorylation of the receptor activates the TGF-β signaling pathway - the ligand first binds to TβRII, followed by subsequent phosphorylation of the Gly-Ser regulatory region (GS domain) within TβRI. This results in the incorporation of TβRI and the formation of a large ligand-receptor complex consisting of a dimeric TGF-β ligand and two pairs of TβRI and TβRII (Shi Y, Massagué J, Cell. 2003 Jun 13; 113 (6): 685-700). TGF-β1 and TGF-β3 bind to TβRII without the involvement of type I receptors, while TGF-β2 interacts only with a combination of the two receptors (Derynck R, Feng XH, Biochim Biophys Acta. 1997 Oct 24; 1333 (2): F105-50). It has been observed that different ligand / receptor engagements of the TGF-β family may contribute to qualitative and quantitative differences in signaling events and biological outcomes (Hart PJ et al. Nat Struct Biol 2002 9(3):203-208). In addition, the temporal-spatial expression of some TGF-β isoforms in embryogenesis varies greatly, indicating non-overlapping functions that are not compensated throughout development (Akhurst RJ et al. Development 1990 110(2):445-460).

[0005] In cancer animal models and cancer patients, the expression of transforming growth factor β (TGF-β) is generally associated with tumor metastasis and poor prognosis (Donkor MK et al., 2012, OncoImmunology, 1 (2): 162-171). Members of the TGF-β family are potent regulatory cytokines that affect a variety of cell types that mediate proinflammatory or anti-inflammatory responses of the immune system. The effect of TGF-β on T cells is very multifaceted. In collaboration with other soluble factors, it controls the maturation, differentiation and activity of various T cell subsets that prevent or induce infection, graft-versus-host reaction, immune diseases and cancer formation (Schon HT et al., 2014, Hepatobiliary Surg Nutr, 2014, Dec 3 (6): 386-406). Several studies indicate that TGF-β can promote cancer growth and metastasis by acting on the tumor microenvironment by promoting tumor cell invasion and by suppressing the function of immune cells (Flavell et al., 2010, Nat Rev Imm Aug; 10(8):554-67).

[0006] Studies have demonstrated that blocking TGF-β using the mouse TGF-β universal antibody 1D11 (which recognizes TGF-β1, TGF-β2, and TGF-β3) can inhibit TGF-β expression through CD8 +T cells and synergistically enhance tumor vaccines in animal models (Terabe M et al. (2009) Clin Cancer Res 15:6560-6569; Takaku S et al. (2010) Int J Cancer 126(7):1666). In addition, TGFβ production caused by tumor cells, myeloid-derived suppressor cells (MDSCs) and stromal cells (such as cancer-associated fibroblasts (CAFs)) present at the tumor site and the immunosuppressive activity of TGFβ at the tumor site mean that blocking TGFβ can enhance antigen uptake, presentation, and activation of anti-tumor immune responses mediated by therapeutic vaccines. TGF-β has also been shown to drive the emergence of immunosuppressive plasma cells in various tumor types (e.g., hepatocellular carcinoma) (Shalapour et al. Nature. 2017 Nov 16; 551(7680):340-345; Shalapour et al. Nature. 2015 May 7; 521(7550):94-8). Combining anti-TGF-β blockade with programmed cell death protein 1 (PD1) blockade has been shown to induce anti-tumor immunity and tumor regression in different tumor models (Mariathasan et al., Nature. 2018 Feb 22;554(7693):544-548. Tauriello et al. Nature. 2018 Feb 22;554(7693):538-543).

[0007] TGF-β ligands have been shown to be upregulated in many fibrotic conditions, and many are potent drivers of extracellular matrix formation, a hallmark of fibrotic conditions (Biernacka et al. Growth Factors. 2011 Oct;29(5):196-202). This also includes many types of cancer, where the presence of fibrotic conditions has been indicated in tumor growth and metastatic spread (Principe et al. Cancer Res. 2016 May 1;76(9):2525-39.; Caja et al. Int J Mol Sci. 2018 Apr 26;19(5)). Consequently, anti-TGF-β targeting has been proposed and is currently being tested as a treatment for various fibrotic conditions, including kidney, lung, heart, and skin (Walton et al. Front Pharmacol. 2017 Jul 14;8:461). Other diseases in which TGF-β is implicated are, inter alia, allergic diseases (Tirado-Rodriguez et al. J Immunol Res. 2014; 2014: 318481) and Fanconi Anemia (Tummala and Dokal, Cell Stem Cell. 2016 May 5; 18(5): 567-8).

[0008] Several publications show differences in the expression of TGF-β isoforms in various tissues, diseases, tumors, and tumor microenvironments. For example, Van Belle et al. showed that TGF-β1 is expressed by some melanocytes and almost uniformly by nevi and melanomas, while TGF-β2 and TGF-β3 are not detected in normal melanocytes but are found in nevi and all forms of melanoma (early and late primary and metastatic melanomas) in a manner related to tumor progression (P. Van Belle 1996 American J. of Pathology 148(6):1887-1894). There are many other examples of where differential expression of isoforms is shown, particularly in glioblastoma, breast cancer, wound healing, and fibrosis (Roy et al. Int J Mol Sci. 2018 Apr 8;19(4); Hachim et al., Tumour Biol. 2018 Jan;40(1); Lichtman et al., Wound Repair Regen. 2016 Mar;24(2):215-22).

[0009] Therefore, it is clear that by targeting specific isoforms of TGF-β, one can avoid the damaging inflammatory consequences of blocking all isoforms of TGF-β. Furthermore, the differential expression patterns of TGF-β isoforms in different cancer types give researchers a unique opportunity to target cancer cells with greater specificity and efficacy. There is an unmet need in the art to generate therapeutic TGF-β antibodies against its isoforms, including in particular against TGF-β1. In addition, tools developed to identify different TGF-β isoforms are powerful diagnostic and prognostic sources. Furthermore, targeted TGF-β therapy requires the availability of effective and neutralizing humanized antibodies against specific TGF-β isoforms, in particular TGF-β1, to provide clinically applicable therapies that reduce immunogenicity and the patient's immune response while having stability and longevity in humans. The present invention addresses this unmet need in the art, and in particular with respect to TGF-β1.

[0010] Citation of references herein shall not be construed as an admission that such references are prior art to the present invention. Summary of the Invention

[0011] In general terms, the present invention provides novel transforming growth factor beta TGF-β antibodies, particularly humanized antibodies, directed against human TGF-β1. In one aspect, the TGF-β1 antibody of the present invention has a greater specificity for binding to TGF-β1 than to TGF-β2 or TGF-β3. In one aspect, the TGF-β1 antibody of the present invention does not significantly cross-react or bind to other members of the TGF-β family, and in particular does not cross-react or bind to TGF-β2 or TGF-β3. In one aspect, the present invention provides isolated specific binding members, particularly antibodies or fragments thereof, including Fab fragments and single chain or domain antibodies, which specifically recognize TGF-β1. In a specific aspect, the antibody or its active fragment neutralizes TGF-β1 activity.

[0012] The present invention provides antibodies specific for TGF-β1 for diagnostic and therapeutic purposes. In particular, antibodies specific for TGFβ1 are provided, wherein the antibody is humanized and recognizes and is capable of binding to and neutralizing human (and mouse) TGFβ1. In one aspect, the antibodies of the present invention preferentially recognize and bind to TGFβ1, including wherein the specificity of the antibodies of the present invention for binding to TGF-β1 is greater than binding to TGF-β2 or TGF-β3. In one aspect, the antibodies of the present invention do not recognize other forms of TGF-β, particularly TGF-β2 or TGF-β3. In one aspect, the humanized antibodies of the present invention specifically bind to and neutralize TGF-β1 and do not recognize and / or do not neutralize TGF-β2 or TGF-β3.

[0013] The antibodies of the present invention have diagnostic and therapeutic uses in cancer and immune regulation, including modulation of immune responses to cancer and cancer vaccines. In a further aspect, the antibodies of the present invention have diagnostic and therapeutic uses in fibrotic conditions and fibrotic diseases. The antibodies of the present invention can be used to characterize and modulate the activity of TGF-β1, in particular to neutralize TGF-β1 activity.

[0014] In a further aspect, the present invention provides an antibody or fragment thereof, in particular a humanized antibody or fragment thereof, which recognizes TGF-β1 and is selected from the group consisting of antibody LCR13A1-2A comprising a heavy chain sequence LCR13A1_VH_Glv3 (SEQ ID NO: 19) and a light chain sequence LCR13A1_VK_GLv3 (SEQ ID NO: 26); antibody LCR13A1-2B comprising a heavy chain sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) and a light chain sequence LCR13A1_VK_GLv3 (SEQ ID NO: 26); antibody LCR13A1-2C comprising a heavy chain sequence LCR13A1_VH_Glv3 (SEQ ID NO: 19) and a light chain sequence LCR13A1_VK_GLv1_03 (SEQ ID NO: 23); antibody LCR13A1-2C comprising a heavy chain sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) and a light chain sequence LCR13A1_VK_GLv3 (SEQ ID NO: 23); NO: 18) and the light chain sequence LCR13A1_VK_GLv1_03 (SEQ ID NO: 23); LCR13A1-2E comprising the heavy chain sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) and the light chain sequence LCR13A1_VK_GLv1_04 (SEQ ID NO: 24); LCR13A1-2F comprising the heavy chain sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) and the light chain sequence LCR13A1_VK_GLv1_05 (SEQ ID NO: 25); LCR13A1-2F comprising the heavy chain sequence LCR13A1_VH_Glv1_02 (SEQ ID NO: 17) and the light chain sequence LCR13A1_VK_GLv1_02 (SEQ ID NO: 26). NO: 22); LCR13A1-2G comprising the heavy chain sequence LCR13A1_VH_Glv1_02 (SEQ ID NO: 17) and the light chain sequence LCR13A1_VK_GLv1_03 (SEQ ID NO: 23); LCR13A1-2I comprising the heavy chain sequence LCR13A1_VH_Glv1_02 (SEQ ID NO: 17) and the light chain sequence LCR13A1_VK_GLv1_04 (SEQ ID NO: 24); LCR13A1-2J comprising the heavy chain sequence LCR13A1_VH_Glv1_02 (SEQ ID NO: 17) and the light chain sequence LCR13A1_VK_GLv1_05 (SEQ ID NO: 25);LCR13A1-AF comprising the light chain sequence LCR13A1_VK_GLv3_02 (SEQ ID NO: 52) and the heavy chain sequence LCR13A1_VH_Glv1_04 (SEQ ID NO: 57); LCR13A1-AG comprising the light chain sequence LCR13A1_VK_GLv3_02 (SEQ ID NO: 52) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58); LCR13A1-AH comprising the light chain sequence LCR13A1_VK_GLv3_02 (SEQ ID NO: 52) and the heavy chain sequence LCR13A1_VH_Glv1_06 (SEQ ID NO: 59); LCR13A1-VK_GLv3_03 comprising the light chain sequence LCR13A1_VK_GLv3_04 (SEQ ID NO: 52) and the heavy chain sequence LCR13A1_VH_Glv1_06 (SEQ ID NO: 59); NO: 53) and a heavy chain sequence selected from LCR13A1_VH_Glv1_04 (SEQ ID NO: 57); LCR13A1-BF comprising the light chain sequence LCR13A1_VK_GLv1_06 (SEQ ID NO: 53) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58); LCR13A1-BG comprising the light chain sequence LCR13A1_VK_GLv1_06 (SEQ ID NO: 53) and the heavy chain sequence LCR13A1_VH_Glv1_06 (SEQ ID NO: 59); LCR13A1-BH comprising the light chain sequence LCR13A1_VK_GLv1_07 (SEQ ID NO: 54) and the heavy chain sequence LCR13A1_VH_Glv1_04 (SEQ ID NO: NO: 57); LCR13A1-CF comprising the light chain sequence LCR13A1_VK_GLv1_07 (SEQ ID NO: 54) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58); LCR13A1-CH comprising the light chain sequence LCR13A1_VK_GLv1_07 (SEQ ID NO: 54) and the heavy chain sequence LCR13A1_VH_Glv1_06 (SEQ ID NO: 59); LCR13A1-DF comprising the light chain sequence LCR13A1_VK_GLv1_08 (SEQ ID NO: 55) and the heavy chain sequence LCR13A1_VH_Glv1_04 (SEQ ID NO: 57); LCR13A1-VK_GLv1_09 (SEQ ID NO: 56) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 57); LCR13A1-VK_GLv1_08 (SEQ ID NO: 57) and the heavy chain sequence LCR13A1_VH_Glv1_06 (SEQ ID NO: 59); LCR13A1-VK_GLv1_09 (SEQ ID NO: 56) and the heavy chain sequence LCR13A1_VH_Glv1_07 (SEQ ID NO: 56) NO: 55) and LCR13A1-DG of the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58);LCR13A1-DH comprising the light chain sequence LCR13A1_VK_GLv1_08 (SEQ ID NO: 55) and the heavy chain sequence LCR13A1_VH_Glv1_06 (SEQ ID NO: 59); LCR13A1-EF comprising the light chain sequence LCR13A1_VK_GLv1_09 (SEQ ID NO: 56) and the heavy chain sequence LCR13A1_VH_Glv1_04 (SEQ ID NO: 57); LCR13A1-EG comprising the light chain sequence LCR13A1_VK_GLv1_09 (SEQ ID NO: 56) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58); and LCR13A1-VK_GLv1_09 (SEQ ID NO: 57) comprising the light chain sequence LCR13A1_VK_GLv1_09 (SEQ ID NO: 57) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58). NO:56) and LCR13A1-EH of the heavy chain LCR13A1_VH_Glv1_06 (SEQ ID NO:59). ;

[0015] In a specific aspect, the present invention provides an antibody or an active fragment thereof, which specifically recognizes and neutralizes TGF-β1 and is selected from the group consisting of antibody LCR13A1-2A comprising a heavy chain sequence LCR13A1_VH_Glv3 (SEQ ID NO: 19) and a light chain sequence LCR13A1_VK_GLv3 (SEQ ID NO: 26); antibody LCR13A1-2B comprising a heavy chain sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) and a light chain sequence LCR13A1_VK_GLv3 (SEQ ID NO: 26); antibody LCR13A1-2C comprising a heavy chain sequence LCR13A1_VH_Glv3 (SEQ ID NO: 19) and a light chain sequence LCR13A1_VK_GLv1_03 (SEQ ID NO: 23); antibody LCR13A1-2C comprising a heavy chain sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) and a light chain sequence LCR13A1_VK_GLv3 (SEQ ID NO: 23); NO: 18) and the light chain sequence LCR13A1_VK_GLv1_03 (SEQ ID NO: 23); LCR13A1-2E comprising the heavy chain sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) and the light chain sequence LCR13A1_VK_GLv1_04 (SEQ ID NO: 24); LCR13A1-2F comprising the heavy chain sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) and the light chain sequence LCR13A1_VK_GLv1_05 (SEQ ID NO: 25); LCR13A1-2F comprising the heavy chain sequence LCR13A1_VH_Glv1_02 (SEQ ID NO: 17) and the light chain sequence LCR13A1_VK_GLv1_02 (SEQ ID NO: 26). NO: 22); LCR13A1-2G comprising the heavy chain sequence LCR13A1_VH_Glv1_02 (SEQ ID NO: 17) and the light chain sequence LCR13A1_VK_GLv1_03 (SEQ ID NO: 23); LCR13A1-2I comprising the heavy chain sequence LCR13A1_VH_Glv1_02 (SEQ ID NO: 17) and the light chain sequence LCR13A1_VK_GLv1_04 (SEQ ID NO: 24); LCR13A1-2J comprising the heavy chain sequence LCR13A1_VH_Glv1_02 (SEQ ID NO: 17) and the light chain sequence LCR13A1_VK_GLv1_05 (SEQ ID NO: 25); LCR13A1-2J comprising the heavy chain sequence LCR13A1_VH_Glv1_02 (SEQ ID NO: 17) and the light chain sequence LCR13A1_VK_GLv1_05 (SEQ ID NO: 25); LCR13A1-2 NO: 52) and LCR13A1-AF of the heavy chain sequence LCR13A1_VH_Glv1_04 (SEQ ID NO: 57);LCR13A1-AG comprising the light chain sequence LCR13A1_VK_GLv3_02 (SEQ ID NO: 52) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58); LCR13A1-AH comprising the light chain sequence LCR13A1_VK_GLv3_02 (SEQ ID NO: 52) and the heavy chain sequence LCR13A1_VH_Glv1_06 (SEQ ID NO: 59); LCR13A1-BF comprising the light chain sequence LCR13A1_VK_GLv1_06 (SEQ ID NO: 53) and a heavy chain sequence selected from LCR13A1_VH_Glv1_04 (SEQ ID NO: 57); LCR13A1-VK_GLv1_06 (SEQ ID NO: 54) and the heavy chain sequence selected from LCR13A1_VH_Glv1_05 (SEQ ID NO: 56); LCR13A1-VK_GLv1_06 (SEQ ID NO: 55) NO: 53) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58); LCR13A1-BG comprising the light chain sequence LCR13A1_VK_GLv1_06 (SEQ ID NO: 53) and the heavy chain sequence LCR13A1_VH_Glv1_06 (SEQ ID NO: 59); LCR13A1-CF comprising the light chain sequence LCR13A1_VK_GLv1_07 (SEQ ID NO: 54) and the heavy chain sequence LCR13A1_VH_Glv1_04 (SEQ ID NO: 57); LCR13A1-VK_GLv1_07 (SEQ ID NO: 54) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: NO: 58); LCR13A1-CH comprising the light chain sequence LCR13A1_VK_GLv1_07 (SEQ ID NO: 54) and the heavy chain sequence LCR13A1_VH_Glv1_06 (SEQ ID NO: 59); LCR13A1-DF comprising the light chain sequence LCR13A1_VK_GLv1_08 (SEQ ID NO: 55) and the heavy chain sequence LCR13A1_VH_Glv1_04 (SEQ ID NO: 57); LCR13A1-DG comprising the light chain sequence LCR13A1_VK_GLv1_08 (SEQ ID NO: 55) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58); LCR13A1-VK_GLv1_08 (SEQ ID NO: 55) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58); LCR13A1-VK_GLv1_08 (SEQ ID NO: 56) and the heavy chain sequence LCR13A1_VH_Glv1_06 (SEQ ID NO: 57); LCR13A1-VK_GLv1_08 (SEQ ID NO: 56) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: NO: 55) and LCR13A1-DH of the heavy chain sequence LCR13A1_VH_Glv1_06 (SEQ ID NO: 59);LCR13A1-EF comprises the light chain sequence LCR13A1_VK_GLv1_09 (SEQ ID NO: 56) and the heavy chain sequence LCR13A1_VH_Glv1_04 (SEQ ID NO: 57); LCR13A1-EG comprises the light chain sequence LCR13A1_VK_GLv1_09 (SEQ ID NO: 56) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58); and LCR13A1-EH comprises the light chain sequence LCR13A1_VK_GLv1_09 (SEQ ID NO: 56) and the heavy chain sequence LCR13A1_VH_Glv1_06 (SEQ ID NO: 59).

[0016] In a further aspect, the present invention provides an antibody or an active fragment thereof, which specifically recognizes and neutralizes TGF-β1 and is selected from the antibody LCR130A1-2B comprising the heavy chain sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) and the light chain sequence LCR13A1_VK_GLv3 (SEQ ID NO: 26); LCR13A1-2E comprising the heavy chain sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) and the light chain sequence LCR13A1_VK_GLv1_04 (SEQ ID NO: 24); and LCR13A1-2F comprising the heavy chain sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) and the light chain sequence LCR13A1_VK_GLv1_05 (SEQ ID NO: 25). In a further aspect, the present invention provides an antibody or an active fragment thereof, which specifically recognizes and neutralizes TGF-β1 and is selected from the antibody LCR130A1-2B comprising the heavy chain sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) and the light chain sequence LCR13A1_VK_GLv3 (SEQID NO: 26); and LCR13A1-2F comprising the heavy chain sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) and the light chain sequence LCR13A1_VK_GLv1_05 (SEQ ID NO: 25).

[0017] In another aspect, the present invention provides an antibody or an active fragment thereof that specifically recognizes and neutralizes TGF-β1, wherein the antibody or active fragment is a mutant variant of the antibody LCR13A1-2B or LCR13A1-2F. In one aspect, the antibody or active fragment is selected from LCR13A1-AF comprising the light chain sequence LCR13A1_VK_GLv3_02 (SEQ ID NO: 52) and the heavy chain sequence LCR13A1_VH_Glv1_04 (SEQ ID NO: 57); LCR13A1-AG comprising the light chain sequence LCR13A1_VK_GLv3_02 (SEQ ID NO: 52) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58); LCR13A1-AH comprising the light chain sequence LCR13A1_VK_GLv3_02 (SEQ ID NO: 52) and the heavy chain sequence LCR13A1_VH_Glv1_06 (SEQ ID NO: 59); LCR13A1-VK_GLv3_03 (SEQ ID NO: 53) and the heavy chain sequence LCR13A1_VH_Glv1_07 (SEQ ID NO: 58). NO: 53) and a heavy chain sequence selected from LCR13A1_VH_Glv1_04 (SEQ ID NO: 57); LCR13A1-BF comprising the light chain sequence LCR13A1_VK_GLv1_06 (SEQ ID NO: 53) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58); LCR13A1-BH comprising the light chain sequence LCR13A1_VK_GLv1_06 (SEQ ID NO: 53) and the heavy chain sequence LCR13A1_VH_Glv1_06 (SEQ ID NO: 59); LCR13A1_VK_GLv1_07 (SEQ ID NO: 54) and the heavy chain sequence LCR13A1_VH_Glv1_04 (SEQ ID NO: NO: 57); LCR13A1-CF comprising the light chain sequence LCR13A1_VK_GLv1_07 (SEQ ID NO: 54) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58); LCR13A1-CH comprising the light chain sequence LCR13A1_VK_GLv1_07 (SEQ ID NO: 54) and the heavy chain sequence LCR13A1_VH_Glv1_06 (SEQ ID NO: 59); LCR13A1-DF comprising the light chain sequence LCR13A1_VK_GLv1_08 (SEQ ID NO: 55) and the heavy chain sequence LCR13A1_VH_Glv1_04 (SEQ ID NO: 57);LCR13A1-DG comprising the light chain sequence LCR13A1_VK_GLv1_08 (SEQ ID NO: 55) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58); LCR13A1-DH comprising the light chain sequence LCR13A1_VK_GLv1_08 (SEQ ID NO: 55) and the heavy chain sequence LCR13A1_VH_Glv1_06 (SEQ ID NO: 59); LCR13A1-EF comprising the light chain sequence LCR13A1_VK_GLv1_09 (SEQ ID NO: 56) and the heavy chain sequence LCR13A1_VH_Glv1_04 (SEQ ID NO: 57); LCR13A1-VK_GLv1_09 (SEQ ID NO: 57) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58); NO: 56) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58); and LCR13A1-EH comprising the light chain sequence LCR13A1_VK_GLv1_09 (SEQ ID NO: 56) and the heavy chain sequence LCR13A1_VH_Glv1_06 (SEQ ID NO: 59). ;

[0018] In another aspect, the present invention provides an antibody or an active fragment thereof that specifically recognizes TGF-β1, comprising the heavy chain 13A1_VH_Glv_02 (SEQ ID NO: 17). In one such aspect, the antibody further comprises a light chain sequence selected from the group consisting of 13A1_VK_GLv1_02 (A) (SEQ ID NO: 22), 13A1_VK_GLv1_03 (B) (SEQ ID NO: 23), 13A1_VK_GLv1_04 (C) (SEQ ID NO: 24), and 13A1_VK_GLv1_05 (D) (SEQ ID NO: 25). In one aspect, the antibody or active fragment is selected from LCR13A1-2G comprising the heavy chain sequence LCR13A1_VH_Glv1_02 (SEQ ID NO: 17) and the light chain sequence LCR13A1_VK_GLv1_02 (SEQ ID NO: 22); LCR13A1-2H comprising the heavy chain sequence LCR13A1_VH_Glv1_02 (SEQ ID NO: 17) and the light chain sequence LCR13A1_VK_GLv1_03 (SEQ ID NO: 23); LCR13A1-2I comprising the heavy chain sequence LCR13A1_VH_Glv1_02 (SEQ ID NO: 17) and the light chain sequence LCR13A1_VK_GLv1_04 (SEQ ID NO: 24); and LCR13A1-2H comprising the heavy chain sequence LCR13A1_VH_Glv1_02 (SEQ ID NO: 17) and the light chain sequence LCR13A1_VK_GLv1_05 (SEQ ID NO: 26). NO: 17) and LCR13A1-2J of the light chain sequence LCR13A1_VK_GLv1_05 (SEQ ID NO: 25).

[0019] The binding of an antibody to its target antigen is mediated through the complementarity determining regions (CDRs) of its heavy and light chains. Thus, specific binding members based on the CDR regions of the heavy or light chain, or both the heavy and light chains, of the antibodies of the invention, particularly including any of antibodies 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG, and 13A1-EH, will be useful specific binding members for therapy and / or diagnosis. In one aspect, the present invention provides a TGF-β1 antibody capable of binding to and neutralizing TGF-β1, comprising a TGF-β1 antibody as provided herein and Figure 7 、 8and 26. In a specific aspect, the present invention provides a TGF-β1-specific antibody capable of specifically binding to and neutralizing TGF-β1, wherein the antibody does not bind to or neutralize TGF-β2 or TGF-β3, the antibody comprising the light chain and heavy chain variable region CDR1, CDR2 and CDR3 sequences as provided herein and Figure 7 、 8 and 26 for the light and heavy chain variable region CDR1, CDR2, and CDR3 sequences.

[0020] In one aspect, a TGF-β1-specific antibody capable of specifically binding to and neutralizing TGF-β1 is provided, wherein the antibody does not bind to or neutralize TGF-β2 or TGF-β3, and wherein the antibody comprises the heavy chain variable region sequence set forth in SEQ ID NO: 61. In one aspect, the TGF-β1-specific antibody further comprises the light chain variable region sequence set forth in SEQ ID NO: 60. In one aspect, a TGF-β1-specific antibody capable of specifically binding to and neutralizing TGF-β1 is provided, wherein the antibody does not bind to or neutralize TGF-β2 or TGF-β3, and wherein the antibody comprises the light chain variable region sequence set forth in SEQ ID NO: 60. In one aspect, a TGF-β1-specific antibody capable of specifically binding to and neutralizing TGF-β1 is provided, wherein the antibody does not bind to or neutralize TGF-β2 or TGF-β3, and wherein the antibody comprises the heavy chain variable region sequence set forth in SEQ ID NO: 61 and the light chain variable region sequence set forth in SEQ ID NO: 60.

[0021] In one such aspect, an antibody is provided, comprising a heavy chain variable region CDR comprising a CDR1 sequence TNYWMH (SEQ ID NO:27), NYWMH (SEQ ID NO:64), or NYWTH (SEQ ID NO:65); a CDR2 sequence TIYPGNSDTNYNQKFK (SEQ ID NO:28) or TIYPGNSDTNYNQKFQ (SEQ ID NO:29); and a CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO:9), EDSRSLNFNGWDYFDY (SEQ ID NO:67), EDSRSLYYNGWDYFDH (SEQ ID NO:68), or EDSRSLNFNGWDYFDH (SEQ ID NO:69). In one aspect, an antibody is provided, comprising a heavy chain variable region CDR comprising a CDR1 sequence TNYWMH (SEQ ID NO: 27), NYWMH (SEQ ID NO: 64) or NYWTH (SEQ ID NO: 65); a CDR2 sequence TIYPGNSDTNYNQKFK (SEQ ID NO: 28), TIYPGNSDTNYNQKFQ (SEQ ID NO: 29) or TIYPGNSDTNYNQKFKD (SEQ ID NO: 75); and a CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9), EDSRSLNFNGWDYFDY (SEQ ID NO: 67), EDSRSLYYNGWDYFDH (SEQ ID NO: 68) or EDSRSLNFNGWDYFDH (SEQ ID NO: 69). In one such aspect, an antibody is provided that comprises a heavy chain variable region CDR comprising a CDR1 sequence TNYWMH (SEQ ID NO: 27), a CDR2 sequence TIYPGNSDTNYNQKFK (SEQ ID NO: 28) or TIYPGNSDTNYNQKFQ (SEQ ID NO: 29), and a CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9).In one aspect, a TGF-β1-specific antibody is provided, which comprises a heavy chain variable region CDR, wherein the heavy chain variable region CDR includes a CDR1 sequence NYWTH (SEQ ID NO: 65); a CDR2 sequence TIYPGNSDTN (SEQ ID NO: 8), IYPGNSDT (SEQ ID NO: 11), TIYPGNSDTNYNQKFK (SEQ ID NO: 28) or TIYPGNSDTNYNQKFQ (SEQ ID NO: 29); and a CDR3 sequence EDSRSLNFNGWDYFDY (SEQ ID NO: 67), EDSRSLYYNGWDYFDH (SEQ ID NO: 68) or EDSRSLNFNGWDYFDH (SEQ ID NO: 69). In one aspect, a TGF-β1-specific antibody is provided, which comprises a heavy chain variable region CDR, wherein the heavy chain variable region CDR includes a CDR1 sequence NYWTH (SEQ ID NO: 65); a CDR2 sequence TIYPGNSDTN (SEQ ID NO: 8), IYPGNSDT (SEQ ID NO: 11), TIYPGNSDTNYNQKFK (SEQ ID NO: 28), TIYPGNSDTNYNQKFQ (SEQ ID NO: 29) or TIYPGNSDTNYNQKFKD (SEQ ID NO: 75); and a CDR3 sequence EDSRSLNFNGWDYFDY (SEQ ID NO: 67), EDSRSLYYNGWDYFDH (SEQ ID NO: 68) or EDSRSLNFNGWDYFDH (SEQ ID NO: 69). In one aspect, a TGF-β1 antibody is provided, comprising a heavy chain variable region CDR comprising a CDR1 sequence NYWMH (SEQ ID NO: 64) or NYWTH (SEQ ID NO: 65), a CDR2 sequence TIYPGNSDTNYNQKFK (SEQ ID NO: 28) or TIYPGNSDTNYNQKFQ (SEQ ID NO: 29), and a CDR3 sequence EDSRSLY / NY / FNGWDYFDY / H (SEQ ID NO: 66).

[0022] In a further aspect, an antibody is provided, comprising a light chain variable region CDR comprising a CDR1 sequence of RASESVDNYGISFLN (SEQ ID NO: 30), KSSESVDNYGISFLN (SEQ ID NO: 70), or RASESVDNYGISLLN (SEQ ID NO: 72); a CDR2 sequence of AASNQGS (SEQ ID NO: 31), and a CDR3 sequence of QQSKEVPRT (SEQ ID NO: 14) or QQSKEVPR (SEQ ID NO: 73). In another such further aspect, an antibody is provided, comprising a light chain variable region CDR comprising a CDR1 sequence of RASESVDNYGISFLN (SEQ ID NO: 30), a CDR2 sequence of AASNQGS (SEQ ID NO: 31), and a CDR3 sequence of QQSKEVPRT (SEQ ID NO: 14). In one aspect, a TGF-β1-specific antibody is provided, comprising a light chain variable region CDR comprising a CDR1 sequence of KSSESVDNYGISFLN (SEQ ID NO: 70), a CDR2 sequence of AASNQGS (SEQ ID NO: 31), and a CDR3 sequence of QQSKEVPRT (SEQ ID NO: 14) or QQSKEVPR (SEQ ID NO: 73). In another aspect, an antibody is provided, comprising a light chain variable region CDR comprising a CDR1 sequence of RASESVDNYGISF / LLN (SEQ ID NO: 71), a CDR2 sequence of AASNQGS (SEQ ID NO: 31), and a CDR3 sequence of QQSKEVPRT (SEQ ID NO: 14) or QQSKEVPR (SEQ ID NO: 73). In another aspect, an antibody is provided, comprising a light chain variable region CDR comprising a CDR1 sequence K / RS / ASESVDNYGISF / LLN (SEQ ID NO: 74), a CDR2 sequence AASNQGS (SEQ ID NO: 31), and a CDR3 sequence QQSKEVPRT (SEQ ID NO: 14) or QQSKEVPR (SEQ ID NO: 73).

[0023] The present invention provides an antibody against TGF-β1, comprising a heavy chain variable region sequence comprising a CDR1 sequence of TNYWMH (SEQ ID NO: 27), a CDR2 sequence of TIYPGNSDTNYNQKFK (SEQ ID NO: 28), and a CDR3 sequence of EDSRSLYYNGWDYFDY (SEQ ID NO: 9); or a CDR1 sequence of TNYWMH (SEQ ID NO: 27), a CDR2 sequence of TIYPGNSDTNYNQKFQ (SEQ ID NO: 29), and a CDR3 sequence of EDSRSLYYNGWDYFDY (SEQ ID NO: 9). In one aspect, the present invention provides an antibody further comprising a light chain variable region sequence comprising a CDR1 sequence of RASESVDNYGISFLN (SEQ ID NO: 30), a CDR2 sequence of AASNQGS (SEQ ID NO: 31), and a CDR3 sequence of QQSKEVPRT (SEQ ID NO: 14).

[0024] The present invention provides a TGF-β1 antibody or a fragment thereof, wherein the antibody or fragment comprises a heavy chain variable region sequence, wherein the heavy chain variable region sequence comprises a CDR1 sequence NYWTH (SEQ ID NO: 65); a CDR2 sequence selected from TIYPGNSDTNYNQKFK (SEQ ID NO: 28) and TIYPGNSDTNYNQKFQ (SEQ ID NO: 29); and a CDR3 sequence selected from EDSRSLNFNGWDYFDY (SEQID NO: 67), EDSRSLYYNGWDYFDH (SEQ ID NO: 68), and EDSRSLNFNGWDYFDH (SEQ ID NO: 69). The present invention provides a TGF-β1 antibody or a fragment thereof, wherein the antibody or fragment comprises a heavy chain variable region sequence, wherein the heavy chain variable region sequence comprises a CDR1 sequence NYWTH (SEQ ID NO: 65); a CDR2 sequence selected from TIYPGNSDTNYNQKFK (SEQ ID NO: 28), TIYPGNSDTNYNQKFQ (SEQ ID NO: 29) and TIYPGNSDTNYNQKFKD (SEQ ID NO: 75); and a CDR3 sequence selected from EDSRSLNFNGWDYFDY (SEQ ID NO: 67), EDSRSLYYNGWDYFDH (SEQ ID NO: 68), EDSRSLNFNGWDYFDH (SEQ ID NO: 69). The present invention provides a TGF-β1 antibody or fragment thereof, wherein the antibody or fragment comprises a heavy chain variable region sequence comprising a CDR1 sequence NYWTH (SEQ ID NO: 65); a CDR2 sequence selected from the group consisting of TIYPGNSDTNYNQKFK (SEQ ID NO: 28), TIYPGNSDTNYNQKFQ (SEQ ID NO: 29), and TIYPGNSDTNYNQKFKD (SEQ ID NO: 75); and a CDR3 sequence selected from the group consisting of EDSRSLYYNGWDYFDY (SEQ ID NO: 9), EDSRSLNFNGWDYFDY (SEQ ID NO: 67), EDSRSLYYNGWDYFDH (SEQ ID NO: 68), and EDSRSLNFNGWDYFDH (SEQ ID NO: 69). In one aspect, the antibody or fragment comprises a heavy chain variable region sequence of SEQ ID NO: 58 or SEQ ID NO: 59. In one aspect, the antibody or fragment specifically binds to and neutralizes TGF-β1 and does not bind to or react with TGF-β2 or TGF-β3.In a further aspect, the antibody or fragment further comprises a light chain variable region comprising a CDR1 sequence selected from the group consisting of KSSESVDNYGISFLN (SEQ ID NO: 70), RASESVDNYGISFLN (SEQ ID NO: 30), and RASESVDNYGISLLN (SEQ ID NO: 72); a CDR2 sequence AASNQGS (SEQ ID NO: 31); and a CDR3 sequence QQSKEVPRT (SEQ ID NO: 14) or QQSKEVPR (SEQ ID NO: 73). In one aspect, the antibody further comprises a light chain variable region sequence selected from the group consisting of SEQ ID NO: 22, 25, 26, 52, 53, 54, 55, or 56. In one aspect, the antibody or fragment specifically binds to and neutralizes TGF-β1 and does not bind to or react with TGF-β2 or TGF-β3.

