A SNP molecular marker associated with pig backfat thickness and its use

Abstract

The present invention provides a SNP molecular marker associated with pig backfat thickness and its use, wherein the site of the SNP molecular marker is the 38161769th nucleotide site on chromosome 1 of the international pig reference genome version 11.1, and the base of the site is A or G. By optimizing the dominant allele of the SNP, the present invention can increase the dominant allele frequency from generation to generation, reduce the backfat thickness of breeding pigs, select excellent breeding pigs with the above traits, accelerate the progress of pig genetic improvement, and thus effectively improve the economic benefits of breeding pigs.

Description

Technical Field

[0001] The invention relates to a SNP molecular marker related to pig backfat thickness and application thereof. Background Art

[0002] Pork is an important source of meat for humans, accounting for about 40% of the world's population's meat consumption. Influenced by the Chinese people's meat consumption habits, my country's demand for pork is even greater. Since the 1980s, pork has been the main meat on the tables of urban and rural residents, and pork consumption by urban and rural residents has always accounted for more than 60% of meat consumption, occupying a dominant position. In 2020, the total number of live pigs slaughtered in my country was 527 million, accounting for half of the world's live pigs slaughtered; pork production was 41.13 million tons, accounting for 42.02% of global pork production, also firmly in the top spot. The huge demand for pork is mainly because it can provide a large amount of protein that humans need, and protein mainly comes from lean meat in pork. Therefore, the selection and breeding of high-quality lean pigs has become the focus of pig breeding work, and related traits that affect pig growth are important breeding goals. The lean meat rate of pigs refers to the percentage of lean meat weight contained in pigs to the total carcass weight, which is an important indicator for measuring pig growth performance. Since the lean meat rate can only be measured after slaughter, this greatly increases the cost of measuring this trait. Genetic improvement of lean meat rate traits is mainly improved indirectly through genetic improvement of traits such as back fat thickness, eye muscle area and eye muscle thickness, which are positively correlated with lean meat rate.

[0003] The backfat thickness of pigs refers to the thickness of the subcutaneous fat of pigs. Subcutaneous fat is the subcutaneous fat tissue located below the dermis and above the fascia. Breeding companies usually measure the backfat thickness when the breeding pigs reach 100kg in weight. The measurement position is located between the 3rd and 4th intercostal space from the bottom and 5cm from the midline of the back on the left side. The ultrasound image is formed by A-type and B-type ultrasound instruments, and the backfat thickness is calculated by computer. The measurement cost is low and convenient. Backfat thickness is an indirect indicator of lean meat rate. The thicker the backfat, the lower the lean meat rate, and vice versa. In recent years, due to the improvement of consumption level and the continuous pursuit of high lean meat rate by consumers, the selection of thin backfat in pigs has been widely used in genetic improvement. Looking back on the history of genetic improvement of breeding pigs in modern times around the world, lean breeding pigs represented by Duroc mostly take increasing lean meat rate and reducing backfat thickness as important breeding goals. However, backfat thickness is a typical quantitative trait controlled by multiple genes, and it is difficult to identify the main effect gene. Molecular marker-assisted breeding has become a good choice for improving this trait.

[0004] At present, many candidate genes and QTLs related to backfat thickness have been identified using the candidate gene method and QTL positioning. Candidate genes include DGAT1, FTO, MC4R and ADD1. However, the selection of candidate genes in the candidate gene method has a certain degree of randomness. They may be major effect genes or genes that indirectly affect the trait in a state of close linkage disequilibrium with the actual QTL, which brings some risks to livestock breeding. In addition, the selection of candidate genes also has population heterogeneity; and the genetic distance of QTLs obtained by QTL positioning spans a large range, often including hundreds of genes, which greatly limits the application of QTL positioning methods in the genetic improvement of important economic traits of livestock. Nowadays, genome-wide association study (GWAS) has gradually shown unique advantages in the genetic improvement of complex traits. For example, improving milk production in dairy cows. Compared with the candidate gene method and QTL positioning, GWAS can locate and identify new genes more accurately, and can be directly applied to the genetic improvement of livestock animals, breaking the bottleneck of molecular marker identification of important economic traits of pigs. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings and disadvantages of the prior art and provide a SNP molecular marker related to pig back fat thickness and its use. The present invention also provides a primer pair and a kit for detecting the SNP molecular marker. The present invention also provides a method for screening pig breeds with low back fat thickness traits. The present invention also provides a method for genetic improvement of pigs.

