High-growth influenza virus
By introducing amino acid modifications into the PB2, PB1, M and/or NS2 proteins of influenza viruses, the growth rate and yield of recombinant influenza viruses in cell culture is improved, the problems of instability and low efficiency in influenza virus vaccine production are solved, and efficient and economical virus production and vaccine preparation are achieved.
Patent Information
- Application Number
- CN202080020116.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2019-03-06
- Filing Date
- 2020-01-24
- Publication Date
- 2025-07-18
- Estimated Expiration
- 2040-01-24
AI Technical Summary
Existing methods of influenza virus vaccine production rely on egg supply, with problems of instability in supply and low vaccine efficiency, especially during the pandemic, and cell-based virus production systems have shortcomings in economic and cross-reactivity.
By introducing recombinant influenza viruses modified with specific amino acids in PB2, PB1, M and/or NS2 proteins, the growth rate and yield of the virus in cell culture is improved, and interferon-deficient cells such as Vero cells are used to proliferate to prepare efficient recombinant influenza viruses and viral vectors.
It has achieved efficient production of influenza viruses in cell culture, improved viral titers, enhanced the economy and protection of the vaccine, reduced cross-reactivity, and adapted to the rapid response needs during the pandemic.
Smart Images

Figure BDA0003255406210000311 
Figure BDA0003255406210000312 
Figure BDA0003255406210000321
Abstract
Description
[0001] The present invention provides recombinant influenza viruses and influenza virus vectors comprising amino acid modifications in the PB2, PB1, M and / or NS2 proteins, which exhibit a highly increased growth rate compared to unmodified influenza viruses.
[0002] Also provided are pharmaceutical compositions comprising reassortant viruses and virus vectors containing said modifications and their use for vaccination purposes. Background Art
[0003] Epidemic and pandemic diseases caused by viral illnesses continue to claim human lives and affect the global economy. Influenza causes millions of lost workdays for medical treatment, hundreds of thousands of hospitalizations globally (Couch 1993, Ann. NY. Acad. Sci 685; 803), tens of thousands of excess deaths (Collins & Lehmann 1953 Public Health Monographs 213:1; Glezen 1982 Am. J. Public Health 77:712) and medical costs in the billions of euros (Williams et al. 1988, Ann. Intern. Med. 108:616). When healthy adults are vaccinated, currently available vaccines can prevent clinical disease in 70% - 90% of cases. In individuals over 65 years of age, this figure drops to 30% - 70%, and in those over 65 years of age in nursing homes, the figure drops further (Strategic Perspective 2001: The Antiviral Market. Datamonitor. p. 59). The frequent antigenic changes of the virus further result in a large number of deaths, as vaccination every year does not guarantee protection. Thus, the number of deaths in the United States rose from 16,363 in 1976 / 77 to up to four times as many in 1998 / 99. During the period 2017 - 2018, the number of influenza-related deaths reached approximately 80,000.
[0004] When the World Health Organization (WHO) recommends including antigenically new strains in current vaccine formulations, human influenza virus reference strains must be prepared. The segmented nature of the influenza virus genome allows for segment reassortment when the virus replicates in cells infected with two or more influenza viruses. Over time, segment reassortment combined with gene mutation and drift can give rise to countless different influenza virus strains. New strains exhibit antigenic variation in their hemagglutinin (HA) and / or neuraminidase (NA) proteins, particularly the gene encoding the HA protein has a high mutation rate.
[0005] Currently, influenza strains used for vaccination can be prepared by classical reassortment of recommended and laboratory strains or by reverse genetics techniques, where the gene segments encoding surface proteins are derived from the recommended strain and other gene segments are derived from high-growth virus strains.
[0006] The main current approach to preventing influenza is vaccination. Since the influenza HA protein is the main target antigen for the host's protective immune response against the virus and is highly variable, the isolation of influenza viruses and the identification and characterization of HA antigens in viruses associated with recent outbreaks are very important for vaccine production. Based on prevalence and prediction, vaccines are designed to stimulate a protective immune response against the main and expected influenza virus strains.
[0007] Influenza viruses are divided into three general types, A, B, and C, defined by the absence of serological cross-reactivity between their internal proteins. Based on antigenic and genetic differences in their glycoproteins - the HA and NA proteins, influenza A viruses are further divided into various subtypes. Most known HA and NA subtypes (H1 to H17 and N1 to N10) have been isolated from birds, which are considered the natural reservoir of influenza.
[0008] Influenza virus particles consist of an internal ribonucleoprotein core (helical nucleocapsid) containing a single-stranded RNA genome and an outer lipoprotein envelope lined internally with matrix protein (M1). The segmented genome of influenza A virus consists of eight linear negative-polarity single-stranded RNA molecules that encode eleven (ten in some influenza A strains) polypeptides, including: RNA-dependent RNA polymerase proteins (PB2, PB1, and PA) and the nucleoprotein (NP) that forms the nucleocapsid; matrix membrane proteins (M1, M2); two surface glycoproteins protruding from the lipid-containing envelope: hemagglutinin (HA) and neuraminidase (NA); non-structural protein (NS1) and nuclear export protein (NEP). Most influenza A strains also encode an eleventh protein (PB1-F2) that is thought to have pro-apoptotic properties.
[0009] Transcription and replication of the genome occur in the nucleus, and assembly occurs by budding at the plasma membrane. Viruses can reassort genes during mixed infections. Influenza viruses adsorb via HA to sialic acid oligosaccharides in cell membrane glycoproteins and glycolipids. After endocytosis of the virion, the HA molecules undergo conformational changes in the endosome, promoting membrane fusion and thus triggering uncoating. The nucleocapsid migrates to the nucleus, where viral mRNA is transcribed by a unique mechanism in which the viral endonuclease cleaves the capped 5'-end from cellular heterologous mRNA, which then serves as a primer for transcribing the viral RNA template by the viral transcriptase. Transcripts terminate at a site 15 to 22 bases from the end of their template, where the oligo(U) sequence serves as a signal for adding a poly(A) tract. Of the eight viral RNA molecules so produced, six are monocistronic messages that are translated directly into proteins representing HA, NA, NP, and the viral polymerase proteins PB2, PB1, and PA. The other two transcripts are spliced to each produce two mRNAs that are translated in different reading frames to produce M1, M2, NS1, and NEP. In other words, these 8 viral RNA segments encode 11 proteins: nine structural proteins and 2 non-structural (NS1 and PB1-F2) proteins.
[0010] The growth of viruses, especially influenza viruses in chicken embryos, has been shown to be effective in producing influenza virus particles that can be used to produce inactivated influenza virus vaccine strains or live attenuated influenza virus vaccine strains. Nevertheless, the egg-based method requires a stable supply of specific pathogen-free eggs, which can be problematic in the case of a pandemic. Therefore, in the past few years, a great deal of work has been done in establishing virus production systems using cell culture. Cell-based technology is an alternative production method that does not rely on egg suppliers and can be started as soon as the seed virus is available. In addition, it has been shown that inactivated influenza vaccines prepared from viruses grown in mammalian cells induce more cross-reactive serum antibodies and exhibit better protection than egg-grown vaccines (Alymova et al., 1998, J Virol 72, 4472-7).
[0011] WO2009 / 080806A2 and WO2017 / 143236A1 describe influenza viruses containing M gene modifications.
[0012] Ping J. et al. reported influenza virus mutants with various modifications within the PA, PB1, PB2, NP, NS, and M viral segments (Proc. Natl. Acad. Sci., 113, 51, 2016, pp. E8296-E8305).
[0013] In general, given the urgency of producing pandemic or pandemic influenza vaccine compositions from influenza virus strains recommended by the WHO and the time required to produce such viruses, it is of utmost importance that the virus strain provides a viral backbone for the development of vaccine virus particles, that the virus strain is highly productive for vaccine production, and that it can be produced in cell culture. Summary of the Invention
[0014] Modifications, such as mutations that increase the replication ability of influenza viruses in cell culture, can be used to amplify these viruses and establish a robust influenza vaccine platform. The amino acid substitutions identified herein result in higher virus titers in cell culture, particularly in Vero cells, and can also increase virus titers in MDCK cells, chicken embryos, and any other cells that can be used for virus propagation, thereby enabling more efficient influenza virus growth and more cost-effective vaccine production. The mutations can be used in any combination, depending on the selected viral backbone, the corresponding cell line (or egg) used, and the desired level of increased virus replication.
[0015] Thus, the viruses of the present invention can be used as high-yield influenza virus master strains, or alternatively, as influenza virus vectors that further express heterologous target genes.
[0016] The present invention provides isolated recombinant (e.g., reassortant) influenza viruses that have increased yields, lack a functional NS1 protein, and have selected amino acid residues at one or more selected positions in one, two, or more gene segments encoding PB1, PB2, M (encoding M1 and M2), and / or NS proteins (encoding NS2 protein), such as at the specifically disclosed positions in M1 and NS2, M1, PB2 and NS2, PB1, M1 and / or NS2, PB1 and / or PB2; and contain target HA and NA sequences, such as from annual and pandemic strains, and the influenza viruses are produced more efficiently and cost-effectively by cell culture, such as in Vero, MDCK, or PerC6 cells or in chicken embryos.
[0017] Specifically, the host cells for the cell culture propagation of the delNS1 viruses of the present invention are interferon-deficient cells, such as Vero cells.
[0018] According to one embodiment of the present invention, there is provided a recombinant influenza B virus with an increased growth rate that lacks a functional NS1 protein (delNS1 influenza), the recombinant influenza B virus comprising:
[0019] - an M1 protein having an amino acid substitution at position 89 according to the numbering of SEQ ID No. 6, particularly an M1 protein having serine at the 89th amino acid position, and
[0020] - one or more nucleotide-modified NS and PB gene fragments, generating
[0021] an NS2 protein having an amino acid substitution at positions 75 and / or 76 according to the numbering of SEQ ID No. 10, in particular an NS2 protein having glycine at position 75 and / or arginine at position 76, and / or
[0022] a PB2 protein having an amino acid substitution at position 427 according to the numbering of SEQ ID No. 2, in particular a PB2 protein having serine at position 427.
[0023] SEQ ID No. 6 represents the wild-type M protein sequence.
[0024] SEQ ID No. 10 represents the wild-type NS2 protein sequence.
[0025] According to one embodiment of the present invention, there is provided herein a recombinant influenza B virus with an increased growth rate, which lacks a functional NS1 protein (delNS1 influenza), and the recombinant influenza B virus comprises:
[0026] - an M1 protein having an amino acid substitution at position 89, in particular an M1 protein of amino acid sequence SEQ ID No. 6 having serine at the 89th amino acid position, and
[0027] - NS2 and PB2 proteins comprising amino acid sequences SEQ ID No. 10 and SEQ ID No. 2, wherein
[0028] the NS2 protein contains amino acid substitutions at positions 75 and / or 76, in particular glycine at position 75 and / or arginine at position 76, and / or
[0029] the PB2 protein contains an amino acid substitution at position 427, in particular serine at position 427.
[0030] SEQ ID No. 2 represents the wild-type PB2 protein sequence.
[0031] According to another embodiment, the recombinant influenza B virus comprises amino acid sequences SEQ ID No. 4, SEQ ID No. 8 and SEQ ID No. 12 and / or comprises nucleotide sequences SEQ ID No. 3, SEQ ID No. 7 and SEQ ID No. 11.
[0032] Specifically, the recombinant influenza B virus described herein comprises the amino acid sequences SEQ ID No. 4, SEQ ID No. 8, and SEQ ID No. 12 or any amino acid sequence that is at least 95%, particularly 96%, 97%, 98%, or 99% identical to any one of SEQ ID No. 4, SEQ ID No. 8, and SEQ ID No. 12, provided that position 427 of SEQ ID No. 4, positions 75 and 76 of SEQ ID NO. 10, and / or position 89 of SEQ ID No. 8 are conserved.
[0033] According to another embodiment, the recombinant influenza B virus comprises the amino acid sequences SEQ ID No. 4, SEQ ID No. 8, and SEQ ID No. 34 and / or the nucleotide sequences SEQ ID No. 3, SEQ ID No. 7, and SEQ ID No. 33.
[0034] Specifically, the recombinant influenza B virus described herein comprises the amino acid sequences SEQ ID No. 4, SEQ ID No. 8, and SEQ ID No. 34 or any amino acid sequence that is at least 95%, particularly 96%, 97%, 98%, or 99% identical to any one of SEQ ID No. 4, SEQ ID No. 8, and SEQ ID No. 34, provided that position 427 of SEQ ID No. 4, position 76 of SEQ ID NO. 34, and / or position 89 of SEQ ID No. 8 are conserved.
[0035] According to another embodiment, the recombinant influenza B virus comprises the amino acid sequences SEQ ID No. 8 and SEQ ID No. 12 and / or the nucleotide sequences SEQ ID No. 7 and SEQ ID No. 11.
[0036] Specifically, the recombinant influenza B virus described herein comprises the amino acid sequences SEQ ID No. 8 and SEQ ID No. 12 or any amino acid sequence that is at least 95%, particularly 96%, 97%, 98%, or 99% identical to any one of SEQ ID No. 8 and SEQ ID No. 12, provided that positions 76 and 75 of SEQ ID NO. 12 and position 89 of SEQ ID No. 8 are conserved.
[0037] According to another embodiment, the recombinant influenza B virus comprises the amino acid sequences SEQ ID No. 8 and SEQ ID No. 34 and / or the nucleotide sequences SEQ ID No. 7 and SEQ ID No. 33.
[0038] Specifically, the recombinant influenza B virus described herein comprises the amino acid sequences SEQ ID No.8 and SEQ ID No.34 or any amino acid sequence that is at least 95%, particularly 96%, 97%, 98% or 99% identical to either SEQ ID No.8 or SEQ ID No.34, provided that position 76 of SEQ ID NO.34 and position 89 of SEQ ID No.8 are conserved. According to an alternative embodiment, there is provided herein a recombinant delNS1 influenza B virus comprising M, PB and NS gene segments containing one or more nucleotide modifications, said gene segments giving rise to
[0039] - an M1 protein having an amino acid substitution at positions 89 and / or 93 numbered according to SEQ ID No.6, and / or
[0040] - an NS2 protein having an amino acid substitution at positions 75, 76 and / or 117 numbered according to SEQ ID No.10, and / or
[0041] - a PB2 protein having an amino acid substitution at position 427 numbered according to SEQ ID No.2, and / or
[0042] - a PB1 protein having an amino acid substitution at position 67 numbered according to SEQ ID No.14, or
[0043] - any combination thereof.
[0044] One specific embodiment provided herein is a recombinant influenza B virus comprising M and NS gene segments containing nucleotide modifications, said gene segments encoding
[0045] - an M1 protein having an amino acid substitution at position 89 numbered according to SEQ ID No.6, and
[0046] - an NS2 protein having an amino acid substitution at position 76 numbered according to SEQ ID No.10.
[0047] According to one embodiment described herein, the recombinant influenza B virus further comprises a PB2 gene encoding a PB2 protein having an amino acid substitution at position 427 numbered according to SEQ ID No.2.
[0048] According to another embodiment, the recombinant influenza B virus further comprises an NS gene encoding an NS2 protein having an amino acid substitution at position 75 numbered according to SEQ ID No.10.
[0049] According to another embodiment, the recombinant influenza B virus comprises
[0050] - An M1 protein having an amino acid substitution at position 89 according to the numbering of SEQ ID No. 6, particularly a serine at amino acid position 89;
[0051] - A PB2 protein having an amino acid substitution at position 427 according to the numbering of SEQ ID No. 2, particularly a serine at amino acid position 427; and
[0052] - An NS2 protein having an amino acid substitution at positions 75 and / or 76 according to the numbering of SEQ ID No. 10, particularly a glycine at amino acid position 76 and / or an arginine at amino acid position 75.
[0053] In one embodiment, B / Thüringen / 02 / 06 (a B / Jiangsu / 10 / 03-like virus from the B Yamagata lineage) can serve as a genetic backbone for the production of influenza virus vaccines. In particular, B / Thüringen / 02 / 06 containing gene segments encoding amino acid substitutions at the specified positions herein as well as HA and NA proteins can be derived from any strain, such as but not limited to B / Murmansk / 3 / 2010. According to a specific embodiment, provided herein is a recombinant influenza B virus with increased growth rate that lacks a functional NS1 protein (delNS1 influenza), said recombinant influenza B virus comprising: at least two gene segments containing one or more nucleotide modifications, said gene segments giving rise to
[0054] - An M1 protein having an amino acid substitution at position 93 according to the numbering of SEQ ID No. 6, particularly an arginine at amino acid position 93, and / or
[0055] - A PB1 protein having an amino acid substitution at position 67 according to the numbering of SEQ ID No. 14, particularly an asparagine at amino acid position 67, and / or
[0056] - An NS2 protein having an amino acid substitution at position 117 according to the numbering of SEQ ID No. 10, particularly a histidine at amino acid position 117.
[0057] SEQ ID No. 14 represents the wild-type PB1 protein sequence.
[0058] According to a specific embodiment, provided herein is a recombinant influenza B virus with increased growth rate that lacks a functional NS1 protein (delNS1 influenza), said recombinant influenza B virus comprising:
[0059] - The M1 protein having an amino acid substitution at position 93, particularly arginine at the 93rd amino acid position, of the amino acid sequence SEQ ID No. 6, and / or
[0060] - The PB1 protein having an amino acid substitution at position 67, particularly asparagine at the 67th amino acid position, of the amino acid sequence SEQ ID No. 14, and / or
[0061] - The NS2 protein having an amino acid substitution at position 117, particularly histidine at the 117th amino acid position, of the amino acid sequence SEQ ID No. 10.
[0062] Specifically, the recombinant influenza B virus described herein comprises at least two amino acid sequences among the amino acid sequences SEQ ID No. 16, SEQ ID No. 20, and SEQ ID No. 24 and / or comprises at least two nucleotide sequences among SEQ ID No. 15, SEQ ID No. 19, and SEQ ID No. 23.
