Probes for improved melting resolution and multiplexing in nucleic acid assays

Abstract

The present application relates to probes for improving melt resolution and multiplicity in nucleic acid assays. Methods and compositions for detecting and quantifying nucleic acids are provided. In certain embodiments, the method involves the use of cleavable probes comprising ribonucleotide positions susceptible to cleavage by endoribonucleases (e.g., RNase H) in the presence of a target nucleic acid molecule. The probes of the embodiments may also comprise non-natural nucleotides connected to a reporter group and / or a quenching moiety.

Description

[0001] This application is a divisional application of the Chinese patent application with application number 201580050926.4 and invention name “Probe for improving melting resolution and multiplexity in nucleic acid determination”. The original application is the PCT international application PCT / US2015 / 044609 filed on August 11, 2015, which entered the Chinese national phase on March 21, 2017.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Patent Application No. 62 / 035,783, filed August 11, 2014, which is incorporated herein by reference in its entirety.

[0004] Incorporation of Sequence Listing

[0005] Contained in 8KB created on August 11, 2015 (on Microsoft The sequence listing in the file named "LUMNP0129WO_ST25.txt" (measured in ) is submitted electronically with this article and is incorporated by reference. Background of the Invention Technical Field

[0007] The present invention generally relates to the field of molecular biology. More particularly, it relates to the detection of nucleic acids. Background Art

[0008] Polymerase chain reaction (PCR) is a molecular biology technique that does not use living organisms to enzymatically replicate DNA. PCR is commonly used in medical and biological research laboratories to undertake a variety of tasks, such as the detection of genetic diseases, the identification of genetic fingerprints, the diagnosis of infectious diseases, gene cloning, paternity testing, and DNA computing. Due to its unparalleled replication and precision capabilities, PCR is considered by molecular biologists to be the preferred method for nucleic acid detection. DNA detection is usually performed at the end point (end-point) or the plateau phase of the PCR reaction, which makes it difficult to quantify the starting template. Real-time PCR or dynamic PCR improves the ability of endpoint PCR analysis by recording the concentration of amplicon during the reaction. The concentration of amplicon is most commonly recorded by changes in the fluorescent signal related to the amplified target. The advantage of real-time PCR over endpoint detection is that it is performed in a closed system, thereby limiting contamination. Other advantages include higher sensitivity, dynamic range, speed, and less process required.

[0009] Several assay chemistries have been used in real-time PCR detection methods. These assay chemistries include the use of double-stranded DNA binding dyes, dual-labeled oligonucleotides, such as hairpin primers and hairpin probes. However, a drawback of current real-time PCR is its limited multiplexing capability. Current real-time PCR technology uses reporter fluorescent dyes that are free in solution. In multiplex reactions, the design must use spectrally different fluorescent dyes in each assay. For example, a multiplex reaction designed to detect 4 target sequences will require an instrument that can distinguish 4 different, free-floating fluorescent dyes by spectral differences, and this does not include controls. These requirements not only limit the actual multiplexing capability, but also increase the cost, because such equipment usually requires multiple emission sources, detectors and filters. The multiplexing capability of current real-time PCR technology is about 1-6 plexes. Summary of the invention

[0010] The present invention relates to systems and methods for amplifying and detecting DNA. In particular, embodiments of the present invention provide systems and methods that greatly improve the multiplexing capabilities of detectable probes for detecting amplified target sequences.

[0011] In a first embodiment, a method for detecting the presence of a target nucleic acid is provided, comprising: (a) contacting a sample with a cleavable probe, the probe comprising, from 5' to 3', (i) a first sequence region comprising a marker; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of the target nucleic acid; (b) contacting the cleavable probe with an endoribonuclease, thereby cleaving the probe hybridized to the target nucleic acid to form a truncated cleavable probe; (c) hybridizing the truncated cleavable probe to itself to form a hairpin probe; (d) extending the hairpin probe; and (e) detecting the target nucleic acid by detecting a signal change of the marker. In some aspects, the label in the first sequence region (i) is a reporter group-quencher group pair, and the extension of the hairpin probe on the first sequence region changes the distance between the reporter group and the quencher group; or at least one non-natural nucleotide labeled with the first member of the reporter group-quencher group pair and the extension of the hairpin probe on the first sequence region lead to the introduction of a complementary non-natural nucleotide labeled with the second member of the reporter group-quencher group pair. In some aspects, all or part of the sequence (iii) that is the reverse complement sequence of the second sequence region may be complementary to the first region on the first strand of the target nucleic acid or the sequence (iii) is not complementary to the first region on the first strand of the target nucleic acid. In some embodiments, the method further comprises performing a melt analysis on the hairpin probe.

[0012] In one embodiment, a method for detecting the presence of a target nucleic acid is provided, comprising: (a) contacting a sample with a cleavable probe, the probe comprising, from 5' to 3', (i) a first sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a target nucleic acid; (b) contacting the cleavable probe with an endoribonuclease, thereby cleaving the probe hybridized to the target nucleic acid to form a truncated cleavable probe; (c) hybridizing the truncated cleavable probe with itself to form a hairpin probe; (d) extending the hairpin probe in the presence of a non-natural nucleotide labeled with a second member of a reporter group-quencher group pair that is capable of base pairing with at least one non-natural nucleotide in the first sequence region; and (e) detecting the target nucleic acid by detecting signal changes in the labels on the cleavable probe and the hairpin probe. In certain aspects, the portion of sequence (iii) that is the reverse complement of the second sequence region may be complementary to the first region on the first strand of the target nucleic acid. In some embodiments, the method further comprises performing a melting analysis on the hairpin probe.

[0013] In another embodiment, a method for detecting the presence of a target nucleic acid is provided, comprising: (a) contacting a sample with a cleavable probe, the probe comprising from 5' to 3' (i) a first sequence region labeled with a reporter group-quencher group pair; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence comprising one or more ribonucleotide bases complementary to the first region on the first strand of the target nucleic acid; (b) contacting the cleavable probe with an endoribonuclease, thereby cleaving the cleavable probe hybridized with the target nucleic acid to form a truncated probe; (c) hybridizing the truncated probe with itself to form a hairpin probe; (d) extending the hairpin probe to the first sequence region so that the distance between the reporter group and the quencher group increases; and (e) detecting the target nucleic acid by detecting a signal change in the reporter group. In certain embodiments, one of the members of the reporter group-quencher group pair is at the 5' end of the cleavable probe. In some embodiments, one of the members of the reporter group-quencher group pair is at the 5' end of the first sequence region, and the other member of the reporter group-quencher group pair is at the 3' end of the first sequence region. In certain embodiments, the reporter group is a fluorescent dye. In certain aspects, all or part of the sequence (iii) that is the reverse complementary sequence of the second sequence region may be complementary to the first region on the first strand of the target nucleic acid, or the sequence (iii) is not complementary to the first region on the first strand of the target nucleic acid. In some embodiments, the method further includes performing a melting analysis on the hairpin probe.

[0014] In some aspects, the cleavable probe may also include (v) a loop sequence of one or more nucleotides between the second sequence region and the sequence that is the reverse complementary sequence of the second sequence region. In some aspects, the length of the loop sequence may be 4-20, 6-15 or 10-15 nucleotides. In some aspects, the loop sequence may include at least 3-5 continuous A nucleotides. In some embodiments, the loop sequence includes one or more polymerase extension blocking parts. In some aspects, the loop sequence may include a combination of one or more nucleotides and one or more extension blocking parts. The polymerase extension blocking part may be used as part or all of the loop sequence. Examples of extension blocking parts include carbon spacers. The carbon spacer may include a spacer having a length of 3 to 36 carbon atoms. Common examples of internal oligonucleotide carbon spacers include spacers having a length of 3, 9 and 18 carbon atoms. The carbon spacer may be used to prevent the cleavable probe from forming non-specific double-stranded PCR products. The carbon spacer may also be used to adjust the melting temperature (melt temperature, Tm) of the hairpin probe. Other polymerase extension blocking moieties may comprise non-natural nucleotides, ribonucleotides, or any other non-nucleotide chemical moiety.

[0015] In some aspects, the length of the second sequence area can be 6-20 nucleotides. In some aspects, the length of the second sequence area complementary sequence can be 6-20 nucleotides. In some aspects, the length of the first sequence area can be 4-20 nucleotides. In some aspects, the length of the sequence complementary to the first area on the first strand of the target nucleic acid can be 6-50, 10-50 or 6-30 nucleotides. In some aspects, one or more ribonucleotide bases of the cleavable probe can be located just at 3' of the sequence of the reverse complementary sequence of the second sequence area (also referred to herein as the second sequence area complementary sequence). In some aspects, one or more ribonucleotide bases of the cleavable probe can be located at least 4 bases from the 3' end of the sequence complementary to the first area on the first strand of the target nucleic acid. As described above, all or part of the sequence of the reverse complementary sequence of the second sequence area can be complementary to the first area on the first strand of the target nucleic acid or the sequence is not complementary to the first area on the first strand of the target nucleic acid.

[0016] In some aspects, the cleavable probe may comprise a sequence comprising 1 to 5 ribonucleotide bases complementary to the first region on the first strand of the target nucleic acid sequence. In some aspects, the cleavable probe may comprise a sequence comprising 3 to 5 ribonucleotide bases complementary to the first region on the first strand of the target nucleic acid sequence.

[0017] In some aspects, the cleavable probe can include non-base pairing modifications, which can be located at 3' and / or 5' of a ribobase (ribobase), and within the sequence of the probe, otherwise the sequence will be complementary to the first district on the first strand of the target nucleic acid. These modifications may include natural or non-natural nucleotides that are not base-paired with the target sequence, or may include carbon spacers or other non-nucleotide chemical moieties. Non-base pairing modifications may be placed upstream or downstream of a ribonucleotide but in the region of the probe (otherwise it will be complementary to the target sequence) to improve the specificity of the cleavable probe. The non-base pairing portion may be located between 2 to 20 nucleotides upstream or downstream of a ribonucleotide. In certain embodiments, the non-base pairing portion is located upstream or downstream of a ribonucleotide 1, 2, 3, 4 or 5 nucleotides or any range of nucleotides therein.

[0018] In some aspects, the at least one non-natural nucleotide labeled with the first member of the reporter group-quencher group pair can be located at the 5' end of the cleavable probe. In some aspects, the cleavable probe can include an extension blocking modification at the 3' end. In some aspects, the second sequence region of the cleavable probe can include a G / C content of at least 50%. In some aspects, the length of the second sequence region of the cleavable probe can be 6-15 nucleotides.

[0019] In certain aspects, the second sequence region of the cleavable probe may comprise one or more unnatural bases. In certain aspects, the melt point of the truncated cleavable probe and the target nucleic acid may be below 55°C after endoribonuclease or 5'-nuclease cleavage.

[0020] In some aspects, the first member of the reporter group-quencher group pair can be a reporter group. In some aspects, the reporter group used in the present embodiment can be a fluorophore. Therefore, in some cases, the signal change can be a reduction in fluorescent signal. In some aspects, the signal change of the detection label can include detecting a signal change (or rate of change) from the reporter group as the temperature of the sample changes, such as unquenching of the signal. In some aspects, the signal change of the detection reporter group can include detecting a signal change of the reporter group when the temperature of the sample is increased to above the melting point of the hairpin probe (or decreased to below the melting point of the hairpin probe).

[0021] In certain aspects, the cleavable probe can be attached to a solid support.

[0022] Certain aspects of the embodiments relate to the use of at least one non-natural nucleotide (iv). In some aspects, the non-natural nucleotide is an isobase, such as isoguanine (isoG) or isocytosine (isoC). In some aspects, at least one non-natural nucleotide or a non-natural nucleotide labeled with a quencher group can be isoG, and another can be isoC.

[0023] On the other hand, the method may include (a) contacting the sample with a second (or additional) cleavable probe, which comprises from 5' to 3' (i) a first sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a second (or additional) target nucleic acid; (b) contacting the cleavable probe with an endoribonuclease, thereby cleaving the probe hybridized to the target nucleic acid to form a truncated cleavable probe; (c) hybridizing the truncated cleavable probe with itself to form a hairpin probe; (d) extending the hairpin probe in the presence of a non-natural nucleotide labeled with a second member of a reporter group-quencher group pair that is capable of pairing with at least one non-natural nucleotide base in the first sequence region; and (e) detecting the second (or additional) target nucleic acid by detecting signal changes in the labels on the cleavable probe and the hairpin probe. For example, detecting the presence of the first and / or second target nucleic acid can be performed sequentially or substantially simultaneously. On the other hand, the first and second probes can include distinguishable reporter groups. On the other hand, the first and second probes can include the same reporter group, and in some cases, the first and second probes include hairpins with distinguishable melting points (e.g., melting points differ from each other by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30°C, or any range derivable therein).

[0024] In another aspect, the method is a multiplex method and comprises (a) contacting the sample with a third, fourth, fifth or sixth cleavable probe, the probe comprising from 5' to 3' (i) a first sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a third, fourth, fifth or sixth target nucleic acid; (b) contacting the cleavable probe with an endoribonuclease, thereby cleaving the probe hybridized to the target nucleic acid to form a truncated cleavable probe; (c) hybridizing the truncated cleavable probe with itself to form a hairpin probe; (d) extending the hairpin probe in the presence of a non-natural nucleotide labeled with a second member of a reporter group-quencher group pair that is capable of base pairing with at least one non-natural nucleotide in the first sequence region; and (e) detecting the third, fourth, fifth or sixth target nucleic acid by detecting signal changes in the labels on the cleavable probe and the hairpin probe. For example, detecting the presence of the first and / or second target nucleic acid can be performed sequentially or substantially simultaneously. On the other hand, the first and second probes can include distinguishable reporter groups. On the other hand, the first and second probes can include the same reporter group, and in some cases, the hairpin probe formed by the first and second probes can have distinguishable melting points (e.g., melting points differ from each other by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30° C., or any range that can be derived therefrom). In one aspect, the hairpin probes formed by the first, second, third, fourth, fifth and / or sixth probes can each include distinguishable markers or distinguishable melting points.

[0025] In another embodiment, the method may include (a) contacting the sample with a second (or additional) cleavable probe, the probe comprising from 5' to 3' (i) a first sequence region comprising a reporter group-quencher group pair; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence comprising one or more ribonucleotide bases complementary to the first region on the first strand of the second (or additional) target nucleic acid; (b) contacting the cleavable probe with an endoribonuclease, thereby cleaving the probe hybridized with the target nucleic acid to form a truncated cleavable probe; (c) hybridizing the truncated cleavable probe with itself to form a hairpin probe; (d) extending the hairpin probe on the first sequence region; and (e) detecting the second (or additional) target nucleic acid by detecting a signal change of the reporter group. For example, detecting the presence of the first and / or second target nucleic acid can be performed sequentially or substantially simultaneously. On the other hand, the first and second probes can include distinguishable reporter groups. In another aspect, the first and second probes can comprise the same reporter group, and in some cases, the first and second probes comprise hairpins with distinguishable melting points (e.g., the melting points differ from each other by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30° C., or any range derivable therein).

[0026] In another aspect, the method is a multiplex method and includes (a) contacting the sample with a third, fourth, fifth or sixth cleavable probe, which, from 5' to 3', comprises (i) a first sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a third, fourth, fifth or sixth target nucleic acid; (b) contacting the cleavable probe with an endoribonuclease, thereby cleaving the probe hybridized to the target nucleic acid to form a truncated cleavable probe; (c) hybridizing the truncated cleavable probe with itself to form a hairpin probe; (d) extending the hairpin probe in the presence of a non-natural nucleotide labeled with a second member of a reporter group-quencher group pair that is capable of base pairing with at least one non-natural nucleotide in the first sequence region; and (e) detecting the third, fourth, fifth or sixth target nucleic acid by detecting signal changes in the labels on the cleavable probe and the hairpin probe. For example, detecting the presence of the first and / or second target nucleic acid can be performed sequentially or substantially simultaneously. On the other hand, the first and second probes can include distinguishable reporter groups. On the other hand, the first and second probes can include the same reporter group, and in some cases, the hairpin probe formed by the first and second probes can include distinguishable melting points (e.g., melting points differ from each other by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30° C., or any range that can be derived therefrom). In one aspect, the hairpin probes formed by the first, second, third, fourth, fifth and / or sixth probes can each include distinguishable markers or have distinguishable melting points.

[0027] Thus, in some other aspects, a multiplex method according to an embodiment may include the use of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or more different probes (or any range derivable therein), wherein each probe has (1) a distinguishable melting point or comprises (2) a distinguishable label such that the signal from each different probe can be individually distinguished. In one aspect, each of the first, second, third, fourth, fifth and / or sixth cleavable probes may comprise the same first sequence region, second sequence region and / or the same loop sequence between the second sequence region and a sequence that is the reverse complement of the second sequence region. In certain embodiments, the loop region may comprise one or more polymerase extension blocking portions.

[0028] In another embodiment, a composition is provided, comprising at least a first cleavable probe, the probe comprising from 5' to 3' (i) a first sequence region comprising a marker; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence comprising one or more ribonucleotide bases complementary to the first region on the first strand of the target nucleic acid. In certain aspects, the composition may also comprise a non-natural nucleotide labeled with a reporter group or a quencher group. In certain embodiments, the marker in the first sequence region (i) is a reporter group-quencher group pair or at least one non-natural nucleotide labeled with the first member of the reporter group-quencher group pair.

[0029] In one embodiment, a composition is provided, comprising at least a first cleavable probe, the probe comprising from 5' to 3' (i) a first sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence comprising one or more ribonucleotide bases complementary to the first region on the first strand of a target nucleic acid. In certain aspects, the composition may also comprise a non-natural nucleotide labeled with a reporter group or labeled with a quencher group.

[0030] In one embodiment, a composition is provided that comprises a cleavable probe that comprises, from 5' to 3', (i) a first sequence region labeled with a fluorophore-quencher pair; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence comprising one or more ribonucleotide bases that are complementary to the first region on the first strand of a target nucleic acid.

[0031] In certain aspects, the composition may further comprise a polymerase, an endoribonuclease, a reference probe, or free nucleotides.

[0032] In some aspects, the cleavable probe may also include (v) a loop sequence of one or more nucleotides between the second sequence region and the sequence that is the reverse complementary sequence of the second sequence region. In some aspects, the length of the loop sequence may be 4-20, 6-15 or 10-15 nucleotides. In some aspects, the loop sequence may include at least 3-5 continuous A nucleotides. In some embodiments, the loop sequence includes one or more polymerase extension blocking parts. In some aspects, the loop sequence may include a combination of one or more nucleotides and one or more extension blocking parts. The polymerase extension blocking part may be used as a part or all of the loop sequence. Examples of extension blocking parts include carbon spacers. The carbon spacers may include spacers that may be 3 to 36 carbon atoms in length. Common examples of internal oligonucleotide carbon spacers include spacers that are 3, 9 and 18 carbon atoms in length. The carbon spacers may be used to prevent the cleavable probe from forming non-specific double-stranded PCR products. The carbon spacers may also be used to adjust the melting temperature (Tm) of the hairpin probe. Other polymerase extension blocking parts may include non-natural nucleotides, ribonucleotides or any other non-nucleotide chemical moieties.

[0033] On the other hand, the composition may also include a second (or additional) cleavable probe as described above, wherein different probes may be distinguishable based on having different reporter groups and / or different melting points. For example, the second (or additional) probe may include from 5' to 3' (i) a first sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a second sequence region; (iii) a sequence that is a reverse complementary sequence of the second sequence region; and (iv) a sequence comprising one or more ribonucleotide bases complementary to the first region on the first strand of the second (or additional) target nucleic acid. In some aspects, the first and second probes may include distinguishable reporter groups and / or form a hairpin with distinguishable melting points. In some aspects, the cleavable probe may also include (v) a loop sequence as described above. In some aspects, the composition comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or more probes.