[0025] In a specific aspect, the isolated antibody or fragment of the invention neutralizes TGF-β1. In a specific aspect, the isolated antibody or fragment of the invention does not react with TGF-β2 or TGF-β3. In one aspect, the isolated antibody or fragment preferentially recognizes and binds to TGFβ1, including wherein the antibody or fragment binds to TGF-β1 with greater specificity than to TGF-β2 or TGF-β3.

[0026] In one aspect, the present invention provides an antibody that is specific for TGF-β1 and neutralizes TGF-β1, wherein the antibody does not bind to or neutralize TGF-β2 or TGF-β3, and the antibody comprises a heavy chain variable region sequence comprising a CDR1 sequence TNYWMH (SEQ ID NO:27), NYWMH (SEQ ID NO:64), or NYWTH (SEQ ID NO:65); a CDR2 sequence TIYPGNSDTNYNQKFK (SEQ ID NO:28) or TIYPGNSDTNYNQKFQ (SEQ ID NO:29); and a CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO:9), EDSRSLNFNGWDYFDY (SEQ ID NO:67), EDSRSLYYNGWDYFDH (SEQ ID NO:68), or EDSRSLNFNGWDYFDH (SEQ ID NO:69). In one aspect, the present invention provides an antibody that is specific for and neutralizes TGF-β1, wherein the antibody does not bind to or neutralize TGF-β2 or TGF-β3, and the antibody comprises a heavy chain variable region sequence comprising a CDR1 sequence TNYWMH (SEQ ID NO: 27), NYWMH (SEQ ID NO: 64), or NYWTH (SEQ ID NO: 65); a CDR2 sequence TIYPGNSDTNYNQKFK (SEQ ID NO: 28), TIYPGNSDTNYNQKFQ (SEQ ID NO: 29), or TIYPGNSDTNYNQKFKD (SEQ ID NO: 75); and a CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9), EDSRSLNFNGWDYFDY (SEQ ID NO: 67), EDSRSLYYNGWDYFDH (SEQ ID NO: 68), or EDSRSLNFNGWDYFDH (SEQ ID NO: 69).In one aspect, the present invention provides an antibody that is specific for and neutralizes TGF-β1, wherein the antibody does not bind to or neutralize TGF-β2 or TGF-β3, and the antibody comprises a heavy chain variable region sequence, wherein the heavy chain variable region sequence comprises a CDR1 sequence TNYWMH (SEQ ID NO: 27), a CDR2 sequence TIYPGNSDTNYNQKFK (SEQ ID NO: 28), and a CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9); or a CDR1 sequence TNYWMH (SEQ ID NO: 27), a CDR2 sequence TIYPGNSDTNYNQKFQ (SEQ ID NO: 29), and a CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9). In one aspect, the present invention provides an antibody that specifically targets and neutralizes TGF-β1, wherein the antibody does not bind to or neutralize TGF-β2 or TGF-β3, and the antibody comprises a heavy chain variable region sequence and a light chain variable region sequence, wherein the heavy chain variable region sequence comprises the CDR1 sequence TNYWMH (SEQ ID NO: 27), the CDR2 sequence TIYPGNSDTNYNQKFK (SEQ ID NO: 28), and the CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9); or the CDR1 sequence TNYWMH (SEQ ID NO: 27), the CDR2 sequence TIYPGNSDTNYNQKFQ (SEQ ID NO: 29), and the CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9), and the light chain variable region sequence comprises the CDR1 sequence RASESVDNYGISFLN (SEQ ID NO: 30), the CDR2 sequence AASNQGS (SEQ ID NO: 31), and the CDR3 sequence QQSKEVPRT (SEQ ID NO: 14). In one aspect, the antibody comprises a variable region sequence that is humanized or altered or modified to increase its similarity to an antibody produced naturally by a person. In one aspect, the antibody comprises a variable region sequence that is humanized or altered or modified in the framework regions to increase its similarity to an antibody produced naturally by a person.

[0027] In a further aspect, the present invention provides an antibody, in particular a humanized antibody, comprising a heavy chain variable region sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) or a variant thereof, said variant having at least 90% amino acid identity with the heavy chain variable region sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) or comprising Figure 7In one aspect, the invention provides a humanized antibody comprising one to three amino acid substitutions in one or more heavy chain CDR regions of a humanized antibody, wherein the variant retains TGF-β1 responsiveness and neutralization, and in one aspect, wherein the variant retains lack of or reduced TGF-β2 and TGF-β3 responsiveness. In a specific aspect, the invention provides a humanized antibody comprising the heavy chain variable region sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18).

[0028] In a further aspect, the present invention provides an antibody, in particular a humanized antibody, comprising a heavy chain variable region sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) or LCR13A1_VH_Glv3 (SEQ ID NO: 19) or a variant thereof, said variant having at least 90% amino acid identity with the heavy chain variable region sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) or LCR13A1_VH_Glv3 (SEQ ID NO: 19) or comprising Figure 7 In one aspect, the invention provides a humanized antibody comprising one to three amino acid substitutions in one or more heavy chain CDR regions of a humanized antibody, wherein the variant retains TGF-β1 responsiveness and neutralization, and in one aspect, wherein the variant retains lack of or reduced TGF-β2 and TGF-β3 responsiveness. In a specific aspect, the invention provides a humanized antibody comprising the heavy chain variable region sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) or LCR13A1_VH_Glv3 (SEQ ID NO: 19).

[0029] In a further aspect, the present invention provides an antibody, in particular a humanized antibody, comprising a heavy chain variable region sequence LCR13A1_VH_Glv1_02 (SEQ ID NO: 17) or a variant thereof, said variant having at least 90% amino acid identity with the heavy chain variable region sequence LCR13A1_VH_Glv1_02 (SEQ ID NO: 17) or comprising Figure 7 In one aspect, the invention provides a humanized antibody comprising one to three amino acid substitutions in one or more heavy chain CDR regions of a humanized antibody, wherein the variant retains TGF-β1 responsiveness and neutralization, and in one aspect, wherein the variant retains lack of or reduced TGF-β2 and TGF-β3 responsiveness. In a specific aspect, the invention provides a humanized antibody comprising the heavy chain variable region sequence LCR13A1_VH_Glv1_02 (SEQ ID NO: 17).

[0030] In another aspect, the present invention provides an antibody, in particular a humanized antibody, comprising a heavy chain variable region sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18), LCR13A1_VH_Glv3 (SEQ ID NO: 19), LCR13A1_VH_Glv1_02 (SEQ ID NO: 17), LCR13A1_VH_Glv1_04 (SEQ ID NO: 57), LCR13A1_VH_Glv1_05 (SEQ ID NO: 58) or LCR13A1_VH_Glv1_06 (SEQ ID NO: 59) or a variant thereof, said variant having a homologous heavy chain variable region sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18), LCR13A1_VH_Glv3 (SEQ ID NO: 19), LCR13A1_VH_Glv1_02 (SEQ ID NO: 17), LCR13A1_VH_Glv1_04 (SEQ ID NO: 57), LCR13A1_VH_Glv1_05 (SEQ ID NO: 58) or LCR13A1_VH_Glv1_06 (SEQ ID NO: 59) or a variant thereof NO: 17), LCR13A1_VH_Glv1_04 (SEQ ID NO: 57), LCR13A1_VH_Glv1_05 (SEQ ID NO: 58) or LCR13A1_VH_Glv1_06 (SEQ ID NO: 59) having at least 90% amino acid identity or comprising Figure 7 or Figure 26 The invention further comprises one to three amino acid substitutions in one or more heavy chain CDR regions of a humanized human leukemia cell line, wherein the variant retains TGF-β1 responsiveness and neutralization, and in one aspect, wherein the variant retains absent or reduced TGF-β2 and TGF-β3 responsiveness.

[0031] In a specific aspect, the present invention provides a humanized antibody comprising a heavy chain variable region sequence selected from the group consisting of LCR13A1_VH_Glv1_03 (SEQ ID NO: 18), LCR13A1_VH_Glv3 (SEQ ID NO: 19), LCR13A1_VH_Glv1_02 (SEQ ID NO: 17), LCR13A1_VH_Glv1_04 (SEQ ID NO: 57), LCR13A1_VH_Glv1_05 (SEQ ID NO: 58) and LCR13A1_VH_Glv1_06 (SEQ ID NO: 59).

[0032] The antibodies of the present invention may comprise a heavy chain variable region CDR domain region sequence comprising a CDR1 sequence TNYWMH (SEQ ID NO: 27), NYWMH (SEQ ID NO: 64) or NYWTH (SEQ ID NO: 65); a CDR2 sequence TIYPGNSDTNYNQKFK (SEQ ID NO: 28) or TIYPGNSDTNYNQKFQ (SEQ ID NO: 29); and a CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9), EDSRSLNFNGWDYFDY (SEQ ID NO: 67), EDSRSLYYNGWDYFDH (SEQ ID NO: 68) or EDSRSLNFNGWDYFDH (SEQ ID NO: 69), and a light chain variable region. The antibodies of the present invention may comprise a heavy chain variable region CDR domain region sequence comprising a CDR1 sequence TNYWMH (SEQ ID NO: 27), NYWMH (SEQ ID NO: 64) or NYWTH (SEQ ID NO: 65); a CDR2 sequence TIYPGNSDTNYNQKFK (SEQ ID NO: 28) or TIYPGNSDTNYNQKFQ (SEQ ID NO: 29); and a CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9), EDSRSLNFNGWDYFDY (SEQ ID NO: 67), EDSRSLYYNGWDYFDH (SEQ ID NO: 68), EDSRSLNFNGWDYFDH (SEQ ID NO: 69) or EDSRSLYYNGW (SEQ ID NO: 76), and a light chain variable region. The antibodies of the present invention may comprise a heavy chain variable region CDR domain region sequence comprising a CDR1 sequence TNYWMH (SEQ ID NO: 27), NYWMH (SEQ ID NO: 64) or NYWTH (SEQ ID NO: 65); a CDR2 sequence TIYPGNSDTNYNQKFK (SEQ ID NO: 28), TIYPGNSDTNYNQKFQ (SEQ ID NO: 29) or TIYPGNSDTNYNQKFKD (SEQ ID NO: 75); and a CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9), EDSRSLNFNGWDYFDY (SEQ ID NO: 67), EDSRSLYYNGWDYFDH (SEQ ID NO: 68) or EDSRSLNFNGWDYFDH (SEQ ID NO: 69), and a light chain variable region.The antibodies of the present invention may comprise a heavy chain variable region CDR domain region sequence comprising a CDR1 sequence TNYWMH (SEQ ID NO: 27), NYWMH (SEQ ID NO: 64) or NYWTH (SEQ ID NO: 65); a CDR2 sequence TIYPGNSDTNYNQKFK (SEQ ID NO: 28), TIYPGNSDTNYNQKFQ (SEQ ID NO: 29) or TIYPGNSDTNYNQKFKD (SEQ ID NO: 75); and a CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9), EDSRSLNFNGWDYFDY (SEQ ID NO: 67), EDSRSLYYNGWDYFDH (SEQ ID NO: 68), EDSRSLNFNGWDYFDH (SEQ ID NO: 69) or EDSRSLYYNGW (SEQ ID NO: 76) and a light chain variable region. The antibodies of the present invention may comprise a heavy chain variable region CDR domain sequence comprising a CDR1 sequence TNYWMH (SEQ ID NO: 27), a CDR2 sequence TIYPGNSDTNYNQKFK (SEQ ID NO: 28) and a CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9); or a CDR1 sequence TNYWMH (SEQ ID NO: 27), a CDR2 sequence TIYPGNSDTNYNQKFQ (SEQ ID NO: 29) and a CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9), and a light chain variable region. The antibody of the present invention may comprise a heavy chain variable region CDR domain sequence comprising a CDR1 sequence TNYWMH (SEQ ID NO: 27), NYWMH (SEQ ID NO: 64) or NYWTH (SEQ ID NO: 65), a CDR2 sequence TIYPGNSDTNYNQKFK (SEQ ID NO: 28) or TIYPGNSDTNYNQKFQ (SEQ ID NO: 29) or TIYPGNSDTNYNQKFKD (SEQ ID NO: 75) and a CDR3 sequence EDSRSLYYNGW (SEQ ID NO: 76), and a light chain variable region.The antibodies of the present invention may comprise a heavy chain variable region CDR domain sequence: CDR1 sequence TNYWMH (SEQ ID NO: 27), CDR2 sequence TIYPGNSDTNYNQKFK (SEQ ID NO: 28), and CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9); or CDR1 sequence TNYWMH (SEQ ID NO: 27), CDR2 sequence TIYPGNSDTNYNQKFQ (SEQ ID NO: 29), and CDR3 sequence EDSRSLYYNGW (SEQ ID NO: 76), and a light chain variable region. In one aspect, the TGF-β1 antibody further comprises a light chain variable region CDR sequence: CDR1 sequence RASESVDNYGISFLN (SEQ ID NO: 30), CDR2 sequence AASNQGS (SEQ ID NO: 31), and CDR3 sequence QQSKEVPRT (SEQ ID NO: 14). In one aspect of the invention, TGF-β1-specific neutralizing antibodies having alternative heavy and light chain CDR sequences compete with each other for TGF-β1 binding.

[0033] In one aspect, the TGF-β1 specific antibody of the present invention comprises the heavy chain variable amino acid SEQ ID NO: 18. In one aspect, the TGF-β1 specific antibody of the present invention comprises the heavy chain variable amino acid SEQ ID NO: 18 or SEQ ID NO: 19. In one aspect, the TGF-β1 specific antibody of the present invention comprises the heavy chain variable amino acid SEQ ID NO: 18, SEQ ID NO: 19 or SEQ ID NO: 17. In one aspect, the TGF-β1 specific antibody of the present invention comprises the heavy chain variable amino acid SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 17, SEQ ID NO: 57, SEQ ID NO: 58 or SEQ ID NO: 59. In a specific aspect, the TGF-β1 antibody of the present invention comprises Figure 12 (SEQ ID NO: 18 and 26) or Figure 13 (SEQ ID NO: 18 and 25), or comprising SEQ ID NO: 19 and 26, SEQ ID NO: 19 and 23, SEQ ID NO: 18 and 23, SEQ ID NO: 18 and 24. In one aspect, the TGF-β1 antibody of the present invention comprises Figure 26In one aspect, the variant TGF-β1 antibody of the present invention comprises the heavy chain and light chain variable region amino acid sequences set forth in SEQ ID NO: 18, SEQ ID NO: 57, SEQ ID NO: 58 or SEQ ID NO: 59 and the light chain variable region amino acid sequences set forth in SEQ ID NO: 26, SEQ ID NO: 52, SEQ ID NO: 25, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55 or SEQ ID NO: 56. In one aspect, the variant TGF-β1 antibody of the present invention comprises the heavy chain or light chain variable region amino acid sequences set forth in SEQ ID NO: 61 and SEQ ID NO: 60. In one aspect, the variant TGF-β1 antibody of the present invention comprises the heavy chain and light chain variable region amino acid sequences set forth in SEQ ID NO: 61 and SEQ ID NO: 60. The TGF-β1 antibody of the present invention may comprise the heavy chain or light chain variable region amino acid sequences set forth in SEQ ID NO: 61 and SEQ ID NO: 60. Figure 12 or 13 or an amino acid sequence having at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% amino acid identity to the heavy chain variable region amino acid sequence and the light chain variable region amino acid sequence set forth in SEQ ID NO: 18 and 26, 18 and 25, 19 and 26, 19 and 23, 18 and 23, or 18 and 24. The TGF-β1 antibody of the present invention may comprise an amino acid sequence having at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% amino acid identity to the heavy chain variable region amino acid sequence set forth in SEQ ID NO: 18 and 26, 18 and 25, 19 and 26, 19 and 23, 18 and 23, or 18 and 24. Figure 26or an amino acid sequence having at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% amino acid identity to a heavy chain variable region amino acid sequence and a light chain variable region amino acid sequence as set forth in SEQ ID NO: 18, 57, 58, or 59 and a light chain variable region amino acid sequence as set forth in SEQ ID NO: 26, 52, 53, 54, 55, or 56. In one aspect, the TGF-β1 antibody of the invention comprises a heavy chain variable region of SEQ ID NO: 17. In a further aspect, the TGF-β1 antibody of the invention comprises a heavy chain variable region of SEQ ID NO: 17 and a light chain variable region of SEQ ID NO: 22, 23, 24, or 25. The TGF-β1-specific antibody of the present invention that is capable of specifically binding to TGF-β1 and not binding to TGF-β2 or TGF-β3 may comprise an amino acid sequence that has at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% amino acid identity with the heavy chain variable region amino acid sequence of SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 17. The TGF-β1-specific antibody of the present invention that is capable of specifically binding to TGF-β1 and not binding to TGF-β2 or TGF-β3 may comprise an amino acid sequence that has at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% amino acid identity with the heavy chain variable region amino acid sequence of SEQ ID NO: 18 or SEQ ID NO: 19. The TGF-β1-specific antibody of the present invention that is capable of specifically binding to TGF-β1 and not binding to TGF-β2 or TGF-β3 may comprise an amino acid sequence that has at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% amino acid identity with the heavy chain variable region amino acid sequence of SEQ ID NO: 18. The TGF-β1-specific antibody of the present invention that is capable of specifically binding to TGF-β1 and not binding to TGF-β2 or TGF-β3 may comprise an amino acid sequence that has at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% amino acid identity with the heavy chain variable region amino acid sequence of SEQ ID NO: 17. The TGF-β1-specific antibody of the present invention that is capable of specifically binding to TGF-β1 and not binding to TGF-β2 or TGF-β3 may comprise an amino acid sequence having at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% amino acid identity with the heavy chain variable amino acid SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 17, SEQ ID NO: 57, SEQ ID NO: 58, or SEQ ID NO: 59.The TGF-β1-specific antibody of the present invention that is capable of specifically binding to TGF-β1 and not binding to TGF-β2 or TGF-β3 can comprise an amino acid sequence that has at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% amino acid identity with the heavy chain variable amino acid sequence of SEQ ID NO: 61. In a further aspect, the TGF-β1-specific antibody of the present invention that is capable of specifically binding to TGF-β1 and not binding to TGF-β2 or TGF-β3 can comprise an amino acid sequence that has at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% amino acid identity with the light chain variable region amino acid sequence of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or SEQ ID NO: 26. In a further aspect, a TGF-β1-specific antibody of the invention that is capable of specifically binding to TGF-β1 and not binding to TGF-β2 or TGF-β3 can comprise an amino acid sequence that is at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identical to the light chain variable region amino acid sequence of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, or SEQ ID NO: 56. In a further aspect, a TGF-β1-specific antibody of the invention that is capable of specifically binding to TGF-β1 and not binding to TGF-β2 or TGF-β3 can comprise an amino acid sequence that is at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identical to the light chain variable region amino acid sequence of SEQ ID NO: 60.

[0034] The TGF-β1-specific antibody of the present invention that is capable of specifically binding to TGF-β1 and not binding to TGF-β2 or TGF-β3 or binding less significantly to TGF-β2 or TGF-β3 may comprise an amino acid sequence that has at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% amino acid identity with the heavy chain variable region amino acid sequence of SEQ ID NO: 18 or SEQ ID NO: 19 and further has at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% amino acid identity with the light chain variable region amino acid sequence of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID NO: 26, in particular SEQ ID NO: 25 or SEQ ID NO: 26. The TGF-β1-specific antibody of the present invention that is capable of specifically binding to TGF-β1 and not binding to TGF-β2 or TGF-β3 or binding less significantly to TGF-β2 or TGF-β3 can comprise an amino acid sequence that has at least 80%, at least 90%, at least 95%, at least 98%, at least 99% amino acid identity with the heavy chain variable region amino acid sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 17, SEQ ID NO: 57, SEQ ID NO: 58 or SEQ ID NO: 59 and further has at least 80%, at least 90%, at least 95%, at least 98%, at least 99% amino acid identity with the light chain variable region amino acid sequence of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55 or SEQ ID NO: 56. The TGF-β1-specific antibody of the present invention that is capable of specifically binding to TGF-β1 and not binding to TGF-β2 or TGF-β3 or binding less significantly to TGF-β2 or TGF-β3 may comprise an amino acid sequence that has at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% amino acid identity with the heavy chain variable region amino acid sequence of SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 17 and further has at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% amino acid identity with the light chain variable region amino acid sequence of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID NO: 26.

[0035] In a specific aspect, the antibodies of the present invention or their active fragments neutralize human and mouse TGF-β1. In one aspect, the antibodies of the present invention neutralize and block TGF-β1-mediated signaling in vivo in a mammal, particularly in a human or mouse. In one aspect, the antibodies of the present invention or their active fragments neutralize and block TGF-β1-mediated signaling in vivo in a mammal, but do not neutralize or block TGF-β2 or TGF-β3 signaling in vivo in a mammal.

[0036] Therefore, specific binding proteins (such as antibodies) based on one or more CDRs of an antibody (particularly including the heavy chain CDRs identified herein) will be useful for targeting TGF-β1, particularly TGF-β1-expressing cells, or TGF-β1 activity in disease or cancer, or in immune responses. Because the target of the antibodies of the invention is specifically TGF-β1 and not TGF-β2 and / or TGF-β3, in one aspect of the invention, the antibodies of the invention do not significantly bind to TGF-β forms or family members other than TGF-β1, and it is expected that the TGF-β1-specific antibodies of the invention will have less toxicity and inflammatory or adverse immune reactions or reactions in cellular targets or in animals, particularly compared to more non-specific TGF-β antibodies, such as pan-TGF-β antibodies that recognize more than one form of TGF-β or all forms of TGF-β.

[0037] In another aspect of the invention, provided herein are one or more antibodies or one or more antigen-binding fragments thereof that compete with an antibody or antigen-binding fragment thereof described herein for binding to TGF-β1 (e.g., human TGF-β1). In a specific embodiment, provided herein are one or more antibodies or one or more antigen-binding fragments thereof that compete with an antibody or antigen-binding fragment thereof described herein for binding to TGF-β1 (e.g., human TGF-β1) to the extent that the antibody or antigen-binding fragment thereof described herein itself competes for binding to TGF-β1 (e.g., human TGF-β1).

[0038] In another specific embodiment, provided herein is a first antibody, or antigen-binding fragment thereof, that competes for binding to TGF-β1 (e.g., human TGF-β1) with an antibody, or antigen-binding fragment thereof, described herein, wherein competition is manifested as a reduction in binding of the first antibody, or antigen-binding fragment thereof, to TGF-β1 (e.g., human TGF-β1) by more than 60% (e.g., 65%, 70%, 75%, 85%, 90%, 95%, or 98%, or between 60% and 65%, 65% and 70%, 70% and 75%, 75% and 80%, 80% and 85%, 85% and 95%, or 95% and 100%). In another specific embodiment, provided herein is a first antibody or antigen-binding fragment thereof that competes with an antibody or antigen-binding fragment thereof described herein for binding to TGF-β1 (e.g., human TGF-β1), wherein competition is exhibited by antibodies 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1- In some embodiments, the binding of one or more antibodies or antigen-binding fragments thereof is reduced by more than 60% (e.g., 65%, 70%, 75%, 85%, 90%, 95%, or 98%, or between 60% and 65%, 65% and 70%, 70% and 75%, 75% and 80%, 80% and 85%, 85% and 95%, or 95% and 100%).

[0039] In specific aspects, provided herein are antibodies comprising (i) comprising Figure 8 or Figure 10 、 11 or Figure 12 、 13 or 26 or SEQ ID NO: 70, 30, 72, 31, 14, 73 set forth in the VL CDR1, VLCDR2 and VL CDR3 of the antibody; and (ii) comprising a VL domain having Figure 7 or Figure 10 、 11 or Figure 12 、 13or 26 or the amino acid sequences of the CDRs of the antibodies set forth in SEQ ID NO: 27, 64, 65, 28, 29, 75, 9, 67, 68, 69, that compete (e.g., in a dose-dependent manner) for specific binding to TGF-β1 (e.g., human TGF-β1).

[0040] In a specific embodiment, provided herein are antibodies comprising the VH CDRs of 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG, or 13A1-EH, particularly SEQ ID NOs: 27, 64, 65, 28, 29, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 101, 102, 111, 112, 113 Antibodies to NOs: 27, 28, and 9 or SEQ ID NOs: 27, 29, and 9 compete (eg, in a dose-dependent manner) for specific binding to TGF-β1 (eg, human TGF-β1). In a specific embodiment, provided herein are antibodies comprising the VL CDRs of 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E or 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG or 13A1-EH, particularly SEQ ID NOs: 70, 30, 72, 31, 14 and 73, particularly SEQ ID NOs: Antibodies Nos. 30, 31, and 14 compete (eg, in a dose-dependent manner) for specific binding to TGF-β1 (eg, human TGF-β1).

[0041] In a specific embodiment, an antibody described herein is an antibody whose specific binding to TGF-β1 (e.g., human TGF-β1) is competitively blocked (e.g., in a dose-dependent manner) by an antibody comprising a VH domain having the amino acid sequence of SEQ ID NO: 18 or SEQ ID NO: 19. In a specific embodiment, an antibody described herein is an antibody whose specific binding to TGF-β1 (e.g., human TGF-β1) is competitively blocked (e.g., in a dose-dependent manner) by an antibody comprising a VH domain having the amino acid sequence of SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 17. In a specific embodiment, an antibody described herein is an antibody whose specific binding to TGF-β1 (e.g., human TGF-β1) is competitively blocked (e.g., in a dose-dependent manner) by an antibody comprising a VH domain having the amino acid sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 17, SEQ ID NO: 57, SEQ ID NO: 58, or SEQ ID NO: 59. In a specific embodiment, the antibody described herein is an antibody that is competitively blocked (e.g., in a dose-dependent manner) from specific binding to TGF-β1 (e.g., human TGF-β1) by an antibody comprising a VH domain having the amino acid sequence of SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 17 and a VL domain having the amino acid sequence of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID NO: 26. In a specific embodiment, the antibody described herein is an antibody whose specific binding to TGF-β1 (e.g., human TGF-β1) is competitively blocked (e.g., in a dose-dependent manner) by an antibody comprising a VH domain having the amino acid sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 17, SEQ ID NO: 57, SEQ ID NO: 58, or SEQ ID NO: 59 and a VL domain having the amino acid sequence of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, or SEQ ID NO: 56.

[0042] In other aspects, the invention provides isolated nucleic acids comprising sequences encoding specific binding members or antibodies as defined above, and methods for preparing specific binding members or antibodies of the invention comprising expressing the nucleic acid under conditions that result in expression of the binding member or antibody and recovering the binding member or antibody. In one such aspect, there is provided a nucleic acid encoding a specific binding member or antibody as defined above. Figure 7 、 10 , 12, 13 or 26 listed heavy chain amino acid sequence of the antibody variable region sequence, or provides a nucleic acid having Figure 7 or 26 and SEQ ID NO: 27, 28, 29, 9, 64, 65, 67, 68, 69, 75 or Figure 12 In one aspect, an antibody encoding a heavy chain CDR domain sequence as set forth in claim 1 or 13 or 26 is provided. Figure 8 、 10 , 12, 13 or 26 set forth in the light chain amino acid sequence of the antibody light chain variable region, or provides a light chain amino acid sequence as set forth in Figure 8 or 26 and SEQ ID NO: 30, 31, 14, 70, 72, 73 or Figure 8 、 12 , 13 or 26 listed light chain CDR domain sequences. The present invention also relates to recombinant DNA molecules or cloned genes encoding the antibodies of the present invention or degenerate variants thereof; preferably, nucleic acid molecules encoding antibody VH, especially CDR region sequences and optionally additionally encoding VL, especially CFR region sequences, in particular recombinant DNA molecules or cloned genes, which can encode the heavy chain sequence SEQ ID NO: 18 or 19 or 17 or 57, 58 or 59 and the light chain sequence SEQ ID NO: 22, 23, 24, 25 or 26, or 52, 53, 54, 55 or 56, or such heavy chain and light chain variable region sequences (including such as Figure 10 、 12 , 13 and 26).

[0043] The unique specificity and affinity of the antibodies and fragments of the present invention provide diagnostic and therapeutic uses for identifying, characterizing and targeting conditions associated with TGF-β1 expression, activity or activation. Therefore, methods and aspects thereof are provided according to the present invention. In one aspect, antibodies of the present invention that target TGF-β1 can be used to modulate immune responses, including modulating immune responses against cancer, cancer cells or tumor cells, and cancer antigens or tumor antigens. In another aspect, antibodies of the present invention that target TGF-β1 can be used for therapeutic treatment or management of cancer, enhancing anti-cancer immune responses and enhancing cancer vaccines. The antibodies can be used to enhance the therapeutic effects of one or more cancer therapies (including traditional anticancer agents and compounds and cell therapies, including T cell therapies targeting cancer), including anticancer and / or anticellular effects. The antibodies can be used to enhance the therapeutic effects of one or more radiotherapies, including anticancer and / or anticellular effects. In a specific aspect, the antibodies of the present invention can be used to treat, manage and / or prevent cancer, including the recurrence and metastasis of cancer. In one aspect, the TGF-β1 antibodies of the present invention can be used to treat or modulate breast cancer, melanoma, prostate cancer or lung cancer.

[0044] According to the present invention, provided herein are methods for treating, alleviating or modulating cancer, comprising administering an antibody of the present invention or a pharmaceutical composition thereof. In a further aspect, provided are methods for stimulating or enhancing an immune response to a vaccine or antigen, or an immunomodulatory agent or radiotherapy in a mammal, comprising administering an antibody of the present invention or a pharmaceutical composition thereof.

[0045] In one aspect of the present invention, one or more TGF-β antibodies, in particular one or more TGF-β1 neutralizing antibodies as provided herein, in particular humanized antibodies, can be administered in combination with or in a composition of one or more cancer antigens and one or more adjuvants, including administration to a patient to promote more robust initiation and activation of adaptive anti-tumor responses to enhance immunotherapy against cancer. Additional inhibitors of TGFβ activity, such as small molecules, antisense or aptamers, can also be used to inhibit TGFβ activity, including or in particular TGF-β1.

[0046] Thus, in one aspect of the invention, the one or more anti-TGF-β1 antibodies may be administered alone or in combination with other treatments, therapies, or pharmaceutical agents or cell therapies, either simultaneously or sequentially, depending on the condition to be treated. An immunomodulatory agent may be included in a composition having one or more TGF-β1 antibodies or administered together with one or more TGF-β1 antibodies and / or administered at different times to enhance immunomodulation and / or cancer therapy, including immunotherapy or cell therapy for cancer. An immunomodulatory agent may be an adjuvant. In a further aspect, the TGF-β1 antibodies of the invention may also be used as one or more immunostimulants or one or more adjuvants in combination with antigenic materials such as, but not limited to, proteins, peptides, or nucleic acids, in order to generate a protective immune response, such as a T cell or CTL response against the administered antigen.

[0047] The present invention provides a method for improving, promoting or enhancing chimeric antigen receptor (CAR) T cell therapy, comprising administering one or more anti-TGF-β1 antibodies or fragments thereof simultaneously or sequentially with one or more CAR T cells. In one aspect of the method, the one or more anti-TGF-β1 antibodies or fragments thereof are added to the CAR T cell culture before administration or infusion. In one aspect, the one or more anti-TGF-β1 antibodies or fragments thereof, such as scFv thereof, are expressed by or on one or more CAR T cells. In another method of the present invention, one or more anti-TGF-β1 antibodies or fragments thereof are administered in combination with activated T cells or T cells directed against cancer antigens or cell cycle regulators.

[0048] According to the present invention, provided herein are methods for treating, alleviating or regulating fibrotic conditions or fibrotic diseases, comprising administering an antibody of the present invention or its pharmaceutical composition. In one aspect, provided herein are methods for treating, alleviating or regulating conditions or diseases in which extracellular matrix formation is altered, comprising administering an antibody of the present invention or its pharmaceutical composition. In one aspect of these methods, the antibodies of the present invention may be combined or administered in combination with one or more anti-inflammatory agents, immunosuppressants, immune response regulators, antioxidants or anti-fibrotic drugs or agents. In one such aspect, one or more antibodies of the present invention are combined or administered in combination with a treatment for fibrosis. In one such aspect, provided are methods for treating or regulating pulmonary fibrosis. In one aspect, one or more antibodies of the present invention are combined or administered in combination with a fibrotic treatment, particularly selected from nintedanib. and pirfenidone

[0049] As has been shown, TGF-β1 antibodies (including TGF-β1 specific antibodies) are effective both in vitro and in vivo. Thus, one aspect of the present invention relates to stimulating an immune response in a subject by administering one or more TGF-β1 antibodies of the present invention, with or without an antigenic molecule, in an amount sufficient to stimulate a favorable immune response in such subject.

[0050] The present invention includes compositions and / or kits comprising one or more TGF-β1 antibodies of the present invention in combination with one or more immunogenic proteins or peptides. Such compositions include pharmaceutical compositions and immunological compositions. The antibodies or compositions of the present invention can be administered systemically or in a targeted manner, including administration to an affected organ or target organ, administration to a tumor, administration in the region or location of a tumor, or administration directly to a tumor, such as intratumoral injection.

[0051] Antibodies, fragments and recombinant antibodies comprising the CDR domains according to the present invention can be used in methods for treating or diagnosing the human or animal body, such as methods for treating tumors in human patients, the methods comprising administering to the patient an effective amount of the antibody, fragment and recombinant antibody of the present invention. Antibodies, fragments and recombinant antibodies comprising the CDR domains according to the present invention can be used in methods for stimulating or enhancing an immune response to cancer, tumor cells or one or more cancer or tumor antigens in mammals, particularly humans, the methods comprising administering to the mammal an effective amount of the antibody, fragment and recombinant antibody of the present invention. Antibodies, fragments and recombinant antibodies comprising the CDR domains according to the present invention can be used in methods for inhibiting or reducing the recurrence or metastasis of cancer in mammals, particularly humans, the methods comprising administering to the mammal an effective amount of the antibody, fragment and recombinant antibody of the present invention. Antibodies, fragments and recombinant antibodies comprising the CDR domains according to the present invention can be used in methods for inhibiting or blocking stimulation of TGFβ, particularly TGFβ1, in response to radiation or cancer therapy in mammals, particularly humans, the methods comprising administering to the mammal an effective amount of the antibody, fragment and recombinant antibody of the present invention. In one aspect of the method, TGF-β1 specific antibodies, fragments thereof and recombinant antibodies comprising CDR domains according to the invention are administered to a mammal in combination with or subsequent to radiation therapy and / or cancer therapy.

[0052] The therapeutic methods of the present invention are related to the prevention or treatment of cancer, or the stimulation or enhancement of an immune response to cancer, or the inhibition of immune-mediated protection of cancer cells (including melanoma, breast cancer, prostate cancer, and lung cancer). In one aspect of the method, the specific TGF-β1 neutralizing antibodies of the present invention (including active fragments thereof) are used to stimulate or enhance the immune response to cancer (including melanoma, breast cancer, prostate cancer, and lung cancer). In one aspect, one or more specific neutralizing TGF-β1 antibodies or active fragments thereof of the present invention stimulate or enhance the immune response via a cancer vaccine or cancer immunotherapy or via a cell therapy (including radiotherapy) such as cancer-targeted T cell therapy.

[0053] The antibodies of the present invention and in a specific embodiment have Figure 10 、 12 or 13 or 26, or an antibody or an active fragment thereof, and a single chain, recombinant or synthetic antibody derived therefrom (particularly comprising Figure 7 and 8 and 26, and including SEQ ID NO:27,64,65,28,29,75,9,67,68,69 CDR sequence) can be expressed in immune cells (including lymphoid cells, including T cells). In one such aspect, antibodies, or fragments thereof, and single-chain, recombinant or synthetic antibodies derived therefrom are expressed and secreted by lymphoid cells (including T cells). Lymphoid cells such as T cells can be prepared and used for therapy, including immunomodulation, and for cancer therapy. In one aspect, lymphoid cells (such as T cells) expressing one or more TGFβ1 antibodies of the present invention can be further engineered to express another / other one or more proteins, such as receptors. In one aspect, lymphoid cells (such as T cells) expressing one or more TGFβ1 antibodies of the present invention can be combined with lymphoid cells (such as T cells) engineered to express another / other one or more proteins (such as receptors). In one aspect, the receptor is a chimeric antigen receptor (CAR). In one aspect, the receptor is a T cell receptor. In one aspect, the other / other one or more proteins are cancer antigens or tumor antigens or tumor antigen antibodies or fragments thereof or immunomodulatory agents. The present invention provides methods of treatment comprising administering to a mammal lymphoid cells, such as T cells, expressing one or more TGFβ1 antibodies of the present invention. In one aspect, the methods relate to treating cancer or preventing the recurrence or metastasis of cancer. In one aspect, the methods relate to modulating an immune response, including in cancer or cancer therapy.