[0063] Specifically, the recombinant influenza B virus described herein comprises the amino acid sequences SEQ ID No. 16, SEQ ID No. 20, and SEQ ID No. 24 or at least two amino acid sequences among any amino acid sequences that are at least 95%, particularly 96%, 97%, 98%, or 99% identical to any one of SEQ ID No. 16, SEQ ID No. 20, and SEQ ID No. 24, provided that position 67 of SEQ ID No. 16, position 93 of SEQ ID NO. 20, and / or position 117 of SEQ ID No. 24 is conserved.
[0064] According to another embodiment, provided herein is a recombinant delNS1 influenza B virus with increased yield, which comprises PB1, M, and NS genes containing at least two nucleotide modifications, and the genes encode
[0065] - The PB1 protein having an amino acid substitution at position 67 according to the numbering of SEQ ID No. 14,
[0066] - The M1 protein having an amino acid substitution at position 93 according to the numbering of SEQ ID No. 6, and / or
[0067] - The NS2 protein having an amino acid substitution at position 117 according to the numbering of SEQ ID No. 10.
[0068] In another embodiment, the recombinant influenza B virus described herein comprises a modified protein, and the modified protein is selected from the group consisting of:
[0069] - A PB1 protein having asparagine at amino acid position 67 with reference to the numbering of SEQ ID No. 14,
[0070] - An M1 protein having arginine at amino acid position 93 with reference to the numbering of SEQ ID No. 6, and / or
[0071] - An NS2 protein having histidine at amino acid position 117 with reference to the numbering of SEQ ID No. 10,
[0072] There is further provided a recombinant influenza B virus as described herein, which comprises
[0073] - A PB1 protein having an amino acid substitution at position 67 with reference to the numbering of SEQ ID No. 14,
[0074] - An M1 protein having an amino acid substitution at position 93 with reference to the numbering of SEQ ID No. 6, and
[0075] - An NS2 protein having an amino acid substitution at position 117 with reference to the numbering of SEQ ID No. 10.
[0076] In one embodiment, influenza B virus / Turingen / 02 / 06 can be used as a genetic backbone for generating an influenza virus vaccine. In particular, B / Turingen / 02 / 06 containing gene segments encoding amino acid substitutions at the specified positions herein as well as HA and NA proteins can be derived from any strain, such as but not limited to B / Phuket / 3073 / 2013. According to another embodiment, there is provided a recombinant influenza A virus with increased growth rate, which lacks a functional NS1 protein (delNS1 influenza). The recombinant influenza A virus comprises a PB2 protein having an amino acid substitution at position 80 with reference to the numbering of SEQ ID No. 26, in particular, having arginine at amino acid position 80, and a PB1 gene containing at least one nucleotide modification, which encodes a PB1 protein having amino acid substitutions at positions 97 and 678 with reference to the numbering of SEQ ID No. 30, in particular, having glycine at amino acid position 97 and asparagine at amino acid position 678.
[0077] According to another embodiment, provided herein is a recombinant influenza A virus with increased growth rate, which lacks a functional NS1 protein (delNS1 influenza), said recombinant influenza A virus comprising a PB2 protein containing the amino acid sequence SEQ ID No. 26 having an amino acid substitution at position 80, particularly arginine at the 80th amino acid position, and a PB1 protein containing the amino acid sequence SEQ ID No. 30 having amino acid substitutions at positions 97 and 678, particularly glycine at the 97th amino acid position and asparagine at the 678th amino acid position.
[0078] Specifically, said recombinant influenza A virus comprises the nucleotide sequence SEQ ID No. 27 in combination with any one of SEQ ID No. 31, 35 and 36.
[0079] Specifically, said recombinant influenza A virus comprises the amino acid sequence SEQ ID No. 28 in combination with any one of SEQ ID No. 32, 37 and 38.
[0080] Specifically, the recombinant influenza A virus described herein comprises the amino acid sequence SEQ ID No. 28 in combination with any one of the following: any one of SEQ ID No. 32, 37 and 38 or any amino acid sequence that is at least 95%, particularly 96%, 97%, 98% or 99% identical to SEQ ID No. 28, SEQ ID No. 32, 37 and 38, provided that position 80 of SEQ ID No. 28 and any one of positions 97 and 678 of SEQ ID No. 32, position 97 of SEQ ID No. 37 and / or position 678 of SEQ ID No. 24 is conserved.
[0081] According to another embodiment, provided herein is a recombinant influenza A virus, which comprises PB1 and PB2 genes containing at least two nucleotide modifications, which encode
[0082] - a PB1 protein having amino acid substitutions at positions 97 and 678 according to the numbering of SEQ ID No. 30, and / or
[0083] - a PB2 protein having an amino acid substitution at position 80 according to the numbering of SEQ ID No. 26.
[0084] According to another embodiment, the recombinant influenza A virus described herein comprises
[0085] - a PB1 protein having glycine at the 97th amino acid position and asparagine at the 678th amino acid position with reference to the numbering of SEQ ID No. 30, and / or
[0086] -PB2 protein having arginine at amino acid position 80 with reference to the numbering of SEQ ID No. 26.
[0087] According to an embodiment of the present invention, the recombinant influenza virus disclosed herein is a reassortant virus, particularly wherein said virus comprises at least two gene segments of seasonal or pandemic strain origin, particularly wherein said virus is attenuated or replication-deficient, preferably said virus is completely replication-deficient.
[0088] The recombinant influenza virus described herein may contain one or more modifications in the HA and / or NA genes.
[0089] According to a specific embodiment, the recombinant delNS1 influenza virus encompassed herein contains a modified NS1-encoding gene segment that encodes an NS1 protein lacking a functional RNA-binding domain, a functional carboxy-terminal domain, or lacking both a functional RNA-binding domain and / or a functional carboxy-terminal domain or a combination thereof.
[0090] In another embodiment, the present invention provides a vaccine composition comprising an immunogenicity-inducing effective amount of an influenza virus admixed with a pharmaceutically acceptable carrier.
[0091] According to another embodiment, the present invention provides an isolated nucleic acid encoding the recombinant influenza virus described herein.
[0092] In another embodiment, the influenza virus described herein is used for the preparation of a medicament.
[0093] In another embodiment, the influenza virus described herein is used for the therapeutic or prophylactic treatment of influenza virus infection.
[0094] In some embodiments, a plurality of vectors are introduced into a population of host cells, said plurality of vectors incorporating at least 6 internal genomic segments of an influenza A or B strain and one or more genomic segments encoding immunogenic influenza surface antigens of different influenza strains. For example, at least 6 internal genomic segments (“backbone”) of a selected influenza A or B strain (e.g., an engineered influenza A or B strain containing amino acid substitutions at one or more of the positions specified above, e.g., but not limited to B / Thuringia / 02 / 06 or A / IVR-116) and one or more segments encoding immunogenic antigens derived from another viral strain are introduced into a population of host cells. Typically, immunogenic surface antigens include either or both of the hemagglutinin (HA) and / or neuraminidase (NA) antigens. In embodiments where a single segment encoding an immunogenic surface antigen is introduced, 7 complementary segments of the selected virus are also introduced into the host cells.
[0095] In another embodiment, provided herein are a variety of influenza virus vectors for preparing the reassembled delNS1 influenza B virus described herein, which include
[0096] a) a vector for vRNA production comprising a promoter operably linked to influenza virus PA DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus PB1 DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus PB2 DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus HA DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus NP DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus NA DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus M DNA linked to a transcription termination sequence, and a vector for vRNA production comprising a promoter operably linked to influenza virus NS cDNA or a portion thereof linked to a transcription termination sequence, wherein the PB1, PB2, PA, NP, NS, and M DNA in the vector for vRNA production encode M1 having serine at position 89 and at least one of the following: NS2 having glycine at position 76, NS2 having arginine at position 75, PB2 having serine at position 427, and optionally
[0097] b) a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PA, a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB1, a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB2, and a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NP, and optionally comprising a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus HA, a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NA, a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M1, a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M2, or a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NS2.
[0098] In another embodiment, provided herein are a variety of influenza virus vectors, which include
[0099] a) a vector for vRNA production comprising a promoter operably linked to influenza virus PA DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus PB1 DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus PB2 DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus HA DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus NP DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus NA DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus M DNA linked to a transcription termination sequence, and a vector for vRNA production comprising a promoter operably linked to influenza virus NS cDNA or a portion thereof linked to a transcription termination sequence, wherein the PB1, PB2, PA, NP, NS, and M DNA in the vector for vRNA production encode M1 having arginine at position 93 and at least one of the following: NS2 having histidine at position 117, PB1 having asparagine at position 67,
[0100] b) a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PA, a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB1, a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB2, and a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NP, and optionally a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus HA, a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NA, a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M1, a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M2, or a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NS2.
[0101] In another embodiment, provided herein are a variety of influenza virus vectors, which include
[0102] a) Vectors for vRNA production comprising a promoter operably linked to influenza virus PA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus PB1 DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus PB2 DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus HA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus NP DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus NA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus M DNA linked to a transcription termination sequence, and vectors for vRNA production comprising a promoter operably linked to influenza virus NS cDNA or a portion thereof linked to a transcription termination sequence, wherein the PB1, PB2, PA, NP, NS, and M DNA in the vectors for vRNA production encode at least two of the following: PB1 having glycine at position 97, PB1 having asparagine at position 678, PB2 having arginine at position 80,
[0103] b) Vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB1, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB2, and vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NP, and optionally vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus HA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M1, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M2, or vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NS2.
[0104] According to another embodiment of the invention, provided herein is a method for preparing an influenza B virus as described herein, which is carried out by contacting cells with the following:
[0105] a) Vectors for vRNA production comprising a promoter operably linked to influenza virus PA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus PB1 DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus PB2 DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus HA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus NP DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus NA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus M DNA linked to a transcription termination sequence, and vectors for vRNA production comprising a promoter operably linked to influenza virus NS cDNA or a portion thereof linked to a transcription termination sequence, wherein the PB1, PB2, PA, NP, NS, and M DNA in the vectors for vRNA production encode M1 having serine at position 89 and at least one of the following: NS2 having glycine at position 76, NS2 having arginine at position 75, PB2 having serine at position 427, and optionally
[0106] b) Vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB1, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB2, and vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NP, and optionally vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus HA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M1, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M2, or vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NS2.
[0107] In one embodiment, a method for preparing the influenza B virus of the present invention is further provided, which is carried out by contacting cells with the following:
[0108] a) Vectors for vRNA production comprising a promoter operably linked to influenza virus PA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus PB1 DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus PB2 DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus HA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus NP DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus NA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus M DNA linked to a transcription termination sequence, and vectors for vRNA production comprising a promoter operably linked to influenza virus NS cDNA or a portion thereof linked to a transcription termination sequence, wherein the PB1, PB2, PA, NP, NS, and M DNA in the vectors for vRNA production encode M1 having arginine at position 93 and at least one of the following: NS2 having histidine at position 117 and / or PB1 having asparagine at position 67,
[0109] b) Vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB1, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB2, and vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NP, and optionally vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus HA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M1, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M2, or vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NS2.
[0110] According to another aspect, provided herein is a method for preparing an influenza A virus as described herein, which is carried out by contacting a cell with the following:
[0111] a) Vectors for vRNA production comprising a promoter operably linked to influenza virus PA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus PB1 DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus PB2 DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus HA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus NP DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus NA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus M DNA linked to a transcription termination sequence, and vectors for vRNA production comprising a promoter operably linked to influenza virus NS cDNA linked to a transcription termination sequence, wherein the PB1, PB2, PA, NP, NS, and M DNA in the vectors for vRNA production encode at least two of the following: PB1 having glycine at position 97, PB1 having asparagine at position 678, and PB2 having arginine at position 80,
[0112] b) Vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB1, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB2, and vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NP, and optionally vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus HA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M1, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M2, or vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NS2.
[0113] Specifically, the NS1 coding gene fragment encodes the truncated NS1 protein or the functionally knocked-out or deleted NS1 protein described herein.
[0114] In another aspect, the present disclosure provides a method for preparing a virus as described herein, the method comprising introducing a recombinant vector as described herein into a reverse genetics system and expressing an influenza virus particle as described herein.
[0115] In another embodiment, the present disclosure provides a method for increasing the growth rate of an influenza virus, the method comprising the steps of: introducing a modification into the influenza virus PB2, PB1, M, and / or NS genes, the modification resulting in a recombinant influenza virus as described herein. Specifically, the present disclosure provides a method wherein the PB1, PB2, PA, NP, NS, and M DNAs in the vector for vRNA production have sequences corresponding to sequences encoding polypeptides that have at least 98% amino acid sequence identity to the corresponding polypeptides encoded by SEQ ID No. 2, 4, 6, 8, 10, 12, 14, 16, 20, 24, 26, 28, 30, 32, 34, 37, and 38.
[0116] In a specific embodiment, the present disclosure also provides a virus obtained by the method of the present invention.
[0117] In one embodiment, the isolated recombinant influenza virus comprises heterologous influenza virus NA and / or HA gene segments.
[0118] In one embodiment, A / IVR-116 can be used as a genetic backbone for generating influenza virus vaccines, particularly H3N2 viruses, more particularly the A / Hong Kong / 4801 / 14 virus comprising gene segments encoding amino acid substitutions at positions specified herein.
[0119] The present disclosure provides the influenza virus vectors as described herein, such as those influenza virus vectors that can be used to prepare reassortant viruses (including 6:1:1 reassortants, 6:2 reassortants, and 7:1 reassortants). The 6:1:1 reassortant as described in the present invention is an influenza virus having 6 internal gene segments, 1 NA gene segment from a different second virus isolate, and 1 HA gene segment from a third isolate; the 6:2 reassortant is an influenza virus having 6 internal gene segments and 1 NA gene segment and 1 HA gene segment from a different (second) virus isolate; the 7:1 reassortant is an influenza virus having 6 internal gene segments from a vaccine virus and 1 NA gene segment and 1 HA gene segment from a virus source different from the vaccine virus, or having 6 internal gene segments and 1 HA gene segment and 1 NA gene segment from a virus source different from the vaccine virus. As an alternative, the present disclosure also encompasses 5:1:2 reassortants.
[0120] 6:2 reassortants include, for example, A / IVR-116: A / Hong Kong / 4801 / 2014 with a functional NS1 deletion or B / Thuringia / 02 / 06:B / Murmansk / 3 / 2010 with a functional NS1 deletion.
[0121] According to one specific embodiment, the influenza virus may be of human or avian origin.
[0122] Viruses that can provide internal genes for the reassortants include viruses with high titers in MDCK cells, such as a titer of at least about 10 5 PFU / mL; viruses with high titers in embryonated eggs, such as a titer of at least about 10 7 EID 50 / mL; viruses with high titers in VERO cells, such as a titer of at least about 10 7 PFU / mL.
[0123] In one embodiment, the virus of the present invention may have a titer in cells such as MDCK cells or Vero cells that is 1 log, 2 logs, 3 logs or greater than the titer of the corresponding virus without a specific residue at the selected position.
[0124] Corresponding measurements can be made using the FFA assay, the TCID50 assay, and the plaque assay.
[0125] In one embodiment, there is also provided a vaccine comprising an immunogenicity-inducing effective amount of the recombinant virus described herein mixed with a pharmaceutically acceptable carrier. BRIEF DESCRIPTION OF THE DRAWINGS
[0126] Figure 1 : Average of 3 growth curves: 6:2 B / Thuringia / 02 / 06:B / Murmansk / 3 / 10 ΔFlu point mutant at 72 hpi;
[0127] Figure 2 : Average of 4 growth curves: 6:2 B / Thuringia / 02 / 06:B / Phuket / 3073 / 13 ΔFlu point mutant at 72 hpi;
[0128] Figure 3 : Average of 3 growth curves: 6:2 A / IVR-116:A / Hong Kong / 4801 / 14 ΔFlu point mutant at 48 hpi;
[0129] Figure 4 : Influenza sequence. DETAILED DESCRIPTION
[0130] As used herein, the position numbering of modified amino acids refers to the numbering of the amino acid sequences of PB1, PB2, M1, and NS2 provided herein having SEQ ID No. 2, 6, 10, 14, 26, 30, 32, 34, 37, and 38.
[0131] As used herein, the position numbering of modified nucleotides refers to the numbering of the amino acid sequences of PB1, PB2, M1, and NS2 provided herein having SEQ ID No. 1, 5, 9, 13, 25, 29, 31, 33, 35, and 36.
[0132] The terms "nucleic acid", "polynucleotide", "polynucleotide sequence", and "nucleic acid sequence" refer to single-stranded or double-stranded deoxyribonucleotide or ribonucleotide polymers, or chimeras or analogs thereof. As used herein, the terms optionally include polymers of analogs of natural nucleotides, which have the basic properties of natural nucleotides and hybridize to single-stranded nucleic acids in a manner similar to natural nucleotides (e.g., peptide nucleic acids). Unless otherwise indicated, the specific nucleic acid sequences of the present invention also cover complementary sequences in addition to the explicitly indicated sequences.
[0133] As used herein, the term "gene" is used in a broad sense to refer to any nucleic acid related to a biological function. Thus, a gene includes the coding sequence and / or regulatory sequences required for its expression. The term "gene" applies to a specific genomic sequence as well as the cDNA or mRNA encoded by that genomic sequence. A gene also includes, for example, non-expressed nucleic acid fragments that form recognition sequences for other proteins. Non-expressed regulatory sequences include "promoters" and "enhancers" to which regulatory proteins (e.g., transcription factors) bind, resulting in the transcription of adjacent or nearby sequences.