[0034] In some aspects, the method of the embodiment may also include performing multiple polymerase chain reaction cycles. In some aspects, the signal change of the detection marker includes detecting the signal before, during or after performing multiple polymerase chain reaction cycles. On the other hand, the signal change of the detection marker includes detecting the signal only after performing multiple polymerase chain reaction cycles. In this aspect, the method may also include comparing the signal of the detected marker with a predetermined ratio, which is the ratio of the signal of the marker to the reference signal of the marker on the non-hybridization probe.

[0035] In some aspects, the method of the embodiment may also include quantifying the amount of target nucleic acid in the sample. For example, quantifying the amount of target nucleic acid in the sample may include: using a standard curve; determining the relative amount of the target nucleic acid; using end-point quantification; or determining the amount of the target nucleic acid by correlating the number of PCR cycles at which the signal is detectable relative to the background with the amount of target present.

[0036] In another embodiment, a kit comprising one or more compositions disclosed herein is provided. For example, in one embodiment, a kit is provided, comprising: (a) a first cleavable probe, the probe comprising from 5' to 3' (i) a first sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a second sequence region; (iii) a sequence of a reverse complementary sequence of the second sequence region; and (iv) a sequence comprising one or more ribonucleotide bases complementary to the first region on the first strand of a target nucleic acid; and (b) a non-natural nucleotide labeled with a reporter group; a non-natural nucleotide labeled with a quencher group; or an endoribonuclease. On the other hand, the kit comprises at least two, three, four, five or six probes. In some embodiments, the probe may also comprise (v) a loop sequence as described above. In some aspects, the probe may comprise a distinguishable reporter group or form a hairpin with a distinguishable melting point. In some aspects, the kit may also comprise a polymerase, a reference probe, free nucleotides or instructions for use of the kit.

[0037] In another embodiment, a method for detecting the presence of a target nucleic acid is provided, comprising: (a) contacting a sample with a first probe set, the probe set comprising a cleavable probe and a capture probe, the cleavable probe comprising, from 5' to 3', (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of the target nucleic acid; the capture probe comprising, from 5' to 3', (i) a sequence region identical to a sequence region from the cleavable probe, which comprises at least one unlabeled non-natural nucleoside identical to at least one non-natural nucleotide from the cleavable probe; acid; and (ii) a sequence complementary to the capture sequence of the cleavable probe; (b) contacting the cleavable probe with an endoribonuclease, thereby cleaving the probe hybridized to the target nucleic acid to form a truncated cleavable probe; (c) hybridizing the truncated cleavable probe with a capture probe; (d) extending the truncated cleavable probe in the presence of a non-natural nucleotide labeled with a second member of a reporter group-quencher group pair that is capable of base pairing with at least one unlabeled non-natural nucleotide in the capture probe to form an extended cleavable probe; (e) hybridizing the extended cleavable probe with itself to form a hairpin probe; and (f) detecting the target nucleic acid by detecting signal changes of the labels on the cleavable probe and the hairpin probe.

[0038] In another aspect, a method may include (a) contacting a sample with a second probe set, the probe set comprising a cleavable probe and a capture probe, the cleavable probe comprising, from 5' to 3', (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases that is complementary to a first region on a first strand of a second target nucleic acid; the capture probe comprising, from 5' to 3', (i) a sequence region identical to a sequence region from the cleavable probe, comprising at least one unlabeled non-natural nucleotide identical to at least one non-natural nucleotide from the cleavable probe; and (ii) a sequence complementary to the capture sequence of the cleavable probe; (b) contacting the cleavable probe with an endoribonuclease, thereby cleaving the probe hybridized to the second target nucleic acid to form a truncated cleavable probe; (c) hybridizing the truncated cleavable probe with a capture probe; (d) extending the truncated cleavable probe in the presence of a non-natural nucleotide labeled with a quencher group capable of base pairing with at least one unlabeled non-natural nucleotide in the capture probe to form an extended cleavable probe; (e) hybridizing the extended cleavable probe with itself to form a hairpin probe; and (f) detecting the second target nucleic acid by detecting signal changes of the labels on the cleavable probe and the hairpin probe.

[0039] In some aspects, the cleavable probe may comprise a sequence comprising 1 to 5 ribonucleotide bases complementary to the first region on the first strand of the target nucleic acid sequence. In some aspects, the cleavable probe may comprise a sequence comprising 3 to 5 ribonucleotide bases complementary to the first region on the first strand of the target nucleic acid sequence.

[0040] On the other hand, the method is a multiplex method and includes (a) contacting the sample with a third, fourth, fifth or sixth probe set, the probe set comprising a cleavable probe and a capture probe, the cleavable probe comprising from 5' to 3' (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to a first region on the first strand of a third, fourth, fifth or sixth target nucleic acid; the capture probe comprising from 5' to 3' (i) a sequence region identical to a sequence region from the cleavable probe, which comprises at least one unlabeled non-natural nucleotide identical to the at least one non-natural nucleotide from the cleavable probe; nucleotide; and (ii) a sequence complementary to the capture sequence of the cleavable probe; (b) contacting the cleavable probe with an endoribonuclease to cleave the probe hybridized with the third, fourth, fifth or sixth target nucleic acid to form a truncated cleavable probe; (c) hybridizing the truncated cleavable probe with a capture probe; (d) extending the truncated cleavable probe in the presence of a non-natural nucleotide labeled with a quencher group capable of base pairing with at least one unlabeled non-natural nucleotide in the capture probe to form an extended cleavable probe; (e) hybridizing the extended cleavable probe with itself to form a hairpin probe; and (f) detecting the third, fourth, fifth or sixth target nucleic acid by detecting a signal change of the label on the cleavable probe and the hairpin probe. For example, detecting the presence of the first and / or second target nucleic acid can be performed sequentially or substantially simultaneously. On the other hand, the first and second probe groups can include distinguishable reporter groups. In another aspect, the first and second probe sets can comprise the same reporter group, and in some cases, the hairpin probe formed by the first and second probes can comprise distinguishable melting points (e.g., melting points differ from each other by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30° C., or any range derivable therein). In one aspect, the hairpin probes formed by the first, second, third, fourth, fifth, and / or sixth probe sets can each comprise a distinguishable label or have a distinguishable melting point. Thus, in some other aspects, multiplex methods according to some embodiments can include the use of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or more different probe sets, wherein each probe has (1) a distinguishable melting point or comprises (2) a distinguishable label such that the signal from each different probe can be individually distinguished.

[0041] In certain aspects, the second sequence region of the cleavable probe can comprise one or more unnatural bases. In certain aspects, after endoribonuclease cleavage, the melting point of the truncated cleavable probe and the target nucleic acid can be below 55°C.

[0042] In certain aspects, the first member of the reporter-quencher pair can be a reporter group, such as a fluorophore. In some aspects, the signal change can be a decrease in fluorescent signal.

[0043] In some aspects, the detection of a signal change in a label may include detecting a signal change in a reporter group as the temperature of the sample changes. In some aspects, the detection of a signal change in a reporter group may include detecting a signal change in a reporter group when the temperature of the sample rises above the melting point of the hairpin probe.

[0044] In certain aspects, the cleavable probes and / or capture probes may be attached to a solid support.

[0045] In another embodiment, a composition is provided, which comprises a first probe group, the probe group comprising a cleavable probe and a capture probe, the cleavable probe comprising from 5' to 3' (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to the first region on the first strand of the target nucleic acid; the capture probe comprises from 5' to 3' (i) a sequence region identical to the sequence region from the cleavable probe, comprising at least one unlabeled non-natural nucleotide identical to the at least one non-natural nucleotide from the cleavable probe; and (ii) a sequence complementary to the capture sequence of the cleavable probe. In some aspects, the composition may also include non-natural nucleotides labeled with a reporter group or labeled with a quencher group. In some aspects, the composition may include a polymerase, a reference probe, or free nucleotides.

[0046] On the other hand, the composition may also include a second probe group, the probe group includes a cleavable probe and a capture probe, the cleavable probe from 5' to 3' includes (i) a sequence region including at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to the first region on the first strand of the second target nucleic acid; the capture probe from 5' to 3' includes (i) a sequence region identical to the sequence region from the cleavable probe, which includes at least one unlabeled non-natural nucleotide identical to at least one non-natural nucleotide from the cleavable probe; and (ii) a sequence complementary to the capture sequence of the cleavable probe. In some aspects, the first and second probe groups may include distinguishable reporter groups and / or form a hairpin with distinguishable melting points. In some aspects, the composition comprises 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or more probe sets.

[0047] In another embodiment, a kit is provided, which comprises (a) a first probe group, the probe group comprising a cleavable probe and a capture probe, the cleavable probe comprising from 5' to 3' (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; and (iii) a sequence comprising one or more ribonucleotide bases complementary to the first region on the first strand of the target nucleic acid; the capture probe comprises from 5' to 3' (i) a sequence region identical to the sequence region from the cleavable probe, which comprises at least one unlabeled non-natural nucleotide identical to at least one non-natural nucleotide from the cleavable probe; and (ii) a sequence complementary to the capture sequence of the cleavable probe; and (b) non-natural nucleotides labeled with a reporter group; non-natural nucleotides labeled with a quencher group; or an endoribonuclease. On the other hand, the kit comprises at least four sets of probes. In some aspects, the probe group may comprise a distinguishable reporter group or form a hairpin with a distinguishable melting point. In some aspects, the kit may also comprise a polymerase, a reference probe, free nucleotides, a reference sample, or instructions for use of the kit.

[0048] In yet another embodiment, a method for detecting the presence of a target nucleic acid is provided, comprising: (a) contacting a sample with a first probe set, the probe set comprising a cleavable probe and a capture probe, the cleavable probe comprising, from 5' to 3', (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a target nucleic acid; the capture probe comprising, from 5' to 3', (i) a sequence region identical to a portion of a sequence region from the cleavable probe and (ii) a sequence complementary to the capture sequence of the cleavable probe; (b) contacting a sample with a first probe set, the probe set comprising a cleavable probe and a capture probe, the cleavable probe comprising, from 5' to 3', (i) a sequence region identical to a portion of a sequence region from the cleavable probe and (ii) a sequence complementary to the capture sequence of the cleavable probe; The cleavable probe is contacted with an endoribonuclease, thereby cleaving the cleavable probe hybridized to the target nucleic acid to form a truncated cleavable probe; (c) hybridizing the truncated cleavable probe with a capture probe; (d) extending the truncated cleavable probe to form an extended probe; (e) hybridizing the extended cleavable probe with itself to form a hairpin probe; (f) further extending the hairpin probe in the presence of a non-natural nucleotide labeled with a second member of a reporter group-quencher group pair that is capable of base pairing with at least one labeled non-natural nucleotide at the 5' end of the cleavable probe; and (g) detecting the target nucleic acid by detecting changes in signals from the labels on the cleavable probe and the hairpin probe.

[0049] In another aspect, the method may include (a) contacting the sample with a second probe set, the probe set comprising a cleavable probe and a capture probe, the cleavable probe comprising, from 5' to 3', (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a second target nucleic acid; the capture probe comprising, from 5' to 3', (i) a sequence region identical to a portion of a sequence region from the cleavable probe and (ii) a sequence complementary to the capture sequence of the cleavable probe; (b) contacting the cleavable probe contacting with an endoribonuclease, thereby cleaving a cleavable probe hybridized to a target nucleic acid to form a truncated cleavable probe; (c) hybridizing the truncated cleavable probe to a capture probe; (d) extending the truncated cleavable probe to form an extended probe; (e) hybridizing the extended cleavable probe to itself to form a hairpin probe; (f) further extending the hairpin probe in the presence of a non-natural nucleotide labeled with a second member of a reporter group-quencher group pair capable of base pairing with at least one labeled non-natural nucleotide at the 5' end of the cleavable probe; and (g) detecting a second target nucleic acid by detecting signal changes in the labels on the cleavable probe and the hairpin probe.

[0050] In some aspects, the cleavable probe may comprise a sequence comprising 1 to 5 ribonucleotide bases complementary to the first region on the first strand of the target nucleic acid sequence. In some aspects, the cleavable probe may comprise a sequence comprising 3 to 5 ribonucleotide bases complementary to the first region on the first strand of the target nucleic acid sequence.

[0051] On the other hand, the method is a multiplex method and includes (a) contacting the sample with a third, fourth, fifth or sixth probe set, the probe set comprising a cleavable probe and a capture probe, the cleavable probe comprising from 5' to 3' (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a third, fourth, fifth or sixth target nucleic acid; the capture probe comprising from 5' to 3' (i) a sequence region identical to a portion of a sequence region from the cleavable probe and (ii) a sequence complementary to the capture sequence of the cleavable probe; (b) contacting the sample with a third, fourth, fifth or sixth probe set, the probe set comprising a cleavable probe and a capture probe, the cleavable probe comprising from 5' to 3' (i) a sequence region identical to a portion of a sequence region from the cleavable probe and (ii) a sequence complementary to the capture sequence of the cleavable probe; The cleavable probe is contacted with an endoribonuclease, thereby cleaving the cleavable probe hybridized with the target nucleic acid to form a truncated cleavable probe; (c) the truncated cleavable probe is hybridized with a capture probe; (d) the truncated cleavable probe is extended to form an extended probe; (e) the extended cleavable probe is hybridized with itself to form a hairpin probe; (f) the hairpin probe is further extended in the presence of a non-natural nucleotide labeled with a second member of a reporter group-quencher group pair that can be paired with at least one labeled non-natural nucleotide base of the 5' of the cleavable probe; and (g) a third, fourth, fifth or sixth target nucleic acid is detected by detecting a signal change of the label on the cleavable probe and the hairpin probe. For example, detecting the presence of the first, second and / or additional target nucleic acids can be performed sequentially or substantially simultaneously. On the other hand, the first, second and / or additional probe groups can include distinguishable reporter groups. In another aspect, the first, second and / or additional probe sets can comprise the same reporter group, and in some cases, the hairpin probe formed by the first and second probes can have distinguishable melting points (e.g., melting points differ from each other by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30° C., or any range derivable therein). In one aspect, the hairpin probes formed by the first, second, third, fourth, fifth, and / or sixth probe sets can each comprise a distinguishable label or a distinguishable melting point. Thus, in some additional aspects, multiplex methods according to the embodiments can include the use of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or more different probe sets, wherein each probe comprises (1) a distinguishable melting point or (2) a distinguishable label such that the signal from each different probe can be individually distinguished.

[0052] In certain aspects, the second sequence region of the cleavable probe may comprise one or more unnatural bases. In certain aspects, the melting point of the truncated cleavable probe and the target nucleic acid may be below 55°C after endoribonuclease cleavage.

[0053] In certain aspects, the first member of the reporter-quencher pair can be a reporter group, such as a fluorophore. In some aspects, the signal change can be a decrease in fluorescent signal.

[0054] In some aspects, the detection of a signal change in a label may include detecting a signal change in a reporter group as the temperature of the sample changes. In some aspects, the detection of a signal change in a reporter group may include detecting a signal change in a reporter group when the temperature of the sample rises above the melting point of the hairpin probe.

[0055] In certain aspects, the cleavable probes and / or capture probes may be attached to a solid support.

[0056] In another embodiment, a composition is provided, which comprises a first probe group, the probe group comprising a cleavable probe and a capture probe, the cleavable probe comprising from 5' to 3' (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to the first region on the first strand of the target nucleic acid; the capture probe comprises from 5' to 3' (i) a sequence region identical to a portion of a sequence region from a cleavable probe and (ii) a sequence complementary to the capture sequence of the cleavable probe. In some aspects, the composition may also include non-natural nucleotides labeled with a reporter group or a quencher group. In some aspects, the composition may include a polymerase, a reference probe, or free nucleotides.

[0057] On the other hand, the composition can also include a second probe group, the probe group includes a cleavable probe and a capture probe, the cleavable probe includes from 5' to 3' (i) a sequence region including at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to the first region on the first strand of the second target nucleic acid; the capture probe includes from 5' to 3' (i) a sequence region identical to a portion of the sequence region from the cleavable probe and (ii) a sequence complementary to the capture sequence of the cleavable probe. In some aspects, the first and second probe groups can include distinguishable reporter groups and / or form a hairpin with distinguishable melting points. In some aspects, the composition comprises 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or more probe sets.

[0058] In another embodiment, a kit is provided, comprising (a) a first probe group, the probe group comprising a cleavable probe and a capture probe, the cleavable probe comprising from 5' to 3' (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to the first region on the first strand of the target nucleic acid; the capture probe comprising from 5' to 3' (i) a sequence region identical to a portion of a sequence region from the cleavable probe and (ii) a sequence complementary to the capture sequence of the cleavable probe; and (b) a non-natural nucleotide labeled with a reporter group; a non-natural nucleotide labeled with a quencher group; or an endoribonuclease. On the other hand, the kit comprises at least four sets of probes. In some aspects, the probe group may comprise a distinguishable reporter group or form a hairpin with a distinguishable decomposition point. In some aspects, the kit may also comprise a polymerase, a reference probe, free nucleotides, a reference sample, or instructions for use of the kit.

[0059] In another embodiment, a method for detecting the presence of a target nucleic acid is provided, comprising: (a) contacting a sample with a first cleavable probe, the probe comprising, from 5' to 3', (i) a first sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence complementary to the first region on the first strand of the target nucleic acid; (b) hybridizing the cleavable probe and an upstream primer to the target nucleic acid and extending it using a polymerase with 5' nuclease activity; (c) extending the nucleic acid sequence until the cleavable hairpin probe contacts a polymerase with nuclease activity, thereby cleaving the probe hybridized to the target nucleic acid to form a truncated cleavable probe; (d) hybridizing the truncated cleavable probe with itself to form a hairpin probe; (e) extending the hairpin probe in the presence of a non-natural nucleotide labeled with a second member of a reporter group-quencher group pair that is capable of base pairing with at least one non-natural nucleotide in the first sequence region; and (f) detecting the target nucleic acid by detecting a signal change of the label on the hairpin probe. In certain aspects, the portion of sequence (iii) that is the reverse complement of the second sequence region may be complementary to the first region on the first strand of the target nucleic acid. In certain embodiments, the method may further include performing a melting analysis on the hairpin probe.

[0060] In another embodiment, a method for detecting the presence of a target nucleic acid is provided, comprising: (a) contacting a sample with a first cleavable hairpin probe, the probe comprising from 5' to 3' (i) a first sequence region labeled with a reporter group-quencher group pair; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence complementary to the first region on the first strand of the target nucleic acid; (b) hybridizing the cleavable probe and an upstream primer to the target nucleic acid and extending it using a polymerase with 5' nuclease activity; (c) extending the nucleic acid sequence until the cleavable hairpin probe contacts a polymerase with nuclease activity, thereby cleaving the probe hybridized to the target nucleic acid to form a truncated cleavable probe; (d) hybridizing the truncated probe with itself to form a cleaved hairpin probe; (e) extending the cleaved hairpin probe on itself to physically separate the fluorophore and the quencher group; and (f) detecting the target nucleic acid by detecting the signal change of the extended hairpin probe.

[0061] Certain aspects of the embodiments relate to the use of at least one non-natural nucleotide. In some aspects, the non-natural nucleotide is an isobase, such as isoguanine (isoG) or isocytosine (isoC). In this aspect, the non-natural nucleotide labeled with a quenching group is a homologous isoC (or isoG). In other aspects, at least one of the first and / or second primers includes at least one non-natural nucleotide in the target-specific sequence. For example, in some aspects, the non-natural nucleotide in the target-specific sequence regulates sequence-specific annealing, thereby enhancing the primer-template hybridization of the sequence-specific amplification of the nucleotide (see, e.g., PCT Publication WO2011 / 052078, incorporated herein by reference).