[0054] The binding members and antibodies of the present invention and in a specific embodiment have Figure 10 、 12or 13 or 26, or an active fragment thereof, and a single chain, recombinant or synthetic antibody derived therefrom (particularly comprising the sequence depicted in Figure 7 and 8 The heavy chain CDR region sequences and light chain CDR region sequences in SEQ ID NO: 27, 64, 65, 28, 29, 75, 9, 67, 68, 69, 70, 30, 72, 31, 14, 73, and 26, as well as CDR sequences including SEQ ID NO: 27, 64, 65, 28, 29, 75, 9, 67, 68, 69, 70, 30, 72, 31, 14, 73) can be prepared in a pharmaceutical composition for administration, the pharmaceutical composition comprising a suitable vehicle, carrier or diluent or comprising an adjuvant and / or an immunomodulator. This pharmaceutical composition can also comprise a means for regulating the half-life of the antibody or fragment by methods known in the art (such as pegylation).

[0055] The pharmaceutical composition of the present invention or immunogenic composition may further include other antibodies or therapeutic agents. In one aspect, such other agents or therapies may be selected from anticancer agents or therapy, antimitotic agents, apoptotic agents or antibodies or immunomodulators or small molecule inhibitors for immunomodulators. More generally, these anticancer agents may be tyrosine kinase inhibitors or phosphorylation cascade inhibitors, post-translational regulators, cell growth or division inhibitors (for example, antimitotic agents), inhibitors or signal transduction inhibitors. The composition may be administered together with an immunomodulator (such as an adjuvant). The composition may also be administered together with other anti-TGFβ antibodies, other immunomodulatory antibodies or other anti-tumor antigen antibodies or may include a combination thereof.

[0056] The diagnostic utility of the present invention extends to the use of the antibodies of the invention in assays (including in vitro and in vivo diagnostic assays) for characterizing tumors or cell samples or screening for tumors or cancers. The antibodies of the invention may carry a detectable label or a functional label. The specific binding member may carry a radioactive label, such as an isotope. 3 H. 14 C. 32 P. 35 S. 36 Cl, 51 Cr, 57 Co、 58 Co、 59 Fe, 90 Y. 121 I. 124 I. 125 I. 131 I. 111 In, 117 Lu, 211 At 198 Au, 67 Cu, 225 Ac, 213 Bi,99 Tc and 186 In one aspect, the label can be an enzyme, including where detection can be accomplished by any of the currently used colorimetric, spectrophotometric, fluorospectrophotometric, amperometric, or gasometric techniques known in the art.

[0057] The immunoconjugates or antibody fusion proteins of the present invention (in which the specific binding members of the present invention, particularly antibodies and fragments thereof, are conjugated or attached to other molecules or agents) further include, but are not limited to, binding members conjugated to chemoablative agents, toxins, immunomodulators, cytokines, cytotoxic agents, chemotherapeutic agents or drugs.

[0058] The present invention includes an assay system that can be prepared in the form of a test kit for quantitative analysis of the extent of the presence of, for example, TGFβ 1. The system or test kit can comprise a labeled component prepared by one of the radioactive and / or enzymatic techniques discussed herein (coupling the label to an antibody) and one or more additional immunochemical reagents, at least one of which is the free or immobilized component or one or more binding partners thereof to be determined.

[0059] Other objects and advantages will become apparent to those skilled in the art from a review of the ensuing detailed description, which proceeds with reference to the following illustrative drawings, and the appended claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 Depicted are the cloned hybridoma murine 13A1 antibody parental VH and VK nucleic acids (denoted as _genscript_DNA) (SEQ ID NOs: 1 and 3) and amino acid sequences (denoted as _genscript_AA) (SEQ ID NOs: 2 and 4).

[0061] Figure 2 ELISA results of LCR13A1_phage and LCR13A1_soluble scFv are plotted, demonstrating that reformatting the murine mAb 13A1 variable domains into scFv retained binding and fine specific recognition for TGFb1 as assessed by ELISA.

[0062] Figure 3The amino acid sequences of the transplanted murine 13A1 (SEQ ID NO: 5) and LCR13A1_Glv1 (SEQ ID NO: 6), along with the IGKV7-3*01 / IGHV1-46*01 transplant, are depicted. The mouse CDR core is in bold; Vernier residues are underlined; and the scFv linker is in italics. The Asn residue present in germline IGKV7-3*01 Fr3 was mutated to Asp to remove a putative N-glycon risk—indicated by a "#" below the amino acid (CLUSTAL O (1.2.1) multiple sequence alignment). Homology: (*) conserved sequence; (:) conservative mutation; (.) semiconservative mutation; () nonconservative mutation.

[0063] Figure 4 ELISA results for the parental soluble scFvs LCR13A1_ScFv and LCR13A_Glv1_scFv are plotted and demonstrate that grafting of murine CDRs into a human framework retains binding and fine specific recognition for TGFb1.

[0064] Figure 5 Depicted are ELISA results against TGFb1, TGFb2, and TGFb3 for the indicated constructs 13A1_murine, 13A1_chimeric, 13A1_Glv1 (grafted), and 1901-murine (1901 is a murine anti-TGFb3 antibody). Reconversion of the grafted variable domains to the full huIgG1 scaffold retained TGFb1 binding and exquisite specific recognition of TGFb1.

[0065] Figure 6 An analysis of potential sequence liabilities in the 13A1 VH* and VH CDR and J regions is provided, and a table lists CDR / linker residues with potential sequence liabilities, their suggested modifications, and the final selected residues based on competitive binding assays. IMGT numbering is used for amino acid residue sequence numbering. *No potential sequence liabilities were identified in VK; **All graft residues were retained as none were considered a risk of heterogeneity and global human homology of the Glv1 graft VH chain was already high.

[0066] Figure 7A summary of the VH chain protein sequences and LCR-hu13A1 CDR grafting for the VH chain is provided. The sequences listed in the table are as follows: murine 13A1 VH protein sequence (SEQ ID NO: 15), LCR13A1_Glv1 (grafted onto the huIgHV1-46*01 framework) (SEQ ID NO: 16), 13A1_VH_Glv1_02 (SEQ ID NO: 17), 13A1_VH_Glv1_03 (SEQ ID NO: 18), and LCR13A1_Glv3 (SEQ ID NO: 19). CDRs are in bold. The LCR13A1_Glv1 variant antibody heavy chain CDR sequences are CDR1TNYWMH (SEQ ID NO: 27), CDR2TIYPGNSDTNYNQKFK (SEQ ID NO: 28), and CDR3EDSRSLYYNGWDYFDY (SEQ ID NO: 9). The heavy chain CDR sequences of the LCR13A1_VH_Glv1_02 and 13A1_VH_Glv1_03 variant antibodies are CDR1 TNYWMH (SEQ ID NO: 27), CDR2 TIYPGNSDTNYNQKFK (SEQ ID NO: 28), and CDR3 EDSRSLYYNGW (SEQ ID NO: 76). The LCR13A1_Glv3 variant antibody has a heavy chain CDR sequence: CDR1 TNYWMH (SEQ ID NO: 27), CDR2 TIYPGNSDTNYNQKFQ (SEQ ID NO: 29), and CDR3 EDSRSLYYNGW (SEQ ID NO: 76).

[0067] X = Wernier residue; X * * = non-parental residues that substantially adjust the selected Fr to the alternative cognate human germline 'match'; X* = parental mouse 13A1-restricted backmutation; X# = parental backmutation residues coexisting in a functional human cognate germline framework; X$ = human J region modification. Residue numbering is according to IMGT. ^CDRs (in bold) and the Vernier region were grafted onto the huIGHV1-46*01 framework; the parental IGHJ was adjusted to huIGHJ4 (T123>L123 and L124>V124).

[0068] The graft FR3 was locally modified to better reflect the FR3 in human IGHV1-3*01 (M78>I78; T84>A84; V87>A87) and included the murine parent back mutations (R80>A80; D81>V81). The graft FR1 was locally modified to better reflect the FR1 in IGHV7-4-1*03 (A9>S9; V12>L12) and included the murine parent back mutations (E11>V11; K13>A13); FR3 included the murine parent back mutations (G74D; V76>A76; T77>K77; M78>L78; R80>A80; D81>V81). The replacement graft was based on local FR homology. All FRs were IGHV7-4-1*03 with two mouse backmutations (A25>T25; Y103>F103). One J region residue was also backmutated to a common mouse / human residue (L123>T123).

[0069] Figure 8 A summary of the VL(κ) protein sequences and LCR-hu13A1 CDR grafting for the VL chain is provided. The sequences listed in the table are as follows: murine 13A1 VL(κ) protein sequence (SEQ ID NO: 20), LCR13A1_Glv1 (grafted onto the huIgKV7-3*01 framework) (SEQ ID NO: 21), 13A1_VK_Glv1_02(A) (SEQ ID NO: 22), 13A1_VK_Glv1_03(B) (SEQ ID NO: 23), 13A1_VK_Glv1_04(C) (SEQ ID NO: 24), 13A1_VK_Glv1_05(D) (SEQ ID NO: 25), and LCR13A1_Glv3 (SEQ ID NO: 26). CDRs are in bold. The light chain CDR sequences of the LCR13A1_Glv1, 13A1_VK_Glv1_02 (A), 13A1_VK_Glv1_03 (B), 13A1_VK_Glv1_04 (C), and 13A1_VK_Glv1_05 (D) variant antibodies are CDR1 RASESVDNYGISFLN (SEQ ID NO: 30), CDR2 AASNQGS (SEQ ID NO: 31), and QQSKEVPRT (SEQ ID NO: 14). The light chain CDR sequences of the LCR13A1_Glv3 variant antibody are CDR1 KSSESVDNYGISFLN (SEQ ID NO: 70), CDR2 AASNQGS (SEQ ID NO: 31), and QQSKEVPRT (SEQ ID NO: 14).

[0070] X = Wernier residue; X* * = non-parental residues that essentially adjust the selected Fr to the alternative homologous human germline 'match'; X* = parental mouse 13A1-restricted backmutation; X# = parental backmutation residues coexisting in the functional human homologous germline framework; X$ = human J region modification. Residue numbering is according to IMGT. ^ Parental CDR / Weiniger residues were grafted onto the IGKV7-3*01 framework region; FR2 contains mutations (F42 > Y42) to allow for preferred human Weiniger residues; FR3 contains mutations (N97 > D97) to remove putative N-glycan risk; FR4 contains J region humanizing mutations (K124 > V124) to better reflect huIGKJ4.

[0071] ^^The GLv1 graft FR1 was modified by backmutating two positions (15P>15L, T22>S22) to coexisting human / mouse residues. ^^^Further substitutions included the parental mouse backmutations in FR3 (T90>N90, N92>H92). ^^^^Additional mutations were made to locally adjust FR3 to reflect IGKV6D-21*02 / 6-21*02 (A74>S74, V94>L94, D97>E97, T99>A99, N101>A101), and the FR3 mouse backmutations were retained. D Residues N101 > A101 were found in IGKV6D-21*02. FR3 was further modified by including residues common to both IGKV6D-21*01 and IGKV6-21*02 (N101 > T101). FR1 was locally adjusted to reflect IGKV4-1*01 (A9 > D9, Q17 > E17). The replacement grafts were based on local FR homology matching. FR1 and FR3 were derived from IGKV4-1*01; FR2 was derived from IGKV3D-15*01 and contained the murine backmutation Y42 > F42. Similarly, FR3 contained the murine backmutation Y103 > F103. J region residues were also mutated to common murine / human residues (V124 > L124).

[0072] Figure 9The table provides global germline alignment homology (IGHV / IGKV elements; IMGT) of the VH and VK variable domains relative to the human germline reference sequence. % positional identity (positional similarity); unless otherwise indicated, the average of the top 3 functional alleles is given. (1) There was only one significant human global VK germline match (the predicted pseudogene IGKV7-3*01), which was used as the graft partner. Top: score v IGKV7-3*01; bottom: score v average of the next 3 functional alleles. (2) Alternative partial FR grafting resulted in one significant (functional) germline match (IGKV4-1*01).

[0073] Figure 10 A table of various humanized LCR13A1 antibody VH heavy chain and VK light chain pairings is provided.

[0074] Figure 11 The protein sequence of LCR_13A1_VH_Glv1-VK_GLv1_IgG4[S228P] (LCR13A1_Glv1) is provided. The sequence comprises the VH heavy chain amino acids 13A1 VH_Glv1 (SEQ ID NO: 16) and the VL kappa light chain amino acids VK_Glv1 (SEQ ID NO: 21). The CDRs are in bold. The constant region CH1-hinge-CH2CH3 IgG4 (S228P) sequence (SEQ ID NO: 32) and CK*01 (SEQ ID NO: 33) are shown.

[0075] Figure 12 The protein sequence LCR13A1_VH_Glv1_03-VK_GLv3_IgG4[S228P] (LCR13A1-2B) is provided. The sequence comprises the VH heavy chain amino acids LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) and the VL kappa light chain amino acids VK_Glv3 (SEQ ID NO: 26). The CDRs are in bold. The constant region CH1-hinge-CH2CH3 IgG4 (S228P) sequence (SEQ ID NO: 32) and CK*01 (SEQ ID NO: 33) are shown.

[0076] Figure 13The protein sequence LCR13A1_VH_Glv1_03-VK_GLv1_05_IgG4[S228P] (LCR13A1-2F) is provided. The sequence comprises the VH heavy chain amino acids LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) and the VL kappa light chain amino acids VK_Glv1_05 (SEQ ID NO: 25). The CDRs are in bold. The constant region CH1-hinge-CH2CH3 IgG4 (S228P) sequence (SEQ ID NO: 32) and CK*01 (SEQ ID NO: 33) are shown.

[0077] Figure 14 The predicted stacking torsion angles of LCR13A1 variants are provided (based on the 568 PDB structure; PAPS, bioinf.org.uk / abs / paps / ).

[0078] FIG15 depicts functional neutralization of TGFb1-induced luciferase expression in TMLECs by the LCR 13A1 variant TGFb1 antibody. The antibodies evaluated were (A) 13A1 parent, (B) LCR13A1-2A (denoted as Ab 2A): LCR13A1_VH_Glv3 / LCR13A1_VK_GLv3; (C) LCR13A1-2B (denoted as Ab 2B): LCR13A1_VH_Glv1_03 / LCR13A1_VK_GLv3; (D) LCR13A1-2C (denoted as Ab 2C): LCR13A1_VH_Glv3 / LCR13A1_VK_GLv1_03; (E) LCR13A1-2D (denoted as Ab 2D): LCR13A1_VH_Glv1_03 / LCR13A1_VK_GLv1_03; (F) LCR13A1-2E (denoted as Ab 2E): LCR13A1_VH_Glv1_03 / LCR13A1_VK_GLv1_04; and (G) LCR13A1-2F (denoted as Ab2F): LCR13A1_VH_Glv1_03 / LCR13A1_VK_GLv1_05 antibodies.

[0079] Figure 16 depicts functional TGFb isoform specificity of humanized LCR13A1 variants in TMLECs. The antibodies evaluated were (A) LCR13A1-2A (denoted as Ab 2A): LCR13A1_VH_Glv3 / LCR13A1_VK_GLv3; (B) LCR13A1-2B (denoted as Ab 2B): LCR13A1_VH_Glv1_03 / LCR13A1_VK_GLv3; (C) LCR13A1-2C (denoted as Ab2C): LCR13A1_VH_Glv3 / LCR13A1_VK_GLv1_03; (D) LCR13A1-2D (denoted as Ab 2D): LCR13A1_VH_Glv1_03 / LCR13A1_VK_GLv1_03; (E) LCR13A1-2E (denoted as Ab 2E): LCR13A1_VH_Glv1_03 / LCR13A1_VK_GLv1_04; (F) LCR13A1-2F (denoted as Ab 2F): LCR13A1_VH_Glv1_03 / LCR13A1_VK_GLv1_05; and (G) 13A1 parent antibody.

[0080] Figure 17 Competition ELISA binding curves of LCR13A1 IgG4 variants and reference antibodies with the parental mouse 13A1 antibody are provided. (A) 13A1-2A, (B) 13A1-2B, (C) 13A1-2C, (D) 13A1-2D, (E) 13A1-2E, and (F) 13A1-2F.

[0081] Figure 18 Biacore studies of LCR13A1 variants LCR13A1_2B and LCR13A1_2F relative to immobilized TGF-b1 are provided.

[0082] Figure 19 provides SEC profiles of purified humanized 13A1 variant IgG4 antibodies. Panels AE are for the following LCR13A1 variants: A VH_Glv3-VK_Glv3 (13A1-2A), B VH_Glv1_03-VK_Glv3 (13A1-2B), C VH_Glv3-VK_Glv1_03 (13A1-2C), D VH_Glv1_03-VK_Glv1_03 (13A1-2D), E VH_Glv1_03-VK_Glv1_04 (13A1-2E), and F VH_Glv1_03-VK_Glv1_05 (13A1-2F).

[0083] Figure 20 provides representative DSF melting temperatures of purified humanized 13A1 variant IgG4 antibodies. Panels AE are for the following LCR13A1 variants: A VH_Glv3-VK_Glv3 (13A1-2A), B VH_Glv1_03-VK_Glv3 (13A1-2B), C VH_Glv3-VK_Glv1_03 (13A1-2C), D VH_Glv1_03-VK_Glv1_03 (13A1-2D), E VH_Glv1_03-VK_Glv1_04 (13A1-2E), and F VH_Glv1_03-VK_Glv1_05 (13A1-2F).

[0084] Figure 21 The LCR13A1 DSF unfolding transition and temperature are provided for the variant 13A1 antibody, and also a comparison with several art-known TGFβ antibodies that are non-specific for TGFβ1. Dashes - indicate not tested.

[0085] Figure 22 (A) Relative crude protein expression yields and also (B) SDS-PAGE (denaturing) of humanized 13A1 variant IgG4 antibodies are provided. 2 ml transfection cultures were grown in triplicate; 10 μl of supernatant was loaded.

[0086] Figure 23 The amino acid heavy chain sequence (SEQ ID NO: 2) and light chain sequence (SEQ ID NO: 4) of the TGF-β1 antibody 13A1 variable region are compared to the heavy chain sequence (SEQ ID NO: 18) of humanized variant antibodies 13A1-2B and 13A1-2F, and the light chain sequences of antibodies 13A1-2B and 13A1-2F (SEQ ID NO: 26 and SEQ ID NO: 25, respectively). The CDRs are underlined. The VK and VH CDR sequences of the 2B and 2F variants were determined using Kabat numbering. The VK and VH CDR sequences of m13A1 were determined using IMGT.

[0087] Figure 24Depicted is the rescue of TGFb1-mediated inhibition of anti-MSLN CAR-T target cell killing by the TGFb1-specific antibody mAb 13A1-2F. Inhibition was demonstrated using the TGFb1 antibody 13A1-2F added at 0.5 μg / ml, 2 μg / ml, and 10 μg / ml. Effector: Primary human T cells transfected with an anti-mesothelin CAR (hP4; US 2014301993 A1). Target: H-226 human lung cancer (Meso++); E:T ratio 5:1, Addition: TGFb1 (1 ng / ml), 13A1-2F TGFb1-selective huIgG4, Readout: Incucyte: Cytotoxin Red accumulation caused by dead target cells (mean red object average intensity).

[0088] Figure 25 Depicted is the rescue of TGFb1-mediated inhibition of anti-MSLN CAR-T target cell killing by the TGFb1-specific antibody mAb 13A1-2B. Inhibition was demonstrated using TGFb1 antibody 13A1-2B added at 0.05 μg / ml (or 50 ng / ml). Effectors, targets, additions, and readouts are similar to those of the Figure 24 Those in commensurate.

[0089] Figure 26The heavy and light chain sequences of selected mutant variant antibodies are provided in alignment with the parental variants 13A1-2B and 13A1-2F antibodies. The CDRs according to Kabat nomenclature are underlined. Asterisks * indicate where amino acid changes and differences exist between the parental 2B and 2F antibodies and the mutant variants. The VK light chain of the parental variant 13A1-2B (VK_Glv3) (SEQ ID NO:26) was compared with mutant light chain A (VK_Glv3_02) (SEQ ID NO:52), and the parental variant 13A1-2F (VK_Glv1_05) (SEQ ID NO:25) was compared with mutant light chains B (VK_Glv1_06) (SEQ ID NO:53), C (VK_Glv1_07) (SEQ ID NO:54), D (VK_Glv1_08) (SEQ ID NO:55) and E (VK_Glv1_09) (SEQ ID NO:56). The VH heavy chains of the parental variants 13A1-2B and 13A1-2F (VH_Glv1_03) (SEQ ID NO: 18) were compared with the mutant light chains F (VH_Glv1_04) (SEQ ID NO: 57), G (VH_Glv1_05) (SEQ ID NO: 58), and H (VH_Glv1_06) (SEQ ID NO: 59). The underlined CDRs of the light chain correspond to CDR1 KSSESVDNYGISFLN (SEQ ID NO: 70) or RASESVDNYGISFLN (SEQ ID NO: 30) or RASESVDNYGISLLN (SEQ ID NO: 72), CDR2 AASNQGS (SEQ ID NO: 31), and CDR3 QQSKEVPR (SEQ ID NO: 73). The underlined CDRs in the heavy chain correspond to CDR1 NYWMH (SEQ ID NO: 64) or NYWTH (SEQ ID NO: 65), CDR2 TIYPGNSDTNYNQKFKD (SEQ ID NO: 75), and CDR3 EDSRSLYYNGWDYFDY (SEQ ID NO: 9) or EDSRSLNFNGWDYFDY (SEQ ID NO: 67) or EDSRSLYYNGWDYFDH (SEQ ID NO: 68) or EDSRSLNFNGWDYFDH (SEQ ID NO: 69).

[0090] Figure 27Biacore analysis of the new mutant variant antibodies is provided, and the new mutants are compared with the parent variant 13A1-2F and with mu13A1. The selected variants have different monovalencies (huIgG1 stabilized Fab format). Biacore binding kinetics range from lower to higher than the parent mouse 13A1 (mu13A1, hybrid with mouse VK / VH and huCK / huCH1). The data presented are ka, kd and apparent KD. TGFb1 (chip): 492Ru, Fab: 10nM, flow rate: 30ul / min, contact time: 510s, dissociation time: 600s. Quality: Chi(2) <= 1% Rmax and U score <= 5. Data are presented for mutant variant antibodies 13A1_AF, 13A1_AG, 13A1_AH, 13A1_BF, 13A1_BG, 13A1_BH, 13A1_CF, 13A1_CG, 13A1_CH, 13A1_DF, 13A1_DG, 13A1_DH, 13A1_EF, 13A1_EG, and 13A1_EH.

[0091] Figure 28 Depicted are the VH heavy chain (SEQ ID NO: 62) and VK light chain (SEQ ID NO: 63) amino acid sequences of the 13A1 mouse parental hybrid stabilized Fab (denoted as mu13A1). The human CH1 and CK constant domains are shown in bold, and the purification tag is underlined.

[0092] Figure 29 Depicted is the functional neutralization of TGFb1-induced luciferase expression in TMLECs by LCR13A1 mutant variant TGFb1 antibodies. The antibodies evaluated were the m13A1 hybrid, the 13A1_2F parental variant, murine mAb 13A1, and selected mutant variants 13A1_AF, 13A1_AH, 13A1_BG, and 13A1_DF. Relative luminescence was demonstrated after neutralization with antibodies at concentrations of 0.1 μg / ml, 0.5 μg / ml, and 2 μg / ml.

[0093] Figure 30 Figure 3. T cell secretion of 13A1-2F antibody relative to immobilized TGFβ1. Culture supernatants from Jurkat T cell cultures expressing and secreting TGFβ1 antibody were evaluated for binding to TGFβ1. Iso ctrl is an isotype control antibody. 13A1-2F antibody was added to one sample as a binding control. Supernatants from 13A1-2F-transfected T cells were added and serially diluted up to 50-fold, and binding to immobilized TGFβ1 was demonstrated that was comparable to or greater than that of the added 13A1-2F antibody control. DETAILED DESCRIPTION

[0094] According to the present invention, conventional molecular biology, microbiology and recombinant DNA techniques within the skill of the art may be employed. Such techniques are fully explained in the literature. See, e.g., Sambrook et al., “Molecular Cloning: A Laboratory Manual” (1989); “Current Protocols in Molecular Biology” Vols. I-III [Ausubel, R.M., ed. (1994)]; “Cell Biology: A Laboratory Handbook” Vols. I-III [J.E.Celis, ed. (1994)]; “Current Protocols in Immunology” Vols. I-III [Coligan, J.E., ed. (1994)]; “Oligonucleotide Synthesis” (M.J. Gait, ed. 1984); “Nucleic Acid Hybridization” [B.D. Hames & S.J. Higgins, eds. (1985)]; “Transcription And Translation” [B.D. Hames and S.J. Higgins, eds. (1984)]; “Animal Cell Culture” [R.I. Freshney, ed. (1986)]; “Immobilized Cells And Enzymes” [I.L. Press, (1986)]; B. Perbal, "A Practical Guide To Molecular Cloning" (1984).

[0095] Accordingly, the following terms, if appearing herein, shall have the definitions set out below.

[0096] A. Terminology

[0097] The terms "TGF-β1," "TGFb1," and "TGF-Beta1" refer to and include both human and mouse transforming growth factor beta isoform 1 protein.

[0098] Antibody "13A1-2A", "13A1_2A" or "2A" is also denoted as LCR13A1_VH_Glv3-LCR13A1_VK_GLv3 or 13A1_VH_Glv3-13A1_VK_GLv3. Antibody 13A1-2A comprises the heavy chain sequence 13A1_VH_Glv3 (SEQ ID NO: 19) and the light chain sequence 13A1_VK_Glv3 (SEQ ID NO: 26).

[0099] Antibody "13A1-2B", "13A1_2B" or "2B" is also denoted as LCR13A1_VH_Glv1_03-LCR13A1_VK_GLv3 or 13A1_VH_Glv1_03-13A1_VK_GLv3. Antibody 13A1-2B comprises the heavy chain sequence 13A1_VH_Glv1_03 (SEQ ID NO: 18) and the light chain sequence 13A1_VK_Glv3 (SEQ ID NO: 26).

[0100] Antibody "13A1-2C", "13A1_2C" or "2C" is also denoted as LCR13A1_VH_Glv3-LCR13A1_VK_GLv1_03 or 13A1_VH_Glv3-13A1_VK_GLv1_03. Antibody 13A1-2C comprises the heavy chain sequence 13A1_VH_Glv3 (SEQ ID NO: 19) and the light chain sequence 13A1_VK_Glv1_03 (SEQ ID NO: 23).

[0101] Antibody "13A1-2D", "13A1_2D" or "2D" is also denoted as LCR13A1_VH_Glv1_03-LCR13A1_VK_GLv1_03 or 13A1_VH_Glv1_03-13A1_VK_GLv1_03. Antibody 13A1-2D comprises the heavy chain sequence 13A1_VH_Glv1_03 (SEQ ID NO: 18) and the light chain sequence 13A1_VK_Glv1_03 (SEQ ID NO: 23).

[0102] Antibody "13A1-2E", "13A1_2E" or "2E" is also denoted as LCR13A1_VH_Glv1_03-LCR13A1_VK_GLv1_04 or 13A1_VH_Glv1_03-13A1_VK_GLv1_04. Antibody 13A1-2E comprises the heavy chain sequence 13A1_VH_Glv1_03 (SEQ ID NO: 18) and the light chain sequence 13A1_VK_Glv1_04 (SEQ ID NO: 24).

[0103] Antibody "13A1-2F", "13A1_2F" or "2F" is also denoted as LCR13A1_VH_Glv1_03-LCR13A1_VK_GLv1_05 or 13A1_VH_Glv1_03-13A1_VK_GLv1_05. Antibody 13A1-2F comprises the heavy chain sequence 13A1_VH_Glv1_03 (SEQ ID NO: 18) and the light chain sequence 13A1_VK_Glv1_05 (SEQ ID NO: 25).

[0104] Antibody "13A1-2G", "13A1_2G" or "2G" is also denoted as LCR13A1_VH_Glv1_02-LCR13A1_VK_GLv1_02 or 13A1_VH_Glv1_02-13A1_VK_GLv1_02. Antibody 13A1-2G comprises the heavy chain sequence 13A1_VH_Glv1_02 (SEQ ID NO: 17) and the light chain sequence 13A1_VK_Glv1_02 (SEQ ID NO: 22).

[0105] Antibody "13A1-2H", "13A1_2H" or "2H" is also denoted as LCR13A1_VH_Glv1_02-LCR13A1_VK_GLv1_03 or 13A1_VH_Glv1_02-13A1_VK_GLv1_03. Antibody 13A1-2H comprises the heavy chain sequence 13A1_VH_Glv1_02 (SEQ ID NO: 17) and the light chain sequence 13A1_VK_Glv1_03 (SEQ ID NO: 23).

[0106] Antibody "13A1-2I", "13A1_2I" or "2I" is also denoted as LCR13A1_VH_Glv1_02-LCR13A1_VK_GLv1_04 or 13A1_VH_Glv1_02-13A1_VK_GLv1_04. Antibody 13A1-2I comprises the heavy chain sequence 13A1_VH_Glv1_02 (SEQ ID NO: 17) and the light chain sequence 13A1_VK_Glv1_04 (SEQ ID NO: 24).

[0107] Antibody "13A1-2J", "13A1_2J" or "2J" is also denoted as LCR13A1_VH_Glv1_02-LCR13A1_VK_GLv1_05 or 13A1_VH_Glv1_02-13A1_VK_GLv1_05. Antibody 13A1-2J comprises the heavy chain sequence 13A1_VH_Glv1_02 (SEQ ID NO: 17) and the light chain sequence 13A1_VK_Glv1_05 (SEQ ID NO: 25).

[0108] Antibody "13A1-AF", "13A1_AF" or "AF" is also denoted as LCR13A1_VK_Glv3_02-LCR13A1_VH_GLv1_04 or VK_Glv3_02-VH_GLv1_04. Antibody 13A1-AF comprises the light chain sequence LCR13A1_VK_Glv3_02 (SEQ ID NO: 52) and the heavy chain sequence LCR13A1_VH_Glv1_04 (SEQ ID NO: 57).

[0109] Antibody "13A1-AG", "13A1_AG" or "AG" is also denoted as LCR13A1_VK_Glv3_02-LCR13A1_VH_GLv1_05 or VK_Glv3_02-VH_GLv1_05. Antibody 13A1-AG comprises the light chain sequence LCR13A1_VK_Glv3_02 (SEQ ID NO: 52) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58).

[0110] Antibody "13A1-AH", "13A1_AH" or "AH" is also denoted as LCR13A1_VK_Glv3_02-LCR13A1_VH_GLv1_06 or VK_Glv3_02-VH_GLv1_06. Antibody 13A1-AH comprises the light chain sequence LCR13A1_VK_Glv3_02 (SEQ ID NO: 52) and the heavy chain sequence LCR13A1_VH_Glv1_06 (SEQ ID NO: 59).

[0111] Antibody "13A1-BF", "13A1_BF" or "BF" is also denoted as LCR13A1_VK_Glv1_06-LCR13A1_VH_GLv1_04 or VK_Glv1_06-VH_GLv1_04. Antibody 13A1-BF comprises the light chain sequence LCR13A1_VK_Glv1_06 (SEQ ID NO: 53) and the heavy chain sequence LCR13A1_VH_Glv1_04 (SEQ ID NO: 57).

[0112] Antibody "13A1-BG", "13A1_BG" or "BG" is also denoted as LCR13A1_VK_Glv1_06-LCR13A1_VH_GLv1_05 or VK_Glv1_06-VH_GLv1_05. Antibody 13A1-BG comprises the light chain sequence LCR13A1_VK_Glv1_06 (SEQ ID NO: 53) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58).

[0113] Antibody "13A1-BH", "13A1_BH" or "BH" is also denoted as LCR13A1_VK_Glv1_06-LCR13A1_VH_GLv1_06 or VK_Glv1_06-VH_GLv1_06. Antibody 13A1-BH comprises the light chain sequence LCR13A1_VK_Glv1_06 (SEQ ID NO: 53) and the heavy chain sequence LCR13A1_VH_Glv1_06 (SEQ ID NO: 59).

[0114] Antibody "13A1-CF", "13A1_CF" or "CF" is also denoted as LCR13A1_VK_Glv1_07-LCR13A1_VH_GLv1_04 or VK_Glv1_07-VH_GLv1_04. Antibody 13A1-CF comprises the light chain sequence LCR13A1_VK_Glv1_07 (SEQ ID NO: 54) and the heavy chain sequence LCR13A1_VH_Glv1_04 (SEQ ID NO: 57).

[0115] Antibody "13A1-CG", "13A1_CG" or "CG" is also denoted as LCR13A1_VK_Glv1_07-LCR13A1_VH_GLv1_05 or VK_Glv1_07-VH_GLv1_05. Antibody 13A1-CG comprises the light chain sequence LCR13A1_VK_Glv1_07 (SEQ ID NO: 54) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58).

[0116] Antibody "13A1-CH", "13A1_CH" or "CH" is also denoted as LCR13A1_VK_Glv1_07-LCR13A1_VH_GLv1_06 or VK_Glv1_07-VH_GLv1_06. Antibody 13A1-CH comprises the light chain sequence LCR13A1_VK_Glv1_07 (SEQ ID NO: 54) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 59).

[0117] Antibody "13A1-DF", "13A1_DF" or "DF" is also denoted as LCR13A1_VK_Glv1_08-LCR13A1_VH_GLv1_04 or VK_Glv1_08-VH_GLv1_04. Antibody 13A1-DF comprises the light chain sequence LCR13A1_VK_Glv1_08 (SEQ ID NO: 55) and the heavy chain sequence LCR13A1_VH_Glv1_04 (SEQ ID NO: 57).

[0118] Antibody "13A1-DG", "13A1_DG" or "DG" is also denoted as LCR13A1_VK_Glv1_08-LCR13A1_VH_GLv1_05 or VK_Glv1_08-VH_GLv1_05. Antibody 13A1-DG comprises the light chain sequence LCR13A1_VK_Glv1_08 (SEQ ID NO: 55) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58).

[0119] Antibody "13A1-DH", "13A1_DH" or "DH" is also denoted as LCR13A1_VK_Glv1_08-LCR13A1_VH_GLv1_06 or VK_Glv1_08-VH_GLv1_06. Antibody 13A1-DH comprises the light chain sequence LCR13A1_VK_Glv1_08 (SEQ ID NO: 55) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 59).

[0120] Antibody "13A1-EF", "13A1_EF" or "EF" is also denoted as LCR13A1_VK_Glv1_09-LCR13A1_VH_GLv1_04 or VK_Glv1_09-VH_GLv1_04. Antibody 13A1-EF comprises the light chain sequence LCR13A1_VK_Glv1_09 (SEQ ID NO: 56) and the heavy chain sequence LCR13A1_VH_Glv1_04 (SEQ ID NO: 57).

[0121] Antibody "13A1-EG", "13A1_EG" or "EG" is also denoted as LCR13A1_VK_Glv1_09-LCR13A1_VH_GLv1_05 or VK_Glv1_09-VH_GLv1_05. Antibody 13A1-EG comprises the light chain sequence LCR13A1_VK_Glv1_09 (SEQ ID NO: 56) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 58).

[0122] Antibody "13A1-EH", "13A1_EH" or "EH" is also denoted as LCR13A1_VK_Glv1_09-LCR13A1_VH_GLv1_06 or VK_Glv1_09-VH_GLv1_06. Antibody 13A1-EH comprises the light chain sequence LCR13A1_VK_Glv1_09 (SEQ ID NO: 56) and the heavy chain sequence LCR13A1_VH_Glv1_05 (SEQ ID NO: 59).

[0123] The term "specific binding members" describes a member of a pair of molecules that have binding specificity to each other. The members of the specific binding pair can be of natural origin or produced synthetically in whole or in part. One member of the pair of molecules has a region or cavity on its surface that specifically binds to and is complementary to the specific spatial and polarity organization of the other member of the pair of molecules. Therefore, the members of the pair have the characteristic of specifically binding to each other. Examples of the type of specific binding pairs are antigen-antibody, biotin-avidin, hormone-hormone receptor, receptor-ligand, enzyme-substrate. The present application relates to antigen-antibody type reactions.