[0006] To achieve the above purpose, the technical solution adopted is: a SNP molecular marker related to pig backfat thickness, the site of the SNP molecular marker is the 38161769th nucleotide site on chromosome 1 of the international pig reference genome version 11.1, and the base of this site is A or G. The polymorphism of the base at this site leads to differences in pig backfat thickness.

[0007] Preferably, the sequence of the SNP molecular marker is as shown in SEQ ID NO: 1, and the 135th base from the 5' end of the sequence shown in SEQ ID NO: 1 is G or A. The site of the SNP molecular marker is the nucleotide mutation A135-G135 at position 135 of the sequence annotation of SEQ ID NO: 1.

[0008] Preferably, the pigs include Duroc and its synthetic lines. More preferably, the pigs are Canadian Duroc and its synthetic lines.

[0009] The present invention provides a primer pair for detecting the above-mentioned SNP molecular marker, and the nucleic acid sequences of the primer pair are shown in SEQ ID NO: 2 and SEQ ID NO: 3.

[0010] The present invention provides a kit for detecting the above-mentioned SNP molecular marker, comprising the above-mentioned primer pair.

[0011] The present invention provides a method for screening a pig breed with a low backfat thickness trait, the method comprising the following steps:

[0012] The genotype of the 38161769th nucleotide site on chromosome 1 of the International Porcine Reference Genome 11.1 version was detected, and the AA type individuals at the 38161769th nucleotide site were selected as breeding pigs.

[0013] Preferably, the method for detecting the genotype of the 38161769th nucleotide position on chromosome 1 of the International Pig Reference Genome 11.1 version of the pig comprises the following steps:

[0014] (1) Extracting genomic DNA from the pig to be tested;

[0015] (2) using the primer pair or the kit described above to perform PCR amplification on the genomic DNA of the pig to be tested, so as to obtain a PCR amplification product;

[0016] (3) sequencing the PCR amplification product to obtain a sequencing result;

[0017] (4) Based on the sequencing results, determine the genotype of the SNP markers of the pig to be tested.

[0018] The present invention provides a method for genetic improvement of pigs, comprising the following steps:

[0019] Determine the loci of the above-mentioned SNP molecular markers of the breeding pigs in the breeding pig core group, and make corresponding selections based on the SNP molecular markers: select breeding pig individuals with AG and AA genotypes at loci 38161769 on chromosome 1 of the international pig reference genome version 11.1 from the breeding pig core group, and eliminate breeding pig individuals with GG genotypes at loci 38161769, so as to increase the frequency of allele A at this locus from generation to generation, thereby reducing the back fat thickness of offspring pigs.

[0020] Preferably, the breeding pigs include Duroc and its synthetic lines. More preferably, the breeding pigs are Canadian Duroc and its synthetic lines.

[0021] The present invention also provides the use of the above-mentioned SNP molecular marker, the above-mentioned primer pair or the above-mentioned kit in identifying pig backfat thickness-related traits, screening pig breeds with low backfat thickness traits, pig genetic breeding or reducing pig backfat thickness and improving pig lean meat rate.

[0022] Beneficial effects:

[0023] (1) The present invention studies and determines that the molecular markers related to pig backfat thickness are located on the nucleotide sequence on chromosome 1 of the pig, verifies its effect on the backfat thickness trait, and finally establishes an efficient and accurate molecular marker-assisted breeding technology, which is applied to the genetic improvement of reducing backfat thickness in breeding pigs, thereby reducing the feed intake of offspring pigs, improving corporate economic profits, and increasing core competitiveness. By optimizing the dominant allele of the SNP, the dominant allele frequency can be increased from generation to generation, reducing the backfat thickness of breeding pigs, selecting excellent breeding pigs with the above traits, accelerating the progress of pig genetic improvement, and effectively improving the economic benefits of breeding pigs.

[0024] (2) The present invention provides a primer pair for identifying the SNP molecular marker on chromosome 1 of the above-mentioned pig that is associated with back fat thickness. Through this primer pair, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select for the back fat thickness trait and accelerate the breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the Manhattan plot of the genome-wide association analysis (GWAS) of the backfat thickness trait of Canadian Duroc pigs on chromosome 1; wherein: the horizontal axis represents the chromosome number of the pig; the vertical axis represents the -logP value.

[0026] Figure 2 This is an analysis of the phenotypic differences in back fat thickness among pigs with different genotypes. DETAILED DESCRIPTION

[0027] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0028] Example 1

[0029] (1) Experimental animals

[0030] The experimental pig herd used in the present invention is a purebred Duroc pig herd of the breeding pig branch of Wen's Food Group Co., Ltd., which is the core herd of the breeding pig branch.

