Specific primers for detecting pathogenic variants of Xanthomonas oryzae and their application

Abstract

The invention discloses specific primers for detecting pathogenic variants of Xanthomonas oryzae and applications thereof. The pathogenic variants include primer pairs respectively targeting at pathogenic variant Xoc of oryzae, pathogenic variant Xol of Lishigae and pathogenic variant Xoo of oryzae, wherein a forward primer U_Xoc_1F of the primer pair targeting at Xoc is such as sequence 1 in a sequence table, and a reverse primer U_Xoc_1R thereof is such as sequence 2 in the sequence table; a forward primer U_Xol_2F of the primer pair targeting at Xol is such as sequence 3 in the sequence table, and a reverse primer U_Xol_2R thereof is such as sequence 4 in the sequence table; and a forward primer U_Xoo_2F of the primer pair targeting at Xoo is such as sequence 5 in the sequence table, and a reverse primer U_Xoo_2R thereof is such as sequence 6 in the sequence table.

Description

Technical Field

[0001] The invention relates to the detection and identification of pathogenic Xanthomonas sp. in the technical field of molecular biology, and in particular to specific primers and applications for detecting and identifying pathogenic Xanthomonas sp. Background Art

[0002] As one of the most important food crops, the safe production of rice is closely related to people's lives, national security and social stability. Rice will be infected by a variety of diseases during its growth, resulting in a decrease in yield and quality. Early diagnosis of rice diseases and effective identification of potential pathogens of each disease are the basis for targeted pesticide application and effective prevention and control. Xanthomonas oryzae includes three pathogenic variants: Xanthomonas oryzae pv.oryzae (Xoo), Xanthomonas oryzae pv.oryzicola (Xoc) and Xanthomonas oryzae pv.leersiae (Xol), which can cause rice bacterial leaf blight, rice leaf streak and short rice leaf streak, respectively. Among them, rice bacterial leaf blight and rice leaf streak are the main rice diseases, which occur in major rice-growing areas in my country and have posed a threat to the safe production of rice. Before 2019, the leaf streak disease caused by Xanthomonas oryzae on Lishihe was only considered to be a close relative of Xanthomonas oryzae, until it was confirmed through analysis in 2019 that this type of pathogen was classified as a type of Xanthomonas oryzae pathogenic variant. However, the Xol-related primers currently published online cannot identify the Xol strain stored in this laboratory, and some Xoo primers cannot distinguish between Xoo and Xol strains.

[0003] Molecular detection technology based on PCR (Polymerase Chain Reaction) is a commonly used rapid and accurate DNA detection method, which is widely used in inspection and quarantine, species identification, species traceability, population distribution and density, etc. PCR primer refers to a macromolecule with a specific nucleotide sequence that is stimulated to synthesize at the beginning of nucleotide polymerization. In the annealing stage of the PCR process, the primer binds to the single-stranded template, and the DNA polymerase synthesizes DNA backward along the 3' end of the primer. Specific primers are single-stranded oligonucleotides that can and can only complete the replication of a specific sequence in the entire genome.

[0004] In summary, the existing technology for detecting and identifying pathogenic variants of Xanthomonas oryzae urgently needs to find a specific primer that can quickly and effectively detect and identify different pathogenic variants of Xanthomonas oryzae. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a specific primer for a pathogenic variant of Xanthomonas oryzae, which can quickly and effectively detect and identify different pathogenic variants of Xanthomonas oryzae.

[0006] In order to solve the above technical problems, the present invention provides a specific primer for detecting different pathogenic variants of Xanthomonas oryzae, including one or more primer pairs for Xoc, Xol, and Xoo, wherein:

[0007] The primer pair for Xoc

[0008] Forward primer U_Xoc_1F: AGTTCGAGACGACGGATGC,

[0009] Reverse primer U_Xoc_1R: CCTAGCAATCCCGAACCTG;

[0010] The primer pair for Xol

[0011] Forward primer U_Xol_2F: AGGGTTACTTGGAGGAGGC,

[0012] Reverse primer U_Xol_2R: CAGCGTCTTGATGTCCAGG;

[0013] and a primer pair for Xoo, which

[0014] Forward primer U_Xoo_2F: GCCGCAAACCCTGTGTTCAT,

[0015] Reverse primer U_Xoo_2R: CTGCACACGTAGAAGGCGAT;

[0016] Here, the primer pair U_Xoo_2F / U_Xoo_2R is a primer pair for Xoo in the Asian region.