[0134] The term "vector" refers to a means by which nucleic acids can be propagated and / or transferred between organisms, cells, or cell components. Vectors include plasmids, viruses, bacteriophages, proviruses, phagemids, transposons, and artificial chromosomes, etc., which can replicate autonomously or can integrate into the host cell chromosome. A vector can also be a naked RNA polynucleotide, a naked DNA polynucleotide, a polynucleotide composed of both DNA and RNA in the same strand, a polylysine-conjugated DNA or RNA, a peptide-conjugated DNA or RNA, a liposome-conjugated DNA, etc. Most commonly, the vectors of the present invention are plasmids or linear expression constructs as described in WO 20100063804A1.
[0135] An "expression vector" is a vector capable of promoting the expression and replication of nucleic acids incorporated therein, such as a plasmid. Typically, the nucleic acid to be expressed is "operably linked" to a promoter and / or enhancer and is transcriptionally regulated by the promoter and / or enhancer. The term vector also covers bidirectional vectors.
[0136] A typical characteristic of a "bidirectional expression vector" is that two alternative promoters are in opposite directions relative to the nucleic acid located between the two promoters, so that expression can be initiated in two directions, resulting in transcription of, for example, both the positive (+) or sense strand and the negative (-) or antisense strand RNA. Alternatively, a bidirectional expression vector can be a bivalent vector, in which viral mRNA and viral genomic RNA (as cRNA) are expressed from the same strand.
[0137] As used herein, the term "isolated" refers to the in vitro preparation and / or isolation of a nucleic acid molecule (e.g., a vector or plasmid), a peptide or polypeptide (protein), or a virus of the invention, such that it is not associated with in vivo substances or is substantially purified from in vitro substances. Isolated virus preparations are typically obtained by in vitro culture and propagation and / or by passage in eggs and are substantially free of other infectious agents.
[0138] As used herein, "substantially purified" means that the target substance is the major substance, e.g., on a molar basis, it is more abundant than any other individual substance in the composition, preferably comprising at least about 80%, optionally 90% or more, e.g., 95%, 98%, 99% or more of the substances present in the composition.
[0139] As used herein, "substantially free of" means below the level of detection by standard detection methods for specific infectious agents.
[0140] A "recombinant" virus is a virus that has been manipulated in vitro (e.g., using recombinant DNA technology) to introduce changes in the viral genome. Reassortant viruses can be prepared by recombinant or non-recombinant techniques.
[0141] As used herein, the term "recombinant nucleic acid" or "recombinant DNA / RNA sequence or fragment" refers to a nucleic acid, e.g., DNA or RNA, derived or isolated from one source, which can then be chemically altered in vitro such that its sequence is not naturally occurring or corresponds to a naturally occurring sequence but its location is different from its location in the native genome. Examples of DNA "derived" from one source are DNA sequences that are identified as useful fragments and then chemically synthesized in substantially pure form. Examples of such DNA "isolated" from one source are DNA sequences that are excised or removed from said source by chemical means (e.g., by using restriction endonucleases) so that they can be further manipulated (e.g., amplified) by genetic engineering methods for useful DNA sequences of the invention.
[0142] As used herein, the influenza virus source of a "heterologous" influenza virus gene or gene fragment is different from most of the other influenza virus genes or gene fragments in a recombinant (e.g., reassortant) influenza virus.
[0143] The terms "isolated polypeptide", "isolated peptide", or "isolated protein" include polypeptides, peptides, or proteins encoded by cDNA or recombinant RNA (including cDNA or recombinant RNA of synthetic origin) or some combination thereof.
[0144] As used herein, the terms "recombinant protein" or "recombinant polypeptide" refer to protein molecules expressed from recombinant DNA molecules. In contrast, the term "native protein" is used herein to denote a protein isolated from a native (i.e., non-recombinant) source. Recombinant proteins can be produced using molecular biological techniques to have the same properties as native proteins.
[0145] "Amino acid modification" refers to the exchange (substitution) of amino acids that are the same in polarity and / or charge but can also be different in polarity and / or charge. In this regard, amino acids refer to the twenty natural amino acids encoded by sixty-four triplet codons. These 20 amino acids can be classified into amino acids with neutral charge, positive charge, and negative charge:
[0146] Shown below are the " Neutral " amino acids and their corresponding three-letter and one-letter codes and polarities:
[0147] Alanine: (Ala, A) Non-polar, neutral;
[0148] Asparagine: (Asn, N) Polar, neutral;
[0149] Cysteine: (Cys, C) Non-polar, neutral;
[0150] Glutamine: (Gln, Q) Polar, neutral;
[0151] Glycine: (Gly, G) Non-polar, neutral;
[0152] Isoleucine: (Ile, I) Non-polar, neutral;
[0153] Leucine: (Leu, L) Non-polar, neutral;
[0154] Methionine: (Met, M) Non-polar, neutral;
[0155] Phenylalanine: (Phe, F) Non-polar, neutral;
[0156] Proline: (Pro, P) Non-polar, neutral;
[0157] Serine: (Ser, S) Polar, neutral;
[0158] Threonine: (Thr, T) Polar, neutral;
[0159] Tryptophan: (Trp, W) Non-polar, neutral;
[0160] Tyrosine: (Tyr, Y) Polar, neutral;
[0161] Valine: (Val, V) Non-polar, neutral; and
[0162] Histidine: (His, H) Polar, positively charged (10%) neutral (90%).
[0163] With “ Positive ” Amino acids with this charge are:
[0164] Arginine: (Arg, R) Polar, positively charged; and
[0165] Lysine: (Lys, K) Polar, positively charged.
[0166] With “ Negative ” Amino acids with this charge are:
[0167] Aspartic acid: (Asp, D) Polar, negatively charged; and
[0168] Glutamic acid: (Glu, E) Polar, negatively charged.
[0169] Within the scope of the present invention, the terms “cell” or “cell culture” mean culturing individual cells, tissues, organs, insect cells, avian cells, mammalian cells, hybridoma cells, primary cells, continuous cell lines, and / or genetically engineered cells, such as recombinant cells expressing the recombinant influenza virus or influenza virus vector described herein (optionally expressing a heterologous target gene). They can be, for example, BSC-1 cells, LLC-MK cells, CV-1 cells, CHO cells, COS cells, murine cells, human cells, HeLa cells, 293 cells, VERO cells, MDBK cells, MDCK cells, MDOK cells, CRFK cells, RAF cells, TCMK cells, LLC-PK cells, PK15 cells, Wl-38 cells, MRC-5 cells, T-FLY cells, BHK cells, SP2 / 0 cells, NS0, PerC6 (human retinal cells), chicken embryo cells or their derivatives, embryonated eggs, chicken embryos or their derivatives.
[0170] Many mammalian cell lines are known in the art and include Vero cells (adherent-dependent cells or suspension-growing cells), PER.C6, HEK cells, human embryonic kidney cells (293 cells), HeLa cells, CHO cells, avian cells (continuous or primary), and Vero cells are the preferred cells for the methods of the present invention.
[0171] The cells can be cultured in any system suitable for the propagation of influenza virus in the cells. Specifically, the culture medium can be supplemented with antibiotics such as amphotericin B.
[0172] The recombinant influenza viruses described herein can be used as master donor virus (MDV). Thus, the MDV contains one or more of the M1, PB1, PB2, and NS2 proteins modified herein and other segments from common MDVs described herein (such as B / Thuringia, A / IVR-116, Jiangsu, or viruses from the Yamagata lineage) as well as PA and NP. Typically, a single MDV strain is selected for each of the influenza A and B subtypes. In the case of live attenuated vaccines, the MDV strain is typically selected based on its favorable properties related to vaccine production (e.g., temperature sensitivity, cold adaptation, and / or attenuation). For example, the selected master donor influenza A virus (MDV-A) or master donor influenza B virus (MDV-B) is generated from multiple cloned viral cDNAs that make up the viral genome. In an exemplary embodiment, the recombinant virus is generated from eight cloned viral cDNAs. The eight viral cDNAs representing the selected MDV-A or MDV-B sequences of PB2, PB1, PA, NP, HA, NA, M, and NS are cloned into a bidirectional expression vector (such as a plasmid or linear expression construct) such that viral genomic RNA can be transcribed from an RNA polymerase I (pol I) promoter on one strand and viral mRNA can be synthesized from an RNA polymerase II (pol II) promoter on the other strand. Optionally, any gene segment can be modified, including the HA segment (e.g., to remove polybasic cleavage sites). Then, after transfection of the plasmid carrying the eight viral cDNAs into a suitable host cell (e.g., Vero cells or MDCK cells), the infectious recombinant MDV-A or MDV-B virus is recovered. Using the plasmids and methods described herein, the present invention can be used, for example, to produce 6:2 reassortant influenza vaccines by co-transfecting the selected virus (e.g., MDV-A, MDV-B) with 6 internal genes (PB1, PB2, PA, NP, M, and NS) containing the specific amino acid modifications described herein and HA and NA derived from different corresponding types (influenza A or B) of influenza virus. For example, as is routinely done in vaccine production, the HA segment is advantageously selected from pathogenic-related H1, H3, or B strains. Similarly, the HA segment can be selected from strains showing virulent strain relatedness, such as H2 strains (e.g., H2N2) or H5 strains (e.g., H5N1) or H7 strains (e.g., H7N7). Reassortants incorporating seven genomic segments of the MDV and the HA or NA gene of the selected strain (7:1 reassortants) can also be produced.
[0173] Non-limiting examples of influenza B viruses include strains and clinical isolates such as, but not limited to, B / Thuringia, B / Colorado, B / Maryland, B / Iowa or B / Puerto Rico. The vaccines of the invention comprise the isolated recombinant influenza viruses of the invention, and optionally one or more other components such as other isolated viruses, including influenza viruses; one or more immunogenic proteins or glycoproteins of one or more isolated influenza viruses or one or more other pathogens (e.g., from bacteria, non-influenza viruses, yeast or fungi); or isolated nucleic acids encoding one or more viral proteins. In one embodiment, the influenza viruses of the invention can be vaccine vectors for influenza viruses or heterologous sequences such as, but not limited to, cytokines, chemokines, growth factors or pathogens.
[0174] The whole virus vaccines can be concentrated by ultrafiltration and then purified by zonal centrifugation or chromatography. Viruses other than the viruses of the invention, such as those included in multivalent vaccines, can be inactivated, for example, using formalin or beta-propiolactone, before or after purification.
[0175] Subunit vaccines comprise purified glycoproteins. Such vaccines can be prepared by purifying surface antigens from virus suspensions disrupted by treatment with detergents, for example, by ultracentrifugation. Thus, subunit vaccines mainly contain the HA protein and also the NA. The detergents used can be, for example, cationic detergents such as cetyltrimethylammonium bromide; anionic detergents such as ammonium deoxycholate; or non-ionic detergents such as TRITON X100. The hemagglutinin can also be isolated and then purified after treatment of the virus particles with a protease such as bromelain. Subunit vaccines can be combined with the influenza viruses of the invention in multivalent vaccines.
[0176] Split vaccines comprise virus particles that have been treated with a lipid-dissolving reagent, i.e., whole virus particles. Split vaccines can be prepared by treating an aqueous suspension of the purified virus (inactivated or non-inactivated) obtained as above with a lipid solvent associated with a detergent such as ether or chloroform, with stirring. Dissolution of the viral envelope lipids results in fragmentation of the virus particles. The aqueous phase containing the split vaccine is recovered and consists mainly of hemagglutinin and neuraminidase (whose original lipid environment has been removed) and the core or its degradation products. The remaining infectious particles are then inactivated, if not already inactivated. Split vaccines can be combined with the attenuated viruses of the invention in multivalent vaccines.
[0177] Inactivated influenza virus vaccines are provided by inactivating the replicated virus using known methods such as, but not limited to, formalin or beta-propiolactone treatment. Types of inactivated vaccines that can be used in the present invention can include whole virus vaccines or subviral particle (split) vaccines. Whole virus vaccines contain intact inactivated virus, while split vaccines contain purified virus that has been disrupted using a detergent that solubilizes the lipid-containing viral envelope and then chemically inactivated.
[0178] The influenza viruses described herein can also contain heterologous target genes or open reading frames, such as foreign genes encoding immunogenic peptides or proteins that can be used as vaccines or for gene replacement, e.g., epitopes that can be used for cancer therapy or vaccines or peptides or polypeptides that can be used for gene therapy. When preparing the influenza virus, a vector or plasmid containing the target gene or cDNA can replace the vector or plasmid used for the influenza virus genes or can be a supplement to the vector or plasmid used for all influenza virus genes.
[0179] Accordingly, another embodiment of the present invention includes a composition of the vectors described above or multiple vectors, wherein one of the vectors is replaced by or further contains the following: a 5' influenza virus sequence (optionally including a 5' influenza virus coding sequence or a portion thereof), which is linked to a desired nucleic acid sequence (e.g., a desired cDNA), which is linked to a 3' influenza virus sequence (optionally including a 3' influenza virus coding sequence or a portion thereof). In one embodiment, the desired nucleic acid sequence such as cDNA is in the antisense (antigenomic) orientation. Introducing such vectors into a host cell permissive for influenza virus replication together with the other vectors described above produces a recombinant virus containing vRNA corresponding to the heterologous sequence of the vector.
[0180] In addition, vaccines also include those that contain isolated HA and NA surface proteins, which are referred to as surface antigen or subunit vaccines. Attenuated live influenza virus vaccines, such as those containing the recombinant viruses of the present invention, can be used to prevent or treat influenza virus infections.
[0181] The influenza viruses of the present invention contain deletions or modifications (ΔNS1 viruses, delNS1 viruses) in the NS1 gene as described in WO 99 / 64571 and WO 99 / 64068. These viruses are replication defective because they undergo abortive replication in the animal respiratory tract. After intranasal administration, the vaccine virus is able to initiate an abortive infection in mucosal tissues without the effect of virus shedding. At the same time, the virus stimulates a local cytokine response and elicits a T cell-mediated protective immune response.
[0182] According to the present invention, the term "replication defective" is defined as having a replication rate in interferon-sensitive host cells that is at least 5% less, preferably 1% less, and more preferably 0.1% less than the replication rate of a wild-type influenza virus, where the replication rate is determined by hemagglutination assays, TCID50 assays, or plaque assays well known in the art.
[0183] The term "lacking a functional NS1 protein" refers to an influenza virus that is replication defective, i.e., having a replication rate in interferon-sensitive host cells that is at least 5% less, preferably 1% less, and more preferably 0.1% less than the replication rate of a wild-type influenza virus, where the replication rate is determined by hemagglutination assays, TCID50 assays, or plaque assays well known in the art.
[0184] In one embodiment, the NS1 protein comprises a deletion of at least 60%, preferably at least 70%, and more preferably at least 90% of the NS1 amino acids. Alternatively, the functionality of the NS1 protein can be completely abrogated. The NS1 protein can lack the functional RNA-binding domain and / or the carboxy-terminal domain of the influenza B NS1 protein or both domains, and thus become non-functional. This domain can be completely or partially deleted, and amino acids can be substituted or inserted, and the functionality of the remaining domain can be tested as described in the art (Dauber et al, J Virol. 2006, Dec; 80(23):11667-77).
[0185] In an alternative embodiment, the influenza virus vector comprises a truncated NS1 protein that contains up to 122 amino acids, preferably up to 121 amino acids, preferably up to 120 amino acids, preferably up to 119 amino acids, preferably up to 118 amino acids, preferably up to 117 amino acids, preferably up to 116 amino acids, preferably up to 115 amino acids, preferably up to 114 amino acids, preferably up to 113 amino acids, preferably up to 112 amino acids, preferably up to 111 amino acids, preferably up to 110 amino acids, preferably up to 109 amino acids, preferably up to 108 amino acids, preferably up to 107 amino acids, preferably up to 106 amino acids, preferably up to 105 amino acids, preferably up to 104 amino acids, preferably up to 103 amino acids, preferably up to 102 amino acids, preferably up to 101 amino acids, preferably up to 100 amino acids, preferably up to 99 amino acids, preferably up to 98 amino acids, preferably up to 97 amino acids, preferably up to 96 amino acids, preferably up to 95 amino acids, preferably up to 94 amino acids, preferably up to 93 amino acids, preferably up to 92 amino acids, preferably up to 91 amino acids, preferably up to 90 amino acids, preferably up to 89 amino acids, preferably up to 88 amino acids, preferably up to 87 amino acids, preferably up to 86 amino acids, preferably up to 85 amino acids, preferably up to 84 amino acids, preferably up to 83 amino acids, preferably up to 82 amino acids, preferably up to 81 amino acids, preferably up to 80 amino acids, preferably up to 79 amino acids, preferably up to 78 amino acids, preferably up to 77 amino acids, preferably up to 76 amino acids, preferably up to 75 amino acids, preferably up to 74 amino acids, preferably up to 73 amino acids of the N-terminus of the NS1 protein.
[0186] In a specific embodiment, the influenza virus comprises an NS gene that encodes a truncated NS1 protein that contains up to 123 amino acids, particularly up to 117 amino acids, of the N-terminus of the corresponding wild-type NS1 protein, thereby replicating efficiently in IFN-sensitive tumor cells while showing reduced and defective replication in normal non-tumor cells. More specifically, the virus contains 106 amino acids of the N-terminus of the corresponding wild-type NS1 protein.
[0187] It has been demonstrated that the deletion of the NS1 protein or the functional knockout of said protein results in significant attenuation of influenza virus due to lack of replication (replication-deficient phenotype) in interferon-responsive cells or organisms. Viruses lacking the NS1 protein are unable to antagonize cytokine production in infected cells and thus induce self-adjuvanting and immunomodulatory effects. The hallmark of the immune response after immunization with DelNS1 virus is the triggering of a Th1-type immune response associated with the major IgG2A antibody isotype response (Ferko B. et al. J. Virol., 80(23), 2006, pp. 11621-11627).
[0188] Since resistance to influenza virus is mainly mediated by the production of an immune response against the HA and / or NA glycoproteins, the genes encoding these surface antigens are derived from reassortant viruses or clinical isolates. The attenuation gene is derived from an attenuated parent. In this method, the attenuation gene usually does not encode the HA and NA glycoproteins.