[0062] The cleavage and extension of the cleavable probe disclosed herein can be carried out under isothermal conditions, wherein the cleavage and extension of the cleavable probe are maintained at a substantially constant temperature. Isothermal amplification of the signal can be achieved, because the melting temperature of the two fragments of the cleaved probe and the target is lower than the melting temperature of the probe and the target before cleavage. This causes the two fragments to dissociate from the target, allowing another probe to hybridize and cleave. This process repeats itself, allowing multiple probes to be cut and extended from a single target at a constant temperature. This feature is unique compared to other methods involving closed tube multiplex detection by melting analysis, which rely on 5'-nuclease activity to obtain unique melting characteristics and cannot amplify the signal of the target or amplicon isothermally. Alternatively, the cleavage and extension of the cleavable probe disclosed herein can be carried out under non-isothermal conditions, such as under the cycle temperature conditions of PCR.

[0063] In some aspects, the method of the embodiment may further include performing an amplification step to amplify the target sequence. The cleavage and extension of the cleavable probe may be performed during or after the amplification process. For example, the amplification may be an isothermal amplification or one or more polymerase chain reaction cycles. Isothermal amplification techniques include, for example, strand displacement amplification (SDA), loop-mediated amplification (LAMP), rolling circle amplification (RCA), and helicase-dependent amplification (HAD) (see, for example, Yan et al., 2014). In some aspects, the signal change of the detection marker includes detecting the signal before, during, or after performing isothermal amplification or multiple polymerase chain reaction cycles. On the other hand, the signal change of the detection marker includes detecting the signal only after performing isothermal amplification or multiple polymerase chain reaction cycles. In this aspect, the method may further include comparing the signal of the detected marker with a predetermined ratio, the predetermined ratio being the ratio of the signal of the marker to the reference signal of the marker on the non-hybridized probe.

[0064] In some aspects, the method of the embodiment may further include quantifying the amount of target nucleic acid in the sample. For example, quantifying the amount of target nucleic acid in the sample may include: using digital PCR; using a standard curve; determining the relative amount of nucleic acid target; using end-point quantification; or determining the amount of target nucleic acid by correlating the number of PCR cycles at which the signal is detectable relative to the background with the amount of target present.

[0065] In many aspects of the present method, the signal change of the detection reporter group can include changing the detection signal change (or rate of change) as the temperature of the sample changes, such as the signal is not quenched. In one aspect, the temperature of the sample can be increased to above (or reduced to below) the melting point of the hairpin of one or more primers in the sample. In the presence of two or more primer sets, changing the temperature of the sample can include raising the temperature of the sample from a temperature lower than the first primer of the first primer set and the first primer of the second primer set to a temperature higher than the melting points of the two hairpins.

[0066] In various aspects, the probes of the embodiments can comprise the same reporter group and comprise hairpins with distinguishable melting points (e.g., melting points that differ from each other by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30° C., or any range derivable therein).

[0067] In further aspects, multiplex methods according to the embodiments may comprise the use of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or more different probe sets, wherein each probe or probe set comprises (1) a hairpin with a distinguishable melting point or (2) a distinguishable reporter group, such that the signal from each different probe or probe set can be individually distinguished.

[0068] In another embodiment, a kit comprising one or more probes or probe groups of an embodiment is provided. On the other hand, the kit also comprises a polymerase with exonuclease activity, an endoribonuclease (e.g., RNase H), a reference probe, free nucleotides, free non-natural nucleotides, a reference sample and / or instructions for use of the kit.

[0069] As used herein, the solid support can be a bead having magnetic properties and / or a bead having a density that allows it to rest on a two-dimensional surface in a solution. The particles can rest on a two-dimensional surface by magnetic forces, gravity or ionic forces or by chemical bonds or any other means known to those skilled in the art. The particles can be composed of glass, polystyrene, latex, metal, quantum dots, polymers, silica, metal oxides, ceramics or any other substance suitable for binding nucleic acids, or chemical substances or proteins that can then be connected to nucleic acids. The particles can be rod-shaped or spherical or disc-shaped, or include other arbitrary shapes. The particles can also be distinguished by their shape or size or physical position. The particles can be spectrally different due to the composition, the composition contains a dye or contains one or more dyes or fluorescent dyes in multiple ratios or multiple concentrations, or the particles can be distinguished by bar codes or holographic images or other imprinted forms of particle encoding. When the particles are magnetic particles, they can be attracted to the chamber surface by applying a magnetic field. Similarly, the magnetic particles can be dispersed from the chamber surface by removing the magnetic field. The magnetic particles are preferably paramagnetic or superparamagnetic. In the absence of a magnetic field, paramagnetic and superparamagnetic particles have negligible magnetism, but application of a magnetic field induces alignment of the magnetic domains in the particles, causing the particles to be attracted to the source of the field. When the field is removed, the magnetic domains revert to random orientations, resulting in no magnetic attraction or repulsion between particles. In the case of superparamagnetism, the magnetic domains revert to random orientations of the domains almost immediately, while paramagnetic materials will retain domain alignment for some time after the magnetic field is removed. When the particles have sufficient density, they can be attracted to the floor of the chamber by gravity and dispersed from the floor of the chamber by stirring the chamber (e.g., by vortexing, ultrasound, or fluid motion). Stirring of the chamber can also be used to further assist in particle dispersion in methods and systems in which particles are attracted to the chamber surface by other forces, such as magnetic or ionic forces, or suction, or vacuum filtration, or affinity, or hydrophilicity or hydrophobicity, or any combination thereof.

[0070] A marker or labeling agent is a molecule that facilitates detection of the molecule (e.g., a nucleic acid sequence) to which it is attached. A large number of reporter molecules are known that can be used to label nucleic acids. Direct reporter molecules include fluorophores, chromophores, and radiophores. Non-limiting examples of fluorophores include, for example, red fluorescent square cyanine dyes (e.g., 2,4-bis[1,3,3-trimethyl-2-dihydroindolylmethyl]cyclobutene dihydrogen phosphate) and fluorophores. -1,3-dioxolane (2,4-Bis[1,3,3-trimethyl-2-indolinylidenemethyl]cyclobutenediylium-1,3-dio-xolate)), infrared dyes (e.g. 2,4-Bis[3,3-dimethyl-2-(1H-phenyl[e]dihydroindolylmethyl)]cyclobutenediylium -1,3-dioxolane (2,4Bis[3,3-dimethyl-2-(1H-benz[e]indolinylidenemethyl)]cyclobutenediylium-1,3-dioxolate)) or an orange fluorescent square acid cyanine dye (e.g. 2,4-bis[3,5-dimethyl-2-pyrrolyl]cyclobutenediylium -1,3-dioxolane (2,4-Bis[3,5-dimethyl-2-pyrrolyl]cyclobutenediylium-1,3-diololate). Other non-limiting examples of fluorophores include: quantum dots, Alexa Fluor TM Dye, AMCA, BODIPY TM 630 / 650, BODIPY TM 650 / 665, BODIPY TM -FL,BODIPY TM -R6G, BODIP Y TM -TMR, BODIPY TM -TRX, Cascade Blue TM , CyDye TM including but not limited to Cy2 TM , Cy3 TM and Cy5 TM ,DNA intercalating dye, 6-FAM TM , fluorescein, HEX TM ,6-JOE,Oregon Green TM 488,Oregon Green TM 500,Oregon Green TM 514,Pacific Blue TM ,REG, phycobilliproteins include but are not limited to phycoerythrin and allophycocyanin, Rhodamine Green TM ,Rhodamine Red TM ,ROX TM ,TAMRA TM ,TET TM,Tetramethylrhodamine, or Texas Red TM Signal amplification reagents, such as tyramide (PerkinElmer), can be used to enhance the fluorescent signal. Indirect reporter molecules include biotin, which must be bound to another molecule (such as streptavidin-phycoerythrin) for detection. Label pairs, such as fluorescence resonance energy transfer pairs or dye-quencher pairs, can also be used.

[0071] The labeled amplification product can be directly or indirectly labeled. Direct labeling can be achieved, for example, by using labeled primers, labeled dNTPs, labeled nucleic acid intercalators, or a combination thereof. Indirect labeling can be achieved, for example, by hybridizing a labeled probe to the amplification product.

[0072] The method disclosed herein may also include quantifying the initial amount of the target nucleic acid in the sample. The quantification may include, for example, determining the relative concentration of DNA present in the exponential phase of real-time PCR by mapping the fluorescence relative to the number of cycles on a logarithmic coordinate. Afterwards, the amount of DNA may be determined by comparing the result with a standard curve, and the standard curve may be generated by performing real-time PCR on a serial dilution of a known amount of DNA. In addition, real-time PCR may be combined with reverse transcription polymerase chain reaction to quantify the RNA (including low-abundance RNA) in the sample. Alternatively, quantification may be achieved by digital PCR.

[0073] The target nucleic acid sequence can be any sequence of interest. The sample comprising the target nucleic acid sequence can be any sample comprising nucleic acid. In some aspects of the present invention, the sample is, for example, an object of the presence or absence of one or more genetic mutations or polymorphisms being screened. In another aspect of the present invention, the sample can be from an object of the presence or absence of a pathogen being tested. When the sample is obtained from the object, it can be obtained by methods known to those skilled in the art, such as aspiration, biopsy, swabbing, venipuncture, spinal puncture, fecal sample or urine sample. In some aspects of the present invention, the sample is an environmental sample, such as water, soil or air sample. In other aspects of the present invention, the sample is from a plant, bacterium, virus, fungus, protozoa or metazoan.

[0074] Each amplification cycle has three stages: a denaturation stage, a primer annealing stage, and a primer extension stage. The amplification cycle can be repeated until the desired amount of amplification product is produced. Typically, the amplification cycle is repeated about 10 to 40 times. For real-time PCR, detection of the amplification product is usually performed after each amplification cycle. However, in certain aspects of the present invention, the amplification product can be detected after every 2, 3, 4, or 5 amplification cycles. Detection can also be performed so that the analysis or detection is as little as 2 or more amplification cycles. The amplification cycle can be performed in the same chamber as the amplification detection, in which case the chamber needs to contain a heating element so that the temperature in the chamber can be adjusted during the denaturation stage, primer annealing stage, and primer extension stage of the amplification cycle. The heating element is usually controlled by a processor. However, the amplification cycle can be performed in a different chamber from the amplification detection, in which case the "amplification" chamber needs to contain a heating element, while the "detection" or "imaging" chamber does not need to have a heating element. When amplification and detection occur in different chambers, the fluid of the amplification reaction can be transferred between the chambers by, for example, a pump or a piston. The pump or piston can be controlled by a processor. Alternatively, fluids may be transferred between the chambers manually (eg, using a pipette).

[0075] Amplification can be carried out in a reaction mixture comprising at least one non-natural nucleotide having a non-natural nucleotide. The at least one non-natural nucleotide of the reaction mixture can be base paired with at least one non-natural nucleotide present in the primer of the first and / or second primer set. Optionally, the non-natural nucleotide is coupled to a label that can include a fluorophore and a quencher group. The quencher group can quench the fluorophore present in the primer of the first and / or second primer set.

[0076] Detection can include amplifying one or more polynucleotides in the group. For example, in the presence of at least one non-natural nucleotide, detection can include amplifying one or more polynucleotides in the group. The non-natural nucleotides can have non-natural nucleotides (e.g., isoC and isoG) that are optionally capable of base pairing with non-natural nucleotides of an oligonucleotide mixture (e.g., non-natural nucleotides present in a denatured oligonucleotide). The non-natural nucleotides can be coupled to a label. Suitable labels include fluorophores and quenching groups.

[0077] The method can be used to continuously detect the target during amplification or in real time. The method can be used quantitatively.

[0078] Some aspects of the embodiment relate to endoribonucleases and use this enzyme specificity to cut probes with ribonucleotide (RNA) positions when the probe is hybridized with a DNA target sequence. In some respects, the endoribonucleases are RNase H, such as RNase HII. In some specific aspects, the endoribonucleases are thermostable enzymes or thermophilic hot start enzymes (e.g., thermostable RNase HII and thermophilic hot start RNase HII).

[0079] Amplification can be performed in the presence of one or more non-natural nucleotides and / or at least one quencher group coupled to the non-natural nucleotide. In some embodiments, the non-natural nucleotide coupled to the at least one quencher group can be isoCTP or isoGTP.

[0080] In some methods, the first and second labels can be different. In some methods, the first and second quencher groups can be different and can quench two different fluorophores. In other methods, the first and second quencher groups can be the same and can quench two different fluorophores.

[0081] The methods described herein may include determining the melting temperature of an amplicon (e.g., an amplified nucleic acid of at least one amplified HIV nucleic acid and an amplified control nucleic acid). The methods may include determining the melting temperature of a nucleic acid complex, the nucleic acid complex comprising a labeled probe hybridized to a target nucleic acid (which may include an amplified target nucleic acid). The melting temperature may be determined by exposing the amplicon or nucleic acid complex to a temperature gradient and observing a signal from a marker. Optionally, the melting temperature may be determined by (a) reacting the amplicon with an intercalator under a temperature gradient and (b) observing a detectable signal from the intercalator. The melting temperature of the nucleic acid complex may be determined by (1) hybridizing a probe to a target nucleic acid to form a nucleic acid complex, wherein at least one of the probe and the target nucleic acid comprises a marker; (2) exposing the nucleic acid complex to a temperature gradient; and (3) observing a signal from the marker.

[0082] The method can be performed in any suitable reaction chamber under any suitable conditions. For example, the method can be performed in the reaction chamber without opening the reaction chamber. The reaction chamber can be part of an array of reaction chambers. In some embodiments, the steps of the method can be performed separately in different reaction chambers.

[0083] The methods disclosed herein can be performed in droplets. Likewise, the compositions disclosed herein can be disposed within droplets. For example, droplets can be used to separate the cleavable probes disclosed herein into many separate reactions for PCR or isothermal amplification. Therefore, in certain embodiments, the methods disclosed herein are compartmentalized in droplets to perform quantitative digital PCR reactions or other quantitative digital amplification reactions. As described in Vogelstein et al., 1999, pp. 9236-9241, digital PCR methods can help distribute target nucleic acids so that the vast majority of reactions contain one or zero target nucleic acid molecules. At certain dilutions, the number of amplification positive reactions is equal to the number of template molecules initially present.

[0084] In some embodiments, the method is capable of detecting no more than about 100 copies of a target nucleic acid in a sample (e.g., a sample having a volume of about 25 microliters). In other embodiments, the method is capable of detecting no more than about 500 copies, 1000 copies, 5000 copies, or 10000 copies in a sample (e.g., a sample having a volume of about 25 microliters).

[0085] In other embodiments, using real-time detection, the method is capable of detecting no more than about 100 copies of a target nucleic acid in a sample (e.g., a sample with a volume of about 25 microliters) within no more than about 150, no more than about 100, no more than about 90, no more than about 80, no more than about 70, no more than about 60, no more than about 50, no more than about 40, or no more than about 30 PCR cycles.

[0086] As used in this specification, expressions without numerical qualifiers may mean one or more. As used in the claims, when used in conjunction with the word "comprises", expressions without numerical qualifiers may mean one or more than one.

[0087] The term "or" used in the claims is intended to mean "and / or" unless it is explicitly stated that it is only alternatives or the alternatives are mutually exclusive, although the present disclosure supports a definition referring only to alternatives and "and / or." As used herein, "another" may mean at least a second or more.

[0088] Throughout this application, the term "about" is used to indicate a value that includes the inherent variation of error for the device, the method being employed to determine the value, or the variability that exists between study subjects.

[0089] Through the following detailed description, other purposes, features and advantages of the present invention will become apparent. However, it should be understood that the detailed description and specific examples describing some preferred embodiments of the present invention are given by way of example only, and therefore, based on the detailed description, various changes and modifications within the spirit and scope of the present invention will become apparent to those skilled in the art. BRIEF DESCRIPTION OF THE DRAWINGS

[0090] The following drawings form part of this specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in conjunction with the detailed description of specific embodiments presented herein.

[0091] Figure 1A -B— is a non-limiting exemplary schematic diagram illustrating a probe system of an embodiment. Figure 1A , the cleavable probe comprises an isoG nucleotide ("isoG*") labeled with a reporter group at its 5' end, a first sequence region ("Tag A"), a second sequence region ("Tag B"), a loop sequence, a sequence region that is the reverse complementary sequence of Tag B ("Tag B complementary sequence"); and a sequence complementary to the target amplicon (denoted as "A"). The cleavable probe also comprises one or more ribonucleotides (indicated by solid squares) in the "A" sequence, and may comprise a modification (denoted as "P") that blocks extension at the 3' end. In the presence of the target amplicon, the cleavable probe hybridizes with the amplicon and is cleaved by RNase H at the ribonucleotide position. After cleavage, the probe can hybridize with itself through Tag B and the Tag B complementary sequence to form a hairpin. Extension of the probe will synthesize a sequence complementary to the Tag A sequence, and will introduce an isoC labeled with a quencher group ("isoC Q ”). The resulting hairpin probe quenches the fluorescence of labeled isoG. Figure 1B Probes can be designed to have unique melting temperatures (Tm), for example by adjusting the sequence and length of the sequence region. Thus, differential probes with different melting temperatures (and therefore not quenched at different temperatures) can be subjected to melting analysis.

[0092] Figure 2 - Non-limiting exemplary probe constructs of embodiments with variable stem, loop, Tm and ΔG. Design probes as detailed in Figure 1. The sequence of each probe is shown (SEQ ID NO: 1-11 listed from top to bottom). The Tag A sequence is bold and the stem consists of 3 segments: sequence specific (B, underlined nucleotides), universal sequence (C, italic nucleotides) and an extendable universal sequence ending with a fluorophore-labeled isobase (A, bold font nucleotides).

[0093] Figure 3- Non-limiting exemplary target-specific probe designs of the embodiments (SEQ ID NOs: 12-21 listed from top to bottom). The three segments of the stem are as follows Figure 2 shown.

[0094] Figure 4 – The diagram shows the Figure 2 Temperature gradient for hairpin folding of the indicated constructs.

[0095] Figure 5 - Graph showing fluorescence quenching of RTx-5 constructs as a function of time as the annealing temperature is gradually reduced (see e.g. Figure 4 ). Complete quenching was observed when the temperature step of 71 °C was reached.

[0096] Figure 6 - Graph showing fluorescence quenching of the RTx-10 construct as a function of time as the annealing temperature is gradually decreased (see e.g. Figure 4 ). Complete quenching was observed when the temperature step of 62°C was reached.

[0097] Figure 7 - Graph showing fluorescence quenching of RTx-11 construct as a function of time as the annealing temperature is gradually decreased (see e.g. Figure 4 ). Complete quenching was observed when the temperature step of 41 °C was reached.

[0098] Figures 8A-8C - The graph shows amplification (upper graph) and melting curves (lower graph) obtained from constructs RTx-1 and RTx-2 at 50°C, 62°C and 68°C.

[0099] Figures 9A-9C - The graph shows amplification (upper graph) and melting curves (lower graph) obtained from constructs RTx-7 and RTx-8 at 50°C, 62°C and 68°C.

[0100] Figures 10A-10C - The graph shows amplification (upper graph) and melting curves (lower graph) obtained from constructs RTx-9, RTx-10 and RTx-11 at 50°C, 62°C and 68°C.

[0101] Figures 11A-11D - The graph shows amplification (upper graph) and melting (lower graph) curves of full-length probes FL-RTx-2-20 (A), FL-RTx-2-12AT1 (B), FL-RTx-2c (C), and FL-RTx-2-12-AT-4 (D). Control: water = thin solid line, clinical negative sample = dotted line. Test probe results are shown as thick solid lines.