[0031] A total of 2781 Duroc pigs were selected from this resource group in this experiment. The pigs in this experiment had free access to food and water, and the entire feeding method and rearing conditions remained consistent, which was a conventional method.

[0032] Duroc pigs have a small litter size, with an average of only 9 to 10 pigs in a large group, but they grow fast, have a high feed conversion rate, a high carcass lean meat rate, a high intramuscular fat content, and strong resistance to stress. A relatively mature hybrid matching system has been established for domestic commercial pig production. Among them, the hybrid combination of Duroc and Changda continues to maintain an absolute dominant position in my country's domestic and export markets. As the terminal sire, Duroc breeding pigs account for 50% of the genetic contribution to commercial pigs. Therefore, research on improving the production performance of Duroc breeding boars is particularly important.

[0033] (2) Phenotypic determination

[0034] The weight of all Duroc pigs was measured at about 100kg (100±5kg), and the back fat thickness was measured between the 10th and 11th ribs of the pigs using a live B-ultrasound instrument (Aloka 500V SSD B ultrasound). The back fat thickness was then uniformly corrected to 100kg back fat thickness (BFT) according to Wen's own back fat thickness correction formula. The correction formula is as follows:

[0035]

[0036] Here, when it is a boar, A=13.468, B=0.111528; when it is a sow, A=15.654 and B=0.156646.

[0037] (3) Collection of pig tissue samples and whole-genome 50K SNP typing

[0038] The tail and ear tissues of the above piglets were collected and immersed in a 75% ethanol solution, and stored in a -20°C refrigerator for later use.

[0039] The ear tissue or tail tissue collected from each individual of the 2781 Duroc breeder pigs selected from the above resource population was used to extract the whole genome DNA using the standard phenol-chloroform method, and the DNA concentration and OD ratio (OD260 / 280, OD260 / 230) of each sample were accurately measured by the Nanodrop2000 / 2000C nucleic acid protein detector. ). The test results are qualified if the OD260 / 280 ratio is between 1.8-2.0 and the OD260 / 230 ratio is between 1.5-2.3. For the qualified DNA samples, the DNA is diluted to about 50ng / μL according to the test concentration. Then 6μL of the extracted DNA sample to be tested is mixed with 2μL Loading Buffer, loaded into an agarose gel with a mass volume ratio of 1%, electrophoresed at 150V for 25min, and observed and photographed under a UV spectrophotometer and gel imaging equipment to observe the integrity of the DNA. The electrophoresis results of each sample must have a single bright band larger than 50Kb, with no RNA or protein contamination.

[0040] DNA samples were sent to Neogen Biotech (Shanghai) Co., Ltd., and genotype determination of the whole-genome 50K SNP chip (Illumina, USA) was performed on the Illumina Beadstration platform according to the company's standard process. The quality control of the 50K chip scanning typing data of all samples was performed using the software PLINKv1.9, and the detection rate of individuals was less than 90%, the family Mendelian error rate was higher than 0.1, the minimum allele frequency was less than 0.05, and the Hardy-Weinberg equilibrium significance level was higher than 10 -6 SNPs.

[0041] (7) Genome-wide association study (GWAS)

[0042] The GEMMA software developed by Xiang Zhou from the University of Michigan and Matthew Stephens from the University of Chicago was selected for genome-wide association analysis. Considering the possibility of false positive results caused by kinship and population stratification effects on association analysis, it is necessary to use GEMMA software to construct an n×n kinship matrix in advance, where n represents the number of individuals. The kinship matrix is ​​constructed by all SNPs after the SNPs chip genotypes are filled.

[0043] This study used a univariate mixed linear model to conduct GWAS between variant sites and traits, and the significance test was performed using the Wald test. The univariate mixed linear model is as follows:

[0044] y=Wα+Xβ+u+ε

[0045] y is an n×1 vector constructed from the phenotypes of all individuals; W is the indicator matrix of covariates (fixed effects), including field year and season, measurement batch and gender, α is the correlation coefficient corresponding to the covariates including the intercept; X is an n×1 vector constructed from the genotypes of SNPs, β is the effect value corresponding to each marker; u is a random effect, and ε is the residual.

[0046] For the results of whole-genome association analysis based on SNPs chips, a strict Bonferroni multiple correction method is often used to set the significance threshold, thereby reducing the false positive rate of the association analysis results.