[0189] Viruses (donor influenza viruses) capable of reproducibly attenuating influenza virus are available. For example, cold-adapted (ca) donor viruses can be used for the production of attenuated vaccines. Attenuated reassortant live virus vaccines can be produced by mating the ca donor virus with a virulent replicating virus. The reassortant progeny are then selected at 25 °C (to restrict the replication of the virulent virus) in the presence of a suitable antiserum that inhibits the replication of viruses bearing the surface antigens of the attenuated ca donor virus. The useful reassortants are infectious, attenuated for seronegative non-adult mammals and immunologically naïve adult mammals, immunogenic and genetically stable.
[0190] Other attenuation mutations can be introduced into influenza virus genes by site-directed mutagenesis to rescue infectious viruses bearing these mutant genes. The attenuation mutations can be introduced into non-coding regions of the genome as well as into coding regions. Such attenuation mutations can also be introduced into genes other than HA or NA (e.g., the PB2 polymerase gene). Thus, new donor viruses bearing attenuation mutations introduced by site-directed mutagenesis can also be generated, and such new donor viruses can be used to produce attenuated reassortant live vaccine candidates in a manner similar to the above-described ca donor virus. Similarly, other known and suitable attenuated donor strains can be reassorted with influenza virus to obtain attenuated vaccines suitable for mammalian vaccination.
[0191] In one embodiment, such attenuated viruses retain genes encoding antigenic determinants that are substantially similar to the antigenic determinants of the original clinical isolate of the virus. The purpose of the attenuated vaccine is to provide substantially the same antigenicity as the original clinical isolate of the virus while lacking pathogenicity, with little chance of the vaccine causing severe disease in the vaccinated mammals.
[0192] Thus, the viruses in the multivalent vaccine can be attenuated or inactivated, formulated and administered according to known methods as a vaccine for inducing an immune response in animals (e.g., mammals). Methods for determining whether such attenuated or inactivated vaccines retain antigenicity similar to that of clinical isolates or their derived high-growth strains are well known in the art. Such known methods include using antiserum or antibodies to eliminate viruses expressing donor virus antigenic determinants; chemical selection (e.g., amantadine or rimantidine); HA and NA activity and inhibition; and nucleic acid screening (such as probe hybridization or PCR) to confirm the absence of donor genes encoding antigenic determinants (e.g., HA or NA genes) in the attenuated virus.
[0193] The pharmaceutical compositions of the present invention suitable for inoculation (e.g., nasal, mucosal, parenteral or oral administration) comprise one or more influenza virus isolates (e.g., one or more attenuated or inactivated influenza viruses), subunits thereof, one or more isolated proteins thereof and / or isolated nucleic acids encoding one or more of its proteins, optionally further comprising sterile aqueous or non-aqueous solutions, suspensions and emulsions. The compositions may further comprise adjuvants or excipients known in the art. The compositions of the present invention are generally in the form of single doses (unit doses).
[0194] Conventional vaccines typically contain about 0.1 to 200 μg, e.g., 30 to 100 μg of HA of each strain incorporated into their composition. The vaccines that form the main component of the vaccine compositions of the present invention may comprise a single influenza virus or a combination of influenza viruses, e.g., at least two or three influenza viruses, including one or more reassortants.
[0195] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions and / or emulsions, which may contain adjuvants or excipients known in the art.
[0196] When the compositions of the present invention are used for administration to an individual, it may further comprise salts, buffers, adjuvants or other substances required to enhance the efficacy of the composition.
[0197] The compositions may also contain variable but small amounts of endotoxin-free formaldehyde and preservatives, which have been found to be safe and do not cause adverse effects on the organisms to which the compositions are administered.
[0198] The administration of the compositions can be for "prophylactic" or "therapeutic" purposes.
[0199] Specifically, the term "treatment" is intended to cover therapeutic measures administered to cure a disease or alleviate the symptoms of a disease.
[0200] Specifically, the term "prevention" is intended to cover preventive measures aimed at reducing the risk of disease occurrence or the risk of disease recurrence.
[0201] When provided prophylactically, the inventive composition, as a vaccine, is provided before any symptoms or clinical signs of pathogen infection become apparent. Prophylactic administration of the composition is used to prevent or attenuate any subsequent infection. When provided prophylactically, the inventive composition is provided before any symptoms or clinical signs of the disease become apparent. Prophylactic administration of the composition is used to prevent or attenuate one or more symptoms or clinical signs associated with the disease.
[0202] When provided therapeutically, a viral vaccine is provided upon detection of symptoms or clinical signs of an actual infection.
[0203] Thus, the vaccine composition of the present invention can be provided before the onset of infection (so as to prevent or attenuate an anticipated infection) or after the onset of an actual infection.
[0204] A "pharmacologically acceptable" composition is one that can be tolerated by the recipient mammal. Such a composition is administered in a "therapeutically effective amount" if the amount administered is physiologically significant. The inventive composition is physiologically significant if its presence results in a detectable change in the physiological functions of the recipient subject, such as an enhanced primary or secondary humoral or cellular immune response against at least one infectious influenza virus strain.
[0205] The "protection" provided need not be absolute, i.e., it need not completely prevent or eradicate influenza infection, as long as there is a statistically significant improvement as compared to a control population or group of mammals, particularly humans. The protection can be limited to reducing the severity or rate of onset of the symptoms or clinical signs of influenza virus infection.
[0206] The inventive composition can confer resistance to one or more pathogens (e.g., one or more influenza virus strains) by passive or active immunization. In active immunization, a live attenuated vaccine composition is prophylactically administered to a subject (e.g., a mammal), and the immune response of the subject to the administered immunization provides protection against infection and / or disease. For passive immunization, antiserum can be harvested and administered to a recipient suspected of having an infection caused by at least one influenza virus strain.
[0207] As referred to herein, a vaccine is said to prevent or attenuate a disease if administration of the vaccine results in the complete or partial attenuation (i.e., inhibition) of the clinical signs or manifestations of the disease or results in the individual having complete or partial immunity to the disease.
[0208] A composition having at least one influenza virus of the present invention (including an attenuated influenza virus and one or more other isolated viruses, one or more isolated viral proteins thereof, one or more isolated nucleic acid molecules encoding one or more viral proteins thereof, or a combination thereof) can be administered by any means that achieves the intended purpose.
[0209] For example, administration of such a composition can be carried out by various parenteral routes such as subcutaneous, intravenous, intradermal, intramuscular, intraperitoneal, intranasal, oral, or transdermal routes. Parenteral administration can be accomplished by bolus injection or gradual infusion over time.
[0210] Typical regimens for preventing, suppressing, or treating influenza virus-related pathologies include administering an effective amount of the vaccine composition described herein, administered as a single treatment, or repeated as a booster or reinforcing dose over a period of time up to and including between one week and about 24 months or any range or value therein.
[0211] According to the present invention, an "effective amount" of a composition is an amount sufficient to achieve the desired effect. It should be understood that the effective dose can depend on the species, age, sex, health, and weight of the recipient, as well as the type of treatment (if any), the frequency of treatment, and the nature of the desired effect. The ranges of effective doses provided below are not intended to limit the present invention and represent dose ranges.
[0212] For animals, such as adult mammalian organisms, the dose of an attenuated live virus vaccine or an inactivated virus vaccine can be about 10 2 -10 15 , for example 10 3 -10 12 plaque-forming units (PFU) / kg, or any range or value therein. The dose range of an inactivated vaccine can be about 0.1 to 1000, for example 30 to 100 μg of HA protein. However, the dose should be a safe and effective amount determined by conventional methods starting from existing vaccines.
[0213] The dose of immunoreactive HA in each dose of a replicating virus vaccine can be standardized to contain a suitable amount, such as 30 to 100 μg or any range or value therein, or an amount recommended by a government agency or a recognized professional organization. The dose of NA can also be standardized; however, this glycoprotein may be unstable during purification and storage.
[0214] The dose of immunoreactive HA in each dose of the replicating virus vaccine can be standardized to contain a suitable amount, such as 1-50 μg or any range or value therein, or the dosage recommended by the U.S. Public Health Service (PHS), which is typically 15 μg / component for older children >3 years old and 7.5 μg / component for older children <3 years old. Each 0.5-ml dose of the vaccine can contain approximately 10-50 billion virus particles, preferably 10 billion virus particles.
[0215] The influenza virus can be selected from the group consisting of: human influenza virus, avian influenza virus, equine influenza virus, swine influenza virus, feline influenza virus. The influenza virus is from influenza A and B strains. The influenza antigen can be derived from interpandemic (annual or seasonal) influenza strains. Alternatively, the influenza antigen can be derived from a strain with the potential to cause a pandemic outbreak; that is, an influenza strain with a new hemagglutinin compared to the hemagglutinin in currently circulating strains or an influenza strain that is pathogenic in avian subjects and has the potential for horizontal transmission in the human population or an influenza strain that is pathogenic to humans.
[0216] Specifically, influenza A viruses can be divided into two phylogenetic groups (Group 1 and Group 2; Joyce MG.et al.,Cell 166,609-623,2016), each group containing different subtypes. Currently, Group 1 influenza viruses from the H1 subtype (1918 and 2009 H1N1 pandemics) and Group 2 H3 subtype (1968 H3N2 pandemic) co-circulate and cause seasonal infections in more than 10% of the population each year. Other subtypes include Group 1 H2 subtype (endemic in humans from 1957-1968), Group 1 H5 subtype (including lethal avian strains), and Group 1 H6 and H9, and Group 2 H7 and H10 subtypes. Potential approaches to a universal influenza vaccine involve inducing neutralizing antibodies that recognize influenza hemagglutinin (HA) from multiple subtypes.
[0217] Gene segments of PB1, PB2, M, and / or NS having residues at specified positions can be combined with gene segments of HA (e.g., H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16, or H17) and gene segments of NA (e.g., N1, N2, N3, N4, N5, N6, N7, N8, N9, or N10), and any combination of HA and NA, to provide the reassortant vaccine viruses of the invention. Non-limiting examples of influenza A viruses include subtypes H10N4, H10N5, H10N7, H10N8, H10N9, H11N1, H11N13, H11N2, H11N4, H11N6, H11N8, H11N9, H12N1, H12N4, H12N5, H12N8, H13N2, H13N3, H13N6, H13N7, H14N5, H14N6, H15N8, H15N9, H16N3, H1N1, H1N2, H1N3, H1N6, H1N9, H2N1, H2N2, H2N3, H2N5, H2N7, H2N8, H2N9, H3N1, H3N2, H3N3, H3N4, H3N5, H3N6, H3N8, H3N9, H4N1, H4N2, H4N3, H4N4, H4N5, H4N6, H4N8, H4N9, H5N1, H5N2, H5N3, H5N4, H5N6, H5N7, H5N8, H5N9, H6N1, H6N2, H6N3, H6N4, H6N5, H6N6, H6N7, H6N8, H6N9, H7N1, H7N2, H7N3, H7N4, H7N5, H7N7, H7N8, H7N9, H8N4, H8N5, H9N1, H9N2, H9N3, H9N5, H9N6, H9N7, H9N8, and H9N9.
[0218] The invention further includes the following items:
[0219] 1. A recombinant influenza B virus comprising M, PB, and NS gene segments containing one or more nucleotide modifications, said gene segments producing
[0220] - an M1 protein having amino acid substitutions at positions 89 and / or 93 according to the numbering of SEQ ID No. 6, and / or
[0221] - an NS2 protein having amino acid substitutions at positions 75, 76, and / or 117 according to the numbering of SEQ ID No. 10, and / or
[0222] - a PB2 protein having an amino acid substitution at position 427 according to the numbering of SEQ ID No. 2, and / or
[0223] - A PB1 protein having an amino acid substitution at position 67 according to the numbering of SEQ ID No. 14, or
[0224] - Any combination thereof.
[0225] 2. The recombinant influenza B virus according to item 1, which comprises M and NS gene segments containing nucleotide modifications, and said gene segments encode
[0226] - An M1 protein having an amino acid substitution at position 89 according to the numbering of SEQ ID No. 6,
[0227] - An NS2 protein having an amino acid substitution at position 76 according to the numbering of SEQ ID No. 10.
[0228] 3. The recombinant influenza B virus according to item 1, which further comprises a PB2 gene encoding a PB2 protein having an amino acid substitution at position 427 according to the numbering of SEQ ID No. 2.
[0229] 4. The recombinant influenza B virus according to item 2 or 3, which further comprises an NS gene encoding an NS2 protein having an amino acid substitution at position 75 according to the numbering of SEQ ID No. 10.
[0230] 5. The recombinant influenza B virus according to any one of items 2 to 4, which comprises
[0231] - An M1 protein having an amino acid substitution at position 89 according to the numbering of SEQ ID No. 6, particularly serine at the 89th amino acid position;
[0232] - A PB2 protein having an amino acid substitution at position 427 according to the numbering of SEQ ID No. 2, particularly serine at the 427th amino acid position; and
[0233] - An NS2 protein having an amino acid substitution at positions 75 and / or 76 according to the numbering of SEQ ID No. 10, particularly glycine at the 76th amino acid position and / or arginine at the 75th amino acid position.
[0234] 6. The recombinant influenza B virus according to any one of items 2 to 5, which comprises amino acid sequences SEQ ID No. 4, SEQ ID No. 8 and SEQ ID No. 12.
[0235] 7. The recombinant influenza B virus according to any one of items 2 to 6, which comprises nucleotide sequences SEQ ID No. 3, SEQ ID No. 7 and SEQ ID No. 11.
[0236] 8. A recombinant influenza B virus, which comprises PB1, M and NS genes containing at least two nucleotide modifications, and the said genes encode
[0237] - a PB1 protein having an amino acid substitution at position 67 according to the numbering of SEQ ID No. 14,
[0238] - an M1 protein having an amino acid substitution at position 93 according to the numbering of SEQ ID No. 6, and / or
[0239] - an NS2 protein having an amino acid substitution at position 117 according to the numbering of SEQ ID No. 10.
[0240] 9. The recombinant influenza B virus according to item 7, which comprises a modified protein, and the said modified protein is selected from the group consisting of:
[0241] - a PB1 protein having asparagine at the 67th amino acid position,
[0242] - an M1 protein having arginine at the 93rd amino acid position, and / or
[0243] - an NS2 protein having histidine at the 117th amino acid position.
[0244] 10. The recombinant influenza B virus according to item 7 or 8, which comprises
[0245] - a PB1 protein having an amino acid substitution at position 67 according to the numbering of SEQ ID No. 14,
[0246] - an M1 protein having an amino acid substitution at position 93 according to the numbering of SEQ ID No. 6, and
[0247] - an NS2 protein having an amino acid substitution at position 117 according to the numbering of SEQ ID No. 10.
[0248] 11. The recombinant influenza B virus according to items 7 to 9, which comprises at least two amino acid sequences among amino acid sequences SEQ ID No. 16, SEQ ID No. 20 and SEQ ID No. 24.
[0249] 12. The recombinant influenza B virus according to any one of items 8 to 10, which comprises at least two nucleotide sequences among SEQ ID No. 15, SEQ ID No. 19 and SEQ ID No. 23.
[0250] 13. A recombinant influenza A virus, which comprises PB1 and PB2 genes containing at least two nucleotide modifications, and the said genes encode
[0251] - A PB1 protein having amino acid substitutions at positions 97 and 678 according to the numbering of SEQ ID No. 30, and / or
[0252] - A PB2 protein having an amino acid substitution at position 80 according to the numbering of SEQ ID No. 26.
[0253] 14. The recombinant influenza A virus according to item 12, which comprises
[0254] - A PB1 protein having glycine at the 97th amino acid position and asparagine at the 678th amino acid position, and / or
[0255] - A PB2 protein having arginine at the 80th amino acid position.
[0256] 15. The recombinant influenza A virus according to item 12 or 13, which comprises at least one nucleotide sequence shown in any one of SEQ ID No. 27 and 31.
[0257] 16. The recombinant influenza A virus according to item 12 or 13, which comprises at least one amino acid sequence in SEQ ID No. 28 and 32.
[0258] 17. The recombinant influenza virus according to any one of items 1 to 15, wherein the virus is a reassortant virus, particularly wherein the virus comprises at least two gene segments from seasonal or pandemic strains.
[0259] 18. The recombinant influenza virus according to any one of items 1 to 16, wherein the virus is attenuated or replication-defective, preferably the virus is completely replication-defective.
[0260] 19. The recombinant influenza virus according to any one of items 1 to 17, wherein the virus comprises one or more modifications in the HA and / or NA genes.
[0261] 20. The recombinant influenza virus according to any one of items 1 to 18, which further comprises a modified NS1 gene segment encoding an NS1 protein lacking a functional RNA-binding domain and a functional carboxyl-terminal domain.
[0262] 21. A vaccine composition comprising an immunogenicity-inducing effective amount of the influenza virus according to any one of items 1 to 19 mixed with a pharmaceutically acceptable carrier.
[0263] 22. An isolated nucleic acid encoding the recombinant influenza virus according to any one of items 1 to 19.
[0264] 23. The influenza virus according to any one of Items 1 to 19, which is used for preparing a medicament.
[0265] 24. The influenza virus according to any one of Items 1 to 19, which is used for the therapeutic or prophylactic treatment of influenza virus infection.
[0266] 25. A plurality of influenza virus vectors for preparing the reassortant influenza B virus according to any one of Items 1 to 6, which comprises
[0267] a) a vector for vRNA production comprising a promoter operably linked to influenza virus PA DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus PB1 DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus PB2 DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus HA DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus NP DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus NA DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus M DNA linked to a transcription termination sequence, and a vector for vRNA production comprising a promoter operably linked to influenza virus NS cDNA or a part thereof linked to a transcription termination sequence, wherein the PB1, PB2, PA, NP, NS and M DNA in the vector for vRNA production encode at least one of the following: M1 having serine at position 89, NS2 having glycine at position 76, NS2 having arginine at position 75, PB2 having serine at position 427, and optionally
[0268] b) Vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PA, a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB1, a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB2, and a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NP, and optionally a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus HA, a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NA, a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M1, a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M2, or a vector for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NS2.