[0102] Fig.12– is a non-limiting exemplary schematic diagram of a probe system illustrating an embodiment. The reporter probe comprises a reporter group-labeled isoC nucleotide ("isoC*") at its 5' end, a first sequence region ("region 1"), a sequence comprising isoG and / or isoC positions ("isoprimer"); and a sequence complementary to the amplicon (denoted as "A"). The sequence complementary to the amplicon also comprises at least one ribonucleotide position. In the presence of the target amplicon, the reporter probe hybridizes with the amplicon and is cleaved by RNase H at the ribonucleotide position. After cleavage, the reporter probe can hybridize with a capture oligonucleotide ("capture oligonucleotide or capture oligo"), which comprises a capture segment complementary to the isoprimer and an optional A sequence portion, followed by a mirror tag region and a 3' unlabeled isoC. Extension of the reporter probe will synthesize a sequence complementary to mirror region 1 on the capture oligonucleotide, and will introduce isoG labeled with a quencher group ("isoG Q ”). The extended reporter probe now comprises region 1 and a region 1 complementary sequence, which allows the probe to form a hairpin, thereby quenching the fluorescence of the labeled isoC. The probes can be designed to have unique melting temperatures (Tm), for example by adjusting the sequence and length of the first sequence region. Thus, melting analysis can be performed on differential probes with different melting temperatures (and therefore no quenching at different temperatures).

[0103] Fig.13 - Plot of the inverted derivative of the data obtained during the melting analysis.

[0104] Fig.14 – Melting profile data of multiple probes using the same fluorophore.

[0105] Fig.15 - A non-limiting exemplary schematic diagram of a probe system of an embodiment is shown, wherein the probe comprises both a fluorophore ("F") and a quencher ("Q"), as well as a ribose cleavage ("R") site. Following cleavage at the ribose cleavage site, extension results in the separation of the fluorophore and the quencher, such that a detectable change in the signal can be observed.

[0106] Fig.16 - A non-limiting exemplary schematic diagram of a probe system of an embodiment is shown, wherein the probe comprises both a fluorophore ("F") and a quencher ("Q"). 5' nuclease cleavage followed by extension results in the separation of the fluorophore and quencher, allowing a detectable change in signal to be observed.

[0107] Fig.17– A non-limiting exemplary schematic diagram of a probe system of an embodiment is shown, wherein the probe comprises a loop sequence of one or more nucleotides located between a second sequence region and a sequence (B and B') that is a reverse complement of the second sequence region, wherein the loop sequence is complementary to a sequence of a target nucleic acid. DETAILED DESCRIPTION

[0108] Description of Illustrative Embodiments

[0109] Melting analysis detection utilizes melting or annealing peaks to distinguish the identity of amplicons, but these melting peaks are not easily distinguishable among amplicons that melt around the same temperature and are easily affected by the native sequence composition of the target. By generating hairpin sequences with unique melting profiles, multiplexing can be achieved in a single color channel, thereby enabling even greater multiplexing with multicolor channels.

[0110] Disclosed are methods and kits for detecting nucleic acids in samples. Generally, the method includes detecting signals, such as signals emitted from fluorophores. Also disclosed are oligonucleotides, particularly probes, that can be used to detect target nucleic acids. In a specific method of the embodiment, extendable probes are used to promote multiplicity by generating multiple melting curves for each fluorophore. In some cases, the probe is composed of a hairpin structure having a sequence-specific tail at the 3' end and an extendable universal sequence at the 5' end that ends with an isobase labeled with a fluorophore. Different from other probe-based chemicals, the sequence-specific segment is used for target recognition and the release of the hairpin is used for detection. In some aspects, the release of the hairpin is based on the cutting of the RNA / DNA hybrid generated as the sequence-specific tail of the probe hybridizes with the template. Therefore, the sequence-specific segment has no or only a few (e.g., 3-4) bases introduced into the hairpin structure, and the hairpin structure is mainly composed of a target-independent sequence. Changing the length of the extendable segment of the hairpin produces a hairpin with a variety of sizes, thereby allowing each fluorophore to generate multiple melting curves.

[0111] I. Definitions

[0112] As used herein, "nucleic acid" means DNA or RNA, single-stranded or double-stranded and any chemical modification thereof. Modifications include, but are not limited to, those that provide other chemical groups that integrate additional charge, polarity, hydrogen bonding, electrostatic interactions, and mobility (fluxionality) to nucleic acid ligand bases or the entire nucleic acid ligand. Such modifications include, but are not limited to, sugar modifications at the 2' position, pyrimidine modifications at the 5 position, purine modifications at the 8 position, modifications at the exocyclic amine, replacement of 4-thiouridine, replacement of 5-bromo- or 5-iodo-uracil, backbone modifications, methylation, and unusual base pairing combinations, such as isobases. Therefore, nucleic acids described herein include not only the standard bases adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U), but also non-standard or non-natural nucleotides. For example, non-standard or non-natural nucleotides that form hydrogen bond base pairing are described in US Patent Nos. 5,432,272, 5,965,364, 6,001,983, 6,037,120 and 6,140,496, which are all incorporated herein by reference. "Non-standard nucleotides" or "non-natural nucleotides" means bases other than A, G, C, T or U, which are easily incorporated into oligonucleotides and can be paired with complementary non-standard or non-natural nucleotide bases to form base pairs by hydrogen bonds or hydrophobic, entropic or van der Waals interactions. Some examples include the base pair combinations of iso-C / iso-G, K / X, K / P, H / J and M / N illustrated in US Patent No. 6,037,120, which are incorporated herein by reference.

[0113] The hydrogen bonds of these non-standard or non-natural nucleotide pairs are similar to those of natural bases, wherein two or three hydrogen bonds are formed between the hydrogen bond acceptor and the hydrogen bond donor of the non-standard or non-natural nucleotides of the pairing. One difference between natural bases and these non-standard or non-natural nucleotides is the number and position of hydrogen bond acceptors and hydrogen bond donors. For example, cytosine can be considered as donor / acceptor / acceptor base, and guanine is a complementary acceptor / donor / donor base. Iso-C is an acceptor / acceptor / donor base, and iso-G is a complementary donor / donor / acceptor base, as illustrated in US Patent No. 6,037,120, which is incorporated herein by reference.

[0114] Other non-natural nucleotides for use in oligonucleotides include, for example, naphthalene, phenanthrene, and pyrene derivatives as discussed in Ren et al., 1996 and McMinn et al., 1999, both of which are incorporated herein by reference. These bases do not utilize hydrogen bonding for stabilization, but instead rely on hydrophobic or van der Waals interactions to form base pairs.

[0115] The term "sample" as used herein is used in its broadest sense. Samples may include body tissues or body fluids, including but not limited to blood (or blood fractions, such as plasma or serum), lymph, mucus, tears, urine and saliva. Samples may include extracts of cells, chromosomes, organelles or viruses. Samples may include DNA (e.g., genomic DNA), RNA (e.g., mRNA), and / or cDNA, any of which may be amplified to provide amplified nucleic acids. Samples may include nucleic acids in solution or be bound to a substrate (e.g., a part of a microarray). Samples may include materials obtained from environmental locations (e.g., water bodies, soil, etc.), or materials obtained from fomites (i.e., inanimate objects used to transfer pathogens from one host to another).

[0116] The term "nucleic acid source" refers to any sample containing nucleic acids (RNA or DNA). Particularly preferred target nucleic acid sources are biological samples, including, but not limited to, blood, plasma, serum, saliva, cerebrospinal fluid, pleural fluid, milk, lymph, sputum and semen.

[0117] As used herein, the term "limit of detection" refers to the lowest level or amount of an analyte (e.g., nucleic acid) that can be detected and quantified. The limit of detection can be expressed as a molar value (e.g., a limit of detection of 2.0 nM), a measurement in grams (e.g., a limit of detection of 2.0 micrograms under specific reaction conditions), a copy number (e.g., 1×10 5 limit of detection of copy number), or other expression methods known in the art.

[0118] The term "separation" used herein about nucleic acid molecules refers to nucleic acid molecules separated from organisms and biological materials (e.g., blood, cells, serum, plasma, saliva, urine, feces, sputum, nasopharyngeal aspirates, etc.), which are present in the natural sources of nucleic acid molecules. When produced by recombinant technology, the nucleic acid molecules of separation (e.g., cDNA molecules) may not contain other cell materials or culture medium substantially, or when chemical synthesis, the nucleic acid molecules of the separation may not contain chemical precursors or other chemical substances substantially. In some embodiments, the nucleic acid molecules of the polypeptide / protein encoding can also be separated or purified. The method for nucleic acid separation is well known in the art and may include total nucleic acid separation / purification method, RNA specific separation / purification method, or DNA specific separation / purification method.

[0119] The term "microarray" used herein refers to the arrangement of multiple polynucleotides, polypeptides or other chemical compounds on a substrate. The terms "element" and "array element" refer to polynucleotides, polypeptides or other chemical compounds with unique and defined positions on a microarray.

[0120] Oligonucleotide used herein is understood to be a molecule with a base sequence on a backbone, and the backbone is mainly composed of identical monomeric units with a definite interval. The base is arranged in such a way on the backbone that it can be bonded with a nucleic acid, and the nucleic acid has a base sequence complementary to the base of the oligonucleotide. The most common oligonucleotide has a sugar-phosphate unit backbone. There can be a difference between the oligodeoxyribonucleotides consisting of "dNTPs" not having a hydroxyl group in the 2' position and the oligoribonucleotides consisting of "NTPs" having a hydroxyl group in the 2' position. Oligonucleotides can also include derivatives in which the hydrogen of the hydroxyl group is replaced by an organic group (e.g., allyl).

[0121] Oligonucleotides are nucleic acids comprising at least two nucleotides. Oligonucleotides used in the methods disclosed herein typically comprise at least about 10 nucleotides, more typically at least about 15 nucleotides. Preferred oligonucleotides for the methods disclosed herein comprise about 10-25 nucleotides. Oligonucleotides can be designed as "primers". "Primers" are short nucleic acids, typically ssDNA oligonucleotides, which can anneal with a target polynucleotide by complementary base pairing. Then, the primers can be extended along a target DNA or RNA chain by a polymerase (e.g., DNA polymerase). Primer pairs can be used to amplify (and identify) nucleic acid sequences (e.g., by polymerase chain reaction (PCR)). Oligonucleotides can be designed as "probes". "Probes" refer to oligonucleotides, complementary sequences thereof, or fragments thereof, for detecting identical, allelic, or related nucleic acid sequences. Probes can comprise oligonucleotides that have been connected to detectable markers or reporter group molecules. Typical markers include fluorescent dyes, quenching groups, radioisotopes, ligands, scintillators, chemiluminescent agents, and enzymes.

[0122] Oligonucleotides can be designed to have specificity to the target nucleic acid sequence in the sample. For example, oligonucleotides can be designed to include the "antisense" nucleic acid sequence of the target nucleic acid. The term "antisense" used herein refers to any composition that can base pair with the "sense" (coding) strand of a specific target nucleic acid sequence. The antisense nucleic acid sequence can be "complementary" to the target nucleic acid sequence. "Complementarity" used herein describes the relationship between two single-stranded nucleic acid sequences annealed by base pairing. For example, 5'-AGT-3' and its complementary sequence 3'-TCA-5' pair. In some embodiments, primers or probes can be designed to include mismatches at different positions. "Mismatches" used herein means nucleotide pairs that do not include standard Watson-Crick base pairs, or nucleotide pairs that do not preferentially form hydrogen bonds. The mismatch can include non-natural or non-standard nucleotides or natural nucleotides that are replaced by specific bases in the target. For example, the probe or primer sequence 5'-AGT-3' has a single mismatch with the target sequence 3'-ACA-5'. The 5' "A" of the probe or primer is mismatched with the 3' "A" of the target. Similarly, the target sequence 5'-AGA-3' has a single mismatch with the probe or primer sequence 3'-(iC)CT-5'. Here, iso-C replaces the native "T". However, the sequence 3'-(iC)CT-5' has no mismatch with the sequence 5'-(iG)GA-3'.

[0123] Oligonucleotide can also be designed as degenerate oligonucleotide. " degenerate oligonucleotide " used herein is intended to include oligonucleotide groups, oligonucleotide pools (pool) or multiple oligonucleotides containing different sequence mixtures, wherein sequence differences occur in the specific position of each oligonucleotide of the group. Multiple replacements can include any natural or non-natural nucleotides, and can include any number of possible nucleotides that are different in any given position. For example, the above-mentioned degenerate oligonucleotide can alternatively include R=iC or iG, or R=A or G or T or C or iC or iG.

[0124] Oligonucleotide described herein can form hydrogen bonds with oligonucleotides with complementary base sequences generally.These bases can include natural bases, such as A, G, C, T and U, and artificial, non-standard or non-natural nucleotides, such as iso-cytosine and iso-guanine.As described herein, when compared with the continuous bases (reading from 3' to 5') of the second sequence, when the continuous bases (reading from 5' to 3') of the first sequence follow the base pairing rule of Watson-Crick, the first sequence of oligonucleotide is described as 100% complementary to the second sequence of oligonucleotide.Oligonucleotide can include nucleotide replacement.For example, artificial base can be used to replace natural base, so that the artificial base shows the specific interaction similar to natural base.

[0125] Oligonucleotides that are specific for a target nucleic acid can also be specific for a nucleic acid sequence that has "homology" with the target nucleic acid sequence. "Homology" as used herein refers to sequence similarity or (interchangeably) sequence identity between two or more polynucleotide sequences or two or more polypeptide sequences. The terms "percent identity" and "% identity" for polynucleotide sequences refer to the percentage of residue matches between at least two polynucleotide sequences compared using a standard algorithm (e.g., BLAST).

[0126] An oligonucleotide specific for a target nucleic acid will "hybridize" with the target nucleic acid under appropriate conditions. "Hybridization" or "hybridization with..." as used herein refers to the process by which a single strand of an oligonucleotide anneals to a complementary strand through base pairing under defined hybridization conditions. "Specific hybridization" refers to the high degree of complementarity shared by two nucleic acid sequences. A specific hybridization complex is formed under conditions that allow annealing, and hybridization is maintained after any subsequent washing steps. Conditions that allow annealing of nucleic acid sequences can be routinely determined by one of ordinary skill in the art, and can be performed at 65°C, for example, in the presence of about 6×SCC. The stringency of hybridization can be expressed in part by reference to the temperature at which the washing steps are performed. Under a defined ionic strength and pH, the temperature is generally selected to be higher than the thermal melting point (T m ) is about 5℃ to 20℃ lower. m It is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. m Equations such as the nearest-neighbor parameter, and conditions for nucleic acid hybridization are known in the art.

[0127] As used herein, "target" or "target nucleic acid" refers to a nucleic acid molecule containing a sequence that is at least partially complementary to an oligonucleotide, such as a probe or primer. A "target" sequence may include a portion of a gene or genome.

[0128] As used herein, "nucleic acid", "nucleotide sequence" or "nucleic acid sequence" refers to a nucleotide, an oligonucleotide, a polynucleotide or any fragment thereof, and a naturally occurring or synthetic molecule. These terms also refer to DNA or RNA of genomic or synthetic origin, which may be single-stranded or double-stranded, and may represent the sense or antisense strand, or any DNA-like or RNA-like material. Reference to an "RNA equivalent" of a DNA sequence consists of a linear sequence of nucleotides identical to the reference DNA sequence, except that the nitrogenous base thymine is completely replaced by uracil and the sugar backbone consists of ribose instead of deoxyribose. RNA can be used in the methods described herein and / or can be converted to cDNA by reverse transcription employed in the methods described herein.

[0129] "Amplification" as used herein refers to the production of additional copies of a nucleic acid sequence. Amplification is usually performed using polymerase chain reaction (PCR) known in the art. The term "amplification reaction system" refers to any in vitro device that increases the number of copies of a nucleic acid target sequence. The term "amplification reaction mixture" refers to an aqueous solution containing a variety of reagents for amplifying a target nucleic acid. These reagents may include an enzyme (e.g., a thermostable polymerase), a buffered aqueous solution, a salt, an amplification primer, a target nucleic acid, a nucleoside triphosphate, and optionally, at least one labeled probe and / or optionally, at least one reagent for determining the melting temperature of the amplified target nucleic acid (e.g., a fluorescent intercalator that exhibits a fluorescence change in the presence of a double-stranded nucleic acid).

[0130] The amplification methods described herein may include "real-time monitoring" or "continuous monitoring". These terms refer to monitoring multiple times during the PCR cycle, preferably during the temperature transition period, and more preferably obtaining at least one data point at each temperature transition. The term "homogeneous detection assay" is used to describe an assay that includes coupled amplification and detection, which may include "real-time monitoring" or "continuous monitoring".

[0131] Nucleic acid amplification can include amplification of nucleic acids or subregions of these nucleic acids. For example, amplification can include amplification of nucleic acid portions of 30 to 50, 50 to 100, or 100 to 300 bases in length by selecting appropriate primer sequences and using PCR. In other aspects, isothermal amplification techniques (i.e., no thermal cycling is required) can be used to achieve amplification. For example, methods of isothermal nucleic acid amplification, such as loop-mediated isothermal amplification (LAMP) provided in US Patent 6,410,278 and US Patent Publication 20080182312, each of which is incorporated herein by reference in its entirety.

[0132] The disclosed method may include amplifying at least one or more nucleic acids in a sample. In the disclosed method, amplification is monitored using a real-time method.

[0133] The amplification mixture can contain natural nucleotides (including A, C, G, T and U) and non-natural or non-standard nucleotides (for example, including iC and iG). DNA and RNA oligonucleotides include deoxyribose or ribose, respectively, coupled by phosphodiester bonds. Each deoxyribose or ribose contains a base coupled to the sugar. The bases integrated into naturally occurring DNA and RNA are adenosine (A), guanosine (G), thymidine (T), cytidine (C) and uridine (U). These five bases are "natural bases". According to the base pairing rules set forth by Watson and Crick, the natural bases hybridize to form purine-pyrimidine base pairs, in which G pairs with C and A pairs with T or U. These pairing rules facilitate the specific hybridization of oligonucleotides with complementary oligonucleotides.

[0134] Two or three hydrogen bonds are generated between the two bases of each base pair, which is conducive to the formation of base pairs by natural bases. Each base contains two or three hydrogen bond donors and hydrogen bond acceptors. The hydrogen bonds of base pairs are formed separately by the interaction of at least one hydrogen bond donor on a base and a hydrogen bond acceptor on another base. Hydrogen bond donors include, for example, heteroatoms (for example, oxygen or nitrogen) with at least one hydrogen connected. Hydrogen bond acceptors include, for example, heteroatoms (for example, oxygen or nitrogen) with lone pairs of electrons.

[0135] The natural or non-natural nucleotides used herein can be derivatized by replacement of non-hydrogen bonding sites to form modified natural or non-natural nucleotides. For example, natural nucleotides can be derivatized to be attached to a support by coupling reactive functional groups (e.g., sulfhydryls, hydrazines, alcohols, amines, etc.) to non-hydrogen bonding atoms of the nucleotides. Other possible substitutes include, for example, biotin, digoxigenin, fluorescent groups, alkyl groups (e.g., methyl or ethyl groups), etc.

[0136] The use of non-natural nucleotides according to the methods disclosed herein can extend beyond the detection and quantification of nucleic acid sequences present in a sample. For example, non-natural nucleotides can be identified by catalyzing a variety of enzymes that react with nucleic acids. Although polymerases require complementary nucleotides to continue polymerization and extend oligonucleotide chains, other enzymes do not require complementary nucleotides. If non-natural nucleotides are present in the template and there is no complementary non-natural nucleotide in the reaction mixture, when attempting to extend the extended primer through the non-natural nucleotide, the polymerase will usually stop (or, in some cases, when a sufficient amount of time is given, the base will be misintegrated). However, other enzymes that catalyze reactions related to nucleic acids, such as ligases, kinases, nucleases, polymerases, topoisomerases, helicases, etc., can catalyze reactions involving non-natural nucleotides. These features of non-natural nucleotides can be utilized and fall within the scope of the methods and kits disclosed herein.

[0137] The nucleotides disclosed herein, including non-natural nucleotides, can be coupled to a label (eg, a quencher group or a fluorophore). The coupling can be performed using methods known in the art.