[0124] The term "antibody" describes an immunoglobulin, whether natural or partially or wholly synthetically produced. The term also encompasses any polypeptide or protein having a binding domain that is or is homologous to an antibody binding domain. This term also contemplates CDR-grafted antibodies. An "antibody" is any immunoglobulin that binds to a specific epitope, including antibodies and fragments thereof. The term encompasses polyclonal, monoclonal, and chimeric antibodies, the last of which are described in further detail in U.S. Patent Nos. 4,816,397 and 4,816,567. The term "one or more antibodies" includes wild-type immunoglobulin (Ig) molecules that typically contain four full-length polypeptide chains (two heavy (H) chains and two light (L) chains) or their equivalent Ig homologs (e.g., camel antibodies, which contain only heavy chains); including full-length functional mutants, variants or derivatives thereof that retain the essential epitope binding characteristics of Ig molecules, and including dual-specific, bispecific, multispecific and dual variable domain antibodies; immunoglobulin molecules can be of any class (e.g., IgG, IgE, IgM, IgD, IgA and IgY) or subclass (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2). The term "antibody" also includes any "antibody fragment" in its meaning.

[0125] "Antibody fragment" means a molecule comprising at least one non-full-length polypeptide chain, including (i) a Fab fragment, which is a monovalent fragment consisting of a variable light (VL), a variable heavy (VH), a constant light (CL), and a constant heavy 1 (CH1) domain; (ii) a F(ab')2 fragment, which is a bivalent fragment comprising two Fab fragments connected by a disulfide bridge at the hinge region; (iii) the heavy chain portion of a Fab (Fd) fragment, which consists of the VH and CH1 domains; (iv) a variable fragment (Fv), which consists of the VL and VH domains of a single arm of an antibody; and (v) a domain antibody (dAb) fragment, which comprises a single variable domain (Ward, ES et al., Nature 2012). 341, 544-546 (1989)); (vi) camelid antibodies; (vii) isolated complementarity determining regions (CDRs); (viii) single-chain Fv fragments in which the VH and VL domains are connected by a peptide linker that allows the two domains to associate to form an antigen-binding site (Bird et al., Science, 242, 423-426, 1988; Huston et al., PNAS USA, 85, 5879-5883, 1988); (ix) diabodies, which are bivalent, bispecific antibodies in which the VH and VL domains are expressed on a single polypeptide chain, but using a linker that is too short to allow pairing between the two domains on the same chain, thereby forcing the domains to pair with the complementary domains of another chain and form two antigen-binding sites (WO 94 / 13804; P. Holliger et al., Proc. Natl. Acad. Sci. USA 90 6444-6448, (1993)); and (x) linear antibodies, which comprise a pair of tandem Fv segments (VH-CH1-VH-CH1) that, together with complementary light chain polypeptides, form a pair of antigen binding regions; (xi) multivalent antibody fragments (scFv dimers, trimers and / or tetramers (Power and Hudson, J Immunol. Methods 242: 193-204 9 (2000)); (xii) minibodies, which are bivalent molecules composed of scFv fused to constant immunoglobulin domains CH3 or CH4, wherein the constant CH3 or CH4 domains serve as dimerization domains (Olafsen T et al. (2004) Prot Eng Des Sel 17(4): 315-323; Hollinger P and Hudson PJ (2005) Nature Biotech 23(9):1126-1136); and (xiii) other non-full-length portions of the heavy and / or light chains, or mutants, variants or derivatives thereof, alone or in any combination.

[0126] Because antibodies can be modified in a variety of ways, the term "antibody" should be interpreted as covering any specific binding member or substance having a binding domain with the desired specificity. Thus, this term covers antibody fragments, derivatives, functional equivalents and homologs of antibodies, including any polypeptide comprising an immunoglobulin binding domain, whether natural or wholly or partially synthesized. Thus, chimeric molecules comprising an immunoglobulin binding domain or equivalent fused to another polypeptide are included. The cloning and expression of chimeric antibodies are described in EP-A-0120694 and EP-A-0125023 and U.S. Patent Nos. 4,816,397 and 4,816,567.

[0127] The "antibody binding site" is the structural portion of an antibody molecule that specifically binds to an antigen and is composed of the light chain or heavy chain and the light chain variable region and hypervariable region.

[0128] The phrase "antibody molecule" in its various grammatical forms as used herein contemplates both intact immunoglobulin molecules and immunologically active portions of immunoglobulin molecules.

[0129] Exemplary antibody molecules are intact immunoglobulin molecules, substantially intact immunoglobulin molecules, and those portions of immunoglobulin molecules that contain the paratope, including those portions known in the art as Fab, Fab', F(ab')2, and F(v), which are preferably used in the therapeutic methods described herein.

[0130] Antibodies can also be bispecific, in which one binding domain of the antibody is a specific binding member of the present invention and the other binding domain has a different specificity, for example to recruit effector functions and the like. The bispecific antibodies of the present invention include those in which one binding domain of the antibody is a specific binding member of the present invention, including fragments thereof, and the other binding domain is a different antibody or fragment thereof, including the binding domain of a different anti-cancer or anti-tumor specific antibody. The other binding domain can be an antibody that recognizes or targets a specific cell type, such as in a neural or glial cell specific antibody. In the bispecific antibodies of the present invention, one binding domain of an antibody of the present invention can be combined with other binding domains or molecules that recognize specific cell receptors and / or regulate cells in a specific manner (such as, for example, immunomodulators (e.g., one or more interleukins), growth regulators or cytokines or toxins (e.g., ricin) or anti-mitotic or apoptotic agents or factors). Thus, the TGFβ-1 antibodies of the present invention can be used to guide or target agents, markers, other molecules or compounds or antibodies in indications such as wound healing, inflammation, cancer or tumors.

[0131] The phrase "monoclonal antibody" in its various grammatical forms refers to an antibody that has only antibody binding sites capable of immunoreacting with a specific antigen. Thus, a monoclonal antibody typically exhibits a single binding affinity for any antigen with which it immunoreacts. A monoclonal antibody can also contain antibody molecules with multiple antibody binding sites, each of which is immunospecific for a different antigen; for example, bispecific (chimeric) monoclonal antibodies.

[0132] The term "antigen binding domain" describes a portion of an antibody that includes a region that specifically binds to and is complementary to a portion or all of an antigen. In the case of a larger antigen, an antibody may only bind to a specific portion of the antigen, which is called an epitope. The antigen binding domain can be provided by one or more antibody variable domains. Preferably, the antigen binding domain comprises an antibody light chain variable region (VL) and an antibody heavy chain variable region (VH).

[0133] The immunoconjugates or antibody fusion proteins of the present invention (in which the antibodies, antibody molecules or fragments thereof used in the present invention are conjugated or attached to other molecules or agents) further include, but are not limited to, such antibodies, molecules or fragments conjugated to chemoablative agents, toxins, immunomodulators, cytokines, cytotoxic agents, chemotherapeutic agents, antimicrobial agents or peptides, cell walls and / or cell membranes, or drugs.

[0134] The term "one or more adjuvants" describes substances, compounds, agents or materials that can be used to improve immune responses or immune cells or component stimulation, and can be combined with any specific antigen in immunological compositions, pharmaceutical compositions or vaccine compositions in some cases. Adjuvants can be used to increase the amount of antibodies and effector T cells produced and to reduce the number and injection frequency of antigens or immunostimulants or regulators. Although some antigens are administered without adjuvants, there are many such antigens that lack sufficient immunogenicity to stimulate a useful immune response in the absence of an effective adjuvant. Adjuvants also improve the immune response from "self-sufficient" antigens because the immune response obtained can be increased or the amount of the administered antigen can be reduced. Adjuvants can be used as tissue reservoirs for slowly releasing antigens, and also as lymphoid system activators (Hood et al., Immunology, 2nd ed., 1984, Benjamin / Cummings: Menlo Park, California, p. 384) that nonspecifically enhance immune responses. In a preferred aspect, adjuvants are physiologically and / or pharmaceutically acceptable in mammals, particularly humans. The standard adjuvant used in experimental animals is Freund's adjuvant. Freund's complete adjuvant (FCA) is an emulsion containing mineral oil and killed mycobacteria in saline. Freund's incomplete adjuvant (FIA) omits the mycobacteria. Both FIA and FCA induce good humoral (antibody) immunity, and FCA additionally induces high levels of cell-mediated immunity. However, due to side effects, neither FCA nor FIA is acceptable for clinical use. In particular, mineral oil is known to cause granulomas and abscesses, and Mycobacterium tuberculosis is a factor that causes tuberculosis. Adjuvants previously known and used include, but are not limited to, complete Freund's adjuvant, incomplete Freund's adjuvant, saponin, mineral gels such as aluminum hydroxide, surfactants such as lysolecithin, pluronic polyols, polyanions, peptides, oil or hydrocarbon emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum. Mineral salt adjuvants include, but are not limited to, aluminum hydroxide, aluminum phosphate, calcium phosphate, zinc hydroxide, and calcium hydroxide. Preferably, the adjuvant composition further comprises the lipids of a fat emulsion comprising about 10% (by weight) vegetable oil and about 1%-2% (by weight) phospholipids.Preferably, the adjuvant composition further optionally comprises an emulsion form having oily particles dispersed in a continuous aqueous phase, having an emulsion-forming polyol in an amount from about 0.2% (by weight) to about 49% (by weight), optionally an emulsion-forming amount of a metabolizable oil up to 15% (by weight), and optionally an emulsion-stabilizing amount of a glycol ether-based surfactant up to about 5% (by weight). There are many substances that have been tried as adjuvants, such as the lipid A portion of Gram-negative bacterial endotoxins and mycobacterial trehalose dimycolate. The phospholipid lysolecithin exhibits adjuvant activity (Arnold et al., Eur. J Immunol. 9: 363-366, 1979). Some synthetic surfactants exhibit adjuvant activity, including dimethyldioctadecylammonium bromide (DDA) and certain linear polyoxypropylenepolyoxyethylene (POP-POE) block polymers (Snippe et al., Int. Arch. Allergy Appl. Immunol. 65:390-398, 1981; and Hunter et al., J. Immunol. 127:1244-1250, 1981).

[0135] The term "specific" may be used to refer to situations in which one member of a specific binding pair will not show any significant binding to molecules other than its specific binding partner(s). The term is also applicable, for example, where an antigen binding domain is specific for a particular epitope carried by many antigens, in which case a specific binding member carrying that antigen binding domain will be able to bind to a variety of antigens carrying that epitope.

[0136] The term "comprise" is generally used in the sense of including, that is, allowing for the presence of one or more features or components.

[0137] The term "consisting essentially of" refers to a product, particularly a peptide sequence, having a defined number of residues that is not covalently attached to a larger product. In the case of the peptides of the invention mentioned above, it will be understood by those skilled in the art that minor modifications to the N- or C-terminus of the peptide are contemplated, such as chemical modifications to the termini to add protecting groups, for example, amidation of the C-terminus.

[0138] The term "isolated" refers to a state in which the specific binding members of the present invention or the nucleic acid encoding such binding members will be according to the present invention. Members and nucleic acids will be free of or substantially free of the material naturally associated with them, such as other polypeptides or nucleic acids found together with them in their natural environment or the environment (e.g., cell culture) in which they are prepared, wherein such preparation is carried out by the recombinant DNA technology practiced in vitro or in vivo. Members and nucleic acids can be prepared together with diluents or adjuvants and still can be isolated for practical purposes - for example, if the member is used to coat microtiter plates for immunoassay, it will typically be mixed with gelatin or other carriers, or when used for diagnosis or therapy, it will be mixed with pharmaceutically acceptable carriers or diluents.

[0139] As used herein, "pg" means picogram, "ng" means nanogram, "ug" or "μg" means microgram, "mg" means milligram, "ul" or "μl" means microliter, "ml" means milliliter, and "l" means liter.

[0140] The terms "antibody," "anti-TGFβ1 antibody," "TGFβ1 antibody," "TGF-β1 antibody," "humanized TGFβ1 antibody," "TGFb1 antibody," and any variants not specifically listed herein are used interchangeably herein and as used throughout this application and claims refer to proteinaceous materials comprising single or multiple proteins and, by extension, having the properties described herein and Figure 7 、 8 , 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG, and 13A1-EH, as provided and characterized herein. The antibodies provided herein extend to those having the properties described herein and Figure 7 、 8, 10, 12, 13 and 26 (including CDR sequences SEQ ID NOs: 27, 28, 75, 9, 29, 64, 65, 67, 68, 69 and 30, 31, 14, 70, 72, 73, and variable region heavy chain sequences SEQ ID NOs: 18, 19, 17, 57, 58, 59 and variable region light chain sequences SEQ ID NOs: 22, 23, 24, 25, 26, 52, 53, 54, 55 and 56) and the activity profiles set forth herein and in the claims. Thus, proteins that exhibit substantially equivalent or altered activity are also contemplated. These modifications may be intentional, such as, for example, those obtained by site-directed mutagenesis, or may be accidental, such as those obtained by mutation in a host that is a producer of the complex or its named subunits. Additionally, the terms "antibody," "anti-TGFβ1 antibody," "TGFβ1 antibody," "TGF-β1 antibody," "humanized TGFβ1 antibody," and exemplary antibodies 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-2 A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG or 13A1-EH are intended to include within their scope the proteins specifically recited herein as well as all substantially homologous analogs and allelic variants.

[0141] In one aspect of the present invention, and particularly herein provided herein, are antibodies specific for the TGF-β isoform TGF-β1. In a specific aspect, the antibodies of the invention are humanized, including those wherein the antibodies have been modified to increase their similarity to naturally occurring human antibody variants. Such specific TGF-β1 antibodies bind to and recognize the TGF-β1 isoform and do not, or do not significantly, bind to or recognize alternative TGF-β isoforms, particularly TGF-β2 and TGF-β3. Examples of the TGF-β1-specific antibodies of the present invention are antibodies 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG, and 13A1-EH.

[0142] The amino acid residues described herein are preferably in the "L" isomeric form. However, any L-amino acid residue may be substituted with a residue in the "D" isomeric form, as long as the polypeptide retains the desired immunoglobulin binding functional properties. NH2 refers to the free amino group present at the amino terminus of the polypeptide. COOH refers to the free carboxyl group present at the carboxyl terminus of the polypeptide. In keeping with standard polypeptide nomenclature, J. Biol. Chem., 243:3552-59 (1969), the abbreviations for the amino acid residues are shown in the following corresponding table:

[0143] Correspondence table

[0144]

[0145] It should be noted that all amino acid residue sequences are represented herein by their left and right orientations in the conventional direction of the amino terminal to the carboxyl terminal. In addition, it should be noted that the dash indication at the beginning or end of the amino acid residue sequence is connected to the peptide bond of the sequence of one or more other amino acid residues. The above table is presented in order to associate the three-letter and one-letter notations that may alternately appear in this article.

[0146] A "replicon" is any genetic element (eg, plasmid, chromosome, virus) that functions as an autonomous DNA replication unit in vivo (ie, is capable of replicating under its own control).

[0147] A "vector" is a replicon, such as a plasmid, phage, or cosmid, to which another DNA segment may be attached so as to bring about the replication of the attached segment.

[0148] "DNA molecule" refers to a polymeric form of deoxyribonucleotides (adenine, guanine, thymine or cytosine) in its single-stranded form or double-stranded helix. This term refers only to the primary and secondary structures of the molecule and is not limited to any specific tertiary form. Thus, this term includes double-stranded DNA found, in particular, in linear DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes. When discussing the structure of a specific double-stranded DNA molecule, the sequence can be described herein according to the common convention of only giving the sequence along the non-transcribed strand of the DNA (i.e., the strand with a sequence homologous to the mRNA) in the 5' to 3' direction.

[0149] "Origins of replication" refer to those DNA sequences that participate in DNA synthesis.

[0150] A DNA "coding sequence" is a double-stranded DNA sequence that is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) end and a translation stop codon at the 3' (carboxyl) end. The coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. Polyadenylation signals and transcription termination sequences will typically be located at the 3' end of the coding sequence.

[0151] Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding sequence in a host cell.

[0152] " Promoter sequence " is a DNA regulatory region that is capable of binding the RNA polymerase in the cell and initiating transcription of the downstream (3 ' direction) coding sequence. For the purposes of limiting the present invention, the promoter sequence is bounded by the transcription start site at its 3 ' end and extends upstream (5 ' direction) to include the minimum number of bases or elements necessary for initiating transcription at a detectable level above background. The transcription start site (conveniently defined by mapping with nuclease S1) and the protein binding domain (consensus sequence) responsible for binding RNA polymerase will be found in the promoter sequence. Eukaryotic promoters will typically, but not always, contain a "TATA" box and a "CAT" box. In addition to the -10 and -35 consensus sequences, prokaryotic promoters also contain a Shine-Dalgarno sequence.

[0153] An "expression control sequence" is a DNA sequence that controls and regulates the transcription and translation of another DNA sequence. A coding sequence is "under the control" of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then translated into the protein encoded by the coding sequence.

[0154] A "signal sequence" may be included before the coding sequence. This sequence encodes a signal peptide located at the N-terminus of the polypeptide that communicates with the host cell to direct the polypeptide to the cell surface or to secrete the polypeptide into the culture medium. This signal peptide is removed by the host cell before the protein leaves the cell. Signal sequences are found in association with a variety of naturally occurring proteins in both prokaryotes and eukaryotes.

[0155] The term "oligonucleotide" as used herein in reference to the probes of the present invention is defined as a molecule composed of two or more, preferably more than three ribonucleotides. Its exact size will depend on many factors which in turn depend on the ultimate function and use of the oligonucleotide.

[0156] As used herein, term " primer " refers to oligonucleotide (no matter whether it is naturally occurring or synthetically produced as in the restriction digest of purification), and described oligonucleotide can serve as synthesis starting point when being placed in the condition of inducing synthesis and primer extension product complementary to nucleic acid chain (that is, in the presence of nucleotide and inducing agent (such as DNA polymerase) and under suitable temperature and pH).Primer can be single-stranded or double-stranded, and must be long enough to induce the synthesis of desired extension product in the presence of inducing agent.The exact length of primer will depend on many factors, including the use of temperature, primer source and method.For example, for diagnostic applications, depending on the complexity of target sequence, oligonucleotide primer typically contains 15-25 or more nucleotides, although it can contain less nucleotides.

[0157] Primers herein are selected to be "substantially" complementary to the different chains of specific target DNA sequences. This means that primers must be sufficiently complementary to hybridize with their corresponding chains. Therefore, the primer sequence does not need to reflect the exact sequence of the template. For example, non-complementary nucleotide fragments can be attached to the 5 ' end of the primer, and the remainder of the primer sequence is complementary to the chain. Alternatively, non-complementary bases or longer sequences can be interspersed in the primer, and condition is that the primer sequence and the sequence of the chain have enough complementarity to hybridize with it and thereby form a template for synthesizing extension products.

[0158] As used herein, the terms "restriction endonucleases" and "restriction enzymes" refer to bacterial enzymes, each of which cleaves double-stranded DNA at or near a specific nucleotide sequence.

[0159] When such DNA has been introduced into the interior of a cell, the cell has been "transformed" by exogenous or heterologous DNA. The transforming DNA may or may not be integrated (covalently linked) into the chromosomal DNA constituting the genome of the cell. For example, in prokaryotes, yeast, and mammalian cells, the transforming DNA may remain on an additional element (such as a plasmid). For eukaryotic cells, stably transformed cells are cells in which the transforming DNA has become integrated into the chromosome so that it is inherited by daughter cells via chromosome replication. The ability of eukaryotic cells to establish cell lines or clones consisting of colonies of daughter cells containing the transforming DNA demonstrates this stability." Clone" is a colony of cells derived from a single cell or a common ancestor by mitosis. A "cell line" is a primary cell clone that can stably grow many generations in vitro.

[0160] Two DNA sequences are "substantially homologous" when at least about 75% (preferably at least about 80%, and most preferably at least about 90% or 95%) of the nucleotides match over a defined length of the DNA sequence. Substantially homologous sequences are identified by comparing the sequences using standard software available in sequence databases or in, for example, Southern hybridization experiments under stringent conditions defined for the particular system. Defining appropriate hybridization conditions is within the skill of the art.

[0161] It will be appreciated that within the scope of the present invention are DNA sequences encoding specific binding members (antibodies) of the present invention, which DNA sequences encode for example Figure 10 、 11 , 12, 13 or 26 or comprising the amino acid sequence provided herein or Figure 7 、 8 , 10, 11, 12, 13 or 26, but degenerate thereto. "Degenerate to" means that different three-letter codons are used to specify a specific amino acid. It is well known in the art that the following codons can be used interchangeably to encode each specific amino acid:

[0162]

[0163] It will be appreciated that the codons specified above are for RNA sequences. The corresponding codons for DNA have T substituted for U.

[0164] In coding Figure 7 、 8, 10,11,12,13 and / or 26 and CDR sequence SEQ ID NO:27,64,65,28,29,75,9,67,68,69,70,30,72,31,14,73 in the sequence of the amino acid, antibody fragment, CDR region sequence listed can be mutated so that a specific codon becomes a codon encoding a different amino acid. Such mutation is usually carried out by changing the minimum nucleotides possible. Such substitution mutations can be carried out to change the amino acid in the resulting protein in a non-conservative manner (e.g., by changing a codon from an amino acid belonging to a grouping with a specific size or feature to an amino acid belonging to another grouping) or in a conservative manner (e.g., by changing a codon from an amino acid belonging to a grouping with a specific size or feature to an amino acid belonging to the same grouping). Such conservative changes generally result in less changes in the structure and function of the resulting protein. Non-conservative changes are more likely to change the structure, activity or function of the resulting protein. The invention encompasses sequences containing amino acid changes and substitutions, including conservative changes, that do not significantly alter the activity or binding characteristics of the resulting protein.

[0165] The following is an example of the various amino acid groupings:

[0166] Amino acids with nonpolar R groups

[0167] Alanine, valine, leucine, isoleucine, proline, phenylalanine, tryptophan, methionine

[0168] Amino acids with uncharged polar R groups

[0169] Glycine, serine, threonine, cysteine, tyrosine, asparagine, glutamine

[0170] Amino acids with charged polar R groups (negatively charged at pH 6.0)

[0171] Aspartic acid, glutamic acid

[0172] basic amino acids (Positively charged at pH 6.0)

[0173] Lysine, arginine, histidine (at pH 6.0)

[0174] Another grouping could be those amino acids with a phenyl group:

[0175] Phenylalanine, tryptophan, tyrosine

[0176] Another grouping can be based on molecular weight (i.e., the size of the R group):

[0177]

[0178] Particularly preferred substitutions are:

[0179] - Lys replaces Arg and vice versa, allowing the positive charge to be maintained;

[0180] -Glu replaces Asp and vice versa, allowing the negative charge to be maintained;

[0181] -Ser replaces Thr, allowing for the retention of a free -OH group; and

[0182] -Gln replaces Asn, allowing free NH2 to remain.

[0183] Exemplary and preferred conservative amino acid substitutions include any of the following:

[0184] Glutamine (Q) replaces glutamic acid (E) and vice versa; leucine (L) replaces valine (V) and vice versa; serine (S) replaces threonine (T) and vice versa; isoleucine (I) replaces valine (V) and vice versa; lysine (K) replaces glutamine (Q) and vice versa; isoleucine (I) replaces methionine (M) and vice versa; serine (S) replaces asparagine (N) and vice versa ; Leucine (L) replaces methionine (M) and vice versa; Lysine (L) replaces glutamate (E) and vice versa; Alanine (A) replaces serine (S) and vice versa; Tyrosine (Y) replaces phenylalanine (F) and vice versa; Glutamate (E) replaces aspartic acid (D) and vice versa; Leucine (L) replaces isoleucine (I) and vice versa; Lysine (K) replaces arginine (R) and vice versa.

[0185] Amino acid substitutions can also be introduced to replace amino acids with particularly preferred properties. For example, a Cys can be introduced into a potential site to form a disulfide bridge with another Cys. His can be introduced as a particularly "catalytic" site (i.e., His can act as an acid or a base and is the most common amino acid in biochemical catalysis). Pro may be introduced due to its particularly planar structure, which induces a beta-turn in the protein structure.

[0186] Two amino acid sequences are "highly homologous" or "substantially homologous" when at least about 70% of the amino acid residues (preferably at least about 80%, and most preferably at least about 90% or 95%) are identical or represent conservative substitutions. The CDR regions of two antibodies are substantially homologous when one or more, or one or several, or one to three, or one or two amino acids are substituted with similar or conservative amino acids, and wherein one antibody / antibodies have one or more of the antibodies disclosed herein, particularly antibodies 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2G, 13A1-2H, 13A1-2V ... The antibodies can be substantially homologous in that one, two, or three amino acids, or up to three amino acids, in the CDR domain regions, wherein one, two, three, or four, or up to four amino acids, are substituted with another amino acid, and wherein the antibody retains the antibody binding and activity profile.

[0187] Exemplary CDR domain amino acid substitutions are provided herein. Thus, according to the present invention, antibody CDR domain sequences, particularly the 13A1 murine antibody CDR domain sequences, have been modified, thereby providing amino acid substitutions and variant CDR domain sequences thereof in the antibodies herein. According to the present invention, antibodies of the present invention comprising novel, variant, or altered CDR domain sequences from the murine 13A1 antibody significantly retain TGFB-1 binding, specificity, and neutralization, and possess further improved properties, including variable region sequences, particularly including framework region sequences, that have increased similarity to naturally occurring human antibody variants. Therefore, according to the present invention, a TGF-β1 antibody, in particular a TGF-β1 specific antibody, is provided, which has a heavy chain variable region comprising a CDR1 sequence TNYWMH (SEQ ID NO: 27), NYWMH (SEQ ID NO: 64) or NYWTH (SEQ ID NO: 65), a CDR2 sequence TIYPGNSDTNYNQKFK (SEQ ID NO: 28), TIYPGNSDTNYNQKFQ (SEQ ID NO: 29) or TIYPGNSDTNYNQKFKD (SEQ ID NO: 75), and a CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9), EDSRSLNFNGWDYFDY (SEQ ID NO: 67), EDSRSLYYNGWDYFDH (SEQ ID NO: 68) or EDSRSLNFNGWDYFDH (SEQ ID NO: 69); or a CDR1 sequence TNYWMH (SEQ ID NO: 27), NYWMH (SEQ ID NO: 64) or NYWTH (SEQ ID NO: 65), a CDR2 sequence TIYPGNSDTNYNQKFK (SEQ ID NO: 28), TIYPGNSDTNYNQKFQ (SEQ ID NO: 29) or TIYPGNSDTNYNQKFKD (SEQ ID NO: 75), and a CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9), EDSRSLNFNGWDYFDY (SEQ ID NO: 67), EDSRSLYYNGWDYFDH (SEQ ID NO: 68) or EDSRSLNFNGWDYFDH (SEQ ID NO: 69). NO:27), CDR2 sequence TIYPGNSDTNYNQKFK (SEQ ID NO:28) and CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO:9); or CDR1 sequence TNYWMH (SEQ ID NO:27), CDR2 sequence TIYPGNSDTNYNQKFQ (SEQ ID NO:29) and CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO:9); or CDR1 sequence TNYWMH (SEQ ID NO:27), CDR2 sequence TIYPGNSDTNYNQKFK (SEQ ID NO:28) or TIYPGNSDTNYNQKFQ (SEQ ID NO:29) and CDR3 sequence EDSRSLYYNGW (SEQ ID NO:76).In a further aspect, an antibody of the invention may comprise a light chain variable region sequence comprising a CDR1 sequence of RASESVDNYGISFLN (SEQ ID NO:30), KSSESVDNYGISFLN (SEQ ID NO:70) or RASESVDNYGISLLN (SEQ ID NO:72), a CDR2 sequence of AASNQGS (SEQ ID NO:31), and a CDR3 sequence of QQSKEVPRT (SEQ ID NO:14) or QQSKEVPR (SEQ ID NO:73).

[0188] The present invention provides a TGF-β1 antibody or a fragment thereof, wherein the antibody or fragment comprises a heavy chain variable region sequence comprising a CDR1 sequence NYWTH (SEQ ID NO: 65); a CDR2 sequence selected from TIYPGNSDTNYNQKFK (SEQ ID NO: 28) and TIYPGNSDTNYNQKFQ (SEQ ID NO: 29); and a CDR3 sequence selected from EDSRSLNFNGWDYFDY (SEQID NO: 67), EDSRSLYYNGWDYFDH (SEQ ID NO: 68) and EDSRSLNFNGWDYFDH (SEQ ID NO: 69). In one aspect, the present invention provides a TGF-β1 antibody or a fragment thereof, wherein the antibody or fragment comprises a heavy chain variable region sequence comprising a CDR1 sequence NYWTH (SEQ ID NO: 65); a CDR2 sequence selected from the group consisting of TIYPGNSDTNYNQKFK (SEQ ID NO: 28), TIYPGNSDTNYNQKFQ (SEQ ID NO: 29) and TIYPGNSDTNYNQKFKD (SEQ ID NO: 75); and a CDR3 sequence selected from the group consisting of EDSRSLNFNGWDYFDY (SEQ ID NO: 67), EDSRSLYYNGWDYFDH (SEQ ID NO: 68) and EDSRSLNFNGWDYFDH (SEQ ID NO: 69). In one aspect, the present invention provides a TGF-β1 antibody or a fragment thereof, wherein the antibody or fragment comprises a heavy chain variable region sequence comprising a CDR1 sequence NYWTH (SEQ ID NO: 65); a CDR2 sequence selected from the group consisting of TIYPGNSDTNYNQKFK (SEQ ID NO: 28), TIYPGNSDTNYNQKFQ (SEQ ID NO: 29) and TIYPGNSDTNYNQKFKD (SEQ ID NO: 75); and a CDR3 sequence selected from the group consisting of EDSRSLYYNGWDYFDY (SEQ ID NO: 9), EDSRSLNFNGWDYFDY (SEQ ID NO: 67), EDSRSLYYNGWDYFDH (SEQ ID NO: 68) and EDSRSLNFNGWDYFDH (SEQ ID NO: 69).In one aspect, the present invention provides a TGF-β1 antibody or fragment thereof, wherein the antibody or fragment comprises a heavy chain variable region sequence comprising a CDR1 sequence NYWTH (SEQ ID NO: 65); a CDR2 sequence selected from TIYPGNSDTNYNQKFK (SEQ ID NO: 28) or TIYPGNSDTNYNQKFQ (SEQ ID NO: 29); and a CDR3 sequence selected from EDSRSLYYNGWDYFDY (SEQ ID NO: 9) and EDSRSLNFNGW (SEQ ID NO: 76). In one aspect, the antibody or fragment comprises a heavy chain variable region sequence of SEQ ID NO: 58 or SEQ ID NO: 59. In a further aspect, the antibody or fragment further comprises a light chain variable region comprising a CDR1 sequence selected from the group consisting of KSSESVDNYGISFLN (SEQ ID NO: 70), RASESVDNYGISFLN (SEQ ID NO: 30), and RASESVDNYGISLLN (SEQ ID NO: 72); a CDR2 sequence AASNQGS (SEQ ID NO: 31); and a CDR3 sequence QQSKEVPRT (SEQ ID NO: 14) or QQSKEVPR (SEQ ID NO: 73). In one aspect, the antibody further comprises a light chain variable region sequence selected from the group consisting of SEQ ID NO: 22, 25, 26, 52, 53, 54, 55, or 56.

[0189] A "heterologous" region of a DNA construct is an identifiable DNA segment within a larger DNA molecule that is not found associated with the larger molecule in nature. Thus, when a heterologous region encodes a mammalian gene, the gene will typically be flanked by DNA that is not flanked by mammalian genomic DNA in the genome of the source organism. Another example of a heterologous coding sequence is a construct in which the coding sequence itself is not found in nature (e.g., a cDNA in which the genomic coding sequence contains introns, or a synthetic sequence with codons different from those of the native gene). Allelic variation or naturally occurring mutational events do not produce heterologous regions of DNA as defined herein.

[0190] When the expression control sequence controls and regulates the transcription and translation of the DNA sequence, the DNA sequence is "operably linked" to the expression control sequence. The term "operably linked" includes having an appropriate start signal (e.g., ATG) in front of the DNA sequence to be expressed, and maintaining the correct reading frame to allow the DNA sequence to be expressed under the control of the expression control sequence and to produce the desired product encoded by the DNA sequence. If the gene that one wishes to insert into the recombinant DNA molecule does not contain an appropriate start signal, such a start signal can be inserted in front of the gene.

[0191] The term "agent" is intended to refer to any molecule including polypeptides, antibodies, polynucleotides, chemical compounds and small molecules. In particular, the term agent includes compounds such as test compounds or drug candidate compounds.

[0192] The term "agonist" refers to a ligand that stimulates the binding of a receptor ligand in the broadest sense.

[0193] The term "assay" means any method used to measure a specific property of a compound. "Screening assay" means a method used to characterize or select compounds from a collection of compounds based on their activity.

[0194] The terms "preventing" or "prevention" refer to reducing the risk of acquiring or developing a disease or disorder (i.e., causing at least one clinical symptom of the disease to not develop) in a subject who may have been exposed to a causative agent or who is otherwise susceptible to the disease prior to the onset of the disease.

[0195] The term "prophylaxis" is related to and encompassed by the term 'prevention' and refers to measures or procedures intended to prevent, rather than treat or cure, a disease. Non-limiting examples of prophylaxis may include administering vaccines; administering low molecular weight heparin to hospitalized patients who are at risk of thrombosis, for example, due to immobilization; and administering antimalarial agents, such as chloroquine, prior to visiting geographic areas where malaria is prevalent or the risk of contracting malaria is high.

[0196] "Therapeutically effective amount" means an amount of a drug, compound, antimicrobial agent, antibody, or pharmaceutical agent that will elicit the biological or medical response in a subject that is being sought by a physician or other clinician. In particular, with respect to Gram-positive bacterial infections and the growth of Gram-positive bacteria, the term "effective amount" is intended to include an effective amount of a compound or agent that will result in a biologically meaningful increase in the amount or degree of tumor regression and or an increase in the length of survival or disease-free period or remission in a subject. As used herein, the phrase "therapeutically effective amount" means an amount sufficient to prevent, and preferably reduce by at least about 30 percent, more preferably by at least 50 percent, and most preferably by at least 90 percent, a clinically significant change in the growth or amount of tumor size, or to enhance survival or disease-free period by at least about 30 percent, more preferably by at least 50 percent, and most preferably by at least 90 percent.

[0197] In one embodiment, the terms "treating" or "treatment" of any disease or infection refer to ameliorating the disease or infection (i.e., preventing the growth of a disease or infectious agent or bacteria or reducing the expression, extent, or severity of at least one clinical symptom thereof). In another embodiment, "treating" or "treatment" refers to improving at least one physical parameter that the subject may not be able to discern. In yet another embodiment, "treating" or "treatment" refers to regulating a disease or infection physically (e.g., stabilization of discernible symptoms), physiologically (e.g., stabilization of a physical parameter), or both. In one other embodiment, "treating" or "treatment" relates to slowing the progression of a disease or reducing an infection.

[0198] As used herein, the term "one or more fibrotic conditions" or "one or more fibrotic diseases" refers to and includes conditions or diseases characterized by excessive or persistent scarring (particularly due to excessive or abnormal production, deposition of extracellular matrix), and is associated with abnormal accumulation of cells and / or fibronectin and / or collagen and / or increased recruitment of fibroblasts, and includes but is not limited to fibrosis of individual organs or tissues (such as the heart, kidney, liver, joints, lungs, pleural tissue, peritoneal tissue, skin, cornea, retina, musculoskeletal and digestive tract). In particular aspects, the term fibrotic disease refers to idiopathic pulmonary fibrosis (IPF), cystic fibrosis, other diffuse parenchymal lung diseases of varying etiology (including iatrogenic drug-induced fibrosis, occupational and / or environmentally induced fibrosis), granulomatous diseases (sarcoidosis, hypersensitivity pneumonitis), collagen vascular diseases, pulmonary alveolar proteinosis, Langerhans cell granulomatosis (Langerhans cell granulomatosis). cell granulomatosis), lymphangioleiomyomatosis, hereditary diseases (Hermansky-Pudlak syndrome, tuberous sclerosis, neurofibromatosis, metabolic storage disorders, familial interstitial lung disease), radiation-induced fibrosis, chronic obstructive pulmonary disease (COPD), scleroderma, bleomycin-induced pulmonary fibrosis, chronic asthma, silicosis, asbestos-induced pulmonary fibrosis, acute respiratory distress syndrome (ARDS), renal fibrosis, tubulointerstitial fibrosis, glomerulonephritis, focal segmental glomerulosclerosis, IgA nephropathy, hypertension, Alport syndrome, intestinal fibrosis, liver fibrosis, Cirrhosis, alcohol-induced liver fibrosis, toxic / drug-induced liver fibrosis, hemochromatosis, nonalcoholic steatohepatitis (NASH), biliary tract injury, primary biliary cirrhosis, infection-induced liver fibrosis, viral-induced liver fibrosis, autoimmune hepatitis, corneal scarring, hypertrophic scarring, Dupuytren's syndrome, keloids, cutaneous fibrosis, cutaneous scleroderma, systemic sclerosis, spinal cord injury / fibrosis, myelofibrosis, vascular restenosis, atherosclerosis, arteriosclerosis, Wegener's granulomatosis, and Peyronie's disease.