[0269] 26. A plurality of influenza virus vectors for preparing a reassortant influenza B virus according to any one of items 7 to 11, comprising
[0270] a) A vector for vRNA production comprising a promoter operably linked to influenza virus PA DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus PB1 DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus PB2 DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus HA DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus NP DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus NA DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus M DNA linked to a transcription termination sequence, and a vector for vRNA production comprising a promoter operably linked to influenza virus NS cDNA or a portion thereof linked to a transcription termination sequence, wherein the PB1, PB2, PA, NP, NS, and M DNA in the vector for vRNA production encode at least one of the following: M1 having arginine at position 93, NS2 having histidine at position 117, PB1 having asparagine at position 67,
[0271] b) Vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB1, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB2, and vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NP, and optionally vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus HA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M1, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M2, or vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NS2.
[0272] 27. Multiple influenza virus vectors for preparing a reassortant influenza A virus according to any one of items 12 to 13, comprising
[0273] a) Vectors for vRNA production comprising a promoter operably linked to influenza virus PA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus PB1 DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus PB2 DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus HA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus NP DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus NA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus M DNA linked to a transcription termination sequence, and vectors for vRNA production comprising a promoter operably linked to influenza virus NS cDNA or a portion thereof linked to a transcription termination sequence, wherein the PB1, PB2, PA, NP, NS, and M DNA in the vectors for vRNA production encode at least one of the following: PB1 having glycine at position 97, PB1 having asparagine at position 678, PB2 having arginine at position 80,
[0274] b) Vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB1, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB2, and vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NP, and optionally vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus HA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M1, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M2, or vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NS2.
[0275] 28. A method for preparing an influenza B virus according to any one of items 1 to 6, which is carried out by contacting cells with:
[0276] a) Vectors for vRNA production comprising a promoter operably linked to influenza virus PA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus PB1 DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus PB2 DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus HA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus NP DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus NA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus M DNA linked to a transcription termination sequence, and vectors for vRNA production comprising a promoter operably linked to influenza virus NS cDNA or a portion thereof linked to a transcription termination sequence, wherein the PB1, PB2, PA, NP, NS, and M DNA in the vectors for vRNA production encode at least one of the following: M1 having serine at position 89, NS2 having glycine at position 76, NS2 having arginine at position 75, PB2 having serine at position 427, and optionally
[0277] b) Vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB1, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB2, and vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NP, and optionally vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus HA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M1, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M2, or vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NS2.
[0278] 29. A method for preparing an influenza B virus according to any one of items 7 to 11, which is carried out by contacting cells with:
[0279] a) Vectors for vRNA production comprising a promoter operably linked to influenza virus PA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus PB1 DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus PB2 DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus HA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus NP DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus NA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus M DNA linked to a transcription termination sequence, and vectors for vRNA production comprising a promoter operably linked to influenza virus NS cDNA or a portion thereof linked to a transcription termination sequence, wherein the PB1, PB2, PA, NP, NS, and M DNA in the vectors for vRNA production encode at least one of the following: M1 having arginine at position 93, NS2 having histidine at position 117, PB1 having asparagine at position 67,
[0280] b) Vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB1, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB2, and vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NP, and optionally vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus HA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M1, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M2, or vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NS2.
[0281] 30. A method for preparing an influenza A virus according to any one of items 12 to 13, which is carried out by contacting cells with the following:
[0282] a) Vectors for vRNA production comprising a promoter operably linked to influenza virus PA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus PB1 DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus PB2 DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus HA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus NP DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus NA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus M DNA linked to a transcription termination sequence, and vectors for vRNA production comprising a promoter operably linked to influenza virus NS cDNA linked to a transcription termination sequence, wherein the PB1, PB2, PA, NP, NS, and M DNA in the vectors for vRNA production encode at least one of the following: PB1 having glycine at position 97, PB1 having asparagine at position 678, PB2 having arginine at position 80,
[0283] b) Vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB1, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus PB2, and vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NP, and optionally vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus HA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NA, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M1, vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus M2, or vectors for mRNA production comprising a promoter operably linked to a DNA fragment encoding influenza virus NS2.
[0284] 31. A method for preparing a virus according to any one of items 1 to 19, wherein the method comprises introducing a recombinant vector according to any one of items 24 to 26 that expresses an influenza virus particle according to any one of items 1 to 19 into a reverse genetics system.
[0285] 31. A method for increasing the growth rate of an influenza virus, wherein the method comprises the following steps: introducing a modification into the influenza virus PB2, PB1, M, and / or NS genes to obtain a recombinant influenza virus according to any one of items 1 to 19.
[0286] 32. According to the method of any one of items 27 to 31, wherein the PB1, PB2, PA, NP, NS, and M DNAs in the vector for vRNA production have sequences corresponding to the sequences of polypeptides that have at least 98% amino acid sequence identity with the corresponding polypeptides encoded by SEQ ID No. 2, 4, 6, 8, 10, 12, 14, 16, 20, 24, 26, 28, 30, and 32.
[0287] 33. A virus obtained by the method according to any one of items 27 to 32.
[0288] 34. The recombinant influenza according to any one of items 1 to 19, which contains a group 1 HA gene.
[0289] 35. The recombinant influenza according to any one of items 1 to 19, which contains a group 2 HA gene.
[0290] 36. The recombinant influenza according to item 20, which is used for prime-boost immunization with different group 1 HA genes.
[0291] 37. The recombinant influenza according to item 21, which is used for prime-boost immunization with different group 2 HA genes.
[0292] 38. The recombinant influenza according to any one of items 1 to 19, which expresses a foreign antigen.
[0293] The examples described herein are provided to assist in understanding the present invention, but are not intended and should not be construed in any way as limiting the scope of the present invention. The examples do not include a detailed description of conventional methods, such as cloning, transfection, and the basic aspects of methods for expressing proteins in microbial host cells. Such methods are well known to those of ordinary skill in the art.
[0294] Examples
[0295] Example 1:
[0296] Objective:
[0297] Test the growth of the 6:2B / Thuringia / 02 / 06:B / Murmansk / 3 / 2010 delNS1 point mutant in a growth curve assay to identify the mutations that result in improved virus growth.
[0298] Method
[0299] Generate 6:2 recombinant viruses with specific amino acid changes
[0300] To generate amino acid changes in the internal genes, site-directed mutagenesis was performed on each plasmid containing the target gene by using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA) to introduce point mutations. 6:2 reassortant viruses were generated by reverse genetics. Six pHW2000 derivatives (plasmids) containing fragments PB2, PB1, PA, NP, M, ΔNS1 from B / Thuringia / 02 / 06 (a B / Jiangsu / 10 / 03-like virus from the B Yamagata lineage) and a protein expression plasmid encoding influenza A PR8 NS1 (pCAGGS-NS1(SAM)) were co-transfected with a pHW2000-derived plasmid containing the HA and NA genes from B / Murmansk / 3 / 2010 into Vero cells. The transfected cell supernatant was collected 3 - 8 days after transfection and used to infect Vero cells (CP1) in serum-free medium. The CP0 or CP1 stock solution was used to infect the growth curve.
[0301] Growth curve:
[0302] Vero cells were infected with Opti-Pro serum-free medium containing recombinant trypsin at an MOI of 0.005. The input virus was titrated, and the actual MOI was calculated retrospectively for each infection. Samples were collected at 24 h, 48 h, 72 h, and 96 h post-infection by removing 1 ml of medium and centrifuging at 2,000 x g for 10 minutes. Samples were stored at -80 °C and titrated at least once in the FFA assay. At least three and up to eight individual growth curve tests were performed on each sample. Each virus was tested at least three times in the growth curve.
[0303] Results
[0304] Plasmid constructs:
[0305] PB2: G427S
[0306] M: T89S
[0307] NS-A: K75R
[0308] NS-B: R76G
[0309] NS-A / NS-B: K75R and T76G
[0310] Virus rescue:
[0311] Rescue 6:2B / Thuringia / 02 / 06 / B / Murmansk / 3 / 2010 delNS with PB2, M, and / or NS mutations:
[0312] Table 1
[0313]
[0314] The rescued supernatant (P0) and the first cell passage (CP1) on Vero cells were titrated by FFA.
[0315] Table 2
[0316]
[0317]
[0318] CP0 = rescued supernatant
[0319] CP1 = the first cell passage after rescue
[0320] Control virus:
[0321] The control virus (NF38) is a 6:2 reassortant virus with 6 internal genes of the B / Thuringia / 02 / 06 prototype sequence and 2 surface genes from B / Murmansk / 03 / 010. The original transfection supernatant (P0) was used for all growth curve infections.
[0322] Table 3
[0323] Summary of mean titers:
[0324]
[0325] Summary:
[0326] Overall, all viruses except five viruses NF73, 67, 95, 40 and the original virus control had high standard deviations. All five of these viruses contained two common mutations: M T89S and NS R76G. For all three time points tested: 48, 72, and 96 hours post-infection, the standard deviations were low. Two of these viruses, NF95 and 40, consistently reached the highest titers. NF95 and 40 contained three common mutations: PB2 G427S, M T89S, and NS R76G. The NS mutation K75R did not appear to have any additional increase in titer. All viruses containing the K75R NS mutation only grew poorly and had high standard deviations.
[0327] For viruses with no or few mutations, there was high variability in the measured titers. To test this hypothesis, the P0 sample was included in the last three growth curves for comparison. The input titer was tested and infection was carried out at an MOI of 0.005. No measurable titer was obtained for this virus at any time point tested. This indicates that the B / Thuringia / 02 / 06 / B / Murmansk / 3 / 10ΔNS1 rescued from the original plasmid without any mutations grew extremely poorly, while the viruses NF73, 67, 95, 40 with low standard deviations as mentioned above seemed to be stable.
[0328] Since the titers of the B / MurmanskΔNS1 virus with the original plasmid were below the detection limit at all time points tested, we assumed the titer to be our detection limit of 3.5 log. Based on this assumption, two viruses (NF40 and 95) with 3 common mutations produced an approximately 4 log increase in titer. NF40: PB2 G427S, M T89S, and NS K75R and R76G produced a titer increase of 4.14 log + / - 0.11 at 72 hours post-infection, and NF 95 (PB2 G427S, M T89S, and R76G) had a titer increase of 4.11 log + / - 0.16 at 72 hours post-infection.
[0329] Example 2:
[0330] Objective:
[0331] Test the 6:2B / Thuringia / 02 / 06:B / Phuket / 3073 / 2013 delNS point mutant in growth curve determination to identify the mutations that lead to improved virus growth.
[0332] Methods:
[0333] Generate 6:2 reassortant viruses with specific amino acid changes
[0334] To introduce amino acid changes in the internal genes, site-directed mutagenesis was performed on each plasmid containing the target gene by using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) to introduce point mutations. 6:2 reassortant viruses were generated by reverse genetics. Six pHW2000 derivatives (plasmids) containing the segments PB2, PB1, PA, NP, M, ΔNS1 from B / Thuringia / 02 / 06 (a B / Jiangsu / 10 / 03-like virus from the B / Yamagata lineage) and the protein expression plasmid encoding influenza A PR8 NS1 (pCAGGS-NS1(SAM)) were co-transfected with the pHW2000-derived plasmid containing the HA and NA genes from B / Phuket / 3073 / 2013 into Vero cells. The transfected cell supernatant was collected 3 - 8 days after transfection and used to infect Vero cells (CP1) in serum-free medium. The CP1 stock solution was used to infect the growth curve.
[0335] Growth curve:
[0336] Vero cells were infected with serum-free medium containing recombinant trypsin (OPTI) at an MOI of 0.005. The input virus was titrated, and the actual MOI was calculated retrospectively for each infection. Samples were collected at 24 h, 48 h, 72 h, and 96 h post-infection by removing 1 ml of medium and centrifuging at 2,000 x g for 10 minutes. The samples were stored at -80 °C and titrated at least once in the FFA assay. At least three and at most eight individual growth curve tests were performed for each sample. Each virus was tested in the growth curve at least three times.
[0337] Results:
[0338] Plasmid constructs:
[0339] PB1: D67N
[0340] M: K93R
[0341] NS: Y117H
[0342] Virus rescue:
[0343] Table 4
[0344] Rescue of 6:2B / Thuringia / 02 / 06 / B / Phuket / 3073 / 2013 del NS with PB1 and / or PB2 mutations:
[0345]
[0346] Rescue of supernatant (P0) and first cell passage (CP1) on Vero cells by FFA titration.
[0347] Table 5
[0348] NF Mutation CP0 CP1 41 None 6.22 5.86 32 PB1 6.40 6.12 33 M 6.70 6.45 64 PB1 / M 7.79 6.98 77 PB1 / NS ND 7.02 63 M / NS 7.44 6.94 43 PB1 / M / NS 7.43 7.43
[0349] ND = Not determined
[0350] Control virus:
[0351] The control virus is a 6:2 reassortant virus with 6 internal genes of the B / Thuringia / 02 / 06 original sequence and 2 surface genes from B / Phuket / 3073 / 2013. The original transfection supernatant (P0) was passaged once on serum-free Vero cells, and CP1 was used for all growth curve infections.
[0352] BD = Below detection limit (3.5 log10 FFU / ml)
[0353] ND = Not determined
[0354] Table 6:
[0355] Mean of growth curve titers:
[0356]
[0357] Summary:
[0358] All growth curves consistently defined 3 distinct populations. NF43 always grew to the highest titers and exceeded 8.0 log FFU / ml in all assays. NF41 had the original plasmid as described above and grew to the lowest titers. The single mutants NF32 (PB1) and NF33 (M) were similar to the original plasmid in growth characteristics. Viruses NF64 (PB1 / M), NF77 (PB1 / NS), and NF64 (M / NS) with a mixture of 2 mutants grew to titers significantly higher than the single mutants but not as high as NF43 with all 3 mutations.
[0359] The combination of all three PB1, M, and NS mutations led to increased virus growth. At peak titers, these three mutations increased the titer by approximately 0.8 - 1.14 log.
[0360] Example 3:
[0361] Objective:
[0362] Test the growth of the 6:2 A / IVR-116:A / Hong Kong / 4801 / 2014 delNS1 point mutant in growth curve determination to identify the mutations that result in improved virus growth.
[0363] Method:
[0364] Generate 6:2 recombinant viruses with specific amino acid changes
[0365] To generate amino acid changes in the internal genes, site-directed mutagenesis was performed on each plasmid containing the target gene by using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) to introduce point mutations. 6:2 reassortant viruses were generated by reverse genetics. Six pHW2000 derivatives (plasmids) containing fragments PB2, PB1, PA, NP, M, ΔNS1 derived from A / IVR-116 (a laboratory strain A virus containing PB2, PA, NP, M, and NS genes from A / Puerto Rico / 08 / 1934 and PB1 from A / Texas / 1 / 1977) and a protein expression plasmid encoding influenza A PR8 NS1 (pCAGGS-NS1(SAM)) were co-transfected with a pHW2000-derived plasmid containing the HA and NA genes from A / Hong Kong / 4801 / 2014 into Vero cells. The transfected cell supernatant was collected 3 - 4 days after transfection and used to infect Vero cells (CP1) in serum-free medium. The CP1 stock solution was used to infect the growth curve.
[0366] Growth curve:
[0367] Vero cells were infected with serum-free medium containing recombinant trypsin (OPTI) at an MOI of 0.005. The input virus was titrated, and the actual MOI was calculated retrospectively for each infection. Samples were collected at 24 h, 48 h, and 72 h post-infection by removing 1 ml of medium and centrifuging at 2,000 x g for 10 minutes. The samples were stored at -80 °C and titrated at least once in the FFA assay. At least three and up to eight separate growth curve tests were performed for each sample. Each virus was tested in the growth curve at least three times.
[0368] Results:
[0369] Plasmid constructs:
[0370] PB2: K80R
[0371] PB1-1: E97G
[0372] PB1-2: S678N
[0373] PB1-3: E97G and S678N
[0374] Virus rescue:
[0375] Table 7
[0376] Rescue of 6:2 AGHB:A / Hong Kong / 4801 / 2014 delNS with PB1 and / or PB2 mutations:
[0377]
[0378] Table 8
[0379] Rescue supernatant (P0) and first cell passage (CP1) on Vero cells were titrated by FFA.
[0380] NF PB1 PB2 CP0 CP1 6 PB1-1 IVR-116 6.72 6.88 7 PB1-2 IVR-116 7.33 7.45 8 PB1-1 / PB1-2 IVR-116 7.33 7.43 9 IVR-116 IVR-116 6.70 6.66 10 PB1-1 PB2-1 7.11 7.1 11 PB1-2 PB2-1 7.31 7.47 12 PB1-1 / PB1-2 PB2-1 6.88 7.66 13 IVR-116 PB2-1 7.00 7.14
[0381] Control virus:
[0382] The control virus is a 6:2 reassortant virus with 6 internal genes of the IVR-116 original sequence and 2 surface genes from A / Hong Kong / 4801 / 2014. The original transfection supernatant (P0) was passaged once on serum-free Vero cells, and CP1 was used for all growth curve infections.
[0383] Table 9
[0384] Average of three growth curve titers:
[0385]
[0386]
[0387] Summary:
[0388] All three growth curves consistently defined 4 distinct populations. NF8 and 12 always grew to the highest titers and exceeded 8.0 log FFU / ml at 48 hours post-infection in the third assay. NF8 and NF12 had 2 PB1 mutations, and 12 had an additional PB2 mutation. NF11 had an additional PB2 mutation. The next group was NF10 and NF13, both of which had PB2 mutations. NF10 had an additional A314G mutation, while NF13 had the original PB1 plasmid. The last and lowest group was NF9 and NF6. NF9 had the original PB2 and PB1 plasmids, while NF6 had the PB1 A314G plasmid.