[0138] The oligonucleotide in the method herein can be used as a primer. In some embodiments, the oligonucleotide is labeled. For example, the oligonucleotide is labeled with a reporter group (e.g., fluorophore) that emits a detectable signal. The oligonucleotide can include at least one non-natural nucleotide. For example, the oligonucleotide can include at least one nucleotide (e.g., iC or iG) that is not an A, C, G, T or U base. When the oligonucleotide is used as a primer, such as for PCR, the amplification mixture can include at least one nucleotide labeled with a quenching group (e.g., Dabcyl). The labeled nucleotide can include at least one non-natural or non-standard nucleotide. For example, the labeled nucleotide can include at least one nucleotide (e.g., iC or iG) that is not an A, C, G, T or U base.

[0139] In some embodiments, the oligonucleotide can be designed to not form an intramolecular structure (e.g., a hairpin). In other embodiments, the oligonucleotide can be designed to form an intramolecular structure (e.g., a hairpin). For example, the oligonucleotide can be designed to form a hairpin structure, which changes after the oligonucleotide is hybridized with the target nucleic acid, and optionally, after the target nucleic acid is amplified using the oligonucleotide as a primer.

[0140] The oligonucleotide can be labeled with a fluorophore that exhibits quenching when the oligonucleotide is incorporated as a primer into the amplified product. In other embodiments, after the oligonucleotide is incorporated as a primer into the amplified product, the oligonucleotide can emit a detectable signal (e.g., intrinsically, or by fluorescence induction or fluorescence dequenching). Such primers are known in the art (e.g., LightCycler primers, Amplifluor primers, TM Primer, Scorpion TM Primers and Lux TM Primer). The fluorophore used to label the oligonucleotide can emit a signal when embedded in a double-stranded nucleic acid. Therefore, after the oligonucleotide acts as a primer to amplify the nucleic acid, the fluorophore can emit a signal.

[0141] The oligonucleotides used in the disclosed method can be suitable as primers to amplify at least one nucleic acid in a sample, and as probes to detect at least one nucleic acid in a sample. In some embodiments, the oligonucleotide is labeled with at least one fluorescent dye, which can produce a detectable signal. The fluorescent dye can be used as a fluorescence donor to perform fluorescence resonance energy transfer (FRET). When the oligonucleotide is used to amplify the target nucleic acid, the detectable signal can be quenched. For example, the amplification mixture can include nucleotides labeled with a quenching group of a detectable signal emitted by a fluorophore. Optionally, the oligonucleotide can be labeled with a second fluorescent dye or a quenching group dye that can be used as a fluorescence acceptor (for example, for FRET). When the oligonucleotide is labeled with a first fluorescent dye and a second fluorescent dye, the first fluorescent dye, the second fluorescent dye, or the signal of both can be detected. Signals can be detected under a certain temperature gradient (for example, in order to determine the melting temperature of an amplicon, a complex comprising a probe hybridized with a target nucleic acid, a hairpin, or a T probe complex).

[0142] The disclosed method can be carried out with the oligonucleotide of any appropriate number. When adopting multiple oligonucleotides (for example 2 or more oligonucleotides), different oligonucleotides can be used to produce different fluorescent dye labels of detectable signal. In some embodiments, the oligonucleotide labeling has at least one of two different fluorescent dyes. In other embodiments, the oligonucleotide labeling has at least one of three different fluorescent dyes.

[0143] In some embodiments, the signal emitted by each different fluorescent dye can be distinguished from the signal emitted by any other different fluorescent dye used to mark the oligonucleotide. For example, different fluorescent dyes can have maximum emission wavelengths, and all maximum emission wavelengths differ from each other by at least about 5nm (preferably at least about 10nm). In some embodiments, each different fluorescent dye is excited by different wavelength energy. For example, different fluorescent dyes can have maximum absorption wavelengths, and all maximum absorption wavelengths differ from each other by at least about 5nm (preferably at least about 10nm).

[0144] When a fluorescent dye is used to determine the melting temperature of a nucleic acid in the method, the signal that the fluorescent dye can emit can be distinguished from the signal emitted by any other different fluorescent dye used to label the oligonucleotide. For example, the maximum emission wavelength of the fluorescent dye used to determine the melting temperature of the nucleic acid can differ from the maximum emission wavelength of any other fluorescent dye used to label the oligonucleotide by at least about 5 nm (preferably at least about 10 nm). In some embodiments, the fluorescent dye used to determine the melting temperature of the nucleic acid can be excited by a wavelength energy that is different from the wavelength energy of any other different fluorescent dye used to label the oligonucleotide. For example, the maximum absorption wavelength of the fluorescent dye used to determine the melting temperature of the nucleic acid can differ from the maximum absorption wavelength of any fluorescent dye used to label the oligonucleotide by at least about 5 nm (preferably at least about 10 nm).

[0145] The method may include determining the melting temperature of at least one nucleic acid in the sample (e.g., an amplicon or a nucleic acid complex comprising a probe that hybridizes to a target nucleic acid), which can be used to identify the nucleic acid. Determining the melting temperature may include exposing the amplicon or nucleic acid complex to a temperature gradient and observing a detectable signal from a fluorophore. Optionally, when the oligonucleotides of the method are labeled with a first fluorescent dye, determining the melting temperature of the detected nucleic acid may include observing a signal from a second fluorescent dye that is different from the first fluorescent dye. In some embodiments, the second fluorescent dye used to determine the melting temperature of the detected nucleic acid is an intercalator. Suitable intercalators may include, but are not limited to, SYBR TM Green 1 dye, SYBR dye, PicoGreen, SYTO dye, SYTOX dye, ethidium bromide, ethidium homodimer-1, ethidium homodimer-2, ethidium derivatives, acridine, acridine orange, acridine derivatives, ethidium-acridine heterodimer, ethidium monoazide, propidium iodide, anthocyanin monomer, 7-aminoactinomycin D, YOYO-1, TOTO-1, YOYO-3, TOTO-3, POPO-1, BOBO-1, POPO-3, BOBO-3, LOLO-1, JOJO-1, anthocyanin dimer, YO-PRO-1, TO-PRO-1, YO-PRO-3, TO-PRO-3, TO-PRO-5, PO-PRO-1, BO-PRO-1, PO-PRO-3, BO-PRO-3, LO-PRO-1, JO-PRO-1, and mixtures thereof. In some suitable embodiments, the intercalator selected is SYBR TM Green 1 dye.

[0146] In the disclosed methods, each amplified target nucleic acid or reporter probe-template pair has a different melting temperature. For example, the melting temperature of each amplified target nucleic acid or reporter probe-template pair may differ from the melting temperature of any other amplified target nucleic acid or reporter probe-template pair by 1-10°C, such as at least about 1°C, more preferably at least about 2°C, or even more preferably at least about 4°C.

[0147] As used herein, a "label" or "reporter molecule" is a chemical or biochemical moiety used to label a nucleic acid. "Labels" and "reporter molecules" include fluorescent agents, chemiluminescent agents, chromogenic agents, quenchers, radionuclides, enzymes, substrates, cofactors, scintillators, inhibitors, magnetic particles, and other moieties known in the art. "Labels" or "reporter molecules" are capable of producing a measurable signal and can be covalently or non-covalently linked to an oligonucleotide.

[0148] As used herein, "fluorescent dye" or "fluorophore" is a chemical group that can be excited by light to emit fluorescence. Some suitable fluorophores can be excited by light to emit phosphorescence. Dyes can include acceptor dyes that can quench the fluorescent signal of fluorescent donor dyes. Dyes that can be used in the disclosed methods include, but are not limited to, fluorophores, such as red fluorescent squarylium dyes (e.g., 2,4-bis[1,3,3-trimethyl-2-dihydroindolylmethyl]cyclobutene dihydrogen phosphate dyes). -1,3-dioxolane), infrared dyes (e.g. 2,4-bis[3,3-dimethyl-2-(1H-phenyl[e]dihydroindolylmethyl)]cyclobutene diols) -1,3-dioxolane) or an orange fluorescent cyanine dye (e.g. 2,4-bis[3,5-dimethyl-2-pyrrolyl]cyclobutene diol) -1,3-dioxolane). Other non-limiting examples of fluorophores include: quantum dots, Alexa Fluor TM Dye, AMCA, BODIPY TM 630 / 650, BODIPY TM 650 / 665, BODIPY TM -FL,BODIPY TM -R6G, BODIPY TM -TMR, BODIPY TM -TRX, Cascade Blue TM , CyDye TM (including but not limited to Cy2 TM , Cy3 TM and Cy5 TM ), DNA intercalating dye, 6-FAM TM , fluorescein, HEX TM,6-JOE,Oregon Green TM 488,Oregon Green TM 500,Oregon Green TM 514,PacificBlue TM ,REG, Phycobiliproteins include but are not limited to phycoerythrin and allophycocyanin, Rhodamine Green TM ,Rhodamine Red TM ,ROX TM ,TAMRA TM ,TET TM ,Tetramethylrhodamine, or Texas Red TM .

[0149] Fluorescent dyes or fluorophores may include derivatives that are modified to facilitate conjugation to another reactive molecule. Thus, fluorescent dyes or fluorophores may include amine reactive derivatives, such as isothiocyanate derivatives and / or succinimidyl ester derivatives of the fluorophore.

[0150] The oligonucleotides and nucleotides of the disclosed methods can be labeled with a quenching group. Quenching can include dynamic quenching (e.g., by FRET), static quenching, or both. Suitable quenching groups include Dabcyl. Suitable quenching groups also include dark quenching groups, which can include black hole quenching groups sold under the trade name "BHQ" (e.g., BHQ-0, BHQ-1, BHQ-2, and BHQ-3, Biosearch Technologies, Novato, CA). Dark quenching groups can also include black hole quenching groups sold under the trade name "QXL TM " Dark quencher groups are sold by Anaspec, San Jose, CA. Dark quencher groups can also include DNP-type non-fluorophores containing 2,4-dinitrophenyl.

[0151] The methods and compositions disclosed herein can be used for compartmentalized reactions. One method for compartmentalized reactions is to use droplets, which are separated volumes of a first fluid completely surrounded by a second fluid or by a second fluid and one or more surfaces. In the field of molecular diagnostics and life science research, this is usually two immiscible liquids. Multiple embodiments disclosed herein use an oil-in-water emulsion containing multiple aqueous droplets in a non-aqueous continuous phase. All or a subset of the droplets can contain an analyte of interest. An emulsion is usually formed by combining two immiscible phases (e.g., water and oil) in the presence of one or more surfactants. The basic types of emulsions are oil-in-water (o / w), water-in-oil (w / o), and bi-continuous. In droplet-based bioassays, emulsions are usually water-in-oil emulsions, wherein assay reagents (e.g., PCR primers, salts, enzymes, etc.) are contained in an aqueous phase. The "oil" phase can be a single oil or a mixture of different oils. Any suitable non-aqueous fluid can form the non-aqueous continuous phase of an emulsion disclosed herein. In some embodiments, the non-aqueous continuous phase comprises mineral oil, silicone oil, or fluorinated oil (e.g., FC-40 [Sigma-Aldrich]).

[0152] Droplets can be imaged by a variety of techniques. For ease of imaging, a composition comprising droplets can be dispersed on a surface so that the droplets are substantially arranged on the surface in a monolayer. The imaging surface can be, for example, on a glass slide or in a chamber (e.g., a glass or quartz chamber). An imaging system can be used to detect droplets, as well as labeled analytes or reaction products (e.g., hairpin probes) in the droplets. For example, detection can include imaging the fluorescence wavelength and / or fluorescence intensity emitted from the labeled hairpin probe. In an embodiment where the droplet also includes coded particles (e.g., coded microspheres), imaging can include collecting decoded images of the coded particles and performing assay imaging to detect the probes in the droplets. The comparison of decoded images and assay images allows greater multiplex capabilities by using a combination of fluorophores. The method of the present invention can also include associating the signal from the amplified product of direct or indirect labeling with the concentration of DNA or RNA in the sample. Examples of imaging systems that can be suitable for use with the methods and compositions disclosed herein are described in U.S. Patent No. 8,296,088 and U.S. Patent Publication 2012 / 0288897, which are incorporated herein by reference.

[0153] As mentioned above, polymerase chain reaction (PCR) is an example of a reaction that can be performed in a droplet. In particular, droplets can be used for digital PCR (dPCR) technology. dPCR includes partitioning samples so that independent nucleic acid molecules contained in the sample are located in many separate areas, such as independent wells of a microplate, in a dispersed phase of an emulsion, or in an array of nucleic acid binding surfaces. Each partition (e.g., droplet) will contain 0 or more than 0 molecules, providing a negative reaction or a positive reaction, respectively. Unlike conventional PCR, dPCR does not rely on the number of amplification cycles to determine the initial amount of target nucleic acid in a sample. Therefore, dPCR eliminates the reliance on exponential data to quantify target nucleic acids and provide absolute quantification. Bead emulsion PCR (nucleic acids on beads in its clonally amplified emulsion) is an example of dPCR technology, in which the reaction is partitioned in droplets. See, for example, U.S. Patent Nos. 8,048,627 and 7,842,457, which are incorporated herein by reference. When dPCR is performed in an emulsion as discussed in more detail below, the emulsion should be thermally stable to allow it to undergo thermal cycling conditions.

[0154] There are a variety of methods for performing dPCR in emulsions. For example, in one method, a DNA sample is diluted to an appropriate concentration, mixed with PCR reagents (primers, dNTPs, etc.), and encapsulated in droplets in an emulsion as described above to obtain multiple discrete reaction samples. The droplets are subjected to PCR thermal cycles, and the amplicons are detected by fluorescence (or other suitable reporter groups) imaging as described above. In the context of the cleavable probe embodiment of the present invention, the amplicons are detected by the fluorescence (or other suitable reporter groups) of the probe.

[0155] The thermal cycle of the droplet can be performed by any suitable technique known in the art. For example, the droplet can be thermally cycled in a tube or chamber, rather than being heated and cooled. In some embodiments, the method uses continuous flow amplification to amplify the nucleic acid template. A variety of methods for continuous flow amplification have been reported. For example, U.S. Patent No. 7,927,797 (which is incorporated herein by reference) describes an oil-in-water emulsion used in conjunction with continuous flow PCR. Isothermal reactions (e.g., rolling circle amplification, whole genome amplification, NASBA or chain displacement amplification) can also be performed in the droplet. The system can also be used to monitor the droplet while increasing or decreasing the temperature to obtain a melting spectrum for each droplet, which will allow multiple detection and quantification. The probe itself can be used in the droplet to amplify the isothermal signal so that no other forms of amplification (e.g., PCR or other isothermal amplification reactions) are required to detect targets with low copy numbers in the droplet.

[0156] II. Embodiment

[0157] The following examples are included to demonstrate some preferred embodiments of the present invention. It will be appreciated by those skilled in the art that the techniques disclosed in the following examples represent techniques found by the inventor to work well in the practice of the present invention and therefore can be considered to constitute some preferred modes of its practice. However, based on the teachings of the present disclosure, it will be appreciated by those skilled in the art that many changes may be made to the disclosed specific embodiments without departing from the spirit and scope of the present invention and still obtaining the same or similar results.

[0158] Example 1. Multi-probe system

[0159] Solution phase multiplexing strategies for molecular assays rely on the use of multiple fluorophores combined with the generation of multiple fluorescence melt curves to detect >10 targets. Various embodiments disclosed herein provide real-time probe-based chemistry that allows for higher multiplexing capabilities by utilizing extendable hairpin probes to generate multiple melt curves per channel. Figure 1A An example of a probe for this system is shown in . In this example, the cleavable probe includes an isoG nucleotide ("isoG*") labeled with a reporter group at its 5' end, a first sequence region ("label A"), a second sequence region ("label B"), a loop sequence, a sequence region that is reverse complementary to label B ("label B complementary sequence"); and a sequence complementary to the target amplicon (denoted as "A"). The cleavable probe also includes one or more ribonucleotides (indicated by a solid square) in the "A" sequence, and may include a modification (denoted as "P") that blocks the extension on the 3' end. In the presence of the target amplicon, the cleavable probe hybridizes with the amplicon and is cleaved by RNase H2 (which recognizes and cleaves ribonucleotides in annealed RNA / DNA hybrids) at the ribonucleotide position. After cleavage, the probe can hybridize with itself through label B and the label B complementary sequence to form a hairpin. The extension of the probe will synthesize a sequence complementary to the label A sequence, and will introduce an isoC labeled with a quenching group ("isoC Q ”). The resulting hairpin probe quenches the fluorescence of the labeled isoG. The probes can be designed to have unique melting temperatures (Tm), for example by adjusting the sequence and length of the first and second sequence regions. Thus, the composition and length of the Tag A and Tag B stem structures can be varied to resolve at any desired melting temperature of the hairpin probe (see Figure 1B ).

[0160] Materials and methods

[0161] Probe design parameters

[0162] Multiple constructs of the cleavable probe were designed without the target sequence-specific tail (after cleavage) to determine the optimal design parameters for the extendable hairpin.m 10°C above the reaction temperature (about 58°C). The hairpin construct was designed to have a T > 60°C m , to allow the RNA / DNA hybrid to form a single molecule after cleavage. These constructs were designed to determine the loop size (number of bases), stem size, Gibbs free energy, and T of the hairpin after cleavage. m The example of the specific probe constructed is shown in ( Figure 2 ). For these proof-of-concept experiments, a loop of polyadenine residues ending with two cytosine "clamps" on each side of the loop was used (sequences between italic font).

[0163] 1. Folding of the probe

[0164] A temperature gradient was used to assess the folding profiles of these constructs by monitoring the decrease in fluorescence intensity of the hairpin over a temperature range from 95°C to 41°C. Figure 2 The constructs were added to a reaction mixture containing BTP-KCl pH 9.1 buffer, 2.5 mM dNTPs, 2.5 mM MgCl2, 1 mM Dabcyl-isoG and Titanium Taq enzyme (Clontech). After an initial denaturation step at 95°C, the reaction temperature was decreased from 95°C to 41°C in 3°C increments, with each interval held for 10 seconds. The temperature at which complete quenching of each construct was observed was recorded as the folding temperature of the hairpin.

[0165] 2. Efficiency of hairpin loop formation: folding, extension, and quenching of the probe

[0166] The efficiency of hairpin formation was evaluated by measuring the quenching rate of each construct at three temperatures. Figure 2 The construct was added to a reaction mixture containing BTP-KCl pH 9.1 buffer, 2.5mM dNTPs, 1mM isoG-dabcyl- and Titanium Taq enzyme (Clontech). After a 2-minute activation step at 95°C, the reaction was incubated at 50°C, 62°C and 68°C for 30 minutes to allow hairpin folding, extension and introduction of isoG-dabcyl. This was followed by a melting curve cycling scheme of 60°C for 30 seconds and incrementally increased to 95°C. The efficiency of the reaction was determined by the Ct value produced when quenching was achieved.

[0167] 3. Singleplex RT-PCR using full-length probe

[0168] The feasibility of using multiplex RTx probes for detection in amplification reactions was first evaluated in singleplex RT-PCR reactions. Figure 2-3) in the hairpin design evaluated in the present invention produces the multiple design of full-length probe (with sequence-specific tail).The target Tm of sequence-specific segment is about 10 ℃ higher than the annealing temperature of reaction.The sequence of primer (Table 1) and probe is based on the matrix gene (matrix gene) of influenza B virus.The nucleic acid extracted from influenza B strain B / Malaysia / 2506 / 04 (Zeptometrix) is used as the template in one-step RT-PCR reaction.Specifically, PCR primer (forward 180nM, reverse 60nM) and probe (120nM) are added to the reaction mixture containing BTP-KCl pH 9.1 buffer, 2.5mM dNTP, 2.5mM MgCl2, 1mM Dabcyl-isoG, Titanium Taq enzyme (Clontech) and MMLV (Promega) and RNase H (IDT). The following cycling conditions were used for amplification and melting curve analysis: 50°C, 5 min; 95°C for 10 min; 95°C for 10 sec, 58°C for 20 sec, 45 cycles, followed by a melting program: 60°C for 30 sec and 95°C for 1 sec, ending with a cooling step at 40°C.