[0047] (8) Analysis of the association between different genotypes and backfat thickness phenotypes

[0048] Through GWAS analysis, such as Figure 1As shown in the figure, we found that there is a major effect QTL on chromosome 1 that significantly affects the backfat thickness trait. Its most significant associated site g.135A>G is located in the intron region of the gene NKAIN2, so it is the focus of attention. Further analysis according to Table 1 shows that the SNP site g.135A>G of the molecular marker is extremely significantly correlated with the backfat thickness trait (P<0.001), indicating that this molecular marker significantly affects the pig backfat thickness trait. Through auxiliary selection of this SNP site in pigs, the backfat thickness of the population can be reduced, thereby accelerating the breeding process.

[0049] In addition, according to Table 1, the average back fat thickness of GG type is higher than that of AG and AA types, indicating that homozygous GG is the most disadvantageous to the average back fat thickness. Figure 2 It was further learned that the homozygous GG was significantly different from the AG and AA genotypes, and the difference between the GG and AA genotypes was extremely significant, which further showed that the homozygous CC was the most disadvantageous for back fat thickness. Back fat thickness is an important indicator for measuring the lean meat rate of pigs. Low back fat thickness means that the pigs have low fat deposition ability, indicating that the lean meat rate of the pigs is low. Therefore, the back fat thickness performance of pigs with the GG genotype is the worst. In the process of breeding, we need to eliminate GG-type breeding pigs and retain AG and AA-type breeding pigs to increase the frequency of allele A at this site from generation to generation. At present, the frequency of the dominant allele in this group is only 33.6%, indicating that there is a significant room for genetic improvement.

[0050] Table 1 Correlation analysis between molecular marker SNP site g.135A>G and backfat thickness

[0051]

[0052] Example 2 Amplification and sequencing of target DNA sequences

[0053] (1) Primer design

[0054] The DNA sequence of SEQ ID NO: 1 on chromosome 1 of pig was downloaded from the Ensembl website (http: / / asia.ensembl.org / index.html). Primers were designed using primer design software Primer Premier 6.0, and the primers were synthesized by entrusting Sangon Biotech (Shanghai) Co., Ltd. The DNA sequence of the designed primers is shown below:

[0055] P001-F: 5'-ATTGGTGCTTTTCCTTAGAAGTCTTTC-3',

[0056] P002-R: 5'-GTCTACACATCCAGGCTTCTCC-3';

[0057] (2) PCR amplification

[0058] 1 μL DNA template, 3.4 μL double distilled water, 5 μL 2×Tag PCR StanMix with Loading Dye, and 0.3 μL primers P001-F and P002-R were added to the 10 μL reaction system. The PCR reaction conditions were: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 64.5°C annealing for 30 s, 72°C extension for 45 s, 35 cycles, and finally 72°C extension for 5 min.

[0059] (3) DNA sequence determination

[0060] DNA sequencing and identification: It was carried out at Shenzhen BGI Genomics Co., Ltd., and the gene fragments were tested for both positive and negative reactions. The measured sequence was compared with the NCBI genome sequence to obtain the mutation of the corresponding SNP site. The sequencing results are shown below:

[0061]

[0062] Note: The M marked in the sequence table is the mutation site, which is displayed with an underline (the mutated base in brackets is the allele mutation), and the bold at the beginning and end of the sequence is the position of the designed primer sequence.

[0063] Example 3 Analysis of the effect of molecular marker SNP site g.135 A>G

[0064] According to Table 1 and Figure 2 It can be seen that for backfat thickness, the effect of the dominant allele type (AA) of SNP locus g.135 A>G significantly reduced the backfat thickness by 1.16mm on average compared with the GG type phenotype. The results of the correlation analysis of growth rate and backfat thickness trait phenotype showed that the age at which the pig reaches a body weight of 100kg is positively correlated with the backfat thickness, reaching an extremely significant level. In other words, the younger the pig grows to a body weight of 100kg, the thinner the backfat and the higher the lean meat rate, which will greatly increase the economic value of pork and create wealth for the company. Among the individuals of this SNP molecular marker, by optimizing the dominant allele (A) of this SNP in the Additive Duroc line, the economic benefits of commercial pigs can be improved, thereby increasing the profits of the company.

[0065] The present invention detects the 135th base mutation site in the SEQ ID NO: 1 sequence, and preliminarily performs an application of association analysis between its genotype and the pig's backfat thickness trait, thereby providing a new molecular marker for molecular marker-assisted selection of pigs.