[0389] The combination of two PB1 mutations leads to a significant increase in virus growth.
[0390] Materials and methods:
[0391] Master donor viruses with the same internal genes, internal gene sequencing:
[0392] RNA extraction:
[0393] RNA was extracted using the QIAamp Viral Mini Kit from Qiagen. The RNA was eluted in 60 ul of buffer AVE and stored at -80 °C.
[0394] RT-PCR:
[0395] RT-PCR was performed using the SuperScript III One-Step RT-PCR Kit (ThermoFisher Scientific) or the QIAGEN OneStep RT-PCR Kit (Qiagen). The Superscript reaction was set up as follows: 25 uL of 2x SuperScript III buffer, 1 uL of enzyme mix, 19 uL of RNase-free water, 1 uL of forward primer (10 uM), 1 uL of reverse primer (10 uM), and 3 uL of RNA. The thermocycler conditions were as follows: 45 °C for 30 minutes, 94 °C for 2 minutes, and 40 cycles of: 94 °C for 15 seconds, 55 °C for 30 seconds, and 68 °C for 2 minutes. With an extension time of 10 minutes at 68 °C. The RT-PCR primer combinations and sequences are shown in Tables 1 and 2.
[0396] The Qiagen OneStep RT-PCR reaction was set up as follows: 10 uL of 5X QIAGEN OneStep RT-PCR buffer, 2 uL of dNTP mix, 2 uL of enzyme mix, 2 uL of forward primer (10 uM), 2 uL of reverse primer (10 uM), 29 uL of RNA-free water, and 3 uL of RNA. The thermocycler conditions were as follows: 50 °C for 30 minutes, 95 °C for 15 minutes, and 40 cycles of: 94 °C for 30 seconds, 55 °C for 30 seconds, and 72 °C for 2 minutes. With an extension time of 10 minutes at 72 °C. The RT-PCR primer combinations and sequences are shown in Tables 1 and 2.
[0397] Gel purification:
[0398] Run RT-PCR samples on 0.8%-1% agarose gels, excise the bands of the correct size, and purify them using a QIAquick Gel Extraction Kit (Qiagen). Elute the DNA in DNase / RNase-free water and dilute it to 4-10 ng / μl for sequencing.
[0399] Sequencing:
[0400] Perform all sequencing reactions by Genewiz. Prepare sequencing samples by mixing 10 μl of 4-10 ng / μl DNA with 5 μL of sequencing primer (5 μM). Analyze the sequencing chromatograms by Vector NTI (Thermo Fisher Scientific). See Tables 3 and 4 for sequencing primers.
[0401] Subclone HA and NA into the pHW2006 vector:
[0402] RNA extraction:
[0403] Extract RNA using the QIAamp Viral Minikit from Qiagen. Elute the RNA in 60 μl of Buffer AVE and store it at -80 °C.
[0404] RT-PCR:
[0405] Perform RT-PCR using the SuperScript III One-Step RT-PCR Kit (Thermo Fisher Scientific) or the QIAGEN OneStep RT-PCR Kit (Qiagen). The SuperScript reaction is set up as follows: 25 μL of 2x SuperScript III Buffer, 1 μL of enzyme mix, 19 μL of RNase-free water, 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), and 3 μL of RNA. The thermocycler conditions are as follows: 45 °C for 30 minutes, 94 °C for 2 minutes, and 40 cycles of: 94 °C for 15 seconds, 55 °C for 30 seconds, and 68 °C for 2 minutes. With an extension time of 10 minutes at 68 °C. See Table 5 for RT-PCR primers.
[0406] Gel purification:
[0407] Run RT-PCR samples on a 0.8%-1% agarose gel, excise the band of the correct size, and purify it using the QIAquick Gel Extraction Kit (Qiagen). Elute the DNA in DNase / RNase-free water. Digest the purified DNA with BsmBI (NEB) at 55 °C for 2 hours. Purify the digested DNA using the QIAquick Nucleotide Removal Kit. Elute the DNA in DNA / RNA-free water. Digest 2 μg of the pHW2006 vector with BsmBI and purify it in the same manner. Ligate 180 ng of HA and 140 ng of NADNA with 1 μg of pHW2006 DNA at room temperature for 15 minutes using Accupower Ligation PreMix (Bioneer). Transform 2 μL of the ligation mixture into DH5α Max Efficiency Competent Cells (Thermo Fisher Scientific) and grow overnight on an LB / ampicillin plate. Screen the isolated clones for the correct insert using Accustart II PCR SuperMix (Quanta Bio) and vector-specific primers (P3pHW: CCCACTGCTTACTGGCTTAT (SEQ ID No. 21) and P5pHW: CAGATGGCTGGCAACTAGAA (SEQ ID No. 22)). Grow three clones with the correct band size overnight in LB medium with ampicillin and purify the DNA using the QIAprep Spin Miniprep Kit. Dilute the Miniprep DNA to 80 ng / μL using DNA / RNA-free water.
[0408] Sequencing:
[0409] Perform all sequencing reactions by Genewiz. Prepare the sequencing samples by mixing 10 μL of 80 ng / μL DNA with 5 μL of sequencing primer (5 μM). Analyze the sequencing chromatograms by Vector NTI (Thermo Fisher Scientific). The sequencing primers are shown in Table 6.
[0410] RACE (Rapid Amplification of cDNA Ends):
[0411] RNA extraction:
[0412] Extract RNA using the QIAamp Viral Mini Kit from Qiagen. Elute the RNA in 60 μL of buffer AVE and store it at -80 °C.
[0413] Polyadenylation of vRNA
[0414] Polyadenylation was performed using a Poly(A) Tailing Kit (Ambion). Briefly, vRNA was used in a 40 μl reaction containing 8 μl of 5x E-PAP buffer, 4 μl of 25 mM MnCl2, 2 μl of 10 mM ATP, 1 μl of RNAsin Plus (Promega), 1 μl of E-PAP (polymerase), and 22 μl of vRNA. The reaction was incubated at 37 °C for 1 hour.
[0415] cDNA synthesis
[0416] The polyadenylated vRNA was used for cDNA synthesis using Superscript II reverse transcriptase (Thermo Fisher Scientific). The 20 μl reverse transcription reaction was assembled as follows: 2 μL of 5X FS buffer, 1 μl of TRSA oligonucleotide (CGCAGTCGGTACTTTTTTTTTTTTTTTTTTVN, SEQ ID NO.17), 1 μl of TS oligonucleotide (AAGCAGTGGTATCAACGCAGAGTACGCrGrGrG, SEQ ID No.18), 1 μl of 10 mM dNTP, 2 μl of 0.1 M DTT, 1 μl of RNAsin Plus (Promega), 1 μL of Superscript II enzyme, and 9 μl of polyadenylated vRNA. The reaction was incubated at 42 °C for 1 hour. After 1 hour of incubation, 2 μl of 20 mM MgCl2 was added and the incubation was continued at 42 °C for an additional 15 minutes. These samples were stored at -20 °C. The oligonucleotides TRSA and TS were dissolved at a concentration of 10 μM in RNase-free TE pH 7.0: water = 1:1 and stored at -20 °C. The TS oligonucleotide and the influenza virus-specific oligonucleotide were dissolved at 10 μM in TE pH 8.0 or RNase / DNase-free water. The RACE primer sequences are shown in Table 7.
[0417] 5’ and 3’ RACE
[0418] The non-coding region (NCR) was amplified by PCR using pfu Turbo polymerase (Agilent) and Go Taq G2 polymerase (Promega). A 25 ul PCR reaction was assembled by adding: 2.5 ul of Pfu 10X reaction buffer, 2.5 uL of 2 mM dNTP, 0.5 ul of sense primer (see Tables 8 and 9), 0.5 ul of antisense primer (see Tables 8 and 9), 17.5 ul of RNase / DNase-free water, 0.3 uL of Pfu Turbo polymerase (2.5 U / ul, Agilent) and 0.2 uL of Go Taq G2 polymerase (5 U / ul, Promega) and 1 ul of cDNA. Samples were amplified as follows: 30 seconds at 95 °C and 40 cycles of: 30 seconds at 95 °C, 1 minute at 59 °C or 60 °C (see Tables 10 - 11), 1 minute at 68 °C, followed by an extension step of 2 minutes at 68 °C. PCR products were evaluated on a 1.0% agarose gel in 1x TAE and gel purified using the QIAquick Gel Extraction Kit (Qiagen). DNA was eluted in DNase / RNase-free water and diluted to 4 - 10 ng / ul for sequencing with gene-specific primers.
[0419] Sequencing:
[0420] All sequencing reactions were performed by Genewiz. Sequencing samples were prepared by mixing 10 ul of 4 - 10 ng / ul DNA with 5 uL of sequencing primer (5 uM). Sequencing chromatograms were analyzed by Vector NTI (Thermo Fisher Scientific).
[0421] T4 RNA ligase method for 3' and 5' non-coding region sequencing:
[0422] RNA extraction:
[0423] RNA was extracted using the QIAamp Viral Mini Kit from Qiagen. RNA was eluted in 60 ul of buffer AVE and stored at -80 °C.
[0424] Denature RNA:
[0425] In a 16.5 ul reaction, 13 ul of vRNA, 0.5 ul of RNAsin Plus (Promega) and 3 ul of 10X T4 RNA ligase buffer (New England Biolabs) were combined and incubated at 65 °C for 5 minutes. Immediately transfer to ice.
[0426] vRNA ligation:
[0427] To 16.5 ul of denatured vRNA, add the following: 4 ul of T4 RNA ligase (10 U / ul, New England Biolabs), 0.5 ul of RNAsin Plus (Promega), 6 ul of 50% PEG 8000, and 3 ul of 10 uM ATP. Incubate the 30 ul reaction at 37 °C for 1 hour, then inactivate at 65 °C for 10 minutes, and store at -80 °C.
[0428] RT-PCR
[0429] Perform RT-PCR using the Superscript III RT-PCR One-step RT-PCR system (Thermo Fisher Scientific). Use T4 RNA ligated primers and gene-specific primers (see Tables 12 - 13) for each reaction. Set up a 25 ul reaction as follows: 12.5 ul of 2x reaction mixture, 1 ul of RNAsin (Promega), 1 ul of 10 uM sense primer, 1 ul of 10 uM antisense primer, 2 ul of Superscript III RT / Platinum Taq mixture, and 7.5 ul of ligated vRNA (from the previous step). Amplify the samples as follows: 45 °C for 60 minutes, 94 °C for 2 minutes, and 40 cycles of: 94 °C for 15 seconds, 50 °C to 60 °C for 30 seconds, 68 °C for 1 minute, followed by an extension step at 68 °C for 10 minutes. Evaluate the PCR products in 1x TAE on a 1.0% agarose gel and perform gel purification using the QIAquick Gel Extraction Kit (Qiagen). Elute the DNA in DNase / RNase-free water and dilute to 4 - 10 ng / ul for sequencing with gene-specific primers.
[0430] Table 10:
[0431] SEQ ID overview of the modified sequences described herein:
[0432]
[0433]
[0434] Example 4:
[0435] Growth of the 2018 - 2020 season recommended influenza B ΔFLU strains containing HA and NA with (YAM) and without (wild type) internal gene mutations.
[0436] A 6:2 reassortant virus was obtained by reverse genetics, which contains mutations in the internal gene segments from B / Thuringia lacking NS1 and surface proteins from the strains of the 2018 - 2020 season recommended by the WHO. The virus designated as YAM contains the following internal mutations: PB1: D67N, M: K93R, NS1: Y117H. The indicated rescued delNS1 virus at passage 1 was used to infect Vero cells at an MOI of 0.005. Samples were collected at 48, 72, and 96 hours post - infection and titrated by fluorescent focus assay (FFA).
[0437] Table 11:
[0438] 48h 72h 96h B / Colorado / 06 / 2017 del NS1 original 5.03 4.98 5.02 B / Colorado / 06 / 2017 del NS1 YAM 8.22 8.31 8.28 B / Maryland / 15 / 2016 del NS1 YAM 8.26 8.23 8.23 B / Iowa / 06 / 2017 del NS1 YAM 7.63 7.91 7.85 B / Phuket / 3073 / 2013 del NS1 YAM 8.10 8.16 8.22 Sequence Listing <110> Blue Sky Immunotherapy Co., Ltd. <120> High - growth influenza virus <130> MT005P <160> 38 <170> BiSSAP 1.3 <210> 1 <211> 2396 <212> DNA <213> Influenza B virus <400> 1 agcagaagcg gagcgttttc aagatgacat tggctaaaat tgaattgtta aaacaactgt 60 taagggacaa tgaagccaaa acagtactga aacaaacaac agtagatcaa tataacataa 120 taagaaaatt caatacatca agaattgaaa agaacccttc attaaggatg aagtgggcga 180 tgtgttctaa ttttcccttg gctttgacca agggtgacat ggcaaacaga atccccttgg 240 aatacaaggg aatacaactt aaaacaaatg ctgaagacat aggaaccaaa ggccaaatgt 300 gctcaatagc agcagttacc tggtggaata catatggacc aataggggat actgaaggtt 360 tcgaaaaagt ctacgaaagc ttttttctca gaaagatgag acttgacaat gccacttggg 420 gccgaataac ttttggccca gttgaaagag taagaaaaag ggtactgcta aaccctctca 480 ccaaggaaat gcctccagat gaagcaagta atgtgataat ggaaatattg ttccctaaag 540 aagcaggaat accaagagaa tctacttgga tacataggga actgataaaa gaaaaaagag 600 aaaaattgaa aggaacgatg ataactccca ttgtactggc atacatgctc gagagggaat 660 tagttgccag gagaaggttc ctgcccgtgg caggagcaac atcagctgag ttcatagaaa 720 tgctacactg cttacaaggt gaaaattgga ggcaaatata tcacccggga gggaataaac 780 taactgaatc taggtcccaa tcgatgattg tggcttgtag aaagataatc agaagatcaa 840 tagtcgcatc aaacccattg gagctagctg tagaaattgc aaataagact gtgatagata 900 ctgaaccttt aaaatcatgt ctgacagcca tagacggagg tgatgtcgcc tgtgacataa 960 taagagctgc attaggacta aagatcagac aaagacaaag atttggacga cttgaactaa 1020 agagaatatc aggaagagga ttcaaaaatg atgaagaaat attaatcggg aacggaacaa 1080 tacagaagat tggaatatgg gacggagaag aggagttcca tgtgagatgt ggtgaatgca 1140 ggggaatatt aaaaaagagc aaaatgagaa tggaaaaact actaataaat tcagctaaaa 1200 aggaggacat gaaagattta ataatcttgt gcatggtatt ttcccaagac actaggatgt 1260 tccaaggagt gaggggtgaa ataaattttc ttaatagagc aggccaactt ttatctccaa 1320 tgtatcaact ccaaagatat tttttgagta gaagtaacga tctctttgat caatgggggt 1380 atgaggaatc acccaaagca agtgagctac atgggataaa tgaactaatg aatgcatctg 1440 actacacttt