[0169] Table 1: PCR primers

[0170] Primer name sequence <![CDATA[T m (℃)]]> Influenza B positive - short GAA GCA TTT GAA ATA GCA GAA GG (SFO ID NO: 22) 61 Influenza B Reverse - Short CAC AGA GCG TTC CTA GTT TTA CT (SEQ ID NO: 23) 62.8

[0171] result

[0172] Melting spectrum of hairpin loop

[0173] produce Figure 2 The melting profiles of the hairpin probes were used to determine the folding temperatures of the various constructs. This was measured by monitoring the decrease in fluorescence intensity in a temperature gradient from 95°C to 41°C ( Figure 4 ). The diagrams showing the quenching spectra of three exemplary constructs RTx-5, RTx-10 and RTx-11 are shown in Figure 5-7 The results of all studies are shown in Table 2 below. It was found that hairpin constructs RTx-1, 2, 3, 5, 6, 7 and 8 were completely quenched at a temperature step of 71°C, corresponding to a calculated Tm of the extended hairpin of about 71°C (IDT). Hairpin constructs RTx-4, 9 and 10 were quenched at 62°C, and hairpin RTx-11 was quenched at 41°C.

[0174] Table 2: Summary of the folding temperatures of various hairpin probes

[0175]

[0176] When comparing the stem-loop Tm, ΔG values, loop size, and stem size, the data suggest that the primary factor affecting hairpin formation is the number of bases in the stem. A secondary factor may be the Gibbs free energy associated with folding of the hairpin, since a properly folded Tm ism The ΔG of the construct is lower than T m for the 62°C and 41°C constructs.

[0177] Efficiency of hairpin loop formation

[0178] Amplification

[0179] Will come from Figure 2 The hairpin structure is used to measure the efficiency of hairpin formation at each temperature.The result confirms the above observation.For probe RT-x 1,2,7 and 8, the reaction rate is very fast (Figure 8 and Figure 9).For probe RTx-9 and 10, observe slower reaction rate, the Ct value is 5 to 10, and for RTx 11,30-35, record the highest Ct value (Figure 10) of complete quenching.These hairpins need lower temperature to form and extend, and this converts into needing longer time to carry out folding.

[0180] Melting curve analysis

[0181] Melting curve analysis of hairpin constructs RTx 1, 2, 3 and 4 showed that increasing temperature resulted in sharper melting curves ( FIG. 8 ). This was accompanied by a recorded T m Constructs RT-x5 and 6 also produced sharper melting curves at 62 °C, and no T m Melting curves and T values ​​of constructs RTx-7 and 8 m Deviating from the trend observed for the other hairpins (Figure 9).Constructs RTx 9, 10 and 11 produced broad and overlapping melting curves (Figure 10), corresponding to the data generated above.

[0182] Singleplex RT-PCR using full-length probes

[0183] Based on Figure 2 and Figure 3 The full-length probe design was created based on the data generated from the hairpin construct. The minimum stem size for targeting was 8 bases, the loop was 12-20 residues, and the T of the hairpin loop was m It is 55℃-66.4℃.

[0184] Detection

[0185] All probes produced Ct values ​​in the range of 34-35Ct ( Figures 11A-11D ). The melting curves for most probes indicated the presence of one species, primarily the extended hairpin. For some probes, minor, high T m peak.

[0186] The same fluorescence intensity was recorded for all probes except FL-RTx-2-12AT1 and FL-RTx-2-12AT2. The calculated hairpin loop T m Very close to the reaction temperature (58°C). Lowering the reaction temperature can improve the number of hairpin molecules formed and provide better detection.

[0187] Specificity

[0188] Two negative controls were included ( Figures 11A-11D The purpose of including a template negative control (water) is to detect nonspecific hairpin formation due to cleavage of the full-length probe by RNase H2. Only the probe FL-RTx-2-12-AT-4 ( Fig.11D ) shows the background non-specific melting curve, which is the same size as the hairpin that may indicate non-specific cleavage of the probe. The second negative control used was a clinical negative specimen collected from an asymptomatic patient. The purpose was to evaluate the specificity of the probe in the presence of an unrelated template. None of the probes showed any non-specific interaction with the template.

[0189] Example 2. Additional hairpin probe detection systems

[0190] Another example of a hairpin probe detection system is shown in Fig.12 The reporter probe comprises a reporter group-labeled isoC nucleotide ("isoC*") at its 5' end, a first sequence region ("region 1"), a sequence comprising isoG and / or isoC positions ("isoprimer"); and a sequence complementary to the amplicon (denoted as "A"). The sequence complementary to the amplicon also comprises at least one ribonucleotide position. In the presence of the target amplicon, the reporter probe hybridizes with the amplicon and is cleaved by RNase H at the ribonucleotide position. After cleavage, the reporter probe can hybridize with a capture oligonucleotide ("capture oligo"), which comprises a capture segment complementary to the isoprimer and an optional "A" sequence portion, followed by a mirror region 1 and a 3' unlabeled isoC. Extension of the reporter probe will synthesize a sequence complementary to the mirror label on the capture oligonucleotide, and will introduce the quencher-labeled isoG ("isoG Q ”). The extended reporter probe now comprises a tag and a tag-complementary sequence that allows the probe to form a hairpin, thereby quenching the fluorescence of the labeled isoC. The probes can be designed to have unique melting temperatures (Tm), for example by adjusting the sequence and length of the first sequence region. Thus, melting analysis can be performed on differential probes with different melting temperatures (and therefore not quenching at different temperatures).

[0191] Fig.12The assay system can also be further modified so that the capture probe does not require an isobase. In this system, the reporter probe comprises a reporter group-labeled isoC nucleotide ("isoC*") at its 5' end, a first sequence region ("region 1"), a sequence comprising isoG and / or isoC sites ("isoprimer"); and a sequence complementary to the amplicon (denoted as "A"). The sequence complementary to the amplicon also comprises at least one ribonucleotide position. In the presence of the target amplicon, the reporter probe hybridizes with the amplicon and is cleaved by RNase H at the ribonucleotide position. After cleavage, the reporter probe can hybridize with a capture oligonucleotide, which comprises a capture segment complementary to the isoprimer and an optional "A" sequence portion, followed by a mirror region 1 (which is identical to a portion of the region 1 sequence). Extension of the reporter probe will synthesize a sequence complementary to the mirror region 1 on the capture oligonucleotide. The cleavable probe can then form a hairpin by base pairing of the region 1 sequence and the sequence complementary to the mirror region 1. The hairpin sequence is further extended and will introduce the quencher-labeled isoG ("isoG Q ”). Probes can be designed to have unique melting temperatures (T m ), for example by adjusting the sequence and length of the first sequence region. Thus, differential probes having different melting temperatures (and therefore not quenched at different temperatures) can be subjected to melting analysis.

[0192] Fig.15 Another embodiment is shown, wherein the probe comprises both a fluorophore (F) and a quencher group (Q). When single-stranded, the conformation of the first sequence region makes the fluorophore approach the quencher group, resulting in a detectable quenching of the fluorophore signal. In the presence of a target, the probe hybridizes with the target and is cut by a ribonuclease at the ribonucleotide position. In this particular embodiment, the second sequence region complementary sequence, ribonucleotides, and the target-specific region 3' of the ribonucleotide are complementary to the target. After the probe is cut, the second sequence region and the second sequence region complementary sequence of the cut probe hybridize to form a hairpin structure. The 3' end of the cut probe extends to the first sequence region to produce a double-stranded molecule with a conformation that places the fluorophore at a greater distance from the quencher group, so that a detectable change in the signal can be observed.

[0193] Fig.16Another embodiment is shown, wherein the probe comprises both a fluorophore (F) and a quencher group (Q). When single-stranded, the conformation of the first sequence region makes the fluorophore close to the quencher group, resulting in a detectable quenching of the fluorophore signal. In the presence of a target, the probe hybridizes with the target and is cut by the 5' nuclease activity of the polymerase extending the upstream primer. In this specific embodiment, the second sequence region complementary sequence is not complementary to the target. After the probe is cut, the second sequence region of the cut probe and the second sequence region complementary sequence hybridize to each other to form a hairpin structure. The 3' end of the cut probe extends to the first sequence region to produce a double-stranded molecule with a conformation that places the fluorophore at a greater distance from the quencher group, so that a detectable change in the signal can be observed.

[0194] Fig.17 An embodiment is shown in which the probe comprises one member of a reporter-quencher pair, which in this particular case is a fluorophore (F). In addition, the probe comprises a first sequence region, a second sequence region, a loop region, a second sequence region complement, one or more ribonucleotides, and a target-specific region 3' of ribonucleotides. In this particular embodiment, the loop region, the second sequence region complement, the ribonucleotides, and the target-specific region 3' of ribonucleotides are complementary to the target.

[0195] Example 3. Use of hairpin probes with extension blockers in reverse transcription PCR

[0196] The forward primer (Fwd Primer) and reverse primer (Rev Primer) were combined in the wells with either the ATG0015 probe or the T-FL-RTx2c probe, which differed only in that the ATG00015 probe contained a 3 carbon spacer (iSpC3) in the loop region, while the T-FL-RTx2c did not. These were combined with the PCR master mix, thermocycled, and subsequently subjected to melting analysis.

[0197] ATG0015: / 56-FAM / / iMe-isodC / ATATCAGTCATTTGCCCAAAA(SEQ ID NO:24) / iSpC3 / AAACCGCAAATGAC rCAT GAG ACA GTA TAG TAG CGC TGA(SEQ ID NO:25) / 3SpC3 /

[0198] T-FL-RTx2c: / / 56-FAM / / iMe-isodC / ATATCAGTCATTTGCCCAAAAAAAACCGCAAATGACrCAT GAG ACA GTA TAG TAG CGC TGA (SEQ ID NO: 15) / 3SpC3 /

[0199] Forward Primer-GAA GCA TTT GAA ATA GCA GAA GG (SEQ ID NO: 22)

[0200] Reverse Primer-CAC AGA GCG TTC CTA GTT TTA CT (SEQ ID NO: 23)

[0201] Reverse transcription PCR was performed without template to monitor non-specific interactions that would cause signal changes during the melting analysis. The following PCR master mix was generated for a 25 μL reaction and run on an ABI Fast 7500 real-time thermal cycler. The thermal profile included 50°C for 5 minutes, 95°C for 2 minutes and 20 seconds, and 44 cycles of: 95°C for 10 seconds and 57°C for 23 seconds. The melting analysis included a temperature increase from 60°C to 95°C and a reading every 0.5°C.

[0202] Table 3: PCR Master Mix

[0203] Reagents Working concentration Nuclease-free water 10X ISOlution 1x 100mM MgCl2 2.5mM 1M KCl 0.05M Influenza B forward primer 0.12M Influenza B reverse primer 0.06M Probe 0.06M RNase H2 Hot Start 1mU Titanium Taq without glycerol 1x MML V reverse transcriptase 0.75

[0204] Fig.13 Reverse derivatives of the data obtained during the melting analysis are shown. For the T-FL-RTx2c probe lacking a 3-carbon spacer in the loop region, there is a non-specific melting peak at 77°C.

[0205] Without wishing to be bound by theory, it is believed that during the low temperature reverse transcriptase step at 50°C, the reverse primer in this case hybridizes to the probe downstream of the loop region, which allows the primer to extend through the loop and introduce the quencher group opposite the labeled isobase. This hybridization also results in the ribobase being cleaved, allowing the probe to also extend along the primer. The double-stranded product is amplified during the PCR reaction. The extension blocker prevents non-specific extension of the primer on the loop region, which not only prevents the formation of the quencher group / fluorophore pair, but also prevents the double-stranded product with sufficient Tm from being amplified during the 58°C annealing step of the PCR.

[0206] Example 4. Multiplicity using a single dye

[0207] The study demonstrates the ability to use multiple hairpin probes with the same fluorophore but different Tm of each extended hairpin probe. In the same PCR tube, three different probes with the same fluorophore (FAM) specific to influenza A, influenza B or adenovirus were tested together. The positive control sample containing influenza A, influenza B or adenovirus through extraction of virus culture was placed in a separate PCR tube containing multiple PCR reaction components. These targets were tested with 1000 copies per reaction. The cleavable probe sequences are shown in Table 4.

[0208] Table 4: Probe sequences

[0209]

[0210] The following PCR master mix (Table 5) was generated for a 25 μL reaction and run on a Life Technologies QuantStudio real-time PCR thermal cycler. The thermal profile included 50°C for 5 minutes, 95°C for 2 minutes and 20 seconds, and 44 cycles of: 95°C for 10 seconds and 57°C for 23 seconds. The melting analysis included ramping from 60°C to 95°C and reading every 0.5°C.

[0211] Table 5: PCR Master Mix

[0212]

[0213] Fig.14 Shown are the melting profile data of 6 separate reactions (1 positive for each of the three targets at 1000 copies / reaction, 3 no template control (NTC) samples) using the same multiplex PCR reaction mixture. Fig.14 It can be seen that influenza A, influenza B, and adenovirus specific cleavable probes each produce different melting profiles in the same fluorescent channel. Therefore, in this example, when the same fluorescent marker is used, three different viruses are distinguished by melting profiles.

[0214] ***

[0215] According to the teaching of the present disclosure, all methods disclosed and claimed herein can be carried out and executed without excessive experimentation. Although the compositions and methods of the present invention have been described according to some preferred embodiments, it is obvious to those skilled in the art that changes can be applied to the steps of the methods described herein and the steps of the methods described herein or the order of the steps without departing from the concept, spirit and scope of the present invention. More specifically, it is obvious that certain reagents related to chemistry and physiology can replace reagents described herein, and the same or similar results will be achieved at the same time. All these similar substitutions and modifications obvious to those skilled in the art are considered to be within the spirit, scope and concept of the present invention as defined by the appended claims.

[0216] References

[0217] The following references are specifically incorporated herein by reference, to the extent that they provide exemplary procedures or details supplementary to those set forth herein.

[0218] U.S. Patent Nos. 4,942,124; 4,284,412; 4,989,977; 4,498,766; 5,478,722; 4,857,451; 4,774,189; 4,767,206; 4,714,682; 5,160,974; 4,661,913; 5,654,413; 5,656,493; 5,716,784; 5,736,330; 5,837,832; 5,837,860; 5,981,180; 5,994,056; 5,736,330; 5,981,180; 6 ,057,107; 6,030,787; 6,046,807; 6,057,107; 6,103,463; 6,139,800; 6,174,670; 6,268,222; 6,322,971; 6,366,354; 6,410,278; 6,411,904; 6,449,562; 6,514,295; 6,524,793; 6,528,165; 6,592,822; 6,939,720; 6,977,161; 7,226,737; 7,645,868; and 7,955,802

[0219] U.S. Patent Application Nos. 2005 / 0191625; 2008 / 0182312; and 2009 / 0148849

[0220] McMinn et al., J. Am. Chem. Soc., 121: 11585, 1999.

[0221] Ren et al., J. Am. Chem. Soc., 118:1671, 1996.

[0222] Vogelstein et al., PCR Digital, Proc. Natl. Acad. Sci. USA, 96:9236-9241, 1996.

[0223] Yan et al., "Isothermal Amplified Detection of DNA and RNA" Mol. GioSyst. 10: 970-1003, 2014.

[0224] The original claims of the parent case of this application are incorporated herein as part of this specification:

[0225] 1. A method for detecting the presence of a target nucleic acid, comprising:

[0226] (a) contacting a sample with a first cleavable probe, the probe comprising, from 5' to 3', (i) a first sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of the target nucleic acid;

[0227] (b) contacting the cleavable probe with an endoribonuclease, thereby cleaving the probe hybridized to the target nucleic acid to form a truncated cleavable probe;

[0228] (c) hybridizing the truncated cleavable probe to itself to form a hairpin probe;

[0229] (d) extending the hairpin probe in the presence of a non-natural nucleotide labeled with a second member of a reporter group-quencher group pair that is capable of base pairing with the at least one non-natural nucleotide of the first sequence region; and

[0230] (e) detecting the target nucleic acid by detecting the signal change of the labels on the cleavable probe and the hairpin probe.

[0231] 2 . The method according to claim 1 , wherein a portion of the sequence that is the reverse complementary sequence of the second sequence region (ii) is complementary to the first region on the first strand of the target nucleic acid.

[0232] 3. The method of claim 1, wherein the endoribonuclease is RNase H.

[0233] The method according to claim 3 , wherein the RNase H is RNase HII.

[0234] 5. The method of claim 1, wherein the endoribonuclease is the thermostable RNase HII.

[0235] 6. The method of claim 1, wherein the endoribonuclease is a thermophilic, hot-start RNase HII.

[0236] 7. The method of claim 1, wherein the cleavable probe further comprises (v) a loop sequence of one or more nucleotides between the second sequence region and a sequence that is a reverse complementary sequence of the second sequence region.

[0237] 8. The method of claim 7, wherein the loop sequence is 4-20, 6-15 or 10-15 nucleotides in length.

[0238] 9. The method of claim 8, wherein the loop sequence comprises at least 3-5 consecutive A nucleotides.

[0239] 10. The method of claim 1, wherein the cleavable probe comprises an extension-blocking modification located 3' to the ribonucleotide base.

[0240] 11. The method of claim 7, wherein the cleavable probe comprises an extension blocking modification in the loop sequence.

[0241] 12. The method according to claim 1, wherein the second sequence region is 6-20 nucleotides in length.

[0242] 13. The method according to claim 1, wherein the first sequence region is 4-20 nucleotides in length.

[0243] The method according to claim 1 , wherein the length of the sequence complementary to the first region on the first strand of the target nucleic acid is 10-50 nucleotides.

[0244] 15. The method of claim 1, wherein the one or more ribonucleotide bases of the cleavable probe are located just 3' to a sequence that is the reverse complement of the second sequence region.

[0245] 16. The method of claim 1, wherein the one or more ribonucleotide bases of the cleavable probe are located at least 4 bases from the 3' end of the sequence complementary to the first region on the first strand of the target nucleic acid.

[0246] 17. The method of claim 1, wherein the cleavable probe comprises a sequence comprising 1 to 5 ribonucleotide bases complementary to a first region on a first strand of the target nucleic acid sequence.

[0247] 18. The method of claim 17, wherein the cleavable probe comprises a sequence comprising 3 to 5 ribonucleotide bases complementary to a first region on a first strand of the target nucleic acid sequence.

[0248] 19. The method of claim 1, wherein the at least one non-natural nucleotide labeled with a first member of a reporter-quencher pair is located at the 5' end of the cleavable probe.

[0249] 20. The method of claim 1, wherein the cleavable probe comprises an extension blocking modification at the 3' end.

[0250] 21. The method of claim 1, wherein the second sequence region of the cleavable probe comprises a G / C content of at least 50%.

[0251] 22. The method of claim 1, wherein the second sequence region of the cleavable probe is 6-15 nucleotides in length.

[0252] 23. The method of claim 1, wherein the second sequence region of the cleavable probe comprises one or more unnatural bases.

[0253] 24. The method of claim 1, wherein after endoribonuclease cleavage, the melting point of the truncated cleavable probe to the target nucleic acid is lower than the annealing temperature of the cleavable probe to the target nucleic acid.

[0254] 25. The method of claim 1, wherein the melting point of the truncated cleavable probe to the target nucleic acid is below 55°C after endoribonuclease cleavage.

[0255] 26. The method of claim 1, wherein the first member of the reporter-quencher pair is a reporter group.

[0256] 27. The method of claim 26, wherein the reporter group is a fluorophore.

[0257] 28. The method of claim 27, wherein the signal change is a decrease in fluorescent signal.

[0258] 29. The method of claim 1, wherein detecting a signal change of the marker comprises detecting a signal change of a reporter group as the temperature of the sample changes.

[0259] 30. The method of claim 29, wherein detecting a signal change of the reporter group comprises detecting a signal change of the reporter group when the temperature of the sample is raised above a melting point of the hairpin probe.

[0260] 31. The method of claim 1, wherein the cleavable probe is attached to a solid support.