[0017] In order to solve the above technical problems, the present invention provides an application of specific primers in detecting different pathogenic variants of Xanthomonas oryzae, including detecting one or more of the pathogenic variants Xoc, Xol and Xoo.

[0018] The present invention finds out specific primers for identifying different pathogenic variants of Xanthomonas oryzae through research, design and screening. The primers have high specificity for each pathogenic variant and can not only identify low-concentration samples, but also can quickly identify and identify three types of pathogenic variants when used in combination, thereby showing the unique advantages of the specific primers of the present invention in high efficiency and rapid detection and identification. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 is the electrophoresis result of the specific primer of the present invention;

[0020] Figure 2 It is the detection result of the specific primer U_Xoc_1F / R of the present invention;

[0021] Figure 3 It is the detection result of the specific primer U_Xoo_2F / R of the present invention;

[0022] Figure 4 It is the detection result of the specific primer U_Xol_2F / R of the present invention;

[0023] Figure 5 The test result of the specific primers of the present invention mixed together;

[0024] Figure 6 To perform sensitivity detection of U_Xoc_1F / R of the present invention using genomic DNA of Xoc strain as template;

[0025] Figure 7 To perform sensitivity detection on U_Xoo_2F / R of the present invention using genomic DNA of Xoo strain as template;

[0026] Figure 8 The genomic DNA of the Xol strain is used as a template to perform sensitivity detection on the U_Xol_2F / R of the present invention. DETAILED DESCRIPTION

[0027] The technical solution of the present invention is described in detail below in conjunction with preferred embodiments. It should be understood that the embodiments listed below are only used to illustrate and explain the technical solution of the present invention, and are not used to limit the present invention.

[0028] Unless otherwise specified, the materials and reagents used in the following examples can be obtained through commercial channels.

[0029] After Li's rice streak was classified as a type of rice Xanthomonas disease, we consulted relevant literature and found that the Xol primers in the literature could not identify the Xol strain preserved in our laboratory, and some of the published Xoo primers could not distinguish Xol from Xoo. In response to this phenomenon, we used local and online Blast to find the diversity of specific DNA segments in different Xanthomonas pathogenic variants to design primers. In addition, in order to achieve rapid identification using the specific primers of the present invention, these three pairs of primers were subjected to a fusion test, and after optimizing the PCR program and gel running conditions, the possibility of rapid and convenient use was ensured.

[0030] According to the above research results, the present invention provides a specific primer for detecting different pathogenic variants of Xanthomonas oryzae, including one or more primer pairs for Xoc, Xol, and Xoo, wherein:

[0031] The primer pair for Xoc

[0032] Forward primer U_Xoc_1F: AGTTCGAGACGACGGATGC (sequence 1 in the sequence list),

[0033] Reverse primer U_Xoc_1R: CCTAGCAATCCCGAACCTG (sequence 2 in the sequence listing);

[0034] The primer pair for Xol

[0035] Forward primer U_Xol_2F: AGGGTTACTTGGAGGAGGC (sequence 3 in the sequence list),

[0036] Reverse primer U_Xol_2R: CAGCGTCTTGATGTCCAGG (sequence 4 in the sequence listing);

[0037] and a primer pair for Xoo, which

[0038] Forward primer U_Xoo_2F: GCCGCAAACCCTGTGTTCAT (sequence 5 in the sequence list),

[0039] Reverse primer U_Xoo_2R: CTGCACACGTAGAAGGCGAT (sequence 6 in the sequence listing).

[0040] Here, the primer pair U_Xoo_2F / U_Xoo_2R is a primer pair for Xoo in the Asian region.

[0041] The present invention provides an application of specific primers in detecting different pathogenic variants of Xanthomonas oryzae. The detection comprises the following steps:

[0042] S1: Collect rice seeds or leaves, suspected disease samples or asymptomatic latent samples;

[0043] S2: Cut and grind the sample and dissolve it in deionized water;

[0044] S3: PCR verification using specific primers and sample solution;

[0045] S4: Analyze the PCR results.