gaaaggggtt gtagtaacaa aaaatgtgat tgatgatttt agttctactg 1500 aaacagaaaa agtatctata acaaaaaatc ttagtttaat aaaaaggact ggggaagtca 1560 taatgggagc caatgacgta agtgaattag aatcacaagc acagctaatg ataacatatg 1620 atacaccaaa gatgtgggag atggggacaa ccaaagaact ggtgcaaaac acctatcaat 1680 gggtgctgaa aaatttggta acactgaagg ctcagtttct tctagggaaa gaagacatgt 1740 tccaatggga tgcatttgaa gcatttgaaa gcataatccc ccagaagatg gctggccaat 1800 acagtggatt tgcaagagca gtgctcaaac aaatgagaga ccaagaggtc atgaaaactg 1860 accagttcat aaagttgttg cccttttgtt tctcaccacc aaagttaagg agcaatgggg 1920 agccttatca gttcttgagg cttgtattga agggaggagg agaaaatttc atcgaagtaa 1980 ggaaagggtc tcctctattc tcttacaatc cacaaacaga agtcctaact atatgcggca 2040 gaatgatgtc attaaaaggg aaaattgaag atgaagaaag gaatagatca atggggaatg 2100 cagtgttggc gggttttctt gttagtggca agtatgaccc agatcttgga gatttcaaaa 2160 ccattgaaga acttgaaaag ctaaaaccag gggagaaagc aaacatctta ctttatcaag 2220 gaaagcccgt taaagtagtt aaaaggaaaa gatatagtgc tttatccaat gacatttcac 2280 aaggaattaa gagacaaaga atgacagttg agtccatggg gtgggccttg agctaatata 2340 aatttatcca ttaattcaat gaatacaatt gagtgaaaaa tgctcgtgtt tctact 2396 <210> 2 <211> 770 <212> PRT <213> Influenza B virus <400> 2 Methionine, Threonine, Leucine, Alanine, Lysine, Isoleucine, Glutamic acid, Leucine, Leucine, Lysine, Glutamine, Leucine, Leucine, Arginine, Aspartic acid, Asparagine 1 5 10 15 Glutamic acid, Alanine, Lysine, Threonine, Valine, Leucine, Lysine, Glutamine, Threonine, Threonine, Valine, Aspartic acid, Glutamine, Tyrosine, Asparagine, Isoleucine 20 25 30 Isoleucine, Arginine, Lysine, Phenylalanine, Asparagine, Threonine, Serine, Arginine, Isoleucine, Glutamic acid, Lysine, Asparagine, Proline, Serine, Leucine, Arginine 35 40 45 Methionine, Lysine, Tryptophan, Alanine, Methionine, Cysteine, Serine, Asparagine, Phenylalanine, Proline, Leucine, Alanine, Leucine, Threonine, Lysine, Glycine 50 55 60 Aspartic acid, Methionine, Alanine, Asparagine, Arginine, Isoleucine, Proline, Leucine, Glutamic acid, Tyrosine, Lysine, Glycine, Isoleucine, Glutamine, Leucine, Lysine 65 70 75 80 Threonine, Asparagine, Alanine, Glutamic acid, Aspartic acid, Isoleucine, Glycine, Threonine, Lysine, Glycine, Glutamine, Methionine, Cysteine, Serine, Isoleucine, Alanine 85 90 95 Alanine, Valine, Threonine, Tryptophan, Tryptophan, Asparagine, Threonine, Tyrosine, Glycine, Proline, Isoleucine, Glycine, Aspartic acid, Threonine, Glutamic acid, Glycine 100 105 110 Phenylalanine, Glutamic acid, Lysine, Valine, Tyrosine, Glutamic acid, Serine, Phenylalanine, Phenylalanine, Leucine, Arginine, Lysine, Methionine, Arginine, Leucine, Aspartic acid 115 120 125 Asparagine, Alanine, Threonine, Tryptophan, Glycine, Arginine, Isoleucine, Threonine, Phenylalanine, Glycine, Proline, Valine, Glutamic acid, Arginine, Valine, Arginine 130 135 140 Lysine, Arginine, Valine, Leucine, Leucine, Asparagine, Proline, Leucine, Threonine, Lysine, Glutamic acid, Methionine, Proline, Proline, Aspartic acid, Glutamic acid 145 150 155 160 Ala Ser Asn Val Ile Met Glu Ile Leu Phe Pro Lys Glu Ala Gly Ile 165 170 175 Pro Arg Glu Ser Thr Trp Ile His Arg Glu Leu Ile Lys Glu Lys Arg 180 185 190 Glu Lys Leu Lys Gly Thr Met Ile Thr Pro Ile Val Leu Ala Tyr Met 195 200 205 Leu Glu Arg Glu Leu Val Ala Arg Arg Arg Phe Leu Pro Val Ala Gly 210 215 220 Ala Thr Ser Ala Glu Phe Ile Glu Met Leu His Cys Leu Gln Gly Glu 225 230 235 240 Asn Trp Arg Gln Ile Tyr His Pro Gly Gly Asn Lys Leu Thr Glu Ser 245 250 255 Arg Ser Gln Ser Met Ile Val Ala Cys Arg Lys Ile Ile Arg Arg Ser 260 265 270 Ile Val Ala Ser Asn Pro Leu Glu Leu Ala Val Glu Ile Ala Asn Lys 275 280 285 Thr Val Ile Asp Thr Glu Pro Leu Lys Ser Cys Leu Thr Ala Ile Asp 290 295 300 Gly Gly Asp Val Ala Cys Asp Ile Ile Arg Ala Ala Leu Gly Leu Lys 305 310 315 320 Ile Arg Gln Arg Gln Arg Phe Gly Arg Leu Glu Leu Lys Arg Ile Ser 325 330 335 Gly Arg Gly Phe Lys Asn Asp Glu Glu Ile Leu Ile Gly Asn Gly Thr 340 345 350 Ile Gln Lys Ile Gly Ile Trp Asp Gly Glu Glu Glu Phe His Val Arg 355 360 365 Cys Gly Glu Cys Arg Gly Ile Leu Lys Lys Ser Lys Met Arg Met Glu 370 375 380 Lys Leu Leu Ile Asn Ser Ala Lys Lys Glu Asp Met Lys Asp Leu Ile 385 390 395 400 Ile Leu Cys Met Val Phe Ser Gln Asp Thr Arg Met Phe Gln Gly Val 405 410 415 Arg Gly Glu Ile Asn Phe Leu Asn Arg Ala Gly Gln Leu Leu Ser Pro 420 425 430 Met Tyr Gln Leu Gln Arg Tyr Phe Leu Ser Arg Ser Asn Asp Leu Phe 435 440 445 Asp Gln Trp Gly Tyr Glu Glu Ser Pro Lys Ala Ser Glu Leu His Gly 450 455 460 Ile Asn Glu Leu Met Asn Ala Ser Asp Tyr Thr Leu Lys Gly Val Val 465 470 475 480 Val Thr Lys Asn Val Ile Asp Asp Phe Ser Ser Thr Glu Thr Glu Lys 485 490 495 Val Ser Ile Thr Lys Asn Leu Ser Leu Ile Lys Arg Thr Gly Glu Val 500 505 510 Ile Met Gly Ala Asn Asp Val Ser Glu Leu Glu Ser Gln Ala Gln Leu 515 520 525 Met Ile Thr Tyr Asp Thr Pro Lys Met Trp Glu Met Gly Thr Thr Lys 530 535 540 Glu Leu Val Gln Asn Thr Tyr Gln Trp Val Leu Lys Asn Leu Val Thr 545 550 555 560 Leu Lys Ala Gln Phe Leu Leu Gly Lys Glu Asp Met Phe Gln Trp Asp 565 570 575 Ala Phe Glu Ala Phe Glu Ser Ile Ile Pro Gln Lys Met Ala Gly Gln 580 585 590 Tyr Ser Gly Phe Ala Arg Ala Val Leu Lys Gln Met Arg Asp Gln Glu 595 600 605 Val Met Lys Thr Asp Gln Phe Ile Lys Leu Leu Pro Phe Cys Phe Ser 610 615 620 Pro Pro Lys Leu Arg Ser Asn Gly Glu Pro Tyr Gln Phe Leu Arg Leu 625 630 635 640 Val Leu Lys Gly Gly Gly Glu Asn Phe Ile Glu Val Arg Lys Gly Ser 645 650 655 Pro Leu Phe Ser Tyr Asn Pro Gln Thr Glu Val Leu Thr Ile Cys Gly 660 665 670 Arg Met Met Ser Leu Lys Gly Lys Ile Glu Asp Glu Glu Arg Asn Arg 675 680 685 Ser Met Gly Asn Ala Val Leu Ala Gly Phe Leu Val Ser Gly Lys Tyr 690 695 700 Asp Pro Asp Leu Gly Asp Phe Lys Thr Ile Glu Glu Leu Glu Lys Leu 705 710 715 720 Lys Pro Gly Glu Lys Ala Asn Ile Leu Leu Tyr Gln Gly Lys Pro Val 725 730 735 Lys Val Val Lys Arg Lys Arg Tyr Ser Ala Leu Ser Asn Asp Ile Ser 740 745 750 Gln Gly Ile Lys Arg Gln Arg Met Thr Val Glu Ser Met Gly Trp Ala 755 760 765 Leu Ser 770 <210> 3 <211> 2396 <212> DNA <213> Artificial Sequence <220> <223> PB2 G427S <400> 3 agcagaagcg gagcgttttc aagatgacat tggctaaaat tgaattgtta aaacaactgt 60 taagggacaa tgaagccaaa acagtactga aacaaacaac agtagatcaa tataacataa 120 taagaaaatt caatacatca agaattgaaa agaacccttc attaaggatg aagtgggcga 180 tgtgttctaa ttttcccttg gctttgacca agggtgacat ggcaaacaga atccccttgg 240 aatacaaggg aatacaactt aaaacaaatg ctgaagacat aggaaccaaa ggccaaatgt 300 gctcaatagc agcagttacc tggtggaata catatggacc aataggggat actgaaggtt 360 tcgaaaaagt ctacgaaagc ttttttctca gaaagatgag acttgacaat gccacttggg 420 gccgaataac ttttggccca gttgaaagag taagaaaaag ggtactgcta aaccctctca 480 ccaaggaaat gcctccagat gaagcaagta atgtgataat ggaaatattg ttccctaaag 540 aagcaggaat accaagagaa tctacttgga tacataggga actgataaaa gaaaaaagag 600 aaaaattgaa aggaacgatg ataactccca ttgtactggc atacatgctc gagagggaat 660 tagttgccag gagaaggttc ctgcccgtgg caggagcaac atcagctgag ttcatagaaa 720 tgctacactg cttacaaggt gaaaattgga ggcaaatata tcacccggga gggaataaac 780 taactgaatc taggtcccaa tcgatgattg tggcttgtag aaagataatc agaagatcaa 840 tagtcgcatc aaacccattg gagctagctg tagaaattgc aaataagact gtgatagata 900 ctgaaccttt aaaatcatgt ctgacagcca tagacggagg tgatgtcgcc tgtgacataa 960 taagagctgc attaggacta aagatcagac aaagacaaag atttggacga cttgaactaa 1020 agagaatatc aggaagagga ttcaaaaatg atgaagaaat attaatcggg aacggaacaa 1080 tacagaagat tggaatatgg gacggagaag aggagttcca tgtgagatgt ggtgaatgca 1140 ggggaatatt aaaaaagagc aaaatgagaa tggaaaaact actaataaat tcagctaaaa 1200 aggaggacat gaaagattta ataatcttgt gcatggtatt ttcccaagac actaggatgt 1260 tccaaggagt gaggggtgaa ataaattttc ttaatagagc aagccaactt ttatctccaa 1320 tgtatcaact ccaaagatat tttttgagta gaagtaacga tctctttgat caatgggggt 1380 atgaggaatc acccaaagca agtgagctac atgggataaa tgaactaatg aatgcatctg 1440 actacacttt gaaaggggtt gtagtaacaa aaaatgtgat tgatgatttt agttctactg 1500 aaacagaaaa agtatctata acaaaaaatc ttagtttaat aaaaaggact ggggaagtca 1560 taatgggagc caatgacgta agtgaattag aatcacaagc acagctaatg ataacatatg 1620 atacaccaaa gatgtgggag atggggacaa ccaaagaact ggtgcaaaac acctatcaat 1680 gggtgctgaa aaatttggta acactgaagg ctcagtttct tctagggaaa gaagacatgt 1740 tccaatggga tgcatttgaa gcatttgaaa gcataatccc ccagaagatg gctggccaat 1800 acagtggatt tgcaagagca gtgctcaaac aaatgagaga ccaagaggtc atgaaaactg 1860 accagttcat aaagttgttg cccttttgtt tctcaccacc aaagttaagg agcaatgggg 1920 agccttatca gttcttgagg cttgtattga agggaggagg agaaaatttc atcgaagtaa 1980 ggaaagggtc tcctctattc tcttacaatc cacaaacaga agtcctaact atatgcggca 2040 gaatgatgtc attaaaaggg aaaattgaag atgaagaaag gaatagatca atggggaatg 2100 cagtgttggc gggttttctt gttagtggca agtatgaccc agatcttgga gatttcaaaa 2160 ccattgaaga acttgaaaag ctaaaaccag gggagaaagc aaacatctta ctttatcaag 2220 gaaagcccgt taaagtagtt aaaaggaaaa gatatagtgc tttatccaat gacatttcac 2280 aaggaattaa gagacaaaga atgacagttg agtccatggg gtgggccttg agctaatata 2340 aatttatcca ttaattcaat gaatacaatt gagtgaaaaa tgctcgtgtt tctact 2396 <210> 4 <211> 770 <212> PRT <213> Artificial Sequence <220> <223> PB2 G427S <400> 4 Met Thr Leu Ala Lys Ile Glu Leu Leu Lys Gln Leu Leu Arg Asp Asn 1 5 10 15 Glu Ala Lys Thr Val Leu Lys Gln Thr Thr Val Asp Gln Tyr Asn Ile 20 25 30 Ile Arg Lys Phe Asn Thr Ser Arg Ile Glu Lys Asn Pro Ser Leu Arg 35 40 45 Met Lys Trp Ala Met Cys Ser Asn Phe Pro Leu Ala Leu Thr Lys Gly 50 55 60 Asp Met Ala Asn Arg Ile Pro Leu Glu Tyr Lys Gly Ile Gln Leu Lys 65 70 75 80 Thr Asn Ala Glu Asp Ile Gly Thr Lys Gly Gln Met Cys Ser Ile Ala 85 90 95 Ala Val Thr Trp Trp Asn Thr Tyr Gly Pro Ile Gly Asp Thr Glu Gly 100 105 110 Phe Glu Lys Val Tyr Glu Ser Phe Phe Leu Arg Lys Met Arg Leu Asp 115 120 125 Asn Ala Thr Trp Gly Arg Ile Thr Phe Gly Pro Val Glu Arg Val Arg 130 135 140 Lys Arg Val Leu Leu Asn Pro Leu Thr Lys Glu Met Pro Pro Asp Glu 145 150 155 160 Ala Ser Asn Val Ile Met Glu Ile Leu Phe Pro Lys Glu Ala Gly Ile 165 170 175 Pro Arg Glu Ser Thr Trp Ile His Arg Glu Leu Ile Lys Glu Lys Arg 180 185 190 Glu Lys Leu Lys Gly Thr Met Ile Thr Pro Ile Val Leu Ala Tyr Met 195 200 205 Leu Glu Arg Glu Leu Val Ala Arg Arg Arg Phe Leu Pro Val Ala Gly 210 215 220 Ala Thr Ser Ala Glu Phe Ile Glu Met Leu His Cys Leu Gln Gly Glu 225 230 235 240 Asn Trp Arg Gln Ile Tyr His Pro Gly Gly Asn Lys Leu Thr Glu Ser 245 250 255 Arg Ser Gln Ser Met Ile Val Ala Cys Arg Lys Ile Ile Arg Arg Ser 260 265 270 Ile Val Ala Ser Asn Pro Leu Glu Leu Ala Val Glu Ile Ala Asn Lys 275 280 285 Thr Val Ile Asp Thr Glu Pro Leu Lys Ser Cys Leu Thr Ala Ile Asp 290 295 300 Gly Gly Asp Val Ala Cys Asp Ile Ile Arg Ala Ala Leu Gly Leu Lys 305 310 315 320 Ile Arg Gln Arg Gln Arg Phe Gly Arg Leu Glu Leu Lys Arg Ile Ser 325 330 335 Gly Arg Gly Phe Lys Asn Asp Glu Glu Ile Leu Ile Gly Asn Gly Thr 340 345 350 Ile Gln Lys Ile Gly Ile Trp Asp Gly Glu Glu Glu Phe His Val Arg 355 360 365 Cys Gly Glu Cys Arg Gly Ile Leu Lys Lys Ser Lys Met Arg Met Glu 370 375 380 Lys Leu Leu Ile Asn Ser Ala Lys Lys Glu Asp Met Lys Asp Leu Ile 385 390 395 400 Ile Leu Cys Met Val Phe Ser Gln Asp Thr Arg Met Phe Gln Gly Val 405 410 415 Arg Gly Glu Ile Asn Phe Leu Asn Arg Ala Ser Gln Leu Leu Ser Pro 420 425 430 Met Tyr Gln Leu Gln Arg Tyr Phe Leu Ser Arg Ser Asn Asp Leu Phe 435 440 445 Asp Gln Trp Gly Tyr Glu Glu Ser Pro Lys Ala Ser Glu Leu His Gly 450 455 460 Ile Asn Glu Leu Met Asn Ala Ser Asp Tyr Thr Leu Lys Gly Val Val 465 470 475 480 Val Thr Lys Asn Val Ile Asp Asp Phe Ser Ser Thr Glu Thr Glu Lys 485 490 495 Val Ser Ile Thr Lys Asn Leu Ser Leu Ile Lys Arg Thr Gly Glu Val 500 505 510 Ile Met Gly Ala Asn Asp Val Ser Glu Leu Glu Ser Gln Ala Gln Leu 515 520 525 Met Ile Thr Tyr Asp Thr Pro Lys Met Trp Glu Met Gly Thr Thr Lys 530 535 540 Glu Leu Val Gln Asn Thr Tyr Gln Trp Val Leu Lys Asn Leu Val Thr 545 550 555 560 Leu Lys Ala Gln Phe Leu Leu Gly Lys Glu Asp Met Phe Gln Trp Asp 565 570 575 Ala Phe Glu Ala Phe Glu Ser Ile Ile Pro Gln Lys Met Ala Gly Gln 580 585 590 Tyr Ser Gly Phe Ala Arg Ala Val Leu Lys Gln Met Arg Asp Gln Glu 595 600 605 Val Met Lys Thr Asp Gln Phe Ile Lys Leu Leu Pro Phe Cys Phe Ser 610 615 620 Pro Pro Lys Leu Arg Ser Asn Gly Glu Pro Tyr Gln Phe Leu Arg Leu 625 630 635 640 Val Leu Lys Gly Gly Gly Glu Asn Phe Ile Glu Val Arg Lys Gly Ser 645 