[0261] 32. The method of claim 1, wherein the at least one non-natural nucleotide or the quencher-labeled non-natural nucleotide is isoG and the other is isoC.

[0262] 33. The method of claim 1, further comprising:

[0263] (a) contacting the sample with a second cleavable probe, the probe comprising, from 5' to 3', (i) a first sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a second target nucleic acid;

[0264] (b) contacting the cleavable probe with an endoribonuclease, thereby cleaving the probe hybridized to the target nucleic acid to form a truncated cleavable probe;

[0265] (c) hybridizing the truncated cleavable probe to itself to form a hairpin probe;

[0266] (d) extending the hairpin probe in the presence of a non-natural nucleotide labeled with a second member of a reporter group-quencher group pair that is capable of base pairing with the at least one non-natural nucleotide of the first sequence region; and

[0267] (e) detecting the second target nucleic acid by detecting the signal change of the labels on the cleavable probe and the hairpin probe.

[0268] 34. The method of claim 33, further comprising:

[0269] (a) contacting the sample with a third, fourth, fifth or sixth cleavable probe, the probe comprising, from 5' to 3': (i) a first sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a third, fourth, fifth or sixth target nucleic acid;

[0270] (b) contacting the cleavable probe with an endoribonuclease, thereby cleaving the probe hybridized to the target nucleic acid to form a truncated cleavable probe;

[0271] (c) hybridizing the truncated cleavable probe to itself to form a hairpin probe;

[0272] (d) extending the hairpin probe in the presence of a non-natural nucleotide labeled with a second member of a reporter group-quencher group pair that is capable of base pairing with the at least one non-natural nucleotide of the first sequence region; and

[0273] (e) detecting the third, fourth, fifth or sixth target nucleic acid by detecting the signal change of the labels on the cleavable probe and the hairpin probe.

[0274] 35. The method of claim 33, wherein the presence of the first target nucleic acid and the second target nucleic acid are detected substantially simultaneously.

[0275] 36. The method of claim 33, wherein the presence of the first target nucleic acid and the second target nucleic acid are detected sequentially.

[0276] 37. The method of claim 33, wherein the first probe and the second probe comprise distinguishable reporter groups.

[0277] 38. The method of claim 33, wherein the first probe and the second probe comprise the same reporter group.

[0278] 39. The method of claim 38, wherein the hairpin probe formed by the first probe and the second probe comprises distinguishable melting points.

[0279] 40. The method of claim 34, wherein the hairpin probes formed by the first, second, third, fourth, fifth, and sixth probes each comprise a distinguishable label or a distinguishable melting point.

[0280] 41. The method of claim 34, wherein the first, second, third, fourth, fifth, and sixth cleavable probes each comprise the same first sequence region, second sequence region, and / or the same loop sequence between the second sequence region and a sequence that is the reverse complement of the second sequence region.

[0281] 42. The method of claim 1, further comprising amplifying the target nucleic acid using isothermal amplification.

[0282] 43. The method of claim 1, further comprising using the cleavable probe to isothermally amplify the signal.

[0283] 44. The method of claim 1, further comprising performing a plurality of polymerase chain reaction cycles.

[0284] 45. The method of claim 44, wherein detecting a change in the signal of the marker comprises detecting a signal before and after performing the plurality of polymerase chain reaction cycles.

[0285] 46. ​​The method of claim 44, wherein detecting a change in the signal of the marker comprises detecting a signal only after performing the plurality of polymerase chain reaction cycles.

[0286] 47. The method of claim 46, further comprising comparing the detected signal of the label to a predetermined ratio, the predetermined ratio being the ratio of the signal of the label to a reference signal of the label on the non-hybridized probe.

[0287] 48. The method of claim 44, further comprising quantifying the amount of target nucleic acid in the sample.

[0288] 49. A method according to claim 48, wherein quantifying the amount of target nucleic acid in the sample includes: using a standard curve; determining the relative amount of the target nucleic acid; using endpoint quantification; or determining the amount of the target nucleic acid by correlating the number of PCR cycles at which the signal is detectable relative to background with the amount of target present.

[0289] 50. A composition comprising a first cleavable probe, which comprises from 5' to 3': (i) a first sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence comprising one or more ribonucleotide bases complementary to the first region on the first strand of a target nucleic acid.

[0290] 51. A composition according to claim 50, which further comprises a second cleavable probe, which comprises from 5' to 3': (i) a first sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence comprising one or more ribonucleotide bases complementary to the first region on the first strand of a second target nucleic acid.

[0291] 52. The composition of claim 51, wherein the first probe and the second probe comprise distinguishable reporter groups, or form hairpin probes with distinguishable debonding points.

[0292] 53. The composition of claim 51, comprising at least four probes.

[0293] 54. The composition of claim 50, further comprising a non-natural nucleotide labeled with a reporter group or a quencher group.

[0294] 55. The composition of claim 50, further comprising a polymerase, an endoribonuclease, a reference probe, or free nucleotides.

[0295] 56. A kit comprising:

[0296] (a) a first cleavable probe comprising, from 5' to 3', (i) a first sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter-quencher pair; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a target nucleic acid; and

[0297] (b) a non-natural nucleotide labeled with a reporter group; a non-natural nucleotide labeled with a quencher group; or an endoribonuclease.

[0298] 57. The kit of claim 56, comprising at least four probes.

[0299] 58. The kit of claim 57, wherein the probes comprise distinguishable reporter groups and / or form hairpin probes with distinguishable cleavage points.

[0300] 59. The kit of claim 56, further comprising a polymerase, a reference probe, free nucleotides, a reference sample, or instructions for use of the kit.

[0301] 60. A method for detecting the presence of a target nucleic acid, comprising:

[0302] (a) contacting a sample with a first probe set, the probe set comprising a cleavable probe and a capture probe, the cleavable probe comprising, from 5' to 3', (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of the target nucleic acid; the capture probe comprising, from 5' to 3', (i) a sequence region identical to the sequence region of the cleavable probe, comprising at least one unlabeled non-natural nucleotide identical to the at least one non-natural nucleotide of the cleavable probe; and (ii) a sequence complementary to the capture sequence of the cleavable probe;

[0303] (b) contacting the cleavable probe with an endoribonuclease, thereby cleaving the probe hybridized to the target nucleic acid to form a truncated cleavable probe;

[0304] (c) hybridizing the truncated cleavable probe to the capture probe;

[0305] (d) extending the truncated cleavable probe in the presence of a non-natural nucleotide labeled with a second member of a reporter group-quencher group pair capable of base pairing with the at least one unlabeled non-natural nucleotide in the capture probe to form an extended cleavable probe; and

[0306] (e) hybridizing the extended cleavable probe to itself to form a hairpin probe;

[0307] (f) detecting the target nucleic acid by detecting the signal change of the labels on the cleavable probe and the hairpin probe.

[0308] 61. The method of claim 60, wherein the cleavable probe comprises a sequence comprising 1 to 5 ribonucleotide bases complementary to a first region on a first strand of the target nucleic acid sequence.

[0309] 62. The method of claim 60, wherein the endoribonuclease is RNase H.

[0310] 63. The method of claim 62, wherein the RNase H is RNase HII.

[0311] 64. The method of claim 60, wherein the endoribonuclease is the thermostable RNase HII.

[0312] 65. The method of claim 60, wherein the endoribonuclease is a thermophilic, hot-start RNase HII.

[0313] 66. The method of claim 61, wherein the cleavable probe comprises a sequence comprising 3 to 5 ribonucleotide bases complementary to a first region on a first strand of the target nucleic acid sequence.

[0314] 67. The method of claim 60, wherein the capture sequence on the cleavable probe comprises one or more unnatural bases.

[0315] 68. The method of claim 60, wherein the melting points of the cleavable probe and the capture probe are below 55°C prior to cleavage by the endoribonuclease.

[0316] 69. The method of claim 60, wherein the cleavable probe comprises an extension blocking modification at the 3' end.

[0317] 70. The method of claim 60, wherein the cleavable probe comprises an extension blocking modification located 3' to the ribonucleotide base.

[0318] 71. The method of claim 60, wherein the first member of the reporter group-quencher group pair is a reporter group.

[0319] 72. The method of claim 71, wherein the reporter group is a fluorophore.

[0320] 73. The method of claim 72, wherein the signal change is a decrease in fluorescent signal.

[0321] 74. The method of claim 60, wherein detecting a signal change of the marker comprises detecting a signal change of a reporter group as the temperature of the sample changes.

[0322] 75. The method of claim 74, wherein detecting a signal change of the reporter group comprises detecting a signal change of the reporter group when the temperature of the sample is raised above a melting point of the hairpin probe.

[0323] 76. The method of claim 60, wherein the capture probe is attached to a solid support.

[0324] 77. The method of claim 60, wherein the at least one non-natural nucleotide or the quencher-labeled non-natural nucleotide is isoG and the other is isoC.

[0325] 78. The method of claim 60, further comprising:

[0326] (a) contacting the sample with a second probe set, the probe set comprising a cleavable probe and a capture probe, the cleavable probe comprising, from 5' to 3', (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a second target nucleic acid; the capture probe comprising, from 5' to 3', (i) a sequence region identical to the sequence region of the cleavable probe, comprising at least one unlabeled non-natural nucleotide identical to the at least one non-natural nucleotide of the cleavable probe; and (ii) a sequence complementary to the capture sequence of the cleavable probe;

[0327] (b) contacting the cleavable probe with an endoribonuclease, thereby cleaving the probe hybridized to the second target nucleic acid to form a truncated cleavable probe;

[0328] (c) hybridizing the truncated cleavable probe to the capture probe;

[0329] (d) extending the truncated cleavable probe in the presence of a quencher group-labeled non-natural nucleotide capable of base pairing with the at least one unlabeled non-natural nucleotide in the capture probe to form an extended cleavable probe; and

[0330] (e) hybridizing the extended cleavable probe to itself to form a hairpin probe;

[0331] (f) detecting the second target nucleic acid by detecting the signal change of the labels on the cleavable probe and the hairpin probe.

[0332] 79. The method of claim 78, further comprising:

[0333] (a) contacting the sample with a third, fourth, fifth or sixth probe set, the probe set comprising a cleavable probe and a capture probe, the cleavable probe comprising, from 5' to 3', (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a third, fourth, fifth or sixth target nucleic acid; the capture probe comprising, from 5' to 3', (i) a sequence region identical to the sequence region of the cleavable probe, comprising at least one unlabeled non-natural nucleotide identical to the at least one non-natural nucleotide of the cleavable probe; and (ii) a sequence complementary to the capture sequence of the cleavable probe;

[0334] (b) contacting the cleavable probe with an endoribonuclease, thereby cleaving the probe hybridized to the third, fourth, fifth or sixth target nucleic acid to form a truncated cleavable probe;

[0335] (c) hybridizing the truncated cleavable probe to the capture probe;

[0336] (d) extending the truncated cleavable probe in the presence of a quencher group-labeled non-natural nucleotide capable of base pairing with the at least one unlabeled non-natural nucleotide in the capture probe to form an extended cleavable probe; and

[0337] (e) hybridizing the extended cleavable probe to itself to form a hairpin probe;

[0338] (f) detecting the third, fourth, fifth or sixth target nucleic acid by detecting the signal change of the labels on the cleavable probe and the hairpin probe.

[0339] 80. The method of claim 78, wherein the presence of the first target nucleic acid and the second target nucleic acid are detected substantially simultaneously.

[0340] 81. The method of claim 78, wherein the presence of the first target nucleic acid and the second target nucleic acid are detected sequentially.

[0341] 82. The method of claim 78, wherein the first probe set and the second probe set comprise distinguishable reporter groups.

[0342] 83. The method of claim 78, wherein the first probe set and the second probe set comprise the same reporter group.

[0343] 84. The method of claim 83, wherein the hairpin probes formed by the first probe set and the second probe set have distinguishable melting points.

[0344] 85. The method of claim 79, wherein the hairpin probes formed by the first, second, third, fourth, fifth, and sixth probe sets each comprise a distinguishable reporter group or a distinguishable melting point.

[0345] 86. The method of claim 60, further comprising amplifying the target nucleic acid using isothermal amplification.

[0346] 87. The method of claim 60, further comprising performing multiple polymerase chain reaction cycles.

[0347] 88. The method of claim 87, wherein detecting a change in the signal of the marker comprises detecting a signal before and after performing the plurality of polymerase chain reaction cycles.

[0348] 89. The method of claim 87, wherein detecting a change in the signal of the marker comprises detecting a signal only after performing the plurality of polymerase chain reaction cycles.

[0349] 90. The method of claim 89, further comprising comparing the detected signal of the label to a predetermined ratio, the predetermined ratio being the ratio of the signal of the label to a reference signal of the label on the non-hybridized probe.

[0350] 91. The method of claim 87, further comprising quantifying the amount of target nucleic acid in the sample.

[0351] 92. The method of claim 91, wherein quantifying the amount of target nucleic acid in the sample comprises: using a standard curve; determining the relative amount of the target nucleic acid; using endpoint quantification; or determining the amount of the target nucleic acid by correlating the number of PCR cycles at which the signal is detectable relative to background with the amount of target present.

[0352] 93. A composition comprising a first probe group, wherein the probe group comprises a cleavable probe and a capture probe, wherein the cleavable probe comprises from 5' to 3' (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a target nucleic acid; and the capture probe comprises from 5' to 3' (i) a sequence region identical to the sequence region of the cleavable probe, comprising at least one unlabeled non-natural nucleotide identical to the at least one non-natural nucleotide of the cleavable probe; and (ii) a sequence complementary to the capture sequence of the cleavable probe.

[0353] 94. A composition according to claim 93, which further comprises a second probe group, wherein the second probe group comprises a cleavable probe and a capture probe, wherein the cleavable probe comprises from 5' to 3' (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a second target nucleic acid; and the capture probe comprises from 5' to 3' (i) a sequence region identical to the sequence region of the cleavable probe, comprising at least one unlabeled non-natural nucleotide identical to the at least one non-natural nucleotide of the cleavable probe; and (ii) a sequence complementary to the capture sequence of the cleavable probe.

[0354] 95. The composition of claim 94, wherein the first probe set and the second probe set comprise distinguishable reporter groups, or form hairpin probes with distinguishable melting points.

[0355] 96. The composition of claim 94, comprising at least four sets of probes.

[0356] 97. The composition of claim 93, further comprising a non-natural nucleotide labeled with a reporter group or a quencher group.

[0357] 98. The composition of claim 93, further comprising a polymerase, a reference probe, or free nucleotides.

[0358] 99. A kit comprising:

[0359] (a) a first probe set, the probe set comprising a cleavable probe and a capture probe, the cleavable probe comprising, from 5' to 3', (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; and (iii) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a target nucleic acid; the capture probe comprising, from 5' to 3', (i) a sequence region identical to the sequence region of the cleavable probe, comprising at least one unlabeled non-natural nucleotide identical to the at least one non-natural nucleotide of the cleavable probe; and (ii) a sequence complementary to the capture sequence of the cleavable probe; and

[0360] (b) a non-natural nucleotide labeled with a reporter group; a non-natural nucleotide labeled with a quencher group; or an endoribonuclease.

[0361] 100. The kit of claim 99, comprising at least four sets of probes.

[0362] 101. The kit of claim 100, wherein the probe set comprises distinguishable reporter groups and / or forms hairpin probes with distinguishable melting points.

[0363] 102. The kit of claim 99, further comprising a polymerase, a reference probe, free nucleotides, a reference sample, or instructions for use of the kit.

[0364] 103. A method for detecting the presence of a target nucleic acid, comprising:

[0365] (a) contacting a sample with a first probe set, the probe set comprising a cleavable probe and a capture probe, the cleavable probe comprising, from 5' to 3', (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a target nucleic acid; the capture probe comprising, from 5' to 3', (i) a sequence region identical to a portion of the sequence region of the cleavable probe; and (ii) a sequence complementary to the capture sequence of the cleavable probe;

[0366] (b) contacting the cleavable probe with an endoribonuclease, thereby cleaving the cleavable probe hybridized to the target nucleic acid to form a truncated cleavable probe;

[0367] (c) hybridizing the truncated cleavable probe to the capture probe;

[0368] (d) extending the truncated cleavable probe to form an extended probe;

[0369] (e) hybridizing the extended cleavable probe to itself to form a hairpin probe;

[0370] (f) further extending the hairpin probe in the presence of a non-natural nucleotide labeled with a second member of a reporter-quencher pair that is capable of base pairing with the at least one labeled non-natural nucleotide 5' to the cleavable probe; and

[0371] (g) detecting the target nucleic acid by detecting the signal change of the labels on the cleavable probe and the hairpin probe.

[0372] 104. The method of claim 103, wherein the cleavable probe comprises a sequence comprising 1 to 5 ribonucleotide bases complementary to a first region on a first strand of the target nucleic acid sequence.

[0373] 105. The method of claim 103, wherein the endoribonuclease is RNase H.

[0374] 106. The method of claim 105, wherein the RNase H is RNase HII.

[0375] 107. The method of claim 103, wherein the endoribonuclease is the thermostable RNase HII.

[0376] 108. The method of claim 103, wherein the endoribonuclease is a thermophilic, hot-start RNase HII.

[0377] 109. The method of claim 104, wherein the cleavable probe comprises a sequence comprising 3 to 5 ribonucleotide bases complementary to a first region on a first strand of the target nucleic acid sequence.

[0378] 110. The method of claim 103, wherein the capture sequence on the cleavable probe comprises one or more unnatural bases.

[0379] 111. The method of claim 103, wherein the melting point of the cleavable probe and the capture probe is less than 55°C prior to cleavage by the endoribonuclease.

[0380] 112. The method of claim 103, wherein the cleavable probe comprises an extension blocking modification at the 3' end.

[0381] 113. The method of claim 103, wherein the cleavable probe comprises an extension blocking modification located 3' to the ribonucleotide base.

[0382] 114. The method of claim 103, wherein the first member of the reporter group-quencher group pair is a reporter group.

[0383] 115. The method of claim 114, wherein the reporter group is a fluorophore.

[0384] 116. The method of claim 115, wherein the signal change is a decrease in fluorescence signal.

[0385] 117. The method of claim 103, wherein detecting a signal change of the marker comprises detecting a signal change of a reporter group as the temperature of the sample changes.

[0386] 118. The method of claim 117, wherein detecting a signal change of the reporter group comprises detecting a signal change of the reporter group when the temperature of the sample is raised above the melting point of the hairpin probe.

[0387] 119. The method of claim 103, wherein the capture probe is attached to a solid support.

[0388] 120. The method of claim 103, wherein the at least one non-natural nucleotide or the quencher-labeled non-natural nucleotide is isoG and the other is isoC.

[0389] 121. The method of claim 103, further comprising:

[0390] (a) contacting the sample with a second probe set, the probe set comprising a cleavable probe and a capture probe, the cleavable probe comprising, from 5' to 3', (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a second target nucleic acid; the capture probe comprising, from 5' to 3', (i) a sequence region identical to a portion of the sequence region of the cleavable probe; and (ii) a sequence complementary to the capture sequence of the cleavable probe;

[0391] (b) contacting the cleavable probe with an endoribonuclease, thereby cleaving the cleavable probe hybridized to the target nucleic acid to form a truncated cleavable probe;

[0392] (c) hybridizing the truncated cleavable probe to the capture probe;

[0393] (d) extending the truncated cleavable probe to form an extended probe;

[0394] (e) hybridizing the extended cleavable probe to itself to form a hairpin probe;

[0395] (f) further extending the hairpin probe in the presence of a non-natural nucleotide labeled with a second member of a reporter-quencher pair that is capable of base pairing with the at least one labeled non-natural nucleotide 5' to the cleavable probe; and

[0396] (g) detecting the second target nucleic acid by detecting the signal change of the labels on the cleavable probe and the hairpin probe.