[0199] The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and typically do not produce an allergic reaction or similar adverse reactions (such as gastric upset, dizziness, and the like) when administered to a human.

[0200] As used herein, "pg" means picogram, "ng" means nanogram, "ug" or "μg" means microgram, "mg" means milligram, "ul" or "μl" means microliter, "ml" means milliliter, and "l" means liter.

[0201] B. Detailed disclosure content.

[0202] The present invention provides antibodies against transforming growth factor beta 1 (TGF-β1) for diagnostic and therapeutic purposes. In particular, antibodies specific for TGF-β1 are provided, wherein the antibody recognizes and is capable of binding to human and mouse TGF-β1 and does not recognize or bind to other TGFβ forms, in particular the antibody does not recognize or bind to TGF-β2 or TGF-β3, or does not bind to TGF-β2 or TGF-β3 less significantly. In particular, the antibodies of the present invention are humanized and are modified or contain amino acid substitutions to increase their similarity to naturally occurring antibody variants thereof, while retaining or enhancing their TGF-β1 specificity and neutralizing effect, including to enhance their suitability, acceptability and effectiveness in humans and for human diseases and disorders. Exemplary such TGF-β1 antibodies are particularly provided herein. Exemplary antibodies include antibodies 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG , 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG and 13A1-EH. Exemplary antibodies include antibodies comprising the heavy chain sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 17, SEQ ID NO: 57, SEQ ID NO: 58, or SEQ ID NO: 59. Exemplary antibodies include antibodies comprising the heavy chain sequence of SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 17. Exemplary antibodies include antibodies comprising the heavy chain sequence of SEQ ID NO: 18 or SEQ ID NO: 19. Exemplary antibodies include antibodies comprising the heavy chain sequence of SEQ ID NO: 57, SEQ ID NO: 58, or SEQ ID NO: 59. Exemplary antibodies include antibodies comprising the heavy chain sequence of SEQ ID NO: 58 or SEQ ID NO: 59. The present invention particularly provides antibodies or active fragments thereof that recognize and neutralize TGF-β1, particularly wherein the antibodies or active fragments do not recognize or neutralize TGF-β2 or TGF-β3. The present invention particularly provides antibodies or active fragments thereof that recognize and neutralize TGF-β1, particularly wherein the antibody or active fragment does not bind to TGF-β2 or TGF-β3 in a less significant manner.

[0203] In a general aspect, the present invention provides TGF-β1 antibodies directed against human and mouse TGF-β1 that neutralize TGF-β1 activity. In one aspect, such an antibody comprises a heavy chain variable region comprising a CDR1 sequence of TNYWMH (SEQ ID NO: 27), NYWMH (SEQ ID NO: 64), or NYWTH (SEQ ID NO: 65), a CDR2 sequence of TIYPGNSDTNYNQKFK (SEQ ID NO: 28), TIYPGNSDTNYNQKFQ (SEQ ID NO: 29), or TIYPGNSDTNYNQKFKD (SEQ ID NO: 75), and a CDR3 sequence of EDSRSLYYNGWDYFDY (SEQ ID NO: 9), EDSRSLNFNGWDYFDY (SEQ ID NO: 67), EDSRSLYYNGWDYFDH (SEQ ID NO: 68), or EDSRSLNFNGWDYFDH (SEQ ID NO: 69); or a CDR1 sequence of TNYWMH (SEQ ID NO: 27), a CDR2 sequence of TIYPGNSDTNYNQKFK (SEQ ID NO: 28), TIYPGNSDTNYNQKFQ (SEQ ID NO: 29), or TIYPGNSDTNYNQKFKD (SEQ ID NO: 75). NO: 28), and CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9); or CDR1 sequence TNYWMH (SEQ ID NO: 27), CDR2 sequence TIYPGNSDTNYNQKFQ (SEQ ID NO: 29), and CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9). In a further aspect, the antibody of the present invention may comprise a light chain variable region sequence comprising CDR1 sequence RASESVDNYGISFLN (SEQ ID NO: 30), KSSESVDNYGISFLN (SEQ ID NO: 70), or RASESVDNYGISLLN (SEQ ID NO: 72), CDR2 sequence AASNQGS (SEQ ID NO: 31), and CDR3 sequence QQSKEVPRT (SEQ ID NO: 14) or QQSKEVPR (SEQ ID NO: 73). In a further aspect, an antibody of the invention may comprise a light chain variable region sequence comprising a CDR1 sequence of RASESVDNYGISFLN (SEQ ID NO: 30), a CDR2 sequence of AASNQGS (SEQ ID NO: 31), and a CDR3 sequence of QQSKEVPRT (SEQ ID NO: 14).In one such aspect, the present invention provides a TGF-β1 antibody comprising a heavy chain sequence of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 17, SEQ ID NO: 57, SEQ ID NO: 58, or SEQ ID NO: 59. In one such aspect, the present invention provides a TGF-β1 antibody comprising a heavy chain sequence of SEQ ID NO: 18, SEQ ID NO: 19, or SEQ ID NO: 17. In one such aspect, the present invention provides a TGF-β1 antibody comprising a heavy chain sequence of SEQ ID NO: 18, SEQ ID NO: 19, or SEQ ID NO: 17. In one such aspect, the present invention provides a TGF-β1 antibody comprising a heavy chain sequence of SEQ ID NO: 18, SEQ ID NO: 19, or SEQ ID NO: 17. In one such aspect, the present invention provides a TGF-β1 antibody comprising a heavy chain sequence of SEQ ID NO: 18, SEQ ID NO: 19. In one such aspect, the present invention provides a TGF-β1 antibody comprising a heavy chain sequence of SEQ ID NO: 57, SEQ ID NO: 58, or SEQ ID NO: 59. Exemplary antibodies are provided herein, including antibodies 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG, and 13A1-EH. The present invention provides TGF-β1 antibodies directed against human and mouse TGF-β1 that do not cross-react or bind to TGF-β2 and / or TGF-β3 and specifically neutralize TGF-β1 activity. In a specific aspect, the antibodies of the present invention block TGF-β1-mediated signaling and / or TGF-β1-mediated cellular responses or cell proliferation. In a specific aspect, the present invention provides anti-TGF-β1 specific antibodies 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG or 13A1-EH. In a specific aspect, the present invention provides anti-TGF-β1 specific antibodies 13A1-2B, 13A1-2E and 13A1-2F. In a specific aspect, the present invention provides anti-TGF-β1 specific antibodies 13A1-2B and 13A1-2F.In one specific aspect, the present invention provides variant anti-TGF-β1 specific antibodies 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG or 13A1-EH. In another specific aspect, the present invention provides a TGF-β1 specific antibody capable of specifically binding to and neutralizing TGF-β1, comprising SEQ ID NO: 18, 19, 17, 57, 58 or 59 and. Figure 7 、 12 , 13 or 26. In another specific aspect, the present invention provides a TGF-β1-specific antibody capable of specifically binding to and neutralizing TGF-β1, which comprises SEQ ID NO: 18 or 19 or 17 and Figure 7 、 12 In another specific aspect, the present invention provides a TGF-β1-specific antibody capable of specifically binding to and neutralizing TGF-β1, comprising SEQ ID NO: 57, 58 or 59 and Figure 26 The heavy chain amino acid sequence is listed in .

[0204] In one aspect, a TGF-β1-specific antibody capable of specifically binding to and neutralizing TGF-β1 is provided, in particular wherein the antibody does not bind to or neutralize TGF-β2 or TGF-β3, and wherein the antibody comprises the heavy chain variable region sequence set forth in SEQ ID NO: 61. In one aspect, the TGF-β1-specific antibody further comprises the light chain variable region sequence set forth in SEQ ID NO: 60. In one aspect, a TGF-β1-specific antibody capable of specifically binding to and neutralizing TGF-β1 is provided, wherein the antibody does not bind to or neutralize TGF-β2 or TGF-β3, and wherein the antibody comprises the light chain variable region sequence set forth in SEQ ID NO: 60. In one aspect, a TGF-β1-specific antibody capable of specifically binding to and neutralizing TGF-β1 is provided, wherein the antibody does not bind to or neutralize TGF-β2 or TGF-β3, and wherein the antibody comprises the heavy chain variable region sequence set forth in SEQ ID NO: 61 and the light chain variable region sequence set forth in SEQ ID NO: 60.

[0205] In one aspect, the present invention provides a TGF-β1 antibody or a fragment thereof, wherein the antibody or fragment comprises a heavy chain variable region sequence comprising a CDR1 sequence NYWTH (SEQ ID NO: 65); a CDR2 sequence selected from TIYPGNSDTNYNQKFK (SEQ ID NO: 28) and TIYPGNSDTNYNQKFQ (SEQ ID NO: 29); and a CDR3 sequence selected from EDSRSLNFNGWDYFDY (SEQ ID NO: 67), EDSRSLYYNGWDYFDH (SEQ ID NO: 68), EDSRSLNFNGWDYFDH (SEQ ID NO: 69). In one aspect, the present invention provides a TGF-β1 antibody or fragment thereof, wherein the antibody or fragment comprises a heavy chain variable region sequence comprising a CDR1 sequence NYWTH (SEQ ID NO: 65); a CDR2 sequence selected from the group consisting of TIYPGNSDTNYNQKFKD (SEQ ID NO: 75); and a CDR3 sequence selected from the group consisting of EDSRSLNFNGWDYFDY (SEQ ID NO: 67), EDSRSLYYNGWDYFDH (SEQ ID NO: 68), and EDSRSLNFNGWDYFDH (SEQ ID NO: 69). In one aspect, the antibody or fragment comprises a heavy chain variable region sequence of SEQ ID NO: 58 or SEQ ID NO: 59. In one aspect, the antibody or fragment specifically binds to and neutralizes TGF-β1 and does not bind to or react with TGF-β2 or TGF-β3. In a further aspect, the antibody or fragment further comprises a light chain variable region comprising a CDR1 sequence selected from the group consisting of KSSESVDNYGISFLN (SEQ ID NO: 70), RASESVDNYGISFLN (SEQ ID NO: 30), and RASESVDNYGISLLN (SEQ ID NO: 72); a CDR2 sequence AASNQGS (SEQ ID NO: 31); and a CDR3 sequence QQSKEVPRT (SEQ ID NO: 14) or QQSKEVPR (SEQ ID NO: 73). In one aspect, the antibody further comprises a light chain variable region sequence selected from the group consisting of SEQ ID NO: 22, 25, 26, 52, 53, 54, 55, or 56. In one aspect, the antibody or fragment specifically binds to and neutralizes TGF-β1 and does not bind to or react with TGF-β2 or TGF-β3.

[0206] In another aspect, the present invention provides an antibody against TGF-β1, comprising a heavy chain variable region sequence and a light chain variable region, wherein the heavy chain variable region sequence comprises a CDR1 sequence CDR1 sequence TNYWMH (SEQ ID NO: 27), a CDR2 sequence TIYPGNSDTNYNQKFK (SEQ ID NO: 28), and a CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9); or a CDR1 sequence TNYWMH (SEQ ID NO: 27), a CDR2 sequence TIYPGNSDTNYNQKFQ (SEQ ID NO: 29), and a CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9), and the light chain variable region comprises a CDR1 sequence RASESVDNYGISFLN (SEQ ID NO: 30), a CDR2 sequence AASNQGS (SEQ ID NO: 31), and a CDR3 sequence QQSKEVPRT (SEQ ID NO: 14).

[0207] In another aspect of the invention, provided herein are one or more antibodies or one or more fragments thereof that bind to the same epitope of TGF-β1 (such as, in particular, human TGF-β1) as one or more antibodies described herein. In another embodiment, provided herein are one or more antibodies or one or more antigen-binding fragments thereof that compete with an antibody or antigen-binding fragment thereof described herein for binding to TGF-β1 (e.g., human TGF-β1). In a specific embodiment, provided herein are one or more antibodies or one or more antigen-binding fragments thereof that compete with an antibody or antigen-binding fragment thereof described herein for binding to TGF-β1 (e.g., human TGF-β1) to the extent that the antibody or antigen-binding fragment thereof described herein itself competes for binding to TGF-β1 (e.g., human TGF-β1).

[0208] The unique specificity and affinity of the antibodies and fragments of the present invention provide diagnostic and therapeutic uses for identifying, characterizing and targeting conditions associated with TGF-β1 expression, activity or activation. In particular, antibodies of the present invention that target TGF-β1 can be used to modulate immune responses. In one aspect thereof, antibodies of the present invention that target TGF-β1 can be used to modulate immune responses against cancer, cancer cells or tumor cells, and cancer antigens or tumor antigens. The antibodies can be applied to therapeutic treatment or management of cancer. The antibodies can be applied to enhance anti-cancer immune responses and enhance cancer vaccines. The antibodies can be applied to enhance the therapeutic effects of one or more radiotherapies, including anti-cancer and / or anti-cellular effects. In a specific aspect, the antibodies of the present invention can be applied to treat, manage and / or prevent cancer, including recurrence and metastasis of cancer. Applicable conditions include infectious diseases, cancer, host immune responses (including in transplantation) and immune diseases or disorders (such as autoimmune diseases or inflammatory conditions). Applicable cancers include adrenocortical carcinoma, AIDS-related cancers, AIDS-related lymphoma, anal cancer, anorectal cancer, anal canal cancer, appendix cancer, childhood cerebellar astrocytoma, basal cell carcinoma, skin cancer (non-melanoma), biliary tract cancer, extrahepatic bile duct cancer, intrahepatic bile duct cancer, bladder cancer, urinary bladder cancer, bone and joint cancer, osteosarcoma and malignant fibrous histiocytoma, brain cancer, brain tumor, brain stem glioma, cerebellar astrocytoma, brain astrocytoma / malignant glioma, ependymoma, neuroblastoma, cerebellar astrocytoma, cerebral astrocytoma / malignant glioma, cerebellar astrocytoma, basal cell carcinoma, skin cancer (non-melanoma), biliary tract cancer, extrahepatic bile duct cancer, intrahepatic bile duct cancer, bladder cancer, urinary bladder cancer, bone and joint cancer, osteosarcoma and malignant fibrous histiocytoma, brain cancer, brain tumor, brain stem glioma, cerebellar astrocytoma, brain astrocytoma / malignant glioma, ependymoma, neuroblastoma, cerebellar astrocytoma, cerebellar astrocytoma, cerebellar astrocytoma / malignant glioma, ependymoma, cerebellar astrocytoma, cerebellar astrocytoma, cerebellar astrocytoma / malignant gli ... Cytomas, supratentorial primitive neuroectodermal tumors, optic pathway and hypothalamic gliomas, breast cancer, bronchial adenoma / carcinoid, carcinoid tumors, gastrointestinal cancer, nervous system cancer, nervous system lymphoma, central nervous system cancer, central nervous system lymphoma, cervical cancer, childhood cancer, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic myeloproliferative disorders, colon cancer, colorectal cancer, cutaneous T-cell lymphoma, lymphoid neoplasms, mycosis fungoides fungoides), Seziary syndrome, endometrial cancer, esophageal cancer, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, eye cancer, intraocular melanoma, retinoblastoma, gallbladder cancer, gastric cancer (stomach cancer), gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), germ cell tumor, ovarian germ cell tumor, gestational trophoblastic tumor, glioma, head and neck cancer, hepatocellular (liver) cancer, Hodgkin lymphoma, hypopharyngeal cancer, intraocular melanoma, eye cancer, islet cell tumor (endocrine pancreas), Kaposi sarcoma, kidney cancer, renal cell cancercancer), laryngeal cancer, acute lymphocytic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, hairy cell leukemia, lip and oral cancer, liver cancer, lung cancer, non-small cell lung cancer, small cell lung cancer, AIDS-related lymphoma, non-Hodgkin lymphoma, primary central nervous system lymphoma, Waldenström's macroglobulinemia, medulloblastoma, melanoma, intraocular (eye) melanoma, Merkel cell carcinoma, malignant mesothelioma, mesothelioma, metastatic squamous neck cancer, oral cancer, tongue cancer, multiple endocrine neoplasia syndrome, mycosis fungoides, myelodysplastic syndrome, myelodysplastic / myeloproliferative disorders, chronic myeloid leukemia, acute myeloid leukemia, multiple myeloma, chronic myeloproliferative disorders, nasopharyngeal cancer, neuroblastoma, oral cancer, oral cavity cancer cancer), oropharyngeal cancer, ovarian cancer, ovarian epithelial cancer, ovarian low-grade malignant potential tumor, pancreatic cancer, islet cell pancreatic cancer, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pinealoma and supratentorial primitive neuroectodermal tumor, pituitary tumor, plasma cell neoplasm / multiple myeloma, pleuropulmonary blastoma, prostate cancer, rectal cancer, renal pelvis and ureter, transitional cell cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Ewing family of sarcoma tumors, Kaposi sarcoma, soft tissue sarcoma, uterine cancer, uterine sarcoma, skin cancer (non-melanoma), skin cancer (melanoma), Merkel cell skin cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, stomach cancer (gastric cancer), Cancer)), supratentorial primitive neuroectodermal tumors, testicular cancer, laryngeal cancer, thymoma, thymoma and thymic carcinoma, thyroid cancer, transitional cell carcinoma of the renal pelvis and ureter and other urinary organs, gestational trophoblastic tumor, urethral cancer, endometrial cancer, uterine sarcoma, uterine corpus cancer, vaginal cancer, vulvar cancer, and Wilm's Tumor. In one aspect, applicable cancers include or are selected from breast cancer, melanoma, prostate cancer, and lung cancer. In one aspect, the TGF-β1 antibody of the present invention can be used to treat or regulate breast cancer, melanoma, prostate cancer, or lung cancer.

[0209] Evidence for the production of TGFβ by tumor cells and myeloid-derived suppressor cells and the immunosuppressive activity of TGFβ at tumor sites supports that blocking TGFβ, particularly specifically blocking TGF-β1, can enhance antigen uptake, presentation, and activation of anti-tumor immune responses, including where the anti-tumor response is mediated by cancer antigens or antigen-directed T cells and / or mediated by therapeutic vaccines. In one aspect of the invention, one or more TGF-β1 antibodies, particularly one or more TGF-β1 neutralizing antibodies, can be combined with or administered in a composition of one or more cancer antigens and one or more adjuvants, including administration to a patient to promote more robust initiation and activation of adaptive anti-tumor responses to enhance immunotherapy against cancer. Additional inhibitors of TGFβ activity, such as small molecules, antisense or aptamers, can also be used to inhibit TGFβ activity, including or particularly TGF-β1.

[0210] Effective anti-tumor immunity requires modulating multiple arms of the host immune response and targeting pathways that contribute to tumor cell growth and survival. Combination agents that modulate the immune response and prevent tumor growth and progression can produce anti-cancer immunity and prevent tumor growth to improve clinical outcomes (Vanneman, M (2012) Nature Reviews Cancer (12): 237-251). Therefore, in one aspect of the invention, the one or more anti-TGF-β1 antibodies can be administered alone or in combination with other treatments, therapies or agents, simultaneously or sequentially, depending on the condition to be treated. Immunomodulators can be included in a composition having one or more TGF-β1 antibodies or administered together with one or more TGF-β1 antibodies and / or at different times to enhance immunomodulation and / or cancer therapy, including immunotherapy for cancer. Immunomodulators can be adjuvants. Applicable immunomodulators include IDO, TDO (Platten M (2012) Cancer Research 72(21):5435-40), α-galactosylceramide and its analogs (such as threitolceramide (ThrCer) and ThrCer 6), TLR ligands (such as poly I:C (TLR3), MPL (TLR4), imiquimod (TLR7), R848 (TLR8) or CpG (TLR9)), iCOS, CTLA-4, PD1, PD1 ligands, OX40 and OX40 ligands, Lag3, GITR, GITR ligand interleukins, tumor necrosis factor (TNF), or other growth factors that stimulate an immune response or the reduction or elimination of cancer cells or tumors, colony stimulating factors, T cell regulators (including CD8 +T cell regulators), cytokines or hormones (Mellman I (2011) Nature (480): 480-489). Additional immunomodulators are small molecules, antagonist antibodies or agonist antibodies that target applicable immunomodulators, including IDO, TDO, Toll-like receptor family or iCOS, CTLA-4, PD1, PD1 ligand, OX40 and OX40 ligand, interleukins, tumor necrosis factor (TNF), or other growth factors that stimulate immune response or reduction or elimination of cancer cells or tumors, colony stimulating factors, T cell regulators (including CD8 + T cell regulators), cytokines.

[0211] Additional immunomodulators, including TLR ligands such as poly I:C (TLR3), MPL (TLR4), imiquimod (TLR7), R848 (TLR8), or CpG (TLR9), can be used in combination with TGF-β1-specific neutralizing antibodies to produce enhanced immune stimulation and protection from conditions in which an effective immune system response is desired, such as infectious diseases or cancer.

[0212] One or more TGF-β1-specific antibodies can also be used as one or more immunostimulants or one or more adjuvants in combination with antigenic materials such as, but not limited to, proteins, peptides, or nucleic acids to generate a protective immune response, such as B cell and IgG antibody responses to the administered antigen. One or more TGF-β1-specific antibodies can also be used as one or more immunostimulants or one or more adjuvants in combination with antigenic materials such as, but not limited to, proteins, peptides, or nucleic acids to generate a protective immune response, such as T cell or CTL responses to the administered antigen.

[0213] Such antigenic materials can be and may include any material suitable for preventing or treating a / the specific disease. Specifically, with respect to cancer, examples of tumor-associated peptide and protein antigens that can be administered to induce or enhance an immune response are derived from tumor-associated genes and encoded proteins, including MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9, MAGE-A10, MAGE-A11, MAGE-A12, MAGE-A13, GAGE-1, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAG

[0013] Antigenic peptides that are characteristic of tumors include, for example, those listed in published PCT application WO 00 / 20581 (PCT / US99 / 21230), E-7, GAGE-8, BAGE-1, RAGE-1, LB33 / MUM-1, PRAME, NAG, MAGE-Xp2 (MAGE-B2), MAGE-Xp3 (MAGE-B3), MAGE-Xp4 (MAGE-B4), tyrosinase, tyrosinase, melanin-A (Melan-A), MAGE-C1, MAGE-C2, NY-ESO-1, LAGE-1, SSX-1, SSX-2 (HOM-MEL-40), SSX-1, SSX-4, SSX-5, SCP-1, and CT-7.

[0214] Other TGFβ- or TGF-β1-related disorders, diseases, or conditions that would benefit from treatment with anti-TGF-β1 antibodies include diseases characterized by extracellular matrix accumulation, diseases caused by activated TGF-β1 or circulating TGF-β1 at local sites, conditions caused by suppression of the immune system due to endogenous TGF-β1 production, acute immunodeficiency caused by severe injury, burns, and conditions such as viral or bacterial infections, multi-organ systemic diseases caused by TGF-β1 production or overproduction, and tumors that produce TGF-β1. Specific, non-limiting examples include disorders of neurons, glia, astrocytes, hypothalamus and other glands, macrophages, epithelial, stromal and blastocoel; fibrosis; scarring; tissue damage such as that caused by radiation; and adhesions during wound healing; fibrotic skin disorders such as scleroderma; CNS pathological scar tissue; dermal scarring; keloid scarring; and neural scarring; fibrotic diseases of the peritoneal cavity, lungs, liver and kidneys, such as chronic liver fibrosis, acute liver injury, interstitial lung and kidney fibrosis, and cirrhosis; cystic fibrosis; vascular disorders, such as myocardial fibrosis; arterial damage, such as atherosclerosis and arteriosclerosis; vascular disease; vasculopathy; renal disease; systemic sclerosis; infection, Such as macrophage pathogen infection and viral infection (such as hepatitis C and HIV); immunological disorders, angiogenic disorders and inflammatory disorders and defects (such as rheumatoid arthritis); ocular disorders, especially those involving ocular fibrosis, including proliferative retinopathy, retinal detachment, and glaucoma drainage surgery (such as the neural retina, retinal pigment epithelium-choroidal and vitreous of the human eye), and cataracts; osteoporosis; adult respiratory distress syndrome; post-myocardial infarction, restenosis after angioplasty; glomerulonephritis; diabetes-related conditions such as hyperglycemia, diabetes, diabetic kidney disease, diabetic nephropathy, diabetic neuropathy or retinopathy; and macrophage deficiency diseases.

[0215] In another specific embodiment, provided herein is a first antibody or antigen-binding fragment thereof that competes for binding to TGF-β1 (e.g., human TGF-β1) with an antibody or antigen-binding fragment thereof described herein, wherein the first antibody or antigen-binding fragment thereof competes for binding in an assay comprising the following steps: (a) incubating an ELISA plate coated with TGF-β1 with the first antibody or antigen-binding fragment thereof in unlabeled form; (b) adding a labeled antibody or antigen-binding fragment thereof described herein to the ELISA plate coated with TGF-β1 and incubating the TGF-β1-coated ELISA plate; and (c) detecting binding of the antibody or antigen-binding fragment thereof described herein to TGF-β1. In one aspect, antibody 13A1-2A or an antigen-binding fragment thereof, antibody 13A1-2B or an antigen-binding fragment thereof, antibody 13A1-2C or an antigen-binding fragment thereof, antibody 13A1-2D or an antigen-binding fragment thereof, antibody 13A1-2E or an antigen-binding fragment thereof, antibody 13A1-2F or an antigen-binding fragment thereof, or antibody 13A1-2G, 13A1-2H is detected after incubation with a first antibody or an antigen-binding fragment thereof. , 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG, and 13A1-EH, or an antigen-binding fragment thereof. In one aspect, binding of an antibody or antigen-binding fragment thereof comprising a heavy chain variable region sequence of SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 17 or SEQ ID NO: 57 or 58 or 59 is detected after incubation with a first antibody or antigen-binding fragment thereof. In one aspect, provided herein is a first antibody or antigen-binding fragment thereof that competes for binding to TGF-β1 (e.g., human TGF-β1) with an antibody or antigen-binding fragment thereof described herein, wherein the first antibody or antigen-binding fragment thereof competes for binding in an assay comprising the steps of: (a) incubating an ELISA plate coated with TGF-β1 with the first antibody or antigen-binding fragment thereof in unlabeled form; (b) adding the biotinylated antibody or antigen-binding fragment thereof described herein to the TGF-β1-coated ELISA plate and incubating the TGF-β1-coated ELISA plate; and (c) detecting binding of the antibody or antigen-binding fragment thereof described herein to TGF-β1.In this aspect, the labeled or biotinylated antibody or antigen-binding fragment thereof is selected from antibody 13A1-2A or an antigen-binding fragment thereof, antibody 13A1-2B or an antigen-binding fragment thereof, antibody 13A1-2C or an antigen-binding fragment thereof, antibody 13A1-2D or an antigen-binding fragment thereof, antibody 13A1-2E or an antigen-binding fragment thereof, antibody 13A1-2F or an antigen-binding fragment thereof, or any one of antibodies 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG, and 13A1-EH, or an antigen-binding fragment thereof. In one aspect, the binding of one or more of the antibodies or antigen-binding fragments 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG, or 13A1-EH is reduced, in particular significantly reduced, in the presence of the first antibody or antigen-binding fragment thereof in unlabeled form.

[0216] In another specific embodiment, provided herein is a first antibody, or antigen-binding fragment thereof, that competes for binding to TGF-β1 (e.g., human TGF-β1) with an antibody, or antigen-binding fragment thereof, described herein, wherein competition is manifested as a reduction in binding of the first antibody, or antigen-binding fragment thereof, to TGF-β1 (e.g., human TGF-β1) by more than 60% (e.g., 65%, 70%, 75%, 85%, 90%, 95%, or 98%, or between 60% and 65%, 65% and 70%, 70% and 75%, 75% and 80%, 80% and 85%, 85% and 95%, or 95% and 100%). In another specific embodiment, provided herein is a first antibody or antigen-binding fragment thereof that competes with an antibody or antigen-binding fragment thereof described herein for binding to TGF-β1 (e.g., human TGF-β3), wherein competition is exhibited in the presence of and / or after binding of the first antibody or antigen-binding fragment thereof, 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-2 The binding of an antibody or antigen-binding fragment of one or more of 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG, or 13A1-EH, or an antigen-binding fragment thereof, is reduced by more than 60% (e.g., 65%, 70%, 75%, 85%, 90%, 95%, or 98%, or between 60% and 65%, 65% and 70%, 70% and 75%, 75% and 80%, 80% and 85%, 85% and 95%, or 95% and 100%).

[0217] In specific aspects, provided herein are antibodies comprising (i) a Figure 8 、 10 , 12 or 13 or 26; and (ii) comprising a VL domain comprising VL CDR1, VL CDR2 and VL CDR3 of the amino acid sequence of the VL CDR of the antibody provided in Figure 7 、 10 , 12 or 13 or 26, wherein the VH domain of the antibody comprises VH CDR1, VH CDR2 and VH CDR3 of the amino acid sequence of the CDR of the antibody provided in , 12 or 13 or 26, competes (e.g., in a dose-dependent manner) for specific binding to TGF-β1 (e.g., human TGF-β1).

[0218] In a specific embodiment, provided herein are antibodies that compete (e.g., in a dose-dependent manner) for specific binding to TGF-β1 (e.g., human TGF-β1) with an antibody comprising the VH CDRs of antibody 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG, or 13A1-EH. In a specific embodiment, provided herein are antibodies that compete for specific binding to TGF-β1 (e.g., human TGF-β1) with an antibody comprising the VH and VL CDRs of antibody 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG, or 13A1-EH.

[0219] In specific aspects, provided herein are antibodies or antigen-binding fragments thereof that immunospecifically bind to a polypeptide comprising an amino acid sequence described herein (see, e.g., Figure 7 、 8 , 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG or 13A1-EH) that specifically binds to the same epitope as an epitope of TGF-β1, e.g., human TGF-β1. Assays known to those of skill in the art or described herein (eg, X-ray crystallography, ELISA assays, etc.) can be used to determine if two antibodies bind to the same epitope.

[0220] Panels of monoclonal antibodies that recognize human and murine TGF-β1 can be screened for various properties (i.e., isotype, epitope, affinity, etc.). Of particular interest are antibodies that mimic the exemplary antibodies 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-B ... The present invention discloses a novel inhibitory agent that has the following properties: 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG or 13A1-EH, and has affinity for human and mouse TGF-β1, does not react with TGF-β2 or TGF-β3, and directly affects the activity of TGF-β1, in particular neutralizes TGF-β1.

[0221] The monoclonal antibodies of the present invention may comprise a heavy chain variable region, such as exemplified in SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 17 or SEQ ID NO: 57, 58 or 59, and optionally a light chain variable region. Typically, the monoclonal antibodies comprise substantially Figure 7 and 8 The CDR regions of the listed amino acid sequences will be carried in structures that allow the CDR regions to bind to TGF-β1, and in particular to human and mouse TGF-β1.

[0222] "Essentially as set out..." means that the variable region sequences and / or in particular the CDR sequences of the invention will be Figure 7 、 8 , 10, 12, 13 and / or 26 designated regions are identical or highly homologous. "Highly homologous" contemplates that only a few substitutions may be made in the variable region sequence and / or in the CDR sequence, preferably from 1 to 8, preferably from 1 to 5, preferably from 1 to 4, or from 1 to 3, or 1 or 2 substitutions. The term "substantially as listed in ... includes particularly conservative amino acid substitutions that do not substantially or significantly affect the specificity and / or activity of the antibodies of the invention. Conservative and non-conservative amino acid substitutions are contemplated herein for variable region sequences and also for CDR region sequences.

[0223] Substitutions can be made in the variable region sequence outside of the CDRs to preserve the CDR sequence. Thus, changes in the variable region sequence or alternative non-homologous or veneered variable region sequences can be introduced or used such that the CDR sequence is preserved and the remainder of the variable region sequence can be substituted.

[0224] Alternatively, substitutions may be made, in particular in the CDRs. Exemplary CDR sequences for use with the antibodies of the invention, in particular antibodies 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG or 13A1-EH are described herein (inclusive of the CDR sequences in the original text). Figure 7 、 8 , 12, 13 and 26 and in SEQ ID NOs: 27, 28, 29, 75, 9, 65, 67, 68, 69, 30, 31, 70, 72, 73 and 14). Exemplary CDR sequences may include substitutions in the CDR sequences, particularly where amino acids in the CDR regions of the murine 13A1 antibody have been altered or substituted. Antibodies of the invention having substitutions as described and contemplated above are selected to retain activity and specificity commensurate with the exemplary antibodies (including antibodies 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG and / or 13A1-EH) and to have the characteristics as listed herein and in the claims.

[0225] There are several recognized and known methods and approaches for determining CDRs in antibodies. Currently, the most commonly used CDR identification methods are Kabat (Wu TT, Kabat EA (1970) J Exp Med 132:211-250; Kabat EA et al. (1983) Sequence of Proteins of Immunological Interest. Bethesda: National Institute of Health), IMGT (Lefranc MP et al. (2003) Dev Comp Immunol 27:55-77), and Chothia (Chothia C, Lesk AM (1987) J Mol Biol 196:901-917; Chothia C et al. (1989) Nature 342:877-883; Lefranc MP et al. (2003) Dev Comp Immunol 27:55-77). Each of these methods devises a unique residue numbering scheme according to which the hypervariable region residues are numbered and then determines the start and end of each of the six CDRs based on certain key positions. The IMGT and Kabat systems were used in this study. Although these different approaches can identify slightly shifted CDR sequences, they generally provide overlapping sequences and amino acids and can be combined to identify amino acids that should be maintained or conserved and those that may be suitable for variation or alteration while maintaining binding.

[0226] The substantial part of immunoglobulin variable domains will comprise at least three CDR regions together with the framework region therebetween.Preferably, the part will also comprise one or both of the first framework region and the fourth framework region of at least about 50%, and the 50% are the first framework region of C-terminal 50% and the fourth framework region of N-terminal 50%. The other residues at the N-terminal or C-terminal end of the substantial part of the variable domains can be those that are generally unrelated to naturally occurring variable domain regions. For example, the construction of the specific binding members of the present invention manufactured by recombinant DNA technology can result in the introduction of N-terminal or C-terminal residues encoded by the joint introduced to promote cloning or other manipulation steps. Other manipulation steps include introducing a joint to connect the variable domains of the present invention to other protein sequences as provided herein and / or known to those skilled in the art, including immunoglobulin heavy chain, other variable domains (for example, in the production of double antibodies) or protein tags.

[0227] Although in a preferred aspect of the present invention, comprising based on Figure 7 、 8Specific binding members based on a pair of binding domains having substantially the sequences set out in , 10, 12, 13 or 26 are preferred, but single binding domains based on these sequences, particularly based on the heavy and light chain CDRs, form further aspects of the invention. Figure 7 、 8 In the case of a binding domain having a sequence substantially as set forth in , 10, 12, 13 or 26, such a binding domain may be used as a targeting agent against TGF-β1, since it is known that immunoglobulin VH domains are capable of binding to target antigens in a specific manner.