[0066] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention. Sequence Listing <110> South China Agricultural University <120> A SNP molecular marker associated with pig backfat thickness and its use <160> 3 <170> PatentIn version 3.3 <210> 1 <211> 368 <212> DNA <213> Artificial <400> 1 attggtgcttttccttagaa gtctttcata aaagttatac ttccatacca aagagaaatt 60 aaaacttgat tggcagtttg taatgcatta gtgggctggt cagctagtat acttgccttt 120 taaatgctag atctmtagag actgatagga ctttgttctg ggtcttccag tttacctatg 180 gggtagacac tagaccacaa cctccttggg ctgaactaga aaggtgctga tggtcttgct 240 acaaaatatt caggctgttt ttcaggatgc aatcttgaat ttaatgctca ggtgttcaga 300 aacttagctc atgcctactt gtacttcaag aatctttatgc atcagcggag aagcctggat 360 gtgtagac 368 <210> 2 <211> 27 <212> DNA <213> Artificial <400> 2 attggtgcttttccttagaa gtctttc 27 <210> 3 <211> twenty two <212> DNA <213> Artificial <400> 3 gtctacacat ccaggcttct cc 22

Claims

1. A reagent for detecting SNP molecular markers associated with pig backfat thickness for use in identifying pig backfat thickness-related traits, screening pig breeds with low backfat thickness traits, or reducing pig backfat thickness to increase pig lean meat rate, characterized in that: The site of the SNP molecular marker is the 38161769th nucleotide site on chromosome 1 of the international pig reference genome version 11.1, and the base of the site is A or G; wherein the average backfat thickness of the GG genotype is higher than the average backfat thickness of the AG and AA genotypes; The pigs are Canadian Duroc and its synthetic strain.

2. The use according to claim 1, characterized in that The sequence of the SNP molecular marker is shown in SEQ ID NO: 1, and the 135th base from the 5' end of the sequence shown in SEQ ID NO: 1 is G or A.

3. A primer pair for detecting SNP molecular markers associated with pig backfat thickness for use in identifying pig backfat thickness-related traits, screening pig breeds with low backfat thickness traits, or reducing pig backfat thickness to increase pig lean meat rate, characterized in that: The nucleic acid sequences of the primer pair are shown in SEQ ID NO: 2 and SEQ ID NO: 3; The site of the SNP molecular marker is the 38161769th nucleotide site on chromosome 1 of the international pig reference genome version 11.1, and the base of the site is A or G; wherein the average backfat thickness of the GG genotype is higher than the average backfat thickness of the AG and AA genotypes; The pigs are Canadian Duroc and its synthetic strain.

4. A kit for detecting SNP molecular markers associated with pig backfat thickness for use in identifying pig backfat thickness-related traits, screening pig breeds with low backfat thickness traits, or reducing pig backfat thickness to increase pig lean meat rate, characterized in that: The kit comprises the primer pair as claimed in claim 3; The site of the SNP molecular marker is the 38161769th nucleotide site on chromosome 1 of the international pig reference genome version 11.1, and the base of the site is A or G; wherein the average backfat thickness of the GG genotype is higher than the average backfat thickness of the AG and AA genotypes; The pigs are Canadian Duroc and its synthetic strain.

5. A method for selecting a pig breed with a low backfat thickness trait, characterized in that: The method comprises the following steps: The genotype of the 38161769th nucleotide position on chromosome 1 of the International Pig Reference Genome 11.1 version of the pig was detected, and the AA type individuals at the 38161769th nucleotide position were selected as breeding pigs; The pigs are Canadian Duroc and its synthetic strain.

6. The method according to claim 5, characterized in that The method for detecting the genotype of the 38161769th nucleotide position on chromosome 1 of the International Pig Reference Genome 11.1 version of the pig comprises the following steps: (1) Extracting genomic DNA from the pig to be tested; (2) using the primer pair as described in claim 3 or the kit as described in claim 4 to perform PCR amplification on the genomic DNA of the pig to be tested, so as to obtain a PCR amplification product; (3) sequencing the PCR amplification product to obtain a sequencing result; (4) Based on the sequencing results, determining the genotype of the SNP molecular marker as described in claim 1 or 2 of the pig to be tested.

7. A method for genetic improvement of pigs, characterized in that: The following steps are included: Determine the genotype of the SNP molecular marker as described in any one of claims 1-2 of the sows in the sow core group, select sow individuals with AG and AA genotypes at position 38161769 on chromosome 1 of the international pig reference genome version 11.1 from the sow core group, and eliminate sow individuals with GG genotypes at position 38161769, so as to increase the frequency of allele A at the position from generation to generation, thereby reducing the back fat thickness of offspring pigs; The pigs are Canadian Duroc and its synthetic strain.

Images