[0397] 122. The method of claim 121, further comprising:

[0398] (a) contacting the sample with a third, fourth, fifth or sixth probe set, the probe set comprising a cleavable probe and a capture probe, the cleavable probe comprising, from 5' to 3', (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a third, fourth, fifth or sixth target nucleic acid; the capture probe comprising, from 5' to 3', (i) a sequence region identical to a portion of the sequence region of the cleavable probe; and (ii) a sequence complementary to the capture sequence of the cleavable probe;

[0399] (b) contacting the cleavable probe with an endoribonuclease, thereby cleaving the cleavable probe hybridized to the target nucleic acid to form a truncated cleavable probe;

[0400] (c) hybridizing the truncated cleavable probe to the capture probe;

[0401] (d) extending the truncated cleavable probe to form an extended probe;

[0402] (e) hybridizing the extended cleavable probe to itself to form a hairpin probe;

[0403] (f) further extending the hairpin probe in the presence of a non-natural nucleotide labeled with a second member of a reporter-quencher pair that is capable of base pairing with the at least one labeled non-natural nucleotide 5' to the cleavable probe; and

[0404] (g) detecting the third, fourth, fifth or sixth target nucleic acid by detecting the signal change of the labels on the cleavable probe and the hairpin probe.

[0405] 123. The method of claim 121, wherein the presence of the first target nucleic acid and the second target nucleic acid are detected substantially simultaneously.

[0406] 124. The method of claim 121, wherein the presence of the first target nucleic acid and the second target nucleic acid are detected sequentially.

[0407] 125. The method of claim 121, wherein the first probe set and the second probe set comprise distinguishable reporter groups.

[0408] 126. The method of claim 121, wherein the first probe set and the second probe set comprise the same reporter group.

[0409] 127. The method of claim 126, wherein the hairpin probe formed by the first probe set and the second probe set comprises distinguishable melting points.

[0410] 128. The method of claim 122, wherein the hairpin probes formed by the first, second, third, fourth, fifth, and sixth probe sets each comprise a distinguishable reporter group or a distinguishable melting point.

[0411] 129. The method of claim 103, further comprising amplifying the target nucleic acid using isothermal amplification.

[0412] 130. The method of claim 103, further comprising performing multiple polymerase chain reaction cycles.

[0413] 131. The method of claim 130, wherein detecting a change in the signal of the marker comprises detecting a signal before and after performing the plurality of polymerase chain reaction cycles.

[0414] 132. The method of claim 130, wherein detecting a change in the signal of the marker comprises detecting a signal only after performing the plurality of polymerase chain reaction cycles.

[0415] 133. The method of claim 132, further comprising comparing the signal of the detected marker to a predetermined ratio, wherein the predetermined ratio is the ratio of the signal of the marker to a reference signal of the marker on the non-hybridized probe.

[0416] 134. The method of claim 130, further comprising quantifying the amount of target nucleic acid in the sample.

[0417] 135. A method according to claim 134, wherein quantifying the amount of target nucleic acid in the sample includes: using a standard curve; determining the relative amount of the target nucleic acid; using endpoint quantification; or determining the amount of the target nucleic acid by correlating the number of PCR cycles at which the signal is detectable relative to background with the amount of target present.

[0418] 136. A composition comprising a first probe group, wherein the probe group comprises a cleavable probe and a capture probe, wherein the cleavable probe comprises from 5' to 3' (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a target nucleic acid; and the capture probe comprises from 5' to 3' (i) a sequence region identical to a portion of the sequence region of the cleavable probe; and (ii) a sequence complementary to the capture sequence of the cleavable probe.

[0419] 137. A composition according to claim 136, which further comprises a second probe group, wherein the probe group comprises a cleavable probe and a capture probe, wherein the cleavable probe comprises from 5' to 3' (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a second target nucleic acid; and the capture probe comprises from 5' to 3' (i) a sequence region identical to a portion of the sequence region of the cleavable probe; and (ii) a sequence complementary to the capture sequence of the cleavable probe.

[0420] 138. The composition of claim 137, wherein the first probe set and the second probe set comprise distinguishable reporter groups and / or form hairpin probes with distinguishable melting points.

[0421] 139. The composition of claim 137, comprising at least four sets of probes.

[0422] 140. The composition of claim 136, further comprising a non-natural nucleotide labeled with a reporter group or a quencher group.

[0423] 141. The composition of claim 136, further comprising a polymerase, a reference probe, or free nucleotides.

[0424] 142. A kit comprising:

[0425] (a) a first probe set, the probe set comprising a cleavable probe and a capture probe, the cleavable probe comprising, from 5' to 3', (i) a sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a capture sequence; and (iii) a sequence comprising one or more ribonucleotide bases complementary to a first region on a first strand of a target nucleic acid; the capture probe comprising, from 5' to 3', (i) a sequence region identical to a portion of the sequence region of the cleavable probe; and (ii) a sequence complementary to the capture sequence of the cleavable probe; and

[0426] (b) a non-natural nucleotide labeled with a reporter group; a non-natural nucleotide labeled with a quencher group; or an endoribonuclease.

[0427] 143. The kit of claim 142, comprising at least four sets of probes.

[0428] 144. The kit of claim 143, wherein the probe set comprises distinguishable reporter groups and / or forms hairpin probes with distinguishable melting points.

[0429] 145. The kit of claim 142, further comprising a polymerase, a reference probe, free nucleotides, a reference sample, or instructions for use of the kit.

[0430] 146. A method for detecting the presence of a target nucleic acid, comprising:

[0431] (a) contacting a sample with a cleavable probe, the probe comprising, from 5' to 3', (i) a first sequence region labeled with a reporter group-quencher group pair; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence comprising one or more ribonucleotide bases complementary to the first region on the first strand of the target nucleic acid;

[0432] (b) contacting the cleavable probe with an endoribonuclease, thereby cleaving the cleavable probe hybridized to the target nucleic acid to form a truncated probe;

[0433] (c) hybridizing the truncated probe to itself to form a truncated hairpin probe;

[0434] (d) extending the truncated hairpin probe to the first sequence region to physically separate the fluorophore and the quencher; and

[0435] (e) detecting the target nucleic acid by detecting the signal change of the reporter group.

[0436] 147. The method of claim 146, wherein one of the members of the reporter-quencher pair is at the 5' end of the cleavable probe.

[0437] 148. The method of claim 146, further comprising:

[0438] (a) contacting the sample with at least a second cleavable probe, which comprises, from 5' to 3', (i) a first sequence region comprising a reporter group-quencher group pair; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence comprising one or more ribonucleotide bases complementary to the first region on the first strand of a second (or additional) target nucleic acid; (b) contacting the cleavable probe with an endoribonuclease, thereby cleaving the probe hybridized to the target nucleic acid to form a truncated cleavable probe; (c) hybridizing the truncated cleavable probe with itself to form a hairpin probe; (d) extending the hairpin probe to the first sequence region; and (e) detecting a second target nucleic acid by detecting a signal change of the reporter group.

[0439] 149. A method according to claim 148, wherein the first cleavable probe and the second cleavable probe: (i) have the same reporter group; and (2) have different melting temperatures (Tm) after cleavage and extension of the first cleavable probe and the second cleavable probe.

[0440] 150. A method for detecting the presence of a target nucleic acid, comprising:

[0441] (a) contacting a sample with a first cleavable probe, the probe comprising, from 5' to 3', (i) a first sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence complementary to a first region on a first strand of the target nucleic acid;

[0442] (b) hybridizing the cleavable probe and the upstream primer to the target nucleic acid and extending the target nucleic acid using a polymerase having 5' nuclease activity;

[0443] (c) extending the nucleic acid sequence until the cleavable hairpin probe is contacted with a polymerase having nuclease activity, thereby cleaving the probe hybridized to the target nucleic acid to form a truncated cleavable probe;

[0444] (d) hybridizing the truncated cleavable probe to itself to form a hairpin probe;

[0445] (e) extending the hairpin probe in the presence of a non-natural nucleotide labeled with a second member of a reporter group-quencher group pair that is capable of base pairing with the at least one non-natural nucleotide of the first sequence region; and

[0446] (f) detecting the target nucleic acid by detecting the signal change of the label on the hairpin probe.

[0447] 151. The method of claim 150, further comprising performing a melting analysis on the hairpin probe.

[0448] 152. A method for detecting the presence of a target nucleic acid, comprising:

[0449] (a) contacting a sample with a first cleavable hairpin probe, the probe comprising, from 5' to 3', (i) a first sequence region labeled with a reporter group-quencher group pair; (ii) a second sequence region; (iii) a sequence that is the reverse complement of the second sequence region; and (iv) a sequence complementary to the first region on the first strand of the target nucleic acid;

[0450] (b) hybridizing the cleavable probe and the upstream primer to the target nucleic acid and extending the target nucleic acid using a polymerase having 5' nuclease activity;

[0451] (c) extending the nucleic acid sequence until the cleavable hairpin probe is contacted with a polymerase having nuclease activity, thereby cleaving the probe hybridized to the target nucleic acid to form a truncated cleavable probe;

[0452] (d) hybridizing the truncated probe to itself to form a cleaved hairpin probe;

[0453] (e) extending the cleaved hairpin probe upon itself to physically separate the fluorophore and the quencher; and

[0454] (f) detecting the target nucleic acid by detecting a signal change of the extended hairpin probe. Sequence Listing <110> LUMINEX CORPORATION <120> Probes for improved melting resolution and multiplexing in nucleic acid assays <130> LUMN.P0129WO <150> US 62 / 035,783 <151> 2014-08-11 <160> 31 <170> PatentIn version 3.5 <210> 1 <211> 29 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <400> 1 atatcagtca ttgcccaaac cgcaatgac 29 <210> 2 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <400> 2 atatcagtca ttgcccaaaa aaaaccgcaa tgac 34 <210> 3 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <400> 3 atatcagtct tgcccaaacc gcaagac 27 <210> 4 <211> 32 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <400> 4 atatcagtct tgcccaaaaa aaaccgcaag ac 32 <210> 5 <211> 31 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <400> 5 atatcagtca attgcccaaa ccgcaattga c 31 <210> 6 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <400> 6 atatcagtca attgcccaaa aaaaaccgca attgac 36 <210> 7 <211> 29 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <400> 7 atatcagtca agtgccaaac ccacttgac 29 <210> 8 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <400> 8 atatcagtca agtgccaaaa aaaacccact tgac 34 <210> 9 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <400> 9 atatcaggtc agccaaaccc tgacc 25 <210> 10 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <400> 10 atatcagtct gcccaaaccg cagac 25 <210> 11 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <400> 11 atatcagtcg cccaaaccgc gac 23 <210> 12 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <220> <221> modified_base <222> (42)..(42) <223> Ribocytosine <400> 12 atatcagtca ttgcccaaaa aaaaaaaaaa aaccgcaatg accatgagac agtatagtag 60 cgctga 66 <210> 13 <211> 58 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <220> <221> modified_base <222> (35)..(35) <223> Cytosine Riboside <400> 13 atatcagtca ttgcccaaaa aaaaccgcaa tgaccatgag acagtatagt agcgctga 58 <210> 14 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <220> <221> modified_base <222> (37)..(37) <223> Cytosine Riboside <400> 14 atatcagtca tgtgcccaaa aaaaaccgca catgaccatg agacagtata gtagcgctga 60 <210> 15 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <220> <221> modified_base <222> (37)..(37) <223> Cytosine Riboside <400> 15 atatcagtca tttgcccaaa aaaaaccgca aatgaccatg agacagtata gtagcgctga 60 <210> 16 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <220> <221> modified_base <222> (37)..(37) <223> Cytosine Riboside <400> 16 atatcagtca attgcccaaa aaaaaccgca attgaccatg agacagtata gtagcgctga 60 <210> 17 <211> 58 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <220> <221> modified_base <222> (35)..(35) <223> Cytosine Riboside <400> 17 atatcagtca ttgaccaaaa aaaacctcaa tgaccatgag acagtatagt agcgctga 58 <210> 18 <211> 58 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <220> <221> modified_base <222> (35)..(35) <223> Cytosine Riboside <400> 18 atatcagtca ttacccaaaa aaaaccgtaa tgaccatgag acagtatagt agcgctga 58 <210> 19 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <220> <221> modified_base <222> (37)..(37) <223> Cytosine Riboside <400> 19 atatcagtca tgtacccaaa aaaaaccgta catgaccatg agacagtata gtagcgctga 60 <210> 20 <211> 62 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <220> <221> modified_base <222> (39)..(39) <223> Cytosine Riboside <400> 20 atatcagtca ttgtacccaa aaaaaaccgt acaatgacca tgagacagta tagtagcgct 60 62 <210> twenty one <211> 70 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <220> <221> modified_base <222> (47)..(47) <223> Cytosine Riboside <400> twenty one atatcagtca atgtgcccaa aaaaaaaaaa aaaaccgcac attgaccatg agacagtata 60 gtagcgctga 70 <210> twenty two <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> twenty two gaagcatttg aaatagcaga agg 23 <210> twenty three <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Synthetic primers <400> twenty three cacagagcgt tcctagtttt act 23 <210> twenty four <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <400> twenty four atatcagtca tttgcccaaa a 21 <210> 25 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <220> <221> modified_base <222> (15) <223> Cytosine Riboside <400> 25 aaaccgcaaa tgaccatgag acagtatagt agcgctga 38 <210> 26 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <400> 26 caaaaaaaag tcatgttacc aaaa 24 <210> 27 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <220> <221> modified_base <222> (15) <223> Cytosine Riboside <400> 27 aaacctaaca tgaccatgag acagtatagt agcg 34 <210> 28 <211> 32 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <400> 28 catatcatca tcatctcattttaggcccaaaa 32 <210> 29 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <220> <221> modified_base <222> (15) <223> Cytosine Riboside <400> 29 aaaccgccta aaatcccctt agtcagaggt gac 33 <210> 30 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <400> 30 ctccatcctc ctcctcctct ctcttcgaga ccaaaa 36 <210> 31 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Synthetic probe <220> <221> modified_base <222> (14)..(14) <223> Cytosine Riboside <400> 31 aaacctctcg aagcgtcctg tccggc 26

Claims

1. A method for detecting a target nucleic acid in a sample, comprising: (a) partitioning the sample into a plurality of partitions such that a majority of the partitions contain: (i) no more than one target nucleic acid molecule; (ii) a reagent for amplifying the target nucleic acid molecule, wherein the reagent comprises an endoribonuclease; and (iii) a cleavable probe, the probe comprising, in order from 5' to 3': (1) a first sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter-quencher pair; (2) a second sequence region; (3) a sequence that is the reverse complement of the second sequence region; and (4) a sequence complementary to a region on the first strand of the target nucleic acid, wherein the sequence comprises one or more ribonucleotide bases, wherein the sequence is 6 to 50 nucleotides in length; (b) if a target nucleic acid molecule is present in the partition, amplifying the target nucleic acid molecule, hybridizing the cleavable probe to the amplified target nucleic acid, cleaving the hybridized cleavable probe by the endoribonuclease to form a hairpin probe, and extending the hairpin probe in the presence of a non-natural nucleotide labeled with a second member of a reporter group-quencher group pair that is capable of base pairing with at least one non-natural nucleotide of the first sequence region; (c) monitoring the signal from the reporter group in the partition while increasing or decreasing the temperature of the partition to obtain a melting profile of the cleavable probe; and (d) detecting the presence of the target nucleic acid if the melting profile corresponds to the melting profile of the cleavable probe that has been cleaved, or detecting the absence of the target nucleic acid if the melting profile corresponds to the melting profile of the cleavable probe that has not been cleaved, wherein at least one of the non-natural nucleotides labeled with the first member of the reporter-quencher pair or the non-natural nucleotide labeled with the second member of the reporter-quencher pair is isoG and the other is isoC.

2. A method for detecting a target nucleic acid in a sample, comprising: (a) partitioning the sample into a plurality of partitions such that some of the partitions contain zero target nucleic acid molecules and some of the partitions contain one or more target nucleic acid molecules, wherein the plurality of partitions further comprises: (i) a reagent for amplifying the target nucleic acid molecule, wherein the reagent comprises an endoribonuclease; and (ii) a cleavable probe, the probe comprising, in order from 5' to 3': (1) a first sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter-quencher pair; (2) a second sequence region; (3) a sequence that is the reverse complement of the second sequence region; and (4) a sequence complementary to a region on the first strand of the target nucleic acid, wherein the sequence comprises one or more ribonucleotide bases, wherein the sequence is 6 to 50 nucleotides in length; (b) if the target nucleic acid molecule is present in the partition, amplifying the target nucleic acid molecule, hybridizing the cleavable probe to the amplified target nucleic acid, cleaving the hybridized cleavable probe by RNase H to form a hairpin probe, and extending the hairpin probe in the presence of a non-natural nucleotide labeled with a second member of a reporter group-quencher group pair that is capable of base pairing with at least one non-natural nucleotide of the first sequence region; (c) monitoring the signal from the reporter group in the partition while increasing or decreasing the temperature of the partition to obtain a melting profile of the cleavable probe; and (d) detecting the presence of the target nucleic acid if the melting profile corresponds to the melting profile of the cleavable probe that has been cleaved, or detecting the absence of the target nucleic acid if the melting profile corresponds to the melting profile of the cleavable probe that has not been cleaved, wherein at least one of the non-natural nucleotides labeled with the first member of the reporter-quencher pair or the non-natural nucleotide labeled with the second member of the reporter-quencher pair is isoG and the other is isoC.

3. The method of claim 1 or 2, wherein partitioning the sample comprises partitioning the sample into droplets in a non-aqueous continuous phase.

4. The method of claim 3, wherein the droplets are dispersed in a monolayer on a surface while monitoring the signal from the reporter group in the partition.

5. The method of claim 1 or 2, wherein partitioning the sample comprises partitioning the sample into wells in a microplate.

6. The method of claim 1 or 2, wherein the endoribonuclease is RNase H2.

7. A method for quantifying a target nucleic acid in a sample, comprising: (a) performing dPCR to amplify a target nucleic acid region suitable for dPCR in a reaction mixture, each of which contains RNase H2 and a cleavable probe, wherein the cleavable probe contains, in order from 5' to 3': i. a first sequence region comprising at least one non-natural nucleotide labeled with a first member of a reporter group-quencher group pair; ii. the second sequence region; iii. a sequence that is the reverse complement of the second sequence region; and iv. a sequence complementary to a region on the first strand of the target nucleic acid, wherein the sequence comprises one or more ribonucleotide bases, wherein the sequence is 6 to 50 nucleotides in length; (b) if the target nucleic acid is present, hybridizing the cleavable probe to the target nucleic acid, cleaving the hybridized cleavable probe by RNase H to form a hairpin probe, and extending the hairpin probe in the presence of a non-natural nucleotide labeled with a second member of a reporter group-quencher group pair that is capable of base pairing with at least one non-natural nucleotide of the first sequence region; (c) determining a signal from the reporter group in each reaction mixture to identify the reaction mixture containing the target nucleic acid; and (d) quantifying the target nucleic acid present in the sample using the signal determined in the reaction mixture, wherein at least one of the non-natural nucleotides labeled with the first member of the reporter-quencher pair or the non-natural nucleotide labeled with the second member of the reporter-quencher pair is isoG and the other is isoC.

8. The method of claim 7, wherein the reaction mixture comprises compartments formed by droplets surrounded by a non-aqueous continuous phase.

9. The method of claim 8, wherein the droplets are dispersed in a monolayer on a surface when determining the signal from the reporter group.

10. The method of claim 7, wherein the reaction mixture is formed in separate wells in a microplate.

11. The method of claim 7, wherein determining the signal in each reaction mixture further comprises imaging the reaction mixture to determine a melting profile of the cleavable probe, and using the melting profile to identify the target nucleic acid in the reaction mixture.

12. The method of claim 1, 2 or 7, wherein the sequence in the cleavable probe is complementary to a region on the first strand of the target nucleic acid, wherein the sequence comprises 1 to 5 ribonucleotides.

13. The method of claim 1, 2 or 7, wherein the reporter group is a fluorophore.

Images