[0228] Portions or domains of the antibodies of the invention are contemplated and incorporated herein, including any portion or domain, including those modified or fused to agents, labels, or other domains or fragments, wherein the portion or domain retains the characteristics of the antibodies herein, including TGF-β1 specific binding, and optionally, TGF-β1 specific neutralization, such as antibodies 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H ... A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A Exemplified by 1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG and 13A1-EH. The antibodies and antibody fragments of the present invention include smaller recombinant antibody fragments (e.g., classical monovalent antibody fragments (Fab, scFv) and engineered variants (diabodies, triabodies, minibodies and single domain antibodies) that retain the targeting specificity of the whole antibody (mAb) (for review, see Hollinger P and Hudson PJ (2005) Nature Biotech 23(9): 1126-1136).These include, for example, domain antibody (dAb) fragments, which comprise a single variable domain (Ward, ES et al., Nature 341, 544-546 (1989)); camelid antibodies; isolated complementarity-determining regions (CDRs); single-chain Fv fragments in which the VH and VL domains are connected by a peptide linker that allows the two domains to associate to form an antigen-binding site (Bird et al., Science, 242, 423-426, 1988; Huston et al., PNAS USA, 85, 5879-5883, 1988); diabodies, which are bivalent, bispecific antibodies in which the VH and VL domains are expressed on a single polypeptide chain, but using a linker that is too short to allow pairing between the two domains on the same chain, thereby forcing the domains to pair with the complementary domains of another chain and create two antigen-binding sites (WO 94 / 13804; P. Holliger et al. Proc. Natl. Acad. Sci. USA 90 6444-6448, (1993)); linear antibodies comprising a pair of tandem Fv segments (VH-CH1-VH-CH1) that form a pair of antigen binding regions together with complementary light chain polypeptides; multivalent antibody fragments (scFv dimers, trimers and / or tetramers (Power and Hudson, J Immunol. Methods 242: 193-2049 (2000)); and minibodies, which are composed of a constant immunoglobulin domain CH3 or CH4 (e.g., IgG1 (C. H 3) and IgE(C H4)) A bivalent molecule composed of a fused scFv, wherein a constant CH3 or CH4 domain is used as a dimerization domain (Olafsen T et al. (2004) Prot Eng Des Sel 17 (4): 315-323; Hollinger P and Hudson PJ (2005) Nature Biotech 23 (9): 1126-1136). These smaller antibodies and engineered variants or fragments can be produced more economically and can have other unique and superior properties for a range of diagnostic and therapeutic applications. For example, scFV2-Fc can accumulate in higher abundance in tumors or tissues, and miniantibodies are approximately 80 kD and are ideal for therapy due to their higher uptake in tissues, with faster clearance than intact immunoglobulins (150 kDa) or Fab'2 (110 kDa) and a better tissue-to-blood ratio. Antibody fragments can be engineered into multivalent and multispecific agents that are linked to therapeutic payloads such as radionuclides, toxins, enzymes, liposomes, and viruses and engineered to enhance therapeutic efficacy. Recently, single antibody domains have been engineered and selected as targeting agents against heretofore immunologically silent cavities in enzymes, receptors, and infectious agents.

[0229] The specific binding members of the present invention may further comprise an antibody constant region or a portion thereof. Figure 7 、 8 , 10, 12, 13 or 26 can be attached at its C-terminus to an antibody light chain constant domain, including a human Cκ or Cλ chain, preferably a Cλ chain. Figure 7 、 8 Specific binding members of the sequence of 1, 2, 3 or 4 may be attached at their C-termini to all or part of an immunoglobulin heavy chain derived from any antibody isotype (e.g., IgG, IgA, IgE, IgD and IgM) and any isotype subclass (particularly IgG1, IgG2b and IgG4). IgG1 is preferred.

[0230] The antibody or any fragment thereof can be conjugated or recombinantly fused to any cytotoxin, bacterial or other (e.g., pseudomonas) exotoxin, ricin or diphtheria toxin. The toxin portion used can be the entire toxin or any specific domain of the toxin. Such antibody-toxin molecules have been successfully used to target and treat different types of cancer, see, for example, Pastan, Biochim Biophys Acta. 1997 Oct 24; 1333(2): C1-6; Kreitman et al., N Engl J Med. 2001 Jul 26; 345(4): 241-7; Schnell et al., Leukemia. 2000 Jan; 14(1): 129-35; Ghetie et al., Mol Biotechnol. 2001 Jul; 18(3): 251-68.

[0231] Bispecific and trispecific multimers can be formed by the association of different scFv molecules and have been designed as cross-linking reagents for recruiting T cells to tumors (immunotherapy), for viral retargeting (gene therapy), and as hemoglobin agglutination reagents (immunodiagnostics), see, e.g., Todorovska et al., J Immunol Methods. 2001 Feb 1;248(1-2):47-66; Tomlinson et al., Methods Enzymol. 2000;326:461-79; McCall et al., J Immunol. 2001 May 15;166(10):6112-7.

[0232] Fully human antibodies can be prepared by immunizing transgenic mice that carry most of the heavy and light chains of human immunoglobulins. These mice are well known in the art, and an example of such mice is the Xenomouse TM (Abgenix, Inc.) (U.S. Patent Nos. 6,075,181 and 6,150,584), HuMAb-Mouse TM (Medarex, Inc. / GenPharm) (U.S. Patents 5,545,806 and 5,569,825), TransChromo Mouse TM (Kirin) and KM Mouse TM(Medarex / Kirin). Antibodies can then be prepared, for example, by standard hybridoma technology or by phage display. These antibodies will then contain only fully human amino acid sequences. Phage display can also be used to generate fully human antibodies from libraries. Phage display can be performed using methods well known to those skilled in the art and as provided herein, for example, in Hoogenboom et al. and Marks et al. (Hoogenboom HR and Winter G. (1992) J Mol Biol. 227(2):381-8; Marks JD et al. (1991) J Mol Biol. 222(3):581-97; and also U.S. Patents 5,885,793 and 5,969,108).

[0233] The antibodies of the present invention may be labeled with a detectable label or a functional label. Detectable labels include, but are not limited to, radioactive labels, such as isotopes 3 H. 14 C. 32 P. 35 S. 36 Cl, 51 Cr, 57 Co、 58 Co、 59 Fe, 90 Y. 121 I. 124 I. 125 I. 131 I. 111 In, 117 Lu, 211 At 198 Au, 67 Cu, 225 Ac, 213 Bi, 99 Tc and 186 Re, the radiolabel can be attached to the antibody of the present invention using conventional chemical methods known in the field of antibody imaging. Labels also include fluorescent labels (e.g., fluorescein, rhodamine, Texas Red) and labels conventionally used in the art for MRI-CT imaging. They also include enzyme labels, such as horseradish peroxidase, β-glucuronidase, β-galactosidase, urease. Labels further include chemical moieties that can be detected via binding to specific homologous detectable portions (e.g., labeled avidin), such as biotin. Functional labels include substances designed to target tumor sites to cause destruction of tumor tissue. Such functional labels include cytotoxic drugs, such as 5-fluorouracil or ricin; and enzymes capable of converting prodrugs into active drugs at the tumor site, such as bacterial carboxypeptidases or nitroreductases.

[0234] As used herein, " epi-position " is the term in this area and refers to the antigen local area that antibody can specifically bind.Epi-position can be, for example, the continuous amino acid of polypeptide (linear or continuous epi-position), or epi-position can be, for example, jointly from two or more discontinuous regions (conformation, non-linear, interrupted or discontinuous epi-position) of one or more polypeptide.In certain embodiments, the epi-position that antibody is combined can be determined by, for example, NMR spectroscopy, X-ray diffraction crystallography research, ELISA determination, with mass spectrometry (for example, MALDI mass spectrometry) coupled hydrogen / deuterium exchange, array-based oligopeptide scanning determination and / or mutagenesis mapping (for example, site-directed mutagenesis mapping).

[0235] In certain aspects, competition binding assays can be used to determine whether an antibody is competitively blocked by another antibody, e.g., in a dose-dependent manner, e.g., an antibody binds to substantially the same epitope or overlapping epitope as a reference antibody when the two antibodies recognize the same or spatially overlapping epitope in a competition binding assay that can be configured in all number of different formats using labeled antigen or labeled antibody, such as a competition ELISA assay. In a specific embodiment, the antibody can be tested in a competition binding assay with an antibody described herein (e.g., 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG, or 13A1-EH).

[0236] In addition, antibodies that recognize and bind to the same or overlapping epitopes of TGF-β1 (e.g., human TGF-β1) can be identified using conventional techniques such as immunoassays (e.g., by demonstrating the ability of one antibody to block binding of another antibody to a target antigen, i.e., a competitive binding assay). Competitive binding assays can also be used to determine whether two antibodies have similar binding specificities for an antigen or epitope (including a specific epitope on an antigen or protein target). Competitive binding can be determined in an assay in which a test immunoglobulin inhibits specific binding of another antibody to a common antigen or target antigen. In one aspect, in competitive binding, binding of an antibody or antigen-binding fragment of the invention (including a TGFβ1 antibody described herein, e.g., including 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG, or 13A1-EH) is reduced in the presence of the immunoglobulin tested, and competitive binding is thereby assessed and determined and / or confirmed.

[0237] In certain aspects, competition binding assays can be used to determine whether an antibody is competitively blocked by another antibody, e.g., in a dose-dependent manner, e.g., an antibody binds to substantially the same epitope or overlapping epitope as a reference antibody when the two antibodies recognize the same or spatially overlapping epitope in a competition binding assay that can be configured in all number of different formats using labeled antigen or labeled antibody, such as a competition ELISA assay. In a specific embodiment, the antibodies can be tested in a competitive binding assay using a TGF-β1 antibody described herein (e.g., including 13A1-2A, 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG, or 13A1-EH). Competitive binding assays are well known in the art. Exemplary competitive binding assays are provided herein. For example, competition is demonstrated between the antibodies herein, including as described in the Examples and Figures.

[0238] In specific aspects, provided herein are antibodies or antigen-binding fragments thereof that bind to a protein comprising an amino acid sequence described herein (see, e.g., Figure 7 、 8 , 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG, or 13A1-EH) that specifically binds to the same epitope as an epitope of TGF-β1, e.g., human TGF-β1. In specific aspects, provided herein are antibodies or antigen-binding fragments thereof that bind to a protein comprising an amino acid sequence described herein (see, e.g., Figure 7 、 8 , 13A1-2B, 13A1-2C, 13A1-2D, 13A1-2E, 13A1-2F, 13A1-2G, 13A1-2H, 13A1-2I, 13A1-2J, 13A1-AF, 13A1-AG, 13A1-AH, 13A1-BF, 13A1-BG, 13A1-BH, 13A1-CF, 13A1-CG, 13A1-CH, 13A1-DF, 13A1-DG, 13A1-DH, 13A1-EF, 13A1-EG, or 13A1-EH) that specifically binds to an epitope that overlaps with an epitope of TGF-β1, e.g., human TGF-β1. Assays known to those skilled in the art or described herein (e.g., X-ray crystallography, ELISA assays, etc.) can be used to determine whether two antibodies bind to the same epitope. Competitive binding and also epitope binding can be assessed and determined using Biacore assays. Biacore can be used to determine the extent to which different antibodies interact with a single antigen or epitope, to assess protein-protein or antibody-protein interactions and to determine binding affinity.

[0239] TGF-β1 plays an important role in controlling the immune system and is both a tumor promoter and tumor suppressor. Studies of TGF-β1 in cancer provide a rationale for the therapeutic effects of blocking TGF-β1 signaling in human cancers. Overexpression of TGF-β ligands has been reported in most cancers, including in tumors resistant to conventional chemotherapy, and high TGF-β ligand levels in tumor tissue and / or serum are associated with early metastatic recurrence and / or poor patient outcome (Teicher, BA et al. (1997) In Vivo 11:463-472; Wojtowicz-Praga, S. (2003) Invest New Drugs 21:21-32; Ito, N., et al. (1995) Cancer Lett 89:45-48; Shariat, SF, et al. (2001) Cancer 92:2985-2992; Shariat, SF, et al. (2001) J Clin Oncol 19:2856-2864; Tsushima, H., et al. (2001) Clin Cancer Res 7:1258-1262; Rich, JN (2003) Front Biosci 8:e245-e260). Animal studies with pan-TGF-β antibodies have shown inhibition of tumor recurrence or metastasis in fibrosarcoma, colon cancer, and breast cancer (Terabe M et al. (2003) J Exp Med 198:1741-1752; Nam JS et al. (2008) Cancer Res 68(10):3835-3843) and reduced radiation-induced acceleration of metastatic breast cancer (Biswas S et al. (2007) 117:1305-1313). Evidence to date strongly supports that blocking TGFβ can enhance antigen uptake, presentation, and activation of anti-tumor immune responses mediated by therapeutic vaccines. Indeed, recent studies have demonstrated that blockade of TGF-β using the mouse TGF-β universal antibody ID11 (which recognizes TGF-β1, TGF-β2, and TGF-β3) activates TGF-β through CD8 +T cells and synergistically enhance tumor vaccines in animal models (Terabe M et al. (2009) Clin Cancer Res 15:6560-6569; Takaku S et al. (2010) Int J Cancer 126(7):1666). Radiotherapy has the potential to convert irradiated tumors into in situ vaccines (Formanti SC et al. (2012) Int J Radiat Oncol Biol Phys 84:870-880). In a recent study, in a preclinical model of metastatic breast cancer, a nonspecific TGF-β neutralizing antibody (1D11) administered during radiotherapy increased the ability of the therapy to induce T cell responses to endogenous tumor antigens (Vanpoille-Box C et al. (2015) Cancer Res 75(11):2232-2242). Additional PD-1 blockade enhances the effectiveness of radiotherapy with TGF-β antibodies.

[0240] TGF-β antibodies have been produced, and specific examples designated 1D11 and its humanized counterpart GC1008 have been evaluated in animal models and early human clinical trials and are provided and disclosed in patent applications, including WO2007076391, WO 2005097832, WO 2006086469, and 5,571,714. However, antibody 1D11 and its humanized counterpart are general TGF-β antibodies that recognize all forms of TGF-β, including TGF-β1, TGF-β2, and TGF-β3. Therefore, antibody 1D11 and its humanized counterpart do not provide specific and targeted regulation of TGF-β1.

[0241] Monoclonal antibodies obtained from another species other than humans (such as mice) by hybridoma technology can be humanized, which means that the non-human antibody is genetically engineered to be more human in order to avoid HAMA when infused into humans. Methods for humanizing antibodies are well known in the art, with complementary determining region (CDR) grafting and veneering (also known as resurfacing) being among the more common methods. These methods have been widely described in the literature and patents, see, for example, King "Applications and Engineering of Monoclonal Antibodies" Taylor and Francis, 1998; U.S. Patents 5,225,539, 5,530,101, 5,585,089, 5,859,205 and 6,797,492, each of which is incorporated herein by reference. Another common approach is the veneering (v) technique (Daugherty et al. (1991). Nucleic Acids Res. 19(9), 2471-6; U.S. Pat. No. 6,797,492; Padlan, EA (1991) Mol. Immunol. 28(4-5), 489-98; European Patent No. 519596), wherein surface exposed residues in the framework regions (different from those normally found in human antibodies) are substituted to minimize the immunogenicity of the antibody variable domain while retaining ligand binding properties.

[0242] Antibodies (including fragments thereof) may have certain diagnostic applications and may, for example, be used for the purpose of detecting and / or measuring conditions such as cancer, precancerous lesions, conditions associated with or resulting from hyperproliferative cell growth, and the like.

[0243] Radiolabeled specific binding members, particularly antibodies and fragments thereof, can be used for in vitro diagnostic techniques and in vivo radioimaging techniques and for radioimmunotherapy. In the case of in vivo imaging, the specific binding members of the present invention can be conjugated to imaging agents other than one or more radioisotopes, and the imaging agents include but are not limited to magnetic resonance image enhancers, wherein for example, the antibody molecule is loaded with a large amount of paramagnetic ions by a chelating group. The example of a chelating group includes EDTA, porphyrin, polyamine crown ethers and polyoximes. The example of a paramagnetic ion includes gadolinium, iron, manganese, rhenium, europium, lanthanum, holmium and fermium. In a further aspect of the present invention, radiolabeled specific binding members, particularly antibodies and fragments thereof, particularly radioimmunoconjugates can be used for radioimmunotherapy, particularly as radiolabeled antibodies for cancer therapy. In a further aspect, radiolabeled specific binding members, particularly antibodies and fragments thereof can be used for radioimmunotherapy-guided surgical techniques, wherein they can identify and indicate the presence and / or position of such cells before, during or after the operation of removing cancer cells, precancerous cells, tumor cells and overproliferation cells.

[0244] The immunoconjugates or antibody fusion proteins of the present invention (in which the specific binding members of the present invention, particularly antibodies and fragments thereof, are conjugated or attached to other molecules or agents) further include, but are not limited to, binding members conjugated to chemoablative agents, toxins, immunomodulators, cytokines, cytotoxic agents, chemotherapeutic agents or drugs.

[0245] Radioimmunotherapy (RAIT) has entered the clinic and demonstrated efficacy using various antibody immunoconjugates. 131 The humanized anti-carcinoembryonic antigen (anti-CEA) antibody hMN-14 (Behr TM et al. (2002) Cancer 94(4 Suppl):1373-81) was labeled with I and has been evaluated in medullary thyroid carcinoma. 90The same antibody that binds to the Y tag (Stein R et al. (2002) Cancer 94(1):51-61). Radioimmunotherapy using monoclonal antibodies has been evaluated and reported for non-Hodgkin's lymphoma and pancreatic cancer (Goldenberg DM (2001) Crit Rev Oncol Hematol 39(1-2):195-201; Gold DV et al. (2001) Crit Rev Oncol Hematol 39(1-2):147-54). Radioimmunotherapy methods using specific antibodies are also described in U.S. Patents 6,306,393 and 6,331,175. Radioimmunoguided surgery (RIGS) has also entered the clinic and demonstrated efficacy and usefulness, including the use of anti-CEA antibodies and antibodies against tumor-associated antigens (Kim JC et al. (2002) Int J Cancer 97(4):542-7; Schneebaum S et al. (2001) World J Surg 25(12):1495-8; Avital S et al. (2000) Cancer 89(8):1692-8; McIntosh DG et al. (1997) Cancer Biother Radiopharm 12(4):287-94).

[0246] Based on collecting and using the patient's own immune cells to treat cancer, adoptive cell transfer (ACT) is emerging as a new pillar of cancer therapy. There are several types of ACT, including TIL, TCR and CAR (Haanen et al. (2018) J Immunother Cancer 474:449-461). One approach uses immune cells that have infiltrated into the tumor and its surrounding environment, called tumor infiltrating lymphocytes (TIL). Another approach of ACT involves engineering the patient's T cells to express specific T cell receptors (TCR) to recognize tumor cell antigens (Mackall et al. (2019) Nature Medicine 25:1341-1355). Chimeric antigen receptors (CAR) use the part of synthetic antibodies directed against specific surface cell antigens, and CART cell therapy has made significant progress in clinical development. In CAR therapy, T cells are isolated from patients and genetically engineered to produce CAR, so that T cells recognize and attach to specific antigens on tumor cells. antigen CAR T-cell therapy directed against the B-cell antigen CD19 has proven successful in children and young adults with ALL and also in patients with lymphoma.

[0247] The TGF-β1 antibody of the present invention or its fragment can be further used to construct a chimeric antigen receptor (CAR), wherein the CAR comprises a binding domain, a transmembrane domain, a costimulatory signaling region and a signaling domain of a TGF-β1 antibody. In these and other embodiments, the antigen binding domain can be a Fab or scFv of a TGF-β1 antibody. In another embodiment, TGF-β1 is present in a tumor microenvironment or on cells in a tumor microenvironment. In yet other embodiments, the costimulatory signaling region comprises an intracellular domain of a costimulatory molecule, and the costimulatory molecule is selected from the group consisting of: CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, a ligand specifically bound to CD83, and any combination thereof.

[0248] T cells modified to express chimeric antigen receptors (CARs) and administered alone are suppressed in a hostile tumor microenvironment. As a non-limiting example, further modification of these cells to express secretable scFv (e.g., PD-1, PDL-1, or CTLA-4) (referred to as armored CAR) improves anti-tumor function due to its ability to regulate the tumor microenvironment and resist inhibitory factors (e.g., as described in U.S. Patent No. 10,124,023 and Brentjens et al. (2018) Nat Biotechnol 36 (9): 847-856). In one such embodiment, armored CARs expressing one or more TGF-β1 antibodies of the present invention (including one or more scFv thereof) are contemplated, wherein the TGF-β1 antibodies enhance CAR cell activity and block immunosuppression, including, for example, inhibition by endogenous TGF-β. In another embodiment, the TGF-β1 antibody of the present invention can be used in adoptive cell therapy (ACT), wherein the TGF-β1 antibody or fragment thereof will be genetically introduced into T cells (preferably, but not limited to, tumor infiltrating lymphocytes (TIL)) isolated from a cancer patient, and then, such T cells will be expanded and delivered back to the patient, whereby the T cells will target the tumor and express and secrete the TGF-β1 antibody or fragment thereof in the local tumor microenvironment to counteract the immunosuppressive environment there. In another embodiment, when delivered back to the patient for ACT, an exogenous TGF-β1 antibody or fragment thereof can be added to the expanded T cell population. As a non-limiting example, an exogenous TGF-β1 antibody or fragment thereof can be added to the expanded T cell population as described in WO 2019 / 086711 before being delivered back to the patient for ACT.

[0249] The TGF-β1 antibodies of the present invention can also be used in adoptive cell therapy (ACT), wherein the TGF-β1 antibody or fragment thereof will be genetically introduced into T cells isolated from a cancer patient, and then, such T cells will be expanded and delivered back to the patient, whereby the T cells will target the tumor and express the TGF-β1 antibody or fragment thereof in the local tumor microenvironment to counteract the immunosuppressive environment there. Preferably, the T cells used will be tumor infiltrating lymphocytes (TILs).

[0250] The skilled person can use in vivo cancer animal models or animal xenograft studies to further or additionally screen, evaluate and / or validate the specific binding members and antibodies or fragments thereof of the present invention, including further evaluating in vivo TGF-β1 regulation and inhibition and inhibition of tumor progression, recurrence, metastasis, or immune response to tumor cells or responses to antigens or vaccines (including tumor or cancer antigens or vaccines). Such animal models include, but are not limited to, models of immune response, immunomodulation, vaccination, cancer, and cancer metastasis. Models of cancers whose recurrence or metastasis is associated with elevated TGF-β1 levels are particularly susceptible to the antibodies of the present invention and are targeted by the antibodies of the present invention. Such cancers include melanoma, breast cancer, lung cancer, and prostate cancer. Exemplary and suitable models are known to the skilled person and are readily available, and include those cited and / or described herein and known in the art. For example, the antibodies or fragments thereof of the present invention can be evaluated in breast cancer models, including the tumorigenicity of human breast cancer cells in athymic mice (Arteaga CL et al. (1993) Cell Growth Diff 4: 193-201) or in Neu-induced mammary tumors (Muraoka-Cok RS et al. (2004) Cancer Res 64: 2002-2011), or the evaluation of metastasis of transgenic mammary tumors (Siegel PM et al. (2003) Proc Natl Acad Sci USA 100: 8430-8435). In addition, for example, the anti-tumor effect of TGF-β1 antibodies can be examined in the prevention of CT26 colon cancer tumors injected into syngeneic mice using a method similar to that reported by Takaku et al. (Takaku S et al. (2010) Int J Cancer 126 (7): 1666) using a whole cell vaccine.

[0251] The antibodies of the invention can be administered to a patient in need of treatment by any suitable route, including by injection (including intraperitoneal, intramuscular, subcutaneous, intravenous) into the bloodstream or CSF or directly into the tumor site or by intratumoral administration or intratumoral injection. The exact dose will depend on many factors, including whether the antibody is used for diagnosis or treatment, the size and location of the tumor, the exact nature of the antibody (whether whole antibody, fragment, diabody, etc.), and the nature of the detectable label or functional label attached to the antibody. In the case of therapy using a radionuclide, a suitable single dose may be about 45 mCi / m 2 Up to a maximum of approximately 250mCi / m 2 . The preferred dosage is in the range of 15 to 40 mCi, and the further preferred dosage is in the range of 20 to 30 mCi or 10 to 30 mCi. Such therapies may require bone marrow or stem cell replacement. Typical antibody dosages for tumor imaging or tumor treatment will be in the range of antibodies in the form of F(ab')2 from 0.5 to 40 mg, preferably from 1 to 4 mg. Naked antibodies are preferably administered in a dosage of 20 to 1000 mg protein / agent, or 20 to 500 mg protein / agent, or 20 to 100 mg protein / agent. This is a dosage for a single treatment of adult patients, which can be adjusted in proportion for children and infants, and can also be adjusted in proportion to the molecular weight for other antibody forms. According to the doctor's judgment, treatment can be repeated at intervals of once a day, twice a week, once a week, or once a month.

[0252] Pharmaceutical compositions and therapeutic compositions

[0253] The antibody and fragment of the present invention will generally be administered in the form of a pharmaceutical composition, which may also include at least one component in addition to the specific binding members. Therefore, in addition to the active ingredient, the pharmaceutical composition according to the present invention and for use according to the present invention may also include a pharmaceutically acceptable excipient, carrier, buffer, stabilizer or other materials well known to those skilled in the art. Such materials should be nontoxic and should not interfere with the effect of the active ingredient. The exact nature of the carrier or other materials will depend on the route of administration, which may be oral or by injection (e.g., intravenous) or by deposition at the tumor site.

[0254] The binding members and antibodies of the present invention and in a specific embodiment have Figure 7 、 8 , 10, 12, 13, 26, or a fragment thereof, and a single-chain, recombinant, or synthetic antibody derived therefrom (particularly comprising Figure 7 and Figure 8 Medium or Figure 12 、 13or SEQ ID NO:26, SEQ ID NO:27, 64, 65, 28, 29, 75, 9, 67, 68, 69, 30, 70, 72, 31, 14, 73) can be prepared in a pharmaceutical composition comprising a suitable vehicle, carrier or diluent, or comprising an adjuvant and / or immunomodulator for use in instances where therapy is appropriate, such as to treat cancer or stimulate or enhance an immune response, including an immune response against cancer. This pharmaceutical composition can also include means for regulating the half-life of a binding member, antibody or fragment by methods known in the art, such as pegylation. Such pharmaceutical compositions may further comprise additional antibodies or therapeutic agents.

[0255] The compositions of the present invention can be used individually or with other treatments, therapy or medicament combination and be used (simultaneously or sequentially, depending on the disease to be treated).In addition, the present invention contemplates and includes the compositions comprising binding members as herein described (particularly antibody or its fragment) and other medicaments or therapy (such as anticancer agent or therapy, antimitotic agent, apoptosis agent or antibody or immunomodulator or the small molecule inhibitor for immunomodulator).More generally, these anticancer agents can be tyrosine kinase inhibitors or phosphorylation cascade inhibitors, post-translational regulators, cell growth or division inhibitors (for example, antimitotic agent), inhibitor or signal transduction inhibitor.Other treatments or therapy can include the pain relief medicine using appropriate dose, such as nonsteroidal anti-inflammatory drug (for example, aspirin (aspirin), paracetamol (paracetamol), ibuprofen (ibuprofen) or ketoprofen) or opiate (opiate) (such as morphine or antiemetic). In addition, the composition can be administered together with an immunomodulator, such as α-galactosylceramide, interleukins, tumor necrosis factor (TNF), or other growth factors, colony stimulating factors, cytokines, or hormones that stimulate an immune response and the reduction or elimination of cancer cells or tumors. The composition can be administered together with an immunomodulator (such as an adjuvant). The composition can also be administered together with other anti-TGFβ antibodies, other immunomodulatory antibodies, or other anti-tumor antigen antibodies or can include a combination thereof. In one aspect, the composition is administered in combination with another antibody, particularly an anti-tumor antigen antibody.

[0256] The present invention also includes antibodies and fragments thereof that are covalently attached or otherwise associated with other molecules or agents. These other molecules or agents include, but are not limited to, molecules (including antibodies or antibody fragments) with different recognition characteristics, toxins, ligands, and chemotherapeutic agents. In a further aspect, the antibodies or fragments of the present invention can be used to target or direct therapeutic molecules or other agents, such as targeting molecules or agents to TGFβ-expressing cells or TGFβ-responsive cells, particularly TGF-β1-expressing or responsive cells, such as cells at a wound site, a tumor site, an inflammatory area, or a cancerous lesion.

[0257] Pharmaceutical compositions for oral administration can be in tablet, capsule, powder or liquid form. Tablets can include solid carriers, such as gelatin or adjuvants. Liquid pharmaceutical compositions typically include liquid carriers, such as water, petroleum, animal or vegetable oils, mineral oils or synthetic oils. Physiological saline solutions, glucose or other sugar solutions or glycols such as ethylene glycol, propylene glycol or polyethylene glycol can be included.

[0258] For intravenous injection or the injection at the diseased part, active component can be in the form of a parenteral acceptable aqueous solution, which is pyrogen-free and has suitable pH, isotonicity and stability. Those skilled in the art can prepare suitable solutions using, for example, isotonic vehicles (such as sodium chloride injection, Ringer's Injection, lactated Ringer's Injection). Preservatives, stabilizers, buffers, antioxidants and / or other additives can be included as needed.

[0259] Composition can be used individually or with other treatments, therapy or medicament combination and be used (simultaneously or sequentially, depending on the disease to be treated).In addition, the present invention contemplates and includes the composition comprising binding members as described herein (particularly antibody or its fragment) and other medicaments or therapy (such as anticancer agent or therapy, hormone, antimitotic agent, anti-apoptotic agent, antibody or immunomodulator).More generally, these anticancer agents can be but are not limited to tyrosine kinase inhibitors or phosphorylation cascade inhibitors, post-translational regulators, cell growth or division inhibitors (for example, antimitotic agent) or signal transduction inhibitors.Other treatments or therapies can include the use of pain relief drugs of suitable dose, such as nonsteroidal anti-inflammatory drugs (for example, aspirin, paracetamol, ibuprofen or ketoprofen) or opiates (such as morphine or antiemetics). The composition can be administered in combination (sequentially (i.e., before or after) or simultaneously) with a tyrosine kinase inhibitor (including but not limited to AG1478 and ZD1839, STI571, OSI-774, SU-6668), doxorubicin, temozolomide, cisplatin, carboplatin, nitrosoureas, procarbazine, vincristine, hydroxyurea, 5-fluorouracil, cytosine arabinoside, cyclophosphamide, epipodophyllotoxin, carmustine, lomustine and / or other chemotherapeutic agents. Thus, these agents can be specific anticancer agents or immune cell response modifiers, or can be more general anticancer and antineoplastic agents such as doxorubicin, cisplatin, temozolomide, nitrosoureas, procarbazine, vincristine, hydroxyurea, 5-fluorouracil, cytosine arabinoside, cyclophosphamide, epipodophyllotoxin, carmustine or lomustine. In addition, the composition can be administered with hormones (such as dexamethasone), immunomodulators such as interleukins, tumor necrosis factor (TNF), or other growth factors that stimulate, enhance or suppress immune responses and the reduction or elimination of cancer cells or tumors, colony stimulating factors, cytokines, agonists or antagonists antibodies to immune response modifiers. The composition can also be administered with other anti-tumor antigen antibodies or can include combinations thereof.

[0260] Additionally, the present invention contemplates and encompasses therapeutic compositions for use in combination with conventional radiation therapy using one or more antibodies or fragments.

[0261] The present invention further contemplates therapeutic compositions that can be used to practice the therapeutic methods of the present invention. The subject therapeutic compositions comprise a mixed pharmaceutically acceptable excipient (carrier) and one or more of a specific binding member or antibody, a polypeptide analog thereof, or a fragment thereof as an active ingredient as described herein. In one embodiment, the composition comprises an antigen that can modulate the specific binding of a binding member / antibody of the present invention to a target cell. In one embodiment, the composition comprises an antigen or vaccine formulation, particularly a tumor antigen or a cancer vaccine.

[0262] The preparation of therapeutic compositions containing polypeptides, analogs or active fragments as active ingredients is well known in the art. Typically, such compositions can be prepared as injectables in the form of liquid solutions or suspensions. However, solid forms suitable for dissolving or suspending in liquids before injection can also be prepared. The formulations can also be emulsified. Typically, the active therapeutic ingredient is mixed with a pharmaceutically acceptable excipient that is compatible with the active ingredient. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, and combinations thereof. In addition, if desired, the composition can contain a small amount of auxiliary substances, such as wetting agents or emulsifiers, or pH buffers that enhance the effectiveness of the active ingredient.

[0263] The polypeptide, analog or active fragment can be formulated into a therapeutic composition in the form of a neutralized pharmaceutically acceptable salt. Pharmaceutically acceptable salts include acid addition salts (formed with the free amino groups of the polypeptide or antibody molecule), and the acid addition salts are formed with inorganic acids (such as, for example, hydrochloric acid or phosphoric acid) or organic acids (such as acetic acid, oxalic acid, tartaric acid, mandelic acid, etc.). Salts formed from free carboxyl groups can also be derived from inorganic bases (such as, for example, sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide or ferric hydroxide) and organic bases (such as isopropylamine, trimethylamine, 2-ethylaminoethanol, histidine, procaine, etc.).

[0264] Alternative paradigms for cancer therapy using intratumoral immunomodulation and intratumoral immunity have been described and reviewed (Marabelle A et al. (2014) Clin Cancer Res 20(7):1747-1756). This paradigm is particularly effective for drug therapies (including immunostimulatory monoclonal antibodies) designed to interact with molecules that play a role in the activation of immune cells to reverse cancer-induced immune tolerance and promote anti-tumor immune responses (Marabelle A et al. (2014) Clin Cancer Res 20(7):1747-1756; Mellman I et al. (2011) Nature 480:480-489). Applying this paradigm to the antibodies and active fragments of the present invention is one aspect of the present invention. Direct delivery of immunostimulatory monoclonal antibodies to tumors to generate or promote systemic anti-tumor immune responses (including more potent anti-tumor responses that elicit less autoimmune toxicity or other side effects) and require less drug than systemically administered drugs or antibodies, delivery of antibodies in adjuvant around established tumors (anti-CTLA-4 Ab in a water-in-oil emulsion adjuvant (Montadine ISA51) around colon cancer tumors) eradicated local tumors and prevented overt tumor development (Fransen MF et al. (2013) Cancer Res 19:5381-5389).

[0265] The composition is administered in a manner compatible with the dosage formulation and in a therapeutically effective amount. The quantity to be administered depends on the ability of the subject to be treated, the subject's immune system to utilize the active ingredient, and the degree of desired peptide / MHC or tumor antigen binding ability. The precise amount of the active ingredient to be administered depends on the practitioner's judgment and is unique to each individual. Suitable regimens for initial administration and subsequent administration are also variable and may include initial administration, followed by repeated doses of subsequent injections or other administrations at intervals of one or more hours. Alternatively, continuous intravenous infusions sufficient to maintain appropriate and sufficient concentrations in the blood or at the desired treatment site are contemplated.

[0266] Diagnostic tests

[0267] The present invention also relates to various diagnostic applications, including methods for detecting elevated expression or presence of TGF-β1, TGF-β1-mediated cancer, or cancer more generally, by assessing the presence or amount of TGF-β1-responsive cells by reference to their ability to be recognized by one or more specific binding members of the present invention. The peptide complexes can be identified, targeted, labeled and / or quantified on cells including immune cells and / or tumor cells.

[0268] The diagnostic application of specific binding members of the present invention, particularly antibody and fragment thereof includes well-known and standard and based on the in vitro and in vivo application of this specification sheets for technical personnel.For in vitro assessment and evaluation of tumor and cancer state and tumor reaction or immune response diagnostic assay and test kit can be used for diagnosis, evaluation and monitoring patient sample, including known to have or suspect to have cancer, precancerous condition, the illness relevant to the cell growth of hyperproliferation or from tumor sample those.The assessment and evaluation of cancer, tumor and metastatic disease state can also be used to determine the patient to drug clinical trial or to administering the suitability of specific chemotherapeutic agent of the present invention or specific binding members, particularly antibody (including its combination) relative to different medicaments or binding members.This type of diagnostic monitoring and evaluation has been in the practice of using the antibody for HER2 protein in breast cancer (Hercep Test, Dako company), wherein the determination is also used for evaluating the patient for using the antibody therapy of Herceptin (Herceptin).In vivo application includes tumor imaging or assessment individual cancer state, including radiography.

[0269] Preferably, the antibody used in the diagnostic method of the present invention is a mouse antibody, a human antibody, a humanized antibody or a recombinant antibody. Preferably, the antibody is a single-chain antibody or a domain antibody. In addition, the antibody molecule used herein can be in the form of a Fab, Fab', F(ab')2 or F(v) portion of the whole antibody molecule, particularly a Fab.

[0270] The presence of TGF-β1 or TGF-β1 responsive cells or TGF-β1 responsive genes or proteins in cells can be determined by conventional in vitro or in vivo immunological procedures applicable to such determinations. Many useful procedures are known. Such procedures and their application are familiar to those skilled in the art and can therefore be used within the scope of the present invention.

[0271] In another embodiment of the present invention, commercial test kits suitable for use by medical professionals can be prepared to determine the presence or absence of aberrant expression (including, but not limited to, amplified TGF-β1) in suspected target cells. Based on the testing techniques discussed above, one such kit will contain at least the marker or its binding partner, such as an antibody specific therefor, and, of course, instructions, depending on the method selected. The kit may also contain peripheral reagents such as buffers, stabilizers, etc.