[0046] The grinding liquid and extract of the sample to be tested are used as templates, and the above-mentioned specific primers are used for PCR amplification to obtain an amplified product; the amplified product is subjected to gel electrophoresis, and the analysis and judgment are performed based on the gel electrophoresis results:

[0047] If a 280 bp product is amplified, the rice pathogenic variant Xoc is present in the sample;

[0048] If a 119 bp product is amplified, the rice pathogenic variant Xoo is present in the sample;

[0049] If a 352 bp product is amplified, the P. lycopersici pathogenic variant Xol is present in the sample.

[0050] Example 1 Primer design and screening

[0051] The present invention uses Blast to compare related strains with some internationally recognized strains, thereby finding their respective specific fragments and designing three pairs of primers for Xol, Xoo and Xoc. The specific fragment sequences are all derived from the strain genomes of Xol, Xoo and Xoc that have completed whole genome sequencing in the RefSeq genome database of the United States NCBI (National Center for Biotechnology Information, National Center for Biotechnology Information) (as of 2021.03.19). The designed primers are then placed in NCBI's Primer-Blast for specific screening in the nr nucleic acid database. The above primers were all synthesized in the Nanning Synthesis Department of Beijing Qingke Biotechnology Co., Ltd.

[0052] The above strain genomes, including Xol strains but not limited to NCPPB4346, NJ611, BAI23, BB151-3, BB156-2; Xoo strains but not limited to PXO99 A , MAFF311018, KACC10331, AXO1947, JP01, IX-280; Xoc strains include but are not limited to BLS256, BXOR1, RS105, GX01, CFBP7331, CFBP2286.

[0053] The "strains" mentioned in the following examples were all isolated by the laboratory of Guangxi University.

[0054] During the fusion experiment of these three pairs of primers, it was found that the primer temperature and the number of cycles would affect the results of gel running, so the PCR amplification program was adjusted to increase the annealing temperature, reduce the number of cycles, and increase the hardness of the agarose gel.

[0055] The primer annealing temperature of the PCR reaction was optimized to obtain the best PCR reaction system, reaction procedure and reaction conditions.

[0056] The optimal reaction system for PCR amplification was: 1 μL of sample to be tested, 0.2 μL of forward primer, 0.2 μL of reverse primer, 0.2 μL of dNTPs (2.5 mM each), 0.1 μL of Easy Taq DNA Polymerase, 1.0 μL of 10×Easy Taq Buffer, and 7.2 μL of ddH2O.

[0057] The reaction procedure and reaction conditions of PCR amplification are as follows: 1) pre-denaturation at 95°C for 5 min, 2) denaturation at 95°C for 30 s, 3) primer annealing temperature for 30 s, 4) extension at 72°C for 10 s, repeating steps 2) to 4) for a total of 30 cycles, and finally completing the extension at 72°C for 5 min.

[0058] After the reaction is completed, run electrophoresis on 2% agarose gel at 100V for 50-60min. Figure 1 shown.

[0059] Figure 1 It shows that the maker with 100bp plus was used as the control, lane 1 used primers U_Xoc_1F / R, the sample was the genomic DNA of the Xoc strain, and the band size was 280bp; lane 2 used primers U_Xoo_2F / R, the sample was the genomic DNA of the Xoo strain, and the band size was 119bp; lane 3 used primers U_Xol_2F / R, the sample was the genomic DNA of the Xol strain, and the band size was 352bp.

[0060] Example 2 Primer specificity detection

[0061] The established PCR method was used to detect the collected samples suspected of rice white leaf blight, rice leaf streak, and Li's rice short streak, and compared with the specific PCR results of different pathogenic variants of Xanthomonas oryzae isolated in the laboratory. The results showed that the PCR test results of the samples were 100% consistent with the specific PCR test results of different pathogenic variants of Xanthomonas oryzae isolated in the laboratory, indicating that the specific primer test results described in the present invention have high accuracy and are suitable for the rapid identification of different pathogenic variants of Xanthomonas oryzae.

[0062] Please refer to the test results for Figure 2 to Figure 5 .

[0063] like Figure 2The results are shown in the figure, which are the detection results of the specific primer U_Xoc_1F / R of the present invention, i.e., the identification of the specific primer U_Xoc_1F / R was performed using the bacterial mixture of three pathogenic strains of Xanthomonas oryzae and the abrasive liquid of pathogenic leaves thereof. The maker of 100bp plus was used as the control, and the specific primer U_Xoc_1F / R was used in lanes 1-4. The samples were the bacterial mixture of Xoc strain, Xoo strain, and Xol strain (lane 1), the bacterial mixture without Xoc strain (lane 2), the abrasive liquid of pathogenic leaves of Xoc strain (lane 3), and the blank control (lane 4).