[0272] Thus, a test kit for demonstrating the presence or elevated levels of TGF-β1 or a TGF-β1 responsive element or protein may be prepared, the test kit comprising:

[0273] (a) a predetermined amount of at least one labeled immunochemically reactive component obtained by directly or indirectly attaching a specific binding member of the invention or its specific binding partner to a detectable label;

[0274] (b) other reagents; and

[0275] (c) Instructions for using the kit.

[0276] A test kit for demonstrating the presence of TGF-β1-mediated cancer (particularly selected from breast cancer, lung cancer, liver cancer, prostate cancer, bladder cancer) can be prepared, the test kit comprising:

[0277] (a) a predetermined amount of at least one labeled immunochemically reactive component obtained by directly or indirectly attaching a specific binding member of the invention or its specific binding partner to a detectable label;

[0278] (b) other reagents; and

[0279] (c) Instructions for use of the kit.

[0280] Based on the above, an assay system can be prepared for screening for potential drugs that effectively modulate the presence or activity of TGF-β1 and / or the activity or binding of the antibodies of the present invention. The antigenic peptide or binding member or antibody can be introduced into the test system, and the desired drug can also be introduced into the resulting cell culture, and the subsequent culture can be examined to observe any changes in cell activity, antibody binding, or the amount and degree of TGF-β1 caused by the addition of the desired drug alone or as a result of the addition of one or more known agents.

[0281] Nucleic Acids

[0282] The present invention further provides isolated nucleic acids encoding specific binding members of the present invention. Nucleic acids include DNA and RNA. In a preferred aspect, the present invention provides nucleic acids encoding polypeptides of the present invention as defined above, including Figure 7 、 8 , 10, 12, 13 and / or 26; or can encode the CDR region thereof, including SEQ ID NO: 27, 64, 65, 28, 29, 75, 9, 67, 68, 69, 70, 30, 72, 31, 14, 73.

[0283] The present invention also provides constructs in the form of plasmids, vectors, transcription or expression cassettes, which include at least one polynucleotide as above. The present invention also provides recombinant host cells, which include one or more constructs as above. The nucleic acid encoding any specific binding members as provided forms an aspect of the present invention, as does the method for producing specific binding members, which includes expressing from its encoding nucleic acid. Expression can be easily achieved by cultivating a recombinant host cell containing the nucleic acid under appropriate conditions. After production by expression, any suitable technology can be used to separate and / or purify the specific binding members, which can then be used as appropriate.

[0284] Can provide according to the specific binding members of the present invention and encoding nucleic acid molecule and carrier, it is for example from its natural environment with basically pure or homogeneous form or in the case of nucleic acid, do not contain or do not contain basically except the sequence of the polypeptide with the desired function of coding or the form of gene origin separation and / or purification.Nucleic acid according to the present invention can comprise DNA or RNA, and can be wholly or partially synthesized.

[0285] Systems for cloning and expressing polypeptides in a variety of different host cells are well known. Suitable host cells include bacteria, mammalian cells, yeast, and baculovirus systems. Suitable vectors can be selected or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator sequences, polyadenylation sequences, enhancer sequences, marker genes, and optionally other sequences. Optionally, the vector can be a plasmid (viral, for example, phage) or a phagemid.

[0286] Therefore, a further aspect of the present invention provides a host cell containing a nucleic acid as disclosed herein. A further aspect provides a method comprising introducing such a nucleic acid into a host cell. The introduction can be performed using any available technique. Following introduction, expression of the nucleic acid can be induced or allowed, for example, by culturing the host cell under conditions that express the gene. The present invention also provides a method comprising using the constructs described above in an expression system to express a specific binding member or polypeptide as described above.

[0287] Another feature of the present invention is the expression of the DNA sequence disclosed herein. As is well known in the art, the DNA sequence can be expressed by being operably linked to an expression control sequence in an appropriate expression vector and using the expression vector to transform an appropriate unicellular host. A variety of host / expression vector combinations can be used in expressing the DNA sequence of the present invention. Useful expression vectors, for example, can be composed of segments of chromosomes, non-chromosomes, and synthetic DNA sequences. Suitable vectors include derivatives of SV40 and known bacterial plasmids, such as Escherichia coli (E.coli) plasmids col E1, pCR1, pBR322, pMB9 and derivatives thereof, such as plasmids of RP4; phage DNA, such as numerous derivatives of phage λ, such as NM989, and other phage DNA, such as M13 and filamentous single-stranded phage DNA; yeast plasmids, such as 2u plasmids or derivatives thereof; vectors that can be used for eukaryotic cells, such as vectors that can be used for insect or mammalian cells; vectors derived from a combination of plasmids and phage DNA, such as plasmids modified to use phage DNA or other expression control sequences; etc.

[0288] Any of a wide variety of expression control sequences - sequences that control the expression of a DNA sequence to which it is operably linked - can be used in these vectors to express the DNA sequences of the invention. Such useful expression control sequences include, for example, the early or late promoters of SV40, CMV, vaccinia, polyoma, or adenovirus, the lac system, the trp system, the TAC system, the TRC system, the LTR system, the major operator and promoter region of bacteriophage lambda, the control region of the fd coat protein, the promoter of 3-phosphoglycerate kinase or other glycolytic enzymes, the promoter of acid phosphatase (e.g., Pho5), the promoter of yeast α-hybrid factor, and other sequences known to control gene expression in prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.

[0289] A variety of unicellular host cells can also be used to express the DNA sequences of the present invention. These hosts can include well-known eukaryotic and prokaryotic hosts in tissue culture, such as strains of Escherichia coli, Pseudomonas, Bacillus, Streptomyces; fungi, such as yeast; and animal cells, such as CHO, YB / 20, NSO, SP2 / 0, R1.1, BW and LM cells, African green monkey kidney cells (e.g., COS 1, COS 7, BSCl, BSC40 and BMT10), insect cells (e.g., Sf9), and human cells and plant cells.

[0290] It should be understood that not all vectors, expression control sequences and hosts will function equally well to express DNA sequence dna of the present invention. In the case of the same expression system, all hosts will not function equally well. However, without departing from the scope of the present invention, those skilled in the art will be able to select appropriate vectors, expression control sequences and hosts to complete desired expression without carrying out too many experiments.

[0291] As mentioned above, the DNA sequence encoding specific binding members can be synthetically prepared rather than cloned. DNA sequence can be designed with the appropriate codon for specific binding members amino acid sequence. Usually, if sequence is used for expression, people will select preferred codon for desired host. The complete sequence is assembled by overlapping oligonucleotides prepared by standard methods, and is assembled into complete coding sequence. Synthetic DNA sequence allows to easily build the gene that will express specific binding members analogs or " mutant protein ". Alternatively, the DNA encoding mutant protein can be manufactured by site-directed mutagenesis of natural specific binding members gene or cDNA, and conventional polypeptide synthesis can be used to directly prepare mutant protein.

[0292] The present invention may be better understood by reference to the following non-limiting examples, which are provided as illustrations of the invention. The following examples are presented in order to more fully illustrate preferred embodiments of the invention, but should in no way be construed as limiting the broad scope of the invention.

[0293] Example 1

[0294] Mouse TGFβ-1 antibody

[0295] TGF-β1 antibodies were successfully generated in mice using an autovaccination protocol. A panel of mouse anti-TGF-β1 antibodies was isolated, specifically including antibody 13A1. The mouse anti-TGF-β1 antibodies, their specificity for binding and neutralizing TGF-β1, and their sequences are described and provided in PCT / US2013 / 029334, published as WO 2013 / 134365, and published U.S. applications US2015-0132319 A1, now issued as U.S. Patent 9,518,112, and US2017-0137507 A1, now issued as U.S. Patent 10,035,851, which are incorporated herein by reference.

[0296] Murine TGFβ1 antibody 13A1 is described as having a heavy chain variable region sequence comprising the CDR1 sequence GYTFTNYWMH (SEQ ID NO: 7), CDR2 sequence TIYPGNSDTN (SEQ ID NO: 8), and CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9) or comprising the CDR1 sequence GYTFTNYW (SEQ ID NO: 10), CDR2 sequence IYPGNSDT (SEQ ID NO: 11), and CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9), and a light chain variable region comprising the CDR1 sequence ESVDNYGISF (SEQ ID NO: 12), CDR2 sequence YAAS (SEQ ID NO: 13), and CDR3 sequence QQSKEVPRT (SEQ ID NO: 14).

[0297] Example 2

[0298] TGFb signaling in the tumor microenvironment, particularly TGFb1 signaling, participates in the negative regulation of the effective immune response to cancer through multiple mechanisms. TGFb blockade can overcome this immunosuppression, especially when combined with other checkpoint-targeted drugs. This is an emerging and promising therapeutic approach in immuno-oncology clinically. Previously, a series of mouse monoclonal antibodies against TGFb were produced by immunizing mice with recombinant murine TGF protein isoforms TGFb1, TGFb2, and TGFb3. TGFb1 mouse monoclonal antibody clone 13A1 was selected for further development based on its high selectivity and specificity for both human and mouse TGFb1, its lack of binding to TGFb2 and TGFb3, and its in vitro and in vivo efficacy assays for its ability to block TGFb1 signaling (disclosed as U.S. Patent No. US 2015-0132319 A1, now issued as U.S. Patent No. 9,518,112, and US 2017-0137507 A1, now issued as U.S. Patent No. 10,035,851).

[0299] A project was initiated to generate humanized forms of the mouse TGFb1 antibody 13A1 with functional in vitro efficacy similar to or improved upon that of the original mouse mAb. Humanized antibodies may be more acceptable and useful in therapeutic applications for humans. Using sequence mutagenesis techniques driven by CDR / FR transplantation and functional efficacy assays, we engineered a series of humanized forms of the mouse mAb 13A1. Briefly, the antibodies were first expressed as scFv in E. coli for preliminary screening of binding to TGFb1 and then expressed as full-length human IgG1 or IgG4 antibodies in a transient mammalian cell system. Purified antibodies were screened by ELISA for blocking the binding of mouse 13A1 to TGFb1 and for their in vitro efficacy in inhibiting TGFb-induced signaling in a reporter cell line (TMLEC assay). From this screen, six antibodies with similar potency in functionally inhibiting TGFb1 signaling in TMLECs were selected: LCR13A1_VH_GLv3_LCR13A1_VK_GLv3 (LCR13A1-2A), LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv3 (LCR13A1-2B), LCR13A1_VH_GLv3_LCR13A1_VK_GLv1_03 (LCR13A1-2C), LCR13A1_VH_GLv3_LCR13A1_VK_GLv3 (LCR13A1-2D), v1_03_LCR13A1_VK_GLv1_03 (LCR13A1-2D), LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv1_04 (LCR13A1-2E), and LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv1_05 (LCR13A1-2F) were used for extended in vitro characterization, including binding specificity, binding kinetics, structural and physicochemical characteristics, such as small-scale expression yield, SEC profile, and thermal stability. Thus, new antibodies have been generated that are humanized and specific for TGF-β1 and have novel and unique heavy and light chain variable region sequences compared to the mouse antibody 13A1. Based on the characterization profiles, antibodies LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv3 (LCR13A1-2B) and LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv1_05 (LCR13A1-2F) were specifically selected for further preclinical characterization and development.

[0300] The following provides detailed materials and methods used in this and the following examples herein:

[0301] Materials and methods

[0302] LCR1901 was cloned as a scFv into the pCHV101 phage display vector

[0303] The VH and VK chains of the parental mouse LCR13A1 anti-TGFb1 mAb and its humanized CDR-grafted GLv1 variant were designed and synthesized as single open reading frame scFv and cloned into a phagemid vector (pCHV101).

[0304] The scFv host vector was digested to release the scFv insert as follows:

[0305]

[0306] The pCHV101 phagemid vector was digested similarly:

[0307]

[0308] The digest was incubated at 37°C for 1 h and electrophoresed on a 1% agarose gel. The insert band (approximately 770 bp) and the linearized pCHV101 vector (approximately 4830 bp) were gel extracted into 20 μl of warm (preheated at 65°C) 0.2x kit elution buffer (EB) diluted in PCR-grade HO using the Zymoclean Gel DNA Recovery Kit (Zymo Research, catalog number D4002).

[0309] Ligation was performed with an insert:vector ratio of 3:1:

[0310]

[0311] The ligation was incubated at room temperature for 20 minutes, and then 5 μl of the ligation mixture was transferred to 50 μl of E. coli competent cells. The cell / DNA mixture was incubated on ice for 10 min, and then 75 μl of 2xTYG was added and 125 μl of the diluted cells were streaked onto solid 2xTYAG selective agar plates. The plates were incubated at 37°C overnight.

[0312] Colonies were picked into 3 ml of liquid 2xTYAG medium and incubated at 37° C. Cloning vector DNA was prepared using the Vacuum PureYield plasmid miniprep system Quick protocol (Promega, catalog number FB093) and sequenced using primers pCHV101_SeqFOR1 (5′-CTGAAAGGAAGGATATAGAATGTGC-3′) (SEQ ID NO: 34) and PD1-2 (5′-GTCGTCTTTCCAGACGTTAG-3′) (SEQ ID NO: 35).

[0313] Phage / scFv ELISA

[0314] Miniprep clones containing the correct scFv sequence were electroporated into E. coli TG1 cells (Lucigen, catalog number 60502-1) and plated on selective 2xTYAG plates and incubated at 30°C for 18-20h. Ampicillin-resistant colonies were picked into 96-well U-bottom plates (Greinerbio-one, catalog number 650201) filled with 200 μl 2xTYAG and incubated overnight at 30°C, 750 rpm, 70% humidity. The cultures were then used for scFv and phage ELISA according to the following protocol:

[0315] Expression of soluble scFv

[0316] From the overnight plate, 4 μl of culture / well was transferred to a 96-well U-bottom plate containing 170 μl / well of TB medium supplemented with 0.1% glucose and 100 μg / ml ampicillin. The bacteria were grown for 4 h at 30°C, 750 rpm, and 70% humidity. scFv expression was induced by adding 20 μl of IPTG (diluted to 1 mM in TB medium) to obtain a final concentration of 100 μM. Soluble scFv expression was performed overnight at 30°C, 750 rpm, and 70% humidity for 16-18 h.

[0317] scFv-phage rescue

[0318] From overnight plate, 3.5 μ culture / well is transferred to the 96-well U-bottom plate containing the 2xTYAG in 100 μ l / well.Bacteria are grown 4 hours at 30 ℃, 750rpm, 70% humidity.In order to save phage particles, 100 μ l 2xTYAG / M13KO7 helper phage (Invitrogen (Invitrogen), catalog number (Cat. No.) 18311019) (200 μ l M13KO7 diluted to 10 ml 2xTYAG) (Invitrogen, catalog number (Cat. No.) 18311019) is added to each well, and plate is left standstill for 1 hour at 37 ℃.The culture (5 μ l / well) of infection is transferred to the new 96-well U-bottom plate of the 2xTY culture medium that is supplemented with the kanamycin of 50 μ g / ml and the ampicillin of 100 μ g / ml that is filled with 200 μ l / well. Rescue of phage displaying scFv was performed overnight at 30°C, 750 rpm, 70% humidity for 16-18 h.

[0319] ELISA

[0320] To perform ELISA, a 96-well maxisorp Nunc-immunoplate (Thermo Scientific, catalog number 2022-10) was coated overnight at 4°C with 50 μl / well of 500 ng / ml human recombinant TGF-b1 (Acrobiosystems, catalog number TG1-H4212), TGF-b2 (R&D Systems, catalog number 302-B2-010), and human recombinant TGF-b3 (Shenandoah Biotechnology, catalog number 100-109) in PBS. The wells were blocked by directly adding 230 μl of blocking solution (5% skim milk / 0.05% Tween 20 in PBS) without first washing the plate. Blocking was performed for 45 min with gentle agitation. Simultaneously, bacterial cultures containing expressed scFv and rescued phage were blocked by directly adding 120 μl of blocking solution. The blocked maxisorp plates were washed three times with PBST (PBS + 0.1% Tween 20) and 150 μl of blocked scFv or phage culture was applied to the wells. Incubation was carried out at room temperature for 1 h with gentle agitation and the wells were then washed 4x with PBST.

[0321] For scFv ELISA, 100 μ l of the first-level mouse 9E10 anti-cmyc Ab diluted 1 / 1000 in PBS+1% BSA is added to the wells, then incubated for 1 hour at room temperature under gentle agitation. The plate is washed 4 times with PBST, then 100 μ l of the second-level goat anti-mouse IgG (Fab) 2HRP conjugate (Sigma, catalog number A9917) diluted 1 / 10000 in PBS+1% BSA is added. The plate is incubated for 1 hour at room temperature under gentle agitation. By adding the TMB substrate (Thermo Fisher Scientific, catalog number 34021) of 100 μ l / wells, stabilizing with the stop solution (2N sulfuric acid) in 50 μ l / wells, and reading absorbance signals at 450 nm and 620 nm.

[0322] For phage ELISA, 100 μ l of a first-level rabbit anti-fd bacterial phage Ab (Sigma, catalog number B7786) diluted 1 / 1000 in PBS+1% BSA was added to the wells and then incubated for 1 h at room temperature under gentle agitation. The plate was washed 4 times with PBST, followed by addition of 100 μ l of a second-level mouse anti-rabbit IgG (γ-chain specific) HRP conjugate (Sigma, catalog number A1949) diluted 1 / 15000 in PBS+1% BSA. The plate was incubated for 1 h at room temperature under gentle agitation, then washed 5 times with PBST, then washed 2 times with PBS. ELISA was developed as above for the scFv plate.

[0323] Competitive screening of cloned variants (VK revertant framework library)

[0324] LCR13A1 GLv1 graft pairing was used as a starting point. For each chain, the contribution of the parent LCR13A1 mouse framework (Fr) region was studied. Due to the higher degree of homology with the human germline, only two 'revertant' fragments were synthesized for each chain, in which Fr1 and Fr2 were replaced by the mouse parent region. These four chains were randomly combined to produce a small population of scFv DNA clones containing one or two mouse Fr regions by sequential batch cloning into pCHV101. A competition experiment was then performed for the LCR13A1 mouse parent against a group of 13A1_GLv1 framework 'revertants'. After electroporation into TG1, scFv was expressed, and 80 clones randomly selected from 2xTYAG plates were subjected to competitive screening, in this case using 100 ng / mL of LCR13A1 mouse parent mAb as an ELISA competitor and anti-mouse Fc-HRP secondary colorimetric reagent.

[0325] Reconversion of scFv VH and VK chains to IgG1 / IgG4

[0326] The VH chain contained in the pCHV101 scFv vector was amplified using the following PCR primer mix (working stock of 10 μM total oligonucleotide).

[0327] NcoI FOR pool*

[0328] VH_Switch_FOR1 GAGGGTGGTTCTGGCGAGTCCAATGCSGCSGCA (SEQ ID NO:36) (10%) 1μM

[0329] VH_Switch_FOR2 GAGGGTGGTTCTGGCGAGTCCAATGCCRYGGCA (SEQ ID NO:37) (10%) 1μM

[0330] VH_Switch_FOR3 GAGGGTGGTTCTGGCGAGTCCAATGCCATGGCASEQ ID NO:38) (80%) 8μM

[0331] SalI REV Pool

[0332] HJSal_REV1 ATGGACCCTTG GTCGAC GCTGAGGAGACGGTGACCAGGGTTCC (SEQ ID NO:39) 2.5μM

[0333] HJSal_REV2 ATGGACCCTTG GTCGAC GCTGAGGAGACGGTGACCGTGGTCCC (SEQ ID NO:40) 2.5μM

[0334] HJSal_REV3 ATGGACCCTTG GTCGAC GCTGAGGAGACRGTGACCAGGGTSCC (SEQ ID NO:41) 2.5μM

[0335] HJSal_REV4 ATGGACCCTTG GTCGAC GCTGAAGAGACGGTGACCATTGTCCC (SEQ ID NO:42) 2.5μM

[0336] The VK chain contained in the pCHV101 scFv vector was amplified using the following PCR primer mix (working stock of 10 μM total oligonucleotide).

[0337] BssHII FOR POOL*

[0338] VLK_Switch_FOR1 CTGGCTCTTGGCGCGGCTAGCCCTG CSATSG CT (10%) (SEQ ID NO: 43) 1 μM

[0339] VLK_Switch_FOR2 CTGGCTCTTGGCGCGGCTAGCCCTG CGMKCG CT (10%) (SEQ ID NO: 44) 1 μM

[0340] VLK_Switch_FOR3 CTGGCTCTTGGCGCGGCTAGCCCTGT GCGCGC T(80%) (SEQ ID NO:45) 8 μM

[0341] NotI REV pool (κ)

[0342] KJNot_REV1 ACCACCAGATGGT GCGGCCGC AGTTCGTTTGATYTCCACCTTGG(SEQ ID NO:46) 2.5μM

[0343] KJNot_REV2 ACCACCAGATGGT GCGGCCGC AGTTCGTTTGATCTCCAGCTTGG (SEQ ID NO:47) 2.5μM

[0344] KJNot_REV3 ACCACCAGATGGT GCGGCCGC AGTTCGTTTGATATCCACTTTGG (SEQ ID NO:48) 2.5μM

[0345] KJNot_REV4 ACCACCAGATGGT GCGGCCGC AGTTCGTTTAATCTCCAGTCGTG (SEQ ID NO:49) 2.5μM

[0346] Set up the PCR reaction as follows:

[0347] VH - each reaction (50 μl)

[0348] 1μl scFv miniprep (20-30ng / μL)

[0349] 2 μl VH_Switch_FOR pool (10 μM total oligonucleotides)

[0350] 2 μl HJSal_REV pool (10 μM total oligonucleotides)

[0351] 20 μl PCR-grade HO

[0352] 25 μl 2x LongAmp Taq Master Mix (NEB; #M0287)

[0353] VK PCR-each reaction (50ul)

[0354] 1 μl pCHV101 scFv miniprep (20-30 ng / μl)

[0355] 2 μl VLK_Switch_FOR pool (10 μM total oligonucleotide)

[0356] 2 μl KJNot_REV pool (10 μM total oligonucleotide)

[0357] 20 μl PCR-grade HO

[0358] 25 μl 2x LongAmp Taq Master Mix (NEB; #M0287)

[0359] PCR conditions: initial denaturation at 94°C for 30 s, followed by 25 cycles of 94°C for 30 s, 60°C for 30 s, and 65°C for 1 min, and a final extension step at 65°C for 5 min.

[0360] The PCR product was purified by DNA clean & concentrator-5™ (ZymoResearch; #D4003) into 12 μl of warm (preheated at 65° C.) 0.2× kit elution buffer (EB) diluted in PCR grade H 2 O.

[0361] Digest the purified PCR as follows:

[0362]

[0363]

[0364] Digest the IgG expression vector as follows:

[0365]

[0366] Digestion was performed at 37°C for 1-2 hours. The purified PCR product was purified by DNA Clean & Concentrator-5™ Kit (Zymo Research; #D4003) into 20 μl of warm (preheated at 65°C) 0.2x kit elution buffer (EB) diluted in PCR-grade HO. The digested vector was resolved by electrophoresis on a 0.9% agarose gel, and the corresponding linearized vector band was gel extracted into 30 μl of diluted EB using the Zymoclean Gel DNA Recovery Kit (Zymo Research, catalog number D4002).

[0367] Ligation was performed at a 3:1 insert:vector molar ratio,

[0368]

[0369]

[0370] Ligation was performed at room temperature for 2 h and at 16° C. overnight. The ligation mixture (2 μl) was combined with 50 μl E.Cloni competent cells (prepared in-house) and incubated on ice for 10 min. After dilution in 75 μl 2xTYG, the transformed cells were streaked onto selective 2xTYAG plates and incubated at 37° C. overnight.

[0371] Typically, four colonies of each construct were picked into 3 ml of 2xTYAG medium and grown overnight at 37° C. Plasmid minipreps were prepared using the vacuum PureYield Plasmid Miniprep System Rapid Protocol (Promega, catalog number FB093), and the inserts were confirmed by sequencing using primers PD1-5 (5′-GAGGATTTGATATTCACCTGG-3′) (SEQ ID NO: 50) for the VH chain and PD1-91 (5′-GAATTCGATCAGGACTGAACAGAG-3′) (SEQ ID NO: 51) for the VK chain.

[0372] For the correct expression vector clone, use 50 ml of an overnight culture grown at 37 °C in 2xTYAG and ZymoPURE TM Vector midiprep for HEK cell transfection was prepared using the Plasmid Midiprep Kit (Promega, catalog number D4201).

[0373] Antibody Expression - General

[0374] Protein expression was achieved by transient transfection using the HEK293-6E / pTT transient expression system (National Research Council of Canada; obtained with permission). Cells were grown in Erlenmeyer flasks (TriForest, catalog number FPC0125S-K) without baffles at 120 rpm, 37°C, and 5% CO2. 4 mM GlutaMAX, 0.1% The cells to be transfected were grown to 1×10 6 The cell density was 10 cells / ml. The transfection procedure was as follows:

[0375] The density of 45ml is about 1.0x10 6 HEK293-6E cells (viability > 97%) at 10 cells / ml were transferred to a 250 ml flask. For each desired expression culture, 25 μg of expression vector midi-prep DNA (12.5 μg for each VK and VH chain pairing) was added to a 15 ml Falcon tube. A volume of transfection medium (F17 medium only) was added to the tube to give a final volume of 5 ml, and the solution was gently mixed by pipetting. To a separate empty 15 ml Falcon tube, 37.5 μl of pure [pure] FectoPRO TM ( SA, catalog number 116-010). Carefully add 5 ml of diluted DNA to the FectoPRO TM After incubation at room temperature for 20 minutes, DNA-FectoPRO TM The mixture was added to a 250 ml flask containing cells and gently swirled to mix. The flask was immediately transferred to a 37° C. humidified shaking incubator (120 rpm) containing 5% CO . After 5 days, expression supernatants were harvested by centrifuging the cells at 2500 g for 3 min and transferring the clarified culture medium to a fresh 50 ml Falcon tube.

[0376] IgG antibody purification

[0377] 5ml HiTrap Mab Select protein A column (GE Healthcare, catalog number 11003494) is used to purify IgG1 and IgG4 antibodies on AKTA Pure protein purification system 25L (GE Healthcare). The column is balanced with PBS. After the flow rate load sample is loaded with 5ml / min, the column is washed with PBS to remove unbound protein. The antibody is eluted with 0.1M citrate pH 3.2 at a flow rate of 3ml / min, and neutralized with Tris, and then dialyzed overnight with PBS (15ml Slide-A-Lyzer G2 dialysis cassette, 10K MWCO; Thermo Fisher Scientific, catalog number 87731). The protein is then concentrated by centrifugation (Vivaspin 20, 50KDa MWCO; GE Healthcare, catalog number 28932362).

[0378] Antibody Expression - 2ml Scale [Yield Analysis]

[0379] IgG4 antibody yield analysis was determined using 2 ml of transfection culture as follows: approximately 1.0 x 10 6 Each cell (vitality> 97%) is transferred to each well of 12-well plates, and F17 complete medium is added to give a final volume of 1ml. For each expression culture, 0.5 μg expression vector mid-preparation DNA (0.25 μg of each chain) is transferred to a 1.5ml Eppendorf tube, followed by 100 μl F17 culture medium. By pipetting, the solution is fully mixed, and the solution is immediately transferred to a separate Eppendorf tube containing 0.75 μl pure [pure] FectoPro. The transfection mixture is incubated at room temperature for 20 minutes, then carefully added to the well containing the cells. Gently rotate the sample to mix, and the plate is immediately transferred to a 37°C humidified shaking incubator (120 rpm) containing 5% CO2. After 5 days, the expression culture medium is harvested. Each antibody is transfected individually in triplicate to assess the contrasting crude expression yield in the system.

[0380] Fab antibody purification

[0381] The His-tagged Fab antibody was purified using a 5 ml HisTrap Excel column (GE Healthcare, catalog number 17-3712-05) on an AKTA pure protein purification system 25L (GE Healthcare). IMAC The column was equilibrated with wash buffer pH 7.5 (50 mM Tris, 0.5 mM NaCl, 10 mM imidazole). After loading the sample at a flow rate of 1 ml / min, the column was first washed with IMAC Wash with wash buffer and then IMAC The elution buffer was washed with 50 mM Tris, 0.5 mM NaCl, 300 mM imidazole at pH 7.5. The protein was eluted at a flow rate of 1 ml / min and then dialyzed overnight against PBS (15 ml Slide-A-Lyzer G2 dialysis cassette, 10K MWCO; Thermo Fisher Scientific, Cat. No. 87731). The protein was then concentrated by centrifugation (Vivaspin 20, 10 KDa MWCO; GE Healthcare, Cat. No. 28932360).

[0382] Size exclusion chromatography and SDS-PAGE gel analysis

[0383] The monodispersity / aggregation state of the antibodies was checked by qualitative size exclusion chromatography (SEC) using a Superdex 200 Increase 5 / 150 GL column (GE Healthcare, Cat. No. 28-9909-45).The column was equilibrated in PBS and then loaded with 100 μl of sample at a flow rate of 0.3 ml / min.

[0384] By reducing and non-reducing SDS-PAGE using The size and quality of the antibodies were checked on a 4%-12% Bis-Tris protein gel (Thermo Fisher Scientific Life Technologies, catalog number NP0321BOX). MOPS buffer was used as a running buffer (Thermo Fisher Scientific Life Technologies, catalog number). 5 μg of each antibody was mixed with 5 μl LDS-sample buffer (Thermo Fisher Scientific Life Technologies, catalog number) + / - 2 μl sample reduction buffer. Before loading, the sample was heated at 70°C for 10 minutes. The gel was developed by staining with InstantBlue (Expedeon, catalog number ISB1L).

[0385] Thermal shift assay [DSF]

[0386] The thermal stability of anti-TGF-β1 antibodies was evaluated using a protein thermal shift assay using a 7500 Fast Real-Time PCR instrument (Applied Biosystems). TM (protein thermal shift TM ) dyes are mixed and a controlled heating ramp is applied. As the protein begins to denature, the dye interacts with exposed hydrophobic regions and emits more intense fluorescence, thereby establishing one or more transition temperatures.

[0387] Prepare the sample as follows:

[0388]

[0389] Experimental setup on a 7500 Fast RT-PCR machine:

[0390]

[0391] Tm was calculated by the Model 7500 instrument software using a plot of the first derivative versus temperature.

[0392] SPR binding assay

[0393] Experiments were performed using a Biacore T200 equipped with a Serie S sensor chip CM5 (GE Healthcare, catalog number BR-1005-30). The instrument temperature was set to 25°C and the compartment temperature was set to 10°C in all steps of the analysis. All measurements were performed using running buffer 1x HBS-EP+. TGF-β1 was immobilized on the surface of the CM5 sensor chip using amine coupling chemistry according to the manufacturer's instructions. The chip surface was first activated with NHS / ECD. A 1 μg / mL solution of TGF-β1 in acetate (pH 4.5) was injected over several minutes to reach a target density of approximately 300RU. The surface was then inactivated with 1M ethanolamine HCl pH 8.5. Fc1 was used as a control for activation / inactivation.

[0394] For TGF-β1 kinetic analysis, the antibody was diluted to 20 nM, 10 nM, 5 nM, and 1 nM in running buffer, and each concentration series was accompanied by a blank. A buffer blank was always injected before injecting the antibody sample. The antibody was then injected at 30 μL / min for 510 seconds with a dissociation time of 600 seconds. Regeneration was performed with a 30 uL / min injection of 10 mM glycine 1.5 over 60 seconds. To test for isotype cross-reactivity, the antibody was diluted to 40 nM in running buffer and injected according to the above conditions.

[0395] Neutralization of TMLEC function

[0396] This assay is based on TMLEC cells (transfected mink lung epithelial cells) containing a luciferase reporter gene (Abe M et al. Analytical Biochemistry 1994, 216: 276-284). The cell line was subcloned multiple times in the laboratory, and subclone 20 was used in these assays. Cells were cultured in DMEM supplemented with 10% FCS and AAG (0.55 mM L-arginine, 0.24 mM L-asparagine, 1.5 mM L-glutamine, and 400 μg / ml G418) at 8% CO2.

[0397] TGFβ±antibody dilutions were incubated in a 96-well plate at 37° for 4 h. 100 μl of this <<mixture>> was then transferred to a plate containing 5×10 4 TMLEC cells / well) are placed in a 96-well flat-bottom opaque ELISA plate suitable for luciferase activity counting and cultured in the wells for at least 1 hour. All TGFβ isotypes are used at a final concentration of 500pg / ml. Antibody dilution usually starts at 30μg / ml. The plate is incubated for 20-24h. Then 100μl of the well contents are carefully removed and replaced with 100μl of luciferase substrate diluted in the lysis buffer of the Perkin-Elmer Ultra-brite luciferase test kit. Luciferase activity is immediately quantified in a bioluminescent ELISA reader.

[0398] Competitive binding of IgG4 mAb (relative to biotinylated murine 13A1 parent)

[0399] Nunc Maxisorb ELISA plates were coated overnight at 8°C with 0.5 μg / ml hTGF-β1 (Peter Sun, NIH) or hTGF-β3 (Shenandoah Biotechnology) (0.5 μg / ml in 40 mM glycine buffer, pH 9). The plates were washed and blocked with 10% FCS for 1 hour at 37°C. In separate low-binding Greiner Bio-One ELISA plates, various concentrations of competing Ab were mixed with a constant concentration of biotinylated parental 13A1 or 1901 (200 ng / ml in PBS + BSA (10 mg / ml)) and then transferred to TGF-β-coated Nunc Maxisorb ELISA plates. After incubation at 37°C for 2 hours, the plates were washed, avidin-HRP was added, and incubated at 37°C for 1 hour. The plates were washed again, TMB substrate was added, and bound biotinylated antibodies were quantified by measuring color development at a wavelength of 450 nm in an ELISA reader.

[0400] Example 3

[0401] Murine 13A1 antibody was reconverted into scFv and transplanted

[0402] Murine antibody 13A1 VH and VL were reconverted into scFv (LCR13A1_scFv), expressed in E. coli, and binding specificity was verified.

[0403] like Figure 1The mouse antibody 13A1 VH and VL domain nucleotide sequences were synthesized as scFvs in E. coli. The scFvs were converted to the orientation VL-linker-VH. Minor point mutations (VK: 52-54AGG>CGT, 70-72AGA>CGT, and 331-333ATA>AAA; VH: 112-114AGA>CGC, 118-120AGG>CGT, 292-294AGA>CGT, and 358-364ACTCTC>CTGGTT (see also Example 4) were incorporated at this stage to correct / humanize the J region and exchange rare Arg codons in the reading frame, potentially improving the expression in E. coli. Subsequently, the scFv was cloned into the L proprietary phagemid vector pCHV101, which allows dual expression and secretion of the molecule from E. coli as either a free scFv (LCR13A1_scFv) or as a fusion with the pill coat protein of a filamentous bacteriophage (LCR13A1_phage). Both expression methods retained strong and specific binding to surface-immobilized recombinant human TGFb1 in ELISA ( Figure 2 ).

[0404] Selection of human VH for transplantation

[0405] IGHV1-46*01 was selected from the IMGT reference catalog (imgt.org) and the internal IgM / D sequence database as the closest global human homologous germline VH region. Additional modifications were made to the individual FR regions to reflect other global human homologous germline VH regions (see Section 7, Additional FR mutations in the LCR13A1_VH region).

[0406] Selecting human VL for transplantation:

[0407] IGKV7-3*01 was selected from the IMGT reference catalog (imgt.org) and the internal IgM / D sequence database as the closest global human homologous germline VK region. Additional modifications were made to the individual FR regions to reflect other global human homologous germline VH regions (see Section 8, Additional FR mutations in the LCR13A1_VK region).

[0408] Murine CDRs were grafted onto human VH and VL frameworks, expressed as scFvs, and binding specificity verified.

[0409] The six mouse CDRs were grafted onto the corresponding human VH and VK frameworks and Vernier regions and initially expressed as scFvs. The scFvs were converted to the orientation VK-linker-VH. The scFv nucleotide sequence was synthesized by GeneArt (Thermo Fisher Scientific) and cloned into pCHV101 phagemid, and the scFv (13A1_GLv1_scFv) was then expressed in E. coli. Figure 3 The amino acid sequence alignment of the mouse and transplanted LCR13A1_scFv constructs is shown. The N residue in the germline IGKV7-3*01 FR3 region was mutated to D to remove the putative N-glycosylation risk (N97>D97). In addition, residues T123 and L124 in the joining region of FR4 of VH were mutated to L123 and V124 to better reflect hu IGHJ4. Grafting the mouse CDR regions into selected human VK and VH framework regions retained binding specificity for TGFb1 ( Figure 4 ).