[0064] Figure 2 If there is a band in the sample, it means that the pathogenic variant of Xanthomonas oryzae corresponding to the specific primer exists in the sample; even if the sample is a mixture, only a single band can be detected. This shows that U_Xoc_1F / R is specific to the pathogenic variant of Xoc and the detection result is accurate.

[0065] like Figure 3 The results are shown in the figure, which are the detection results of the specific primer U_Xoo_2F / R of the present invention, i.e., the identification of the specific primer U_Xoo_2F / R was performed using the bacterial mixture of three pathogenic variants of Xanthomonas oryzae and the abrasive liquid of pathogenic leaves thereof. The maker of 100bp plus was used as the control, and the specific primer U_Xoo_2F / R was used in lanes 1-4. The samples were the bacterial mixture of Xoc strain, Xoo strain, and Xol strain (lane 1), the bacterial mixture without Xoo strain (lane 2), the abrasive liquid of pathogenic leaves of Xoo strain (lane 3), and the blank control (lane 4).

[0066] Figure 3 If there is a band in the sample, it means that the pathogenic strain Xoo of Xanthomonas oryzae corresponding to the specific primer exists in the sample; even if the sample is a mixture, only a single band can be detected. This shows that U_Xoo_2F / R is specific to the pathogenic strain Xoo and the detection result is accurate.

[0067] like Figure 4 As shown, the detection result of the specific primer U_Xol_2F / R of the present invention is that the bacterial mixture of three pathogenic strains of Xanthomonas oryzae and the pathogenic leaf grinding liquid of the three strains are used to identify the U_Xol_2F / R specific primer. Using 100bp plus maker as a control, lanes 1-4 use U_Xol_2F / R specific primers, and the samples are Xoc strain, Xoo strain, Xol strain bacterial mixture (lane 1), Xol strain-free bacterial mixture (lane 2), Xol strain pathogenic leaf grinding liquid (lane 3) and blank control (lane 4).

[0068] Figure 4If there is a band in the sample, it means that the pathogenic strain Xol corresponding to the specific primer exists in the sample; even if the sample is a mixture, only a single band can be detected. This shows that U_Xol_2F / R is specific to the pathogenic strain Xol and the detection result is accurate.

[0069] like Figure 5 As shown, it is the mixed detection result of three pairs of specific primers of the present invention, that is, the specific primers U_Xoc_1F / R, U_Xoo_2F / R and U_Xol_2F / R are mixed in equal amounts, and 100bp plus maker is used as a control. Lane 1 is a bacterial mixture of three pathogenic variants of Xanthomonas oryzae, lane 2 is a bacterial mixture of Xoc strain and Xoo strain, lane 3 is a bacterial mixture of Xoc strain and Xol strain, lane 4 is a bacterial mixture of Xoo strain and Xol strain, and lanes 5-8 are bacterial solutions of Xoc strain, Xoo strain, Xol strain and blank control, respectively.

[0070] from Figure 5 It can be seen that in the gel display of the primer mixed test, 1-3 bands appear respectively, indicating that as long as there are pathogenic variants of Xanthomonas oryzae in the test sample, the corresponding bands can be detected. This strongly proves that the specific primers of the present invention for different pathogenic variants of Xanthomonas oryzae have high specificity for each corresponding pathogenic variant, and can quickly and effectively identify and identify the three types of pathogenic variants whether they are used separately or mixed.

[0071] Example 3 Sensitivity Detection

[0072] By diluting the sample template in a concentration gradient, it is proved that the three pairs of primers of the present invention have high sensitivity detection, and when sampling in the field, the disease of rice straw that has been infected with the disease but has not yet developed can be accurately identified.

[0073] like Figure 6 , Figure 7 and Figure 8 As shown in the figure, the sensitivity of the present invention is respectively detected by using the genomic DNA of the Xoc strain as a template for U_Xoc_1F / R, the genomic DNA of the Xoo strain as a template for U_Xoo_2F / R, and the genomic DNA of the Xol strain as a template for U_Xol_2F / R. These tests all use the 100bp plus maker as a control, and the template concentrations of lanes 1-9 are 5×10 -1 , 1×10 -1 , 5×10 -2 , 1×10 -2 , 5×10 -3 , 1×10 -3 , 5×10-4 and 1×10 -4 ng / μL, lane 10 is the blank control. The arrow indicates that the sample template at this concentration is the lowest concentration that this primer can detect.

[0074] From the above Figure 6-Figure 8 It can be seen that the minimum detection concentration of Xanthomonas oryzae pv DNA is 1×10 - 3 ng / μL; the minimum detection concentration of rice pathogenic variant DNA is: 5×10 -3 ng / μL; the minimum detection concentration of Lishihe pathogenic variant DNA is: 1×10 -4 ng / μL.

[0075] Sequence Listing

[0076] Sequence 1:

[0077]

[0078] Sequence 2:

[0079]

[0080] Sequence 3:

[0081]

[0082] Sequence Listing 4:

[0083]

[0084] Sequence Listing 5:

[0085]

[0086] Sequence Listing 6:

[0087] Sequence Listing <110> Guangxi University <120> Specific primers for detecting pathogenic variants of Xanthomonas oryzae and their application <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <400> 1 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <400> 2 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <400> 3 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <400> 4 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6

Claims

1. A specific primer combination for detecting different pathogenic variants of Xanthomonas oryzae, characterized in that: It also includes primer pairs for Xoc, Xol, and Xoo, respectively. The primer pair for Xoc Forward primer U_Xoc_1F: AGTTCGAGACGACGGATGC, Reverse primer U_Xoc_1R: CCTAGCAATCCCGAACCTG; The primer pair for Xol Forward primer U_Xol_2F: AGGGTTACTTGGAGGAGGC, Reverse primer U_Xol_2R: CAGCGTCTTGATGTCCAGG; and a primer pair for Xoo, which Forward primer U_Xoo_2F: GCCGCAAACCCTGTGTTCAT, Reverse primer U_Xoo_2R: CTGCACACGTAGAAGGCGAT; The primer pair targeting Xoo refers to a primer pair targeting Xoo in Asia.

2. An application of the specific primer combination as claimed in claim 1 in detecting different pathogenic variants of Xanthomonas oryzae, comprising detecting one or more of the pathogenic variants Xoc, Xol and Xoo.

3. A method for detecting Xanthomonas oryzae pv. oryzae Xoc, pv. lycopersicum Xol and pv. oryzae Xoo using the specific primer combination of claim 1, comprising the following steps: S1: Collect rice seeds or leaves, suspected disease samples or asymptomatic latent samples; S2: Cut and grind the sample and dissolve it in deionized water; S3: PCR verification using specific primers and sample solution; S4: Analyze the PCR results.

4. The method according to claim 3, characterized in that The steps S3-S4 specifically include: The grinding liquid and extract of the sample to be tested are used as templates, and the above-mentioned specific primers are used for PCR amplification to obtain an amplified product; the amplified product is subjected to gel electrophoresis, and the analysis and judgment are performed based on the gel electrophoresis results: If a product of 280 bp is amplified, the rice pathogenic variant Xoc is present in the sample; If a product of 119 bp is amplified, the rice pathogenic variant Xoo is present in the sample; If a product of 352 bp is amplified, the Lishiwo disease pathogenic variant Xol is present in the sample.

5. The method according to claim 4, characterized in that The reaction procedure and reaction conditions of the PCR amplification are: 1) Pre-denaturation at 95°C for 5 min; 2) Denaturation at 95°C for 30 seconds; 3) Primer annealing temperature 30s; 4) Extend at 72°C for 10 seconds; repeat steps 2) to 4) for a total of 30 cycles; 5) Finish and extend at 72℃ for 5 min.

6. The method according to claim 5, characterized in that The reaction system of the PCR amplification is: 1 μL of sample to be tested, 0.2 μL of forward primer, 0.2 μL of reverse primer, 0.2 μL of dNTPs with original concentration of 2.5 mM, 0.1 μL of EasyTaq DNA Polymerase, 1.0 μL of 10-fold concentration of Easy Taq Buffer, and 7.2 μL of ddH2O.

7. The method according to claim 6, characterized in that The minimum detection concentration of the rice pathogenic variant Xoc is: 1×10 -3 ng / μL; the minimum detection concentration of the rice pathogenic variant Xoo is: 5×10 -3 ng / μL; the minimum detection concentration of the pathogenic variant Xol of Lishihe is: 1×10 -4 ng / μL.

Images