[0410] Reconversion from scFv to human IgG1, expression in HEK293 cells and validation of binding specificity

[0411] The human VK and VH chains were reconverted by fusion with their corresponding heavy and light chain human construct domains contained in discrete pTT5-based mammalian expression vectors. The resulting IgG1 heterodimers were expressed into culture medium using small-scale HEK293-6E suspension cell cultures by transient co-transfection. Supernatants containing the transplanted antibodies and mouse chimeric (mouse variable domains fused to human IgG1 Fc) antibodies were subjected to TGFb-specific ELISAs along with the original purified parental mouse antibody 13A1. Both the chimeric and transplanted human IgG1 13A1 antibodies retained binding specificity for TGFb1 ( Figure 5 ).

[0412] Example 4

[0413] Sequence analysis and introduced mutations

[0414] Identification of potential CDR sequence disadvantages in the LCR13A1_GLv1 CDR and J regions by mutagenesis

[0415] The LCR13A1_GLv1 CDR sequences of both the VH and VK chains were subjected to BLAST homology analysis against both the IMGT variable domain reference collection (imgt.org) and a proprietary database containing approximately 6 million translated IgM / IgD VH reads obtained from the peripheral blood of healthy donors. Residues were evaluated at each position along with the corresponding human residue frequency. In the VH chain, a small number of rare or potentially unfavorable residues were identified in the CDR2 (T55>[S / V]55; N68>[S / A]68; K72>Q72) and CDR3 (T105>A105) regions ( Figure 6 However, given the already high human homology of the grafted chains, these residues were not considered problematic and were therefore retained at this stage.

[0416] Additional mutations in the LCR13A1_VH_GLv1 FR region (see also Figure 7 Legend)

[0417] Residues T123 and L124 in the joining region of FR4 were mutated to L123 and V124 to better reflect hu IGHJ4 (see Example 3). To overcome the partial loss of TGFb1 neutralization potency in the TMLEC assay of the grafted LCR13A1_GLv1 construct when compared to murine or chimeric antibodies, additional VH framework mutations were designed and engineered into the original LCR13A1_Glv1_VH chain of the antibody. Figure 7 Details of the three 13A1 VH variant chains are listed in .

[0418] LCR13A1_VH_GLv1_02(H) (SEQ ID NO:17): CDRs and Vernier regions grafted onto the huIGHV1-46*01 framework; FR3 modified to better reflect human IGHV1-3*01 M78>I78; T84>A84; V87>A87, and backmutated to parental murine residues R80>A80; D81>V81; FR4: T123>L123 and L124>V124 (corrected to hu IGHJ4).

[0419] LCR13A1_VH_GLv1_03(I) (SEQ ID NO:18): CDRs and Vernier regions grafted onto the huIGHV1-46*01 framework; FR1 adjusted to be closer to IGHV7-4-1*03 (by substitution of residues A9>S9; V12>L12) and backmutated to parental murine residues E11>V11; K13>A13; FR3 includes murine parental backmutations (G74D; V76>A76; T77>K77; M78>L78; R80>A80; D81>V81); FR4: T123>L123 and L124>V124 (corrected to hu IGHJ4).

[0420] LCR13A1_VH_GLv3 (SEQ ID NO: 19): The VH_GLv3 sequence represents a replacement graft of GLv1 and was generated using discrete local FR homology mapping. All GLv3 VH FRs used IGHV7-4-1*03 as a template, which has two murine backmutations (A25>T25; Y103>F103). J region residues were also backmutated to common murine / human residues (L123>T123).

[0421] Additional mutations in the LCR13A1_VK_GLv1 FR region (see also Figure 8 Legend)

[0422] Residue F42 in the FR2 region was mutated to Y42 (a preferred human Wernier residue). Residue N97 in FR3 is a potential carbohydrate group and was mutated to D97 (see scFv in Example 3). Residue K124 in the linker region of FR4 was mutated to V124 to correct for hu IGKJ4. The resulting VK was designated LCR13A1_VK_Glv1 (SEQ ID NO: 21) ( Figure 8 To overcome the partial loss of TGFb1 neutralization potency in the TMLEC assay of the grafted LCR13A1_GLv1 construct when compared to murine or chimeric antibodies, additional VK framework mutations were designed and engineered into the original VK chain of the antibody. Figure 8 Details of the five 13A1 VK variant chains are listed in .

[0423] LCR13A1_VK_GLv1_02(A) (SEQ ID NO:22): Parental gene grafted onto the IGKV7-3*01 framework region CDR / Weniger residues; FR1: P15>L15, T22>S22 (revertant mouse residues coexisting in the human orthologous germline framework); FR2: F42>Y42 (preferred human Weniger residues); FR3: N97>D97 (removes putative N-glycosylation risk); FR4: K124>V124 (corrected to huIGKJ4)

[0424] LCR13A1_VK_GLv1_03(B) (SEQ ID NO:23): Parental gene grafted onto the IGKV7-3*01 framework region CDR / Weniger residues; FR1: P15>L15, T22>S22 (revertant mouse residues coexisting in the human orthologous germline framework); FR2: Y42>F42 (preferred human Weniger residues); FR3: T90>N90, N92>H92 (residues for backmutation restriction in parental mouse 13A1); N97>D97 (removes putative N-glycosylation risk); FR4: K124>V124 (corrected to huIGKJ4)

[0425] LCR13A1_VK_GLv1_04(C) (SEQ ID NO:24): Parental gene grafted onto the IGKV7-3*01 framework region CDR / Weniger residues; FR1: P15>L15, T22>S22 (revertant mouse residues coexisting in the human orthologous germline framework); FR2: Y42>F42 (preferred human Weniger residues); FR3: T90>N90, N92>H92 (residues for backmutations restricted by parental mouse 13A1); V94>L94; D96>E96; T99>A99; N101>A101 (adjusted to framework IGKV6-21*02); N97>D97 (removed putative N-glycosylation risk); FR4: K124>V124 (corrected to huIGKJ4)

[0426] LCR13A1_VK_GLv1_05(D) (SEQ ID NO: 25): Parental gene grafted onto the IGKV7-3*01 framework region CDR / Weinier residues; FR1: L4>M4, A9>D9, Q17>E17 (adjusted to framework IGKV4-1*01); P15>L15, T22>S22 (revertant mouse residues coexisting in the human orthologous germline framework); FR2: Y42>F42 (preferred human Weinier residues); FR3: T90>N90, N92>H92 (residues for backmutations restricted by parental mouse 13A1); V94>L94; D96>E96; T99>A99; N101>T101 (adjusted to framework IGKV6-21*02); N97>D97 (removal of putative N-glycosylation risk); FR4: K124>V124 (corrected to huIGKJ4)

[0427] LCR13A1_VK_GLv3 (SEQ ID NO:26): The replacement graft was based on local FR homology matching. FR1 and FR3 were derived from IGKV4-1*01; FR2 was derived from IGKV3D-15*01 and contained the murine backmutation Y42>F42. Similarly, FR3 contained the murine backmutation Y103>F103. J region residues were also mutated to consensus murine / human residues (V124>L124).

[0428] Human germline homology of LCR13A1 VH+VK variants

[0429] A global alignment analysis of LCR13A1 VH and VK was performed using the IMGT database (imgt.org), and the corresponding human germline homology was determined for each chain. The germline homology for each chain ranged from 77% to 87% identity and 85% to 92% similarity for the VH chain, and from 68% to 71% identity and 82% to 86% similarity for the VK chain ( Figure 9 ).

[0430] Example 5

[0431] Expression of antibody variants in human IgG4 format

[0432] Six LCR13A1 variants were reconverted into human IgG4 (S228P) antibodies ( Figure 10For this purpose, human IGHG4*01 was selected as the human Ig constant heavy chain, which was further modified to accommodate the S228P mutation to stabilize the antibody for potential Fab-arm exchange (Silva et al., J Biol Chem. 2015 Feb 27; 290(9): 5462-9), and human CK*01 was selected as the human Ig constant light chain. IgG4 heterodimers were expressed in culture using small-scale HEK293-6E suspension cell cultures by transient co-transfection of heavy and light chain vectors and then purified by protein A affinity chromatography. Figure 11-13 The protein sequences of LCR13A1_GLv1 and two LCR13A1 IgG4 variant antibodies are shown in FIG.

[0433] LCR_13A1_VH_GLv1_VK_GLv1_IgG4

[228] (LCR13A1_GLv1): ( Figure 11 This antibody comprises the heavy chain sequence LCR13A1_VH_Glv1 (SEQ ID NO: 16) and the light chain sequence LCR13A1_VK_GLv1 (SEQ ID NO: 21).

[0434] LCR_13A1_VH_GLv1_03_VK_GLv3_IgG4

[228] (LCR13A1-2B): ( Figure 12 The LCR13A1-2B (or "2B") antibody comprises the heavy chain sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) and the light chain sequence LCR13A1_VK_GLv3 (SEQ ID NO: 26).

[0435] LCR_13A1_VH_GLv1_03_VK_GLv1_05_IgG4

[228] (LCR13A1-2F): ( Figure 13 The LCR13A1-2F (or "2F") antibody comprises the heavy chain sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) and the light chain sequence LCR13A1_VK_GLv1_05 (SEQ ID NO: 25).

[0436] Likewise, Figure 10 As described, other 13A1 antibody variants are as follows and comprise the VH and VL variant sequences represented below:

[0437] The LCR13A1-2A (or "2A") antibody comprises the heavy chain sequence LCR13A1_VH_Glv3 (SEQ ID NO: 19) and the light chain sequence LCR13A1_VK_GLv3 (SEQ ID NO: 26).

[0438] The LCR13A1-2C (or "2C") antibody comprises the heavy chain sequence LCR13A1_VH_Glv3 (SEQ ID NO: 19) and the light chain sequence LCR13A1_VK_GLv1_03 (SEQ ID NO: 23).

[0439] The LCR13A1-2D (or "2D") antibody comprises the heavy chain sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) and the light chain sequence LCR13A1_VK_GLv1_03 (SEQ ID NO: 23).

[0440] The LCR13A1-2E (or "2E") antibody comprises the heavy chain sequence LCR13A1_VH_Glv1_03 (SEQ ID NO: 18) and the light chain sequence LCR13A1_VK_GLv1_04 (SEQ ID NO: 24).

[0441] Example 6

[0442] Predicted stacking angle of the variant

[0443] The stacking torsion angles of the corresponding LCR13A1 VH+VK variant antibodies were predicted by computer simulation using PAPS (bioinf.org.uk / abs / paps). The predicted values ​​for the initial CDR graft (LCR13A1_VH_GLv1 / 13A1_VK_GLv1) and the subsequent hyperactive mutant variants differed by 1.5 degrees and showed no clear correlation with functional efficacy or TGFb isotype selectivity ( Figure 14 ).

[0444] Example 7

[0445] Potency of antibodies to neutralize TGFB signaling

[0446] Efficacy of LCR13A1 IgG4 antibody in neutralizing TGFb signaling in TMLEC reporter cells

[0447] Neutralization of TGFb isoform-specific signaling was assessed in a TMLEC reporter cell assay. All six IgG4 variants—LCR13A1_VH_GLv3_LCR13A1_VK_GLv3 (LCR13A1-2A), LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv3 (LCR13A1-2B), LCR13A1_VH_GLv3_LCR13A1_VK_GLv1_03 (LCR13A1-2C), LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv3 (LCR13A1-2A), LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv3 (LCR13A1-2B), LCR13A1_VH_GLv3_LCR13A1_VK_GLv1_03 (LCR13A1-2C), LCR13A1_VH_GLv1_03_LCR13A1 1_VK_GLv1_03(LCR13A1-2D), LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv1_04(LCR13A1-2E) and LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv1_05(LCR13A1-2F)—were highly potent in neutralizing TGFb1-induced luciferase reporter gene product expression in a dose-dependent manner ( FIG. 15 , FIG. 16 ).

[0448] Example 8

[0449] TGFB isoform specificity

[0450] The TGFb isotype specificity of LCR13A1 IgG4 variants was evaluated in a TMLEC reporter gene assay. Six IgG4 variants, LCR13A1_VH_GLv3_LCR13A1_VK_GLv3 (LCR13A1-2A), LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv3 (LCR13A1-2B), LCR13A1_VH_GLv3_LCR13A1_VK_GLv1_03 (LCR13A1-2C), LCR13A1_VH_GLv3_LCR13A1_VK_GLv3 (LCR13A1-2A), LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv3 (LCR13A1-2B), LCR13A1_VH_GLv3_LCR13A1_VK_GLv1_03 (LCR13A1-2C), LCR13A1_VH_GLv3_LCR13A1_VK_GLv3 (LCR13A1-2 v1_03_LCR13A1_VK_GLv1_03 (LCR13A1-2D), LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv1_04 (LCR13A1-2E), and LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv1_05 (LCR13A1-2F) were shown to selectively neutralize TGFb1 isoform-induced signaling. At higher antibody concentrations, the 13A1 variants LCR13A1_VH_GLv3_LCR13A1_VK_GLv3 (LCR13A1-2A) and LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv1_03 (LCR13A1-2D) showed some neutralization of the expression of the luciferase reporter gene induced by the TGFb3 isoform. No neutralization of the expression of the luciferase reporter gene product induced by the TGFb2 isoform was observed (Figure 16).

[0451] Additionally, the VH variant sequence 13A1_VH_Glv_02 is also referred to as 13A1_VH_Glv_02(H) (SEQ ID NO: 17) ( Figure 7 and Figure 9 ),and Figure 8 The four VKs listed in Table 1—13A1_VK_GLv1_02(A) (SEQ ID NO:22), 13A1_VK_GLv1_03(B) (SEQ ID NO:23), 13A1_VK_GLv1_04(C) (SEQ ID NO:24), and 13A1_VK_GLv1_05(D) (SEQ ID NO:25)—were tested in combination (data not shown). The variant 13A1 antibodies were active and neutralized signaling induced by the TGFb1 isoform. In this initial evaluation, the neutralizing potency of these variants based on the 13A1_VH_Glv_02 (SEQ ID NO:17) heavy chain was slightly lower than that of the 13A1_VH_GLv1_03 (SEQ ID NO:18) or LCR13A1_GLv3 (SEQ ID NO:19) constructs.

[0452] Example 9

[0453] Competitive binding and binding kinetics

[0454] Competitive binding of LCR13A1 IgG4 antibody to TGFb1 in ELISA

[0455] The potency of the humanized LCR13A1 IgG4 antibody variants to compete with the parent murine antibody for binding to TGFb1 was assessed by ELISA. The six IgG4 variants LCR13A1_VH_GLv3_LCR13A1_VK_GLv3 (LCR13A1-2A), LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv3 (LCR13A1-2B), LCR13A1_VH_GLv3_LCR13A1_VK_GLv1_03 (LCR13A1-2C), LCR13A1_VH_GLv1_ 03_LCR13A1_VK_GLv1_03 (LCR13A1-2D), LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv1_04 (LCR13A1-2E), and LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv1_05 (LCR13A1-2F) competed with the parental murine 13A1 antibody for binding to TGFb1 ( Figure 17 ).

[0456] Characteristics and binding kinetics of LCR13A1 IgG4 antibody

[0457] Two preferred VH and VK chain pairs 13A1-2B (or 13A1_2B): LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv3 and 13A1-2F (or 13A1_2F): LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv1_05) were expressed as stabilized Fabs, purified, and their binding kinetics to TGFb were assessed using Biacore. The binding SPR kinetic data of the purified Fabs were obtained in Figure 18 Both monovalent 13A1_2B and 13A1_2F exhibited long residence times (slow off-rates). The binding affinities of the Fabs were in the high pM range.

[0458] Example 10

[0459] Additional characterization of humanized antibodies

[0460] SEC spectrum analysis:

[0461] Six IgG4 variants (LCR13A1_VH_GLv3_LCR13A1_VK_GLv3(LCR13A1-2A), LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv3(LCR13A1-2B), LCR13A1_VH_GLv3_LCR13A1_VK_GLv1_03(LCR13A1-2C)) were evaluated using analytical size exclusion chromatography (SEC). 19A and 19B .

[0462] Thermal stability: The relative molecular stabilities of six IgG4 variants (LCR13A1_VH_GLv3_LCR13A1_VK_GLv3, LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv3, LCR13A1_VH_GLv3_LCR13A1_VK_GLv1_03, LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv1_03, LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv1_04, and LCR13A1_VH_GLv1_03_LCR13A1_VK_GLv1_05) to thermal stress were evaluated using differential scanning fluorimetry (DSF). Five of the six LCR13A1 IgG4 variants showed a 2-transition non-cooperative melting curve with characteristic early IgG4 CH2 domain unfolding (Tm1). The unfolding of the Fab domain is represented by transition Tm2. The higher Tm2 indicates that the Fab domains in the four LCR13A1 IgG4 variants appear to be more thermally stable than the Fab domains in the three TGFb reference antibodies (Figures 20A and 20B - melting curves, and Figure 21 - Tm1 and Tm2 of the antibody). Fc CH3 domain transitions are typically not visible in this assay due to their very high stability and thermal quenching of the reporter dye fluorescence at high temperatures.

[0463] Amplify expression yield: Six IgG4 variants (as above) were evaluated for suitability for potential larger scale expression using transient expression in a mammalian cell system (2 ml scale). Four of the six molecules were found to be efficiently expressed at levels comparable to those obtained using the benchmark. The expression yields are summarized in Figure 22 middle.

[0464] Example 11

[0465] The application and use of genetically engineered T cells expressing chimeric antigen receptors (CARs) against cell surface proteins in cancer therapy offers a new and improved approach for various cancers. exist In some cases, T cells modified to express only chimeric antigen receptors (CARs) are suppressed in a hostile tumor microenvironment, which may limit the efficacy of CAR T cells in some clinical indications. For example, immunosuppressive cytokines (such as IL-6, Il-10, and TGF-β) can provide a favorable environment for tumor growth and also inhibit the tumoricidal activity of endogenous T cells and CAR T cells. Studies have shown that inhibition of TGFβ receptors can enhance CAR T cell activity by inhibiting the immunosuppressive effect of TGFβ on the microenvironment (Vong Q et al. (2017) Blood 130:1791).

[0466] We sought to evaluate the role and efficacy of TGFb1-specific antibodies in counteracting TGFb1-mediated inhibition of CAR T cell activity. Exogenous TGFb1 inhibited CAR T cell killing in a cellular assay. CAR T cells targeting mesothelin were evaluated against human lung cancer cells. In the lung cancer study, primary human T cells were transfected with an anti-mesothelin CAR (hP4; described in US 2014301993 A1). T cells and TGFb1 were added, and killing of target Meso+ H-226 human lung cancer cells was evaluated. Exemplary antibodies 13A1-2F and 13A1-2B were used in the CAR-T cell study. The effect of adding TGFb1 antibodies 13A1-2F and 13A1-2B on cell killing was evaluated. CAR T cells alone killed Meso+ lung target cells. In the presence of TGFb1, cell killing was significantly inhibited. Inhibition increased with increasing amounts of TGFb1-specific antibodies. After addition of TGFb1-specific antibodies, TGFb1-mediated inhibition of cell killing was blocked. Antibody 13A1-2B was highly potent even at low concentrations (50 ng / ml). The results for antibodies 13A1-2F and 13A1-2B are depicted in Figure 2. Figure 24 and 25The data demonstrate in vitro rescue of TGFb1-mediated inhibition of anti-MSLN CAR-T target cell killing by humanized and variant antibodies 13A1-2F and 13A1-2B. Thus, it has been demonstrated in a cancer cell model system that TGFb1 inhibition of primary CAR T cell killing can be reversed by administration of TGFb1 isoform-specific mAbs 13A1-2F and 13A1-2B (indicating the expected inhibition of endogenous TGFb1 on cell therapy).

[0467] method

[0468] Target cell line and primary effector cells: Human endogenous antigen-positive target cell line H226 (lung cancer, MSLN + , CRL-5826 TM ) were maintained in RPMI-1640 Glutamax (Gibco BRL Life Technologies, Gaithersburg, MD) containing 10% fetal bovine serum (FBS) and 100 IU / ml Pen / Strep. Cells were maintained at 37° C. in a humidified atmosphere containing 5% carbon dioxide (CO 2 ).

[0469] Buffy coats from healthy volunteers were obtained from the blood bank (Interregional Blood transfusion SRC, Switzerland). Peripheral blood mononuclear cells (PBMCs) were isolated from fresh buffy coats by density centrifugation using Lymphoprep (Axonlab).

[0470] Generation of CAR-modified T cells: The CAR expression cassette was housed within the pRRL lentiviral vector backbone. The organization of the elements is typical of second-generation CARs, in which the scFv is appended to hCD28 (extracellular spacer, TM, and signaling domain) and hCD3ζ. Monomeric GFP was incorporated as a direct fusion downstream of CD3ζ to allow direct assessment of transfection efficiency. The hP4 scFv for the anti-MSLN CAR was generated based on patent US2014301993 A1.

[0471] Virus production was performed by transiently co-transfecting HEK293T production cells with pRRL-CAR and packaging plasmids (pCMVR8.74 and pMD2.G; Didier Trono Laboratory, EPFL) using Turbofect transfection reagent (Life Technologies). Virus-containing supernatants were harvested after 48 h and concentrated by ultracentrifugation.

[0472] PBMC were plated (0.5x10 6 / well) in non-tissue culture treated 24-well plates pre-coated with CD3 clone OKT3 (1 μg / mL; Thermo Fisher) and CD28 clone CD28.2 (2 μg / mL; Thermo Fisher) anti-human antibodies. The cells were cultured for 2 days in complete medium RPMI-1640 + GlutaMAX (Thermo Fisher) supplemented with 10% FBS and human recombinant human IL2 (50 IU / mL, Glaxo IMB). On day 3, freshly prepared lentiviral supernatant was used to transduce CD3 / CD28 activated PBMCs, and they were maintained in complete medium supplemented with human recombinant human IL2 (50 IU / mL, Glaxo IMB) for another 2 days. On day 5, the expanded PBMCs were supplemented with complete medium containing 10 ng / ml of IL-7 and IL-15 (Miltenyi Biotec) and incubated at 37°C, 5% CO2 for 1-2 weeks until they were used for killing assays. Subsequently, cells were split and fed with fresh medium plus IL-7 / IL-15 every 2-3 days. + The proportion of cells determined a transfection efficiency of approximately 40% (anti-MSLNCAR) and approximately 50% (anti-EGFR CAR).

[0473] Kinetic cytotoxicity assay: H226 target cells (100 μL / well) were cultured in complete medium at 0.015×10 6 The cells were seeded in a 96-well plate at a density of 10 cells / mL. On the second day, the cell density reached 0.02x10 6 The supernatant was removed and 50 μL (500 nM) of CytotoxRED dead cell staining reagent (Incucyte, Essen Bioscience) was added to each well. Effector anti-MSLN CAR cells (2×10 6Cells / mL) were combined with 1 μL of stock TGFβ1 (MILAN Analytica AG; 500 ng / mL) to give a concentration of 2 ng / mL or left untreated. Treated / untreated CAR cells (50 μL) were added to each well, resulting in a 5:1E:T ratio + / - 1 ng / mL TGFβ1. The anti-TGFβ1 neutralization (reversal) potential of the hIgG4 13A1-2F antibody was determined by its co-inclusion at a final concentration of 500 ng / ml, 2 μg / ml and 10 μg / ml. The anti-TGFβ1 neutralization (reversal) potential of the hIgG4 13A1-2B antibody was determined by its co-inclusion at a final concentration of 50 ng / ml. The plate was returned to the incubator for 30 min to allow the combined cells and dye to settle and equilibrate, and then transferred to the Incucyte system for 3 days. Cell death was monitored as an increase in red fluorescence and was detected with The analysis was performed using Incucyte software (ZOOM 2016A). The killing slope was determined using the total red image integrated intensity of each image data.

[0474] Example 12

[0475] In an error-prone mutagenesis protocol, 13A1 humanized and variant TGFb1 antibodies were used as parental antibody sequences to generate novel mutagenized antibodies specific for TGFb1. The mutagenized antibodies demonstrated specificity and neutralizing ability against TGFb1 and differed in antibody sequence (including heavy chain CDR sequence) from the parental 13A1-2B and 13A1-2F sequences, as well as from the original murine 13A1 sequence. Certain mutagenized TGFb1-specific antibodies also differed in light chain CDR sequence from the parental 13A1-2B and 13A1-2F sequences, as well as from the original murine 13A1 sequence.

[0476] Produce error-prone library based on 13A1-2F (VH_Glv_03 / VK_GLv_05) and 13A1-2B (VH_Glv103 / VK_Glv3) variant humanized antibody sequence.Extract mutation from the scFv chain that manifests in the stringent competitive screening (relative to 13A1-2F scFv) of R2 error-prone library panning (relative to TGFb1 target, wherein for TGFb3 combination, a large amount of subtractions).Best guess mutant is transformed into people Fab [VHCH1 / VKCK] completely to produce 15 kinds of Fab variants and then with parent mouse Fab [chimeric, mVHhCH1 / mVKhCK] compare.From the heavy / light Fab chain cotransfection in 50ml HEK293-6E culture, produce Fab, and pass through IMAC purification.Then, use Biacore analysis that 10nM Fab antibody is excited to produce contrast kinetics ranking for fixing TGFb1.

[0477] Construction of error-prone mutagenesis libraries of clones 13A1_2B [LCR13A1_VH_GLv1_03 + LCR13A1_VK_GLv3] and 13A1_2F [LCR13A1_VH_GLv1_03 + LCR13A1_VK_GLv1_05]: The VH and VK paired chains of 13A1_2B and 13A1_2F were assembled into scFvs in a phagemid vector (pCHV101) using PCR and overlapping Gibson assembly. Correct clones were sequence verified, and phagemid vector DNA was prepared using the PureYield Plasmid Miniprep System Rapid Protocol (Promega, catalog number FB093).

[0478] Use GeneMorph II random mutagenesis kit (Agilent Technologies, catalog number (Cat. No.) 200550) to carry out error-prone mutagenesis. According to manufacturer's guide, each (2.5ng and 250ng) in two amounts of 13A1_2B and 13A1_2F purified phagemid vectors is used as template in 50ul mutagenesis PCR reaction. scFv amplification primer has incorporated scFv box cloning site (NcoI and SalI). After 30 mutagenesis PCR cycles, DpnI (1ul) restriction enzyme is added to the reaction to destroy the template vector (1h, 37°C). By DNA cleaning & concentrator-25TM (Zymo Research, catalog number (Cat. No.) D4006) purified PCR product. By every kind of PCR product NcoI / SalI double digestion. The PCR products of two kinds of digestion cloned for each starting vector are merged and connected back in pCHV101 phagemid. The vector connected by a small portion is transformed into competent TG1 cells, to produce colonies to confirm the mutagenesis sequence. The pCHV101 vectors were electroporated in large numbers into electrocompetent TG1 cells (Lucigen, catalog number 60502). The cells were plated onto 20 cm x 20 cm 2xTYAG solid medium plates containing 2% glucose and 100 μg / ml ampicillin and grown overnight at 30°C. The mutagenesis library sizes for both 13A1_2B and 13A1_2F were calculated to be 1 x 10 9 Near. The bacterial library was eluted from the plate in liquid 2xTYG medium containing 2% glucose. For agar plates and solid medium plates, such as the designations TYAG, TYG, etc., the designation T refers to added tryptone, Y refers to added yeast extract, G refers to added glucose, and A refers to added ampicillin antibiotic, which was formulated using standard techniques. The bacterial cells were washed and concentrated by centrifugation and plated at an OD of 200. 600 Aliquots of were stored in 15% glycerol. Phage rescue from bacterial libraries was performed using M13KO7 helper phage (Life Technologies, catalog number 18-311-019) according to standard protocols. Purified and concentrated library phage were stored in single-use aliquots at -80°C.

[0479] Panning of 13A1_2F and 13A1_2B error-prone phage libraries: For the first round of panning of the mutagenized 13A1_2F and 13A1_2B phage libraries, two immunotubes were coated overnight with 1 ml of 20 μg / ml TGFb3 and 1 μg / ml TGFb1 in PBS for each library. The next day, the tubes were rinsed twice with PBS, completely filled with freshly prepared blocking solution (2% milk + 1% BSA in PBS), and sealed with parafilm. The tubes were left to stand at room temperature for 1.5 h. During this time, 1.2 mL of blocking solution was added to a 1.5 ml plastic tube, followed by the addition of 150 μl of thawed phage library (containing 10 μg / ml TGFb3). 11 -10 12 CFU). The tubes were sealed with parafilm and incubated for 45 minutes under constant rotation to block the phage. Each of the two libraries was blocked in this manner individually.

[0480] The library was deducted from unwanted TGFb3 binding as follows: the TGFb3-coated immunotubes were washed 4 times with PBS, and the enclosed phage library was transferred to the tubes. The tubes were sealed with paraffin film and incubated at room temperature for 2 hours under constant rotation. The remaining soluble TGFb3 was then added to the tubes to give a final concentration of 10 ug / ml. Unbound deducted and enclosed phage (approximately 1.5 ml volume) were recovered and transferred to the washed immunotubes coated with TGFb1. The immunotubes were sealed with paraffin film and left to stand overnight at 4°C for incubation. After the immunotubes were washed 20 times with PBS, the bound phages were eluted with trypsin (20 ug / ml in PBS) for 30 min at 37°C and used to infect a culture of TG1 cells grown in 10 ml minimal medium, then plated on 2TYAG agar plates. The next day, the cells were recovered, washed, and concentrated in 2TYG, then frozen, waiting for the second round of selection. For each library, the output CFU from R1 panning was quantified between 2-5x10 5 nearby.

[0481] Phages were rescued from R1 bacterial cells using 13KO7 according to standard procedures. A second round of panning was performed as above for R1, except that the TGFb1 immunotube was coated with 100 ng / ml instead of 1 ug / ml. For each library, the output CFU from the R2 panning was quantified at 2-6 x 10 5 The second round of bacterial export cells were grown at an OD of about 300. 600 Store frozen in 2TY + 15% glycerol.

[0482] Competitive ELISA screening of mutant 13A1_2F and 13A1_2B scFv clones against 13A1_2F IgG4: Second round colonies from the plated outputs of mutant 13A1_2F and 13A1_2B phage panning were grown overnight in 384-well microtiter plates containing 60 ul / well of 2xTBAG containing 1% glucose and 100 ug / ml ampicillin. The next day, cells were transferred to 384-well expression plates containing 120 ul / well of TBAG containing 0.1% glucose and 100 ug / ml ampicillin using a replica pin inoculation. Column 12 was left uninoculated. Bacteria were allowed to grow for 6 hours (OD 0.05) at 30°, 750 rpm, 70% humidity. 600 The cells were then incubated at approximately 800 μL (approximately 800 μL) and then 30 μL of IPTG (500 μM stock concentration in TB medium) was added to achieve a final concentration of 100 μM. Secreted scFv expression was allowed to proceed overnight at 30°, 750 rpm, and 70% humidity. A Maxisorb 384-well ELISA plat...

Claims

1. An isolated antibody or antigen-binding fragment thereof, which recognizes human and mouse transforming growth factor β1 (TGF-β1) and neutralizes the activity of TGF-β1, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region sequence and a light chain variable region sequence, wherein the heavy chain variable region sequence comprises a CDR1 sequence NYWMH (SEQ ID NO: 64), a CDR2 sequence TIYPGNSDTNYNQKFKD (SEQ ID NO: 75), and a CDR3 sequence EDSRSLYYNGWDYFDY (SEQ ID NO: 9), The light chain variable region sequence comprises: CDR1 sequence KSSESVDNYGISFLN (SEQ ID NO: 70), CDR2 sequence AASNQGS (SEQ ID NO: 31), and CDR3 sequence QQSKEVPR (SEQ ID NO: 73).

2. The isolated antibody or antigen-binding fragment thereof according to claim 1, which does not react with TGF-β2 or TGF-β3.

3. The isolated antibody or antigen-binding fragment thereof according to claim 1, comprising: The heavy chain variable region sequence is SEQ ID NO: 18, or a variant thereof, said variant having at least 90% amino acid identity to the heavy chain variable region sequence is SEQ ID NO: 18, wherein said variant retains TGF-β1 responsiveness and neutralization.

4. The isolated antibody or antigen-binding fragment thereof according to claim 1, comprising: (a) a light chain variable region sequence of SEQ ID NO: 26 or a variant thereof, said variant having at least 90% amino acid identity with the light chain variable region sequence of SEQ ID NO: 26, wherein said variant retains TGF-β1 responsiveness and neutralization; or (b) a light chain variable region sequence of SEQ ID NO: 52 or a variant thereof, said variant having at least 90% amino acid identity with the light chain variable region sequence of SEQ ID NO: 52, wherein said variant retains TGF-β1 responsiveness and neutralization. 5 . The isolated antibody or antigen-binding fragment thereof according to claim 1 , wherein the light chain variable region sequence of the isolated antibody or antigen-binding fragment thereof is selected from SEQ ID NO: 26 and SEQ ID NO:

52.

6. The isolated antibody or antigen-binding fragment thereof according to claim 1, wherein the isolated antibody is: An antibody comprising a heavy chain variable region sequence of SEQ ID NO: 18 and a light chain variable region sequence of SEQ ID NO:

26.

7. The isolated antibody or antigen-binding fragment thereof according to claim 3, which does not react with TGF-β2 or TGF-β3.

8. The isolated antibody or antigen-binding fragment thereof according to claim 4, which does not react with TGF-β2 or TGF-β3.

9. The isolated antibody or antigen-binding fragment thereof according to claim 5, which does not react with TGF-β2 or TGF-β3.

10. The isolated antibody or antigen-binding fragment thereof according to claim 6, which does not react with TGF-β2 or TGF-β3.

11. The isolated antibody or antigen-binding fragment thereof of claim 1 , wherein the isolated antibody or antigen-binding fragment thereof recognizes human and mouse TGF-β1 and does not recognize or bind to human or mouse TGF-β2 or TGF-β3, the isolated antibody or antigen-binding fragment thereof comprising a heavy chain variable region sequence of SEQ ID NO: 18 or a variant thereof, the variant having at least 90% amino acid identity with the heavy chain variable region sequence of SEQ ID NO: 18, the isolated antibody or antigen-binding fragment thereof further comprising a light chain variable region sequence of SEQ ID NO: 26 or a variant thereof, the variant having at least 90% amino acid identity with the light chain variable region sequence of SEQ ID NO: 26, wherein the variant retains TGF-β1 responsiveness and neutralization and lacks TGF-β2 and TGF-β3 responsiveness.

12. The isolated antibody or antigen-binding fragment thereof according to any one of claims 1 to 11, which is a humanized antibody or antigen-binding fragment thereof.

13. The isolated antibody or antigen-binding fragment thereof according to claim 12, which is a chimeric antibody or antigen-binding fragment thereof.

14. The isolated antibody or antigen-binding fragment thereof according to any one of claims 1 to 11, wherein the isolated antibody is in the form of an antibody F(ab')2, a scFv fragment or a minibody.

15. The isolated antibody or antigen-binding fragment thereof according to any one of claims 1 to 11, further comprising a detectable label or a functional label, wherein the detectable label or the functional label is a covalently attached drug or a radiolabel.

16. An isolated nucleic acid comprising a sequence encoding the antibody or antigen-binding fragment thereof of any one of claims 1 to 11.

17. A method for preparing an antibody or antigen-binding fragment thereof as defined in any one of claims 1 to 11, the method comprising expressing the nucleic acid of claim 16 under conditions that result in expression of the antibody or antigen-binding fragment thereof, and recovering the antibody or antigen-binding fragment thereof.

18. Use of an antibody or antigen-binding fragment thereof as defined in any one of claims 1 to 11 in the preparation of a pharmaceutical composition for treating cancer in a mammal, wherein the cancer expresses TGF-β1 and the cancer is selected from lung cancer, breast cancer, melanoma and colon cancer. The use according to claim 18 , wherein the pharmaceutical composition further comprises an immunomodulator.

20. The use according to any one of claims 18-19, wherein the pharmaceutical composition is formulated for intratumoral injection.

21. A kit for diagnosing or prognosing a cancer in which the TGF-β1 antigen is expressed, the kit comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 11 and instructions for use.

22. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof as defined in any one of claims 1 to 11 and a pharmaceutically acceptable vehicle, carrier or diluent.

23. Lymphoid cells genetically engineered to express and secrete the antibody or antigen-binding fragment thereof according to any one of claims 1 to 11.

24. The lymphoid cell of claim 23, wherein the cell is further engineered to express a receptor that is a chimeric antigen receptor (CAR) or a T cell receptor.

Images