650 655 Pro Leu Phe Ser Tyr Asn Pro Gln Thr Glu Val Leu Thr Ile Cys Gly 660 665 670 Arg Met Met Ser Leu Lys Gly Lys Ile Glu Asp Glu Glu Arg Asn Arg 675 680 685 Ser Met Gly Asn Ala Val Leu Ala Gly Phe Leu Val Ser Gly Lys Tyr 690 695 700 Asp Pro Asp Leu Gly Asp Phe Lys Thr Ile Glu Glu Leu Glu Lys Leu 705 710 715 720 Lys Pro Gly Glu Lys Ala Asn Ile Leu Leu Tyr Gln Gly Lys Pro Val 725 730 735 Lys Val Val Lys Arg Lys Arg Tyr Ser Ala Leu Ser Asn Asp Ile Ser 740 745 750 Gln Gly Ile Lys Arg Gln Arg Met Thr Val Glu Ser Met Gly Trp Ala 755 760 765 Leu Ser 770 <210> 5 <211> 1190 <212> DNA <213> Influenza B virus <400> 5 agcagaagca cgcactttct taaaatgtcg ctgtttggag acacaattgc ctacctgctt 60 tcattgacag aagatggaga aggcaaagca gaactagcag aaaaattaca ctgttggttc 120 ggtgggaaag aatttgacct agactctgcc ttggaatgga taaaaaacaa aagatgctta 180 actgatatac agaaagcact aattggtgcc tctatctgct ttttaaaacc caaagaccag 240 gaaagaaaaa gaagattcat cacagagccc ctatcaggaa tgggaacaac agcaacaaaa 300 aagaagggcc tgattctagc tgagagaaaa atgagaaaat gtgtgagctt ccatgaagca 360 tttgaaatag cagaaggcca tgaaagctca gcgttactat attgtctcat ggtcatgtac 420 ctgaatcctg gaaattattc aatgcaagta aaactaggaa cgctctgtgc tttgtgcgaa 480 aaacaagcat cacattcaca cagggctcat agcagagcag cgagatcttc agtgcccgga 540 gtgagacggg aaatgcagat ggtctcagct atgaacacag caaaaacaat gaatggaatg 600 ggaaaaggag aagacgtcca aaaactggca gaagaactgc aaagcaacat tggagtattg 660 agatctcttg gggcaagtca aaagaatggg gaaggaattg caaaggatgt aatggaagtg 720 ctaaagcaga gctctatggg aaattcagct cttgtgaaga aatacctata atgctcgaac 780 catttcagat tctttcaatt tgttctttta ttttatcagc tctccatttc atggcttgga 840 caataggaca tttaaatcaa ataaaaagag gagtaaacat gaaaatacga ataaaggggc 900 caaataaaga gacaataaac agagaggtat caattttgag acacagttac caaaaagaaa 960 tccaggctaa agaagcaatg aaggaagtac tctctgacaa catggaggta ttgagtgacc 1020 acatagtaat tgaggggctt tctgctgaag agataataaa aatgggtgaa acagttttgg 1080 aggtagaaga atttcattaa attcaatttt tactgtactt cttactatgc atttaagcaa 1140 attgtaatca atgtcagcaa ataaactgga aaaagtgcgt tgtttctact 1190 <210> 6 <211> 248 <212> PRT <213> Influenza B virus <400> 6 Met Ser Leu Phe Gly Asp Thr Ile Ala Tyr Leu Leu Ser Leu Thr Glu 1 5 10 15 Asp Gly Glu Gly Lys Ala Glu Leu Ala Glu Lys Leu His Cys Trp Phe 20 25 30 Gly Gly Lys Glu Phe Asp Leu Asp Ser Ala Leu Glu Trp Ile Lys Asn 35 40 45 Lys Arg Cys Leu Thr Asp Ile Gln Lys Ala Leu Ile Gly Ala Ser Ile 50 55 60 Cys Phe Leu Lys Pro Lys Asp Gln Glu Arg Lys Arg Arg Phe Ile Thr 65 70 75 80 Glu Pro Leu Ser Gly Met Gly Thr Thr Ala Thr Lys Lys Lys Gly Leu 85 90 95 Ile Leu Ala Glu Arg Lys Met Arg Lys Cys Val Ser Phe His Glu Ala 100 105 110 Phe Glu Ile Ala Glu Gly His Glu Ser Ser Ala Leu Leu Tyr Cys Leu 115 120 125 Met Val Met Tyr Leu Asn Pro Gly Asn Tyr Ser Met Gln Val Lys Leu 130 135 140 Gly Thr Leu Cys Ala Leu Cys Glu Lys Gln Ala Ser His Ser His Arg 145 150 155 160 Ala His Ser Arg Ala Ala Arg Ser Ser Val Pro Gly Val Arg Arg Glu 165 170 175 Met Gln Met Val Ser Ala Met Asn Thr Ala Lys Thr Met Asn Gly Met 180 185 190 Gly Lys Gly Glu Asp Val Gln Lys Leu Ala Glu Glu Leu Gln Ser Asn 195 200 205 Ile Gly Val Leu Arg Ser Leu Gly Ala Ser Gln Lys Asn Gly Glu Gly 210 215 220 Ile Ala Lys Asp Val Met Glu Val Leu Lys Gln Ser Ser Met Gly Asn 225 230 235 240 Ser Ala Leu Val Lys Lys Tyr Leu 245 <210> 7 <211> 1190 <212> DNA <213> Artificial sequence <220> <223> PB2 T89S <400> 7 agcagaagca cgcactttct taaaatgtcg ctgtttggag acacaattgc ctacctgctt 60 tcattgacag aagatggaga aggcaaagca gaactagcag aaaaattaca ctgttggttc 120 ggtgggaaag aatttgacct agactctgcc ttggaatgga taaaaaacaa aagatgctta 180 actgatatac agaaagcact aattggtgcc tctatctgct ttttaaaacc caaagaccag 240 gaaagaaaaa gaagattcat cacagagccc ctatcaggaa tgggaacatc agcaacaaaa 300 aagaagggcc tgattctagc tgagagaaaa atgagaaaat gtgtgagctt ccatgaagca 360 tttgaaatag cagaaggcca tgaaagctca gcgttactat attgtctcat ggtcatgtac 420 ctgaatcctg gaaattattc aatgcaagta aaactaggaa cgctctgtgc tttgtgcgaa 480 aaacaagcat cacattcaca cagggctcat agcagagcag cgagatcttc agtgcccgga 540 gtgagacggg aaatgcagat ggtctcagct atgaacacag caaaaacaat gaatggaatg 600 ggaaaaggag aagacgtcca aaaactggca gaagaactgc aaagcaacat tggagtattg 660 agatctcttg gggcaagtca aaagaatggg gaaggaattg caaaggatgt aatggaagtg 720 ctaaagcaga gctctatggg aaattcagct cttgtgaaga aatacctata atgctcgaac 780 catttcagat tctttcaatt tgttctttta ttttatcagc tctccatttc atggcttgga 840 caataggaca tttaaatcaa ataaaaagag gagtaaacat gaaaatacga ataaaggggc 900 caaataaaga gacaataaac agagaggtat caattttgag acacagttac caaaaagaaa 960 tccaggctaa agaagcaatg aaggaagtac tctctgacaa catggaggta ttgagtgacc 1020 acatagtaat tgaggggctt tctgctgaag agataataaa aatgggtgaa acagttttgg 1080 aggtagaaga atttcattaa attcaatttt tactgtactt cttactatgc atttaagcaa 1140 attgtaatca atgtcagcaa ataaactgga aaaagtgcgt tgtttctact 1190 <210> 8 <211> 248 <212> PRT <213> Artificial Sequence <220> <223> PB2 T89S <400> 8 Met Ser Leu Phe Gly Asp Thr Ile Ala Tyr Leu Leu Ser Leu Thr Glu 1 5 10 15 Asp Gly Glu Gly Lys Ala Glu Leu Ala Glu Lys Leu His Cys Trp Phe 20 25 30 Gly Gly Lys Glu Phe Asp Leu Asp Ser Ala Leu Glu Trp Ile Lys Asn 35 40 45 Lys Arg Cys Leu Thr Asp Ile Gln Lys Ala Leu Ile Gly Ala Ser Ile 50 55 60 Cys Phe Leu Lys Pro Lys Asp Gln Glu Arg Lys Arg Arg Phe Ile Thr 65 70 75 80 Glu Pro Leu Ser Gly Met Gly Thr Ser Ala Thr Lys Lys Lys Gly Leu 85 90 95 Ile Leu Ala Glu Arg Lys Met Arg Lys Cys Val Ser Phe His Glu Ala 100 105 110 Phe Glu Ile Ala Glu Gly His Glu Ser Ser Ala Leu Leu Tyr Cys Leu 115 120 125 Met Val Met Tyr Leu Asn Pro Gly Asn Tyr Ser Met Gln Val Lys Leu 130 135 140 Gly Thr Leu Cys Ala Leu Cys Glu Lys Gln Ala Ser His Ser His Arg 145 150 155 160 Ala His Ser Arg Ala Ala Arg Ser Ser Val Pro Gly Val Arg Arg Glu 165 170 175 Met Gln Met Val Ser Ala Met Asn Thr Ala Lys Thr Met Asn Gly Met 180 185 190 Gly Lys Gly Glu Asp Val Gln Lys Leu Ala Glu Glu Leu Gln Ser Asn 195 200 205 Ile Gly Val Leu Arg Ser Leu Gly Ala Ser Gln Lys Asn Gly Glu Gly 210 215 220 Ile Ala Lys Asp Val Met Glu Val Leu Lys Gln Ser Ser Met Gly Asn 225 230 235 240 Ser Ala Leu Val Lys Lys Tyr Leu 245 <210> 9 <211> 442 <212> DNA <213> Influenza B virus <400> 9 agcagaagca gaggatttgt ttagtcactg gcaaacagga aaaatggcgg acaatatgac 60 cacaacacaa attgagtgga ggatgaagaa gatggccatc ggatcctcaa ttcactcttc 120 gagcgtctta atgaaggaca ttcaaagcca attcgagcag ctgaaactgc ggtgggagtc 180 ttatcccaat ttggtcaaga gcaccgatta tcaccagaag agggagacaa ttagactggt 240 cacggaagaa ctttatcttt taagtaaaag aattgatgat aacatattgt tccacaaaac 300 agtaatagct aacagctcca taatagctga catggttgta tcattatcat tattagaaac 360 attgtatgaa atgaaggatg tggttgaagt gtacagcagg cagtgcttgt gaatttaaaa 420 taaaaatcct cttgttacta ct 442 <210> 10 <211> 122 <212> PRT <213> Influenza B virus <400> 10 Met Ala Asp Asn Met Thr Thr Thr Gln Ile Glu Trp Arg Met Lys Lys 1 5 10 15 Met Ala Ile Gly Ser Ser Ile His Ser Ser Ser Val Leu Met Lys Asp 20 25 30 Ile Gln Ser Gln Phe Glu Gln Leu Lys Leu Arg Trp Glu Ser Tyr Pro 35 40 45 Asn Leu Val Lys Ser Thr Asp Tyr His Gln Lys Arg Glu Thr Ile Arg 50 55 60 Leu Val Thr Glu Glu Leu Tyr Leu Leu Ser Lys Lys Ile Asp Asp Asn 65 70 75 80 Ile Leu Phe His Lys Thr Val Ile Ala Asn Ser Ser Ile Ile Ala Asp 85 90 95 Met Val Val Ser Leu Ser Leu Leu Glu Thr Leu Tyr Glu Met Lys Asp 100 105 110 Val Val Glu Val Tyr Ser Arg Gln Cys Leu 115 120 <210> 11 <211> 442 <212> DNA <213> Artificial sequence <220> <223> NS2 K75R R76G <400> 11 agcagaagca gaggatttgt ttagtcactg gcaaacagga aaaatggcgg acaatatgac 60 cacaacacaa attgagtgga ggatgaagaa gatggccatc ggatcctcaa ttcactcttc 120 gagcgtctta atgaaggaca ttcaaagcca attcgagcag ctgaaactgc ggtgggagtc 180 ttatcccaat ttggtcaaga gcaccgatta tcaccagaag agggagacaa ttagactggt 240 cacggaagaa ctttatcttt taagtagagg aattgatgat aacatattgt tccacaaaac 300 agtaatagct aacagctcca taatagctga catggttgta tcattatcat tattagaaac 360 attgtatgaa atgaaggatg tggttgaagt gtacagcagg cagtgcttgt gaatttaaaa 420 taaaaatcct cttgttacta ct 442 <210> 12 <211> 122 <212> PRT <213> Artificial sequence <220> <223> NS2 K75R R76G <400> 12 Met Ala Asp Asn Met Thr Thr Thr Gln Ile Glu Trp Arg Met Lys Lys 1 5 10 15 Met Ala Ile Gly Ser Ser Ile His Ser Ser Ser Val Leu Met Lys Asp 20 25 30 Ile Gln Ser Gln Phe Glu Gln Leu Lys Leu Arg Trp Glu Ser Tyr Pro 35 40 45 Asn Leu Val Lys Ser Thr Asp Tyr His Gln Lys Arg Glu Thr Ile Arg 50 55 60 Leu Val Thr Glu Glu Leu Tyr Leu Leu Ser Arg Gly Ile Asp Asp Asn 65 70 75 80 Ile Leu Phe His Lys Thr Val Ile Ala Asn Ser Ser Ile Ile Ala Asp 85 90 95 Met Val Val Ser Leu Ser Leu Leu Glu Thr Leu Tyr Glu Met Lys Asp 100 105 110 Val Val Glu Val Tyr Ser Arg Gln Cys Leu 115 120 <210> 13 <211> 2369 <212> DNA <213> Influenza B virus <400> 13 agcagaagcg gagcctttaa gatgaatata aatccttatt ttctcttcat agatgtaccc 60 atacaggcag caatttcaac aacattccca tacaccggtg ttccccctta ttcccatgga 120 acgggaacag gctacacaat agacaccgtg atcagaacac atgagtactc gaacaaagga 180 aaacagtatg tttctgacat cacaggatgt acaatgatag atccaacaaa tgggccatta 240 cctgaagaca atgagccaag tgcctatgca caattagatt gcgttctgga ggctttggat 300 agaatggatg aggaacatcc aggtctgttt caagcagcct cacagaatgc catggaggca 360 ctaatggtca caactgtaga caaattaacc caggggagac agactttcga ttggacagta 420 tgcagaaacc agcctgctgc aacggcacta aacacaacaa taacctcctt cagattgaat 480 gatttgaatg gagctgacaa gggtggattg gtaccctttt gccaagatat cattgattca 540 ttagacaagc ctgaaatgac tttcttctca gtaaagaata taaagaaaaa attgcctgct 600 aaaaacagaa agggtttcct cataaagaga ataccaatga aagtaaaaga caggatatcc 660 agagtggaat acatcaaaag agcattgtca ttaaacacaa tgacaaaaga tgctgaaagg 720 ggcaaactaa aaagaagagc gattgcaacc gctggaatac aaatcagagg gtttgtatta 780 gtagttgaaa acttggctaa aaacatctgt gaaaatctag aacaaagtgg tttgcccgtg 840 ggtggaaatg aaaagaaggc caaactgtca aatgcagtgg ccaaaatgct cagtaactgc 900 ccaccaggag ggatcagcat gacagtaaca ggagacaata ctaaatggaa tgaatgctta 960 aatccacgaa tctttttggc tatgactgaa agaataacca gagacagccc aatttggttc 1020 cgggattttt gtagtatagc accggtcttg ttctccaaca aaatagccag attggggaaa 1080 ggatttatga taacaagtaa aacaaaaaga ctaaaggctc aaataccttg tcctgatctg 1140 ttcagcatac cattagaaag atataatgaa gaaacaaggg cgaaattaaa aaggctgaag 1200 ccattcttca atgaagaagg aacggcatct ttgtcgcctg ggatgatgat gggaatgttt 1260 aatatgctat ctaccgtgtt gggagtagca gcactaggca tcaaaaacat tggaaacaag 1320 gaatacttat gggatggact gcaatcttcc gatgattttg ctttgtttgt taatgcaaaa 1380 gatgaagaaa catgtatgga agggataaac gatttttacc gaacatgtaa attattggga 1440 ataaacatga gcaaaaagaa aagttactgt aacgaaactg gaatgtttga atttacaagc 1500 atgttctata gagatggatt tgtatctaac tttgcaatgg aaattccttc atttggagtt 1560 gctggagtaa atgaatcagc agatatggca ataggaatga caataataaa gaacaatatg 1620 attaacaatg ggatgggtcc agcaacagca caaacagcca tacaattgtt catagctgat 1680 tataggtaca catacaaatg ccacagagga gattccaaag tggaaggaaa aagaatgaaa 1740 attataaagg agctatggga aaacactaaa ggaagagatg gtctgttagt agcagatggt 1800 gggcccaaca tttacaattt gagaaactta catatcccag aaatagtatt gaagtacaac 1860 ctaatggacc ctgaatacaa agggcggtta cttcaccctc aaaatccctt tgtaggacat 1920 ttgtctattg aaggcatcaa agaagcagat ataaccccag cacatggtcc tgtgaggaaa 1980 atggattatg atgcagtgtc tggaactcat agttggagaa ccaaaaggaa cagatctata 2040 ctaaatactg atcagaggaa catgattctt gaagaacaat gctacgctaa atgttgcaat 2100 ctttttgagg cctgttttaa cagtgcatca tacaggaaac cagtagggca gcatagcatg 2160 cttgaggcta tggcccatag attaagaatg gatgcacgac tagattatga atcaggaaga 2220 atgtcaaagg atgattttga gaaagcaatg gctcaccttg gtgagattgg gtacacataa 2280 gctccgaaga tgtccatggg gttattggtc atcattggat acatgtgata aacaaatgat 2340 taaaatgaaa aaaggctcgt gtttctact 2369 <210> 14 <211> 752 <212> PRT <213> Influenza B virus <400> 14 Met Asn Ile Asn Pro Tyr Phe Leu Phe Ile Asp Val Pro Ile Gln Ala 1 5 10 15 Ala Ile Ser Thr Thr Phe Pro Tyr Thr Gly Val Pro Pro Tyr Ser His 20 25 30 Gly Thr Gly Thr Gly Tyr Thr Ile Asp Thr Val Ile Arg Thr His Glu 35 40 45 Tyr Ser Asn Lys Gly Lys Gln Tyr Val Ser Asp Ile Thr Gly Cys Thr 50 55 60 Met Ile Asp Pro Thr Asn Gly Pro Leu Pro Glu Asp Asn Glu Pro Ser 65 70 75 80 Ala Tyr Ala Gln Leu Asp Cys Val Leu Glu Ala Leu Asp Arg Met Asp 85 90 95 Glu Glu His Pro Gly Leu Phe Gln Ala Ala Ser Gln Asn Ala Met Glu 100 105 110 Ala Leu Met Val Thr Thr Val Asp Lys Leu Thr Gln Gly Arg Gln Thr 115 120 125 Phe Asp Trp Thr Val Cys Arg Asn Gln Pro Ala Ala Thr Ala Leu Asn 130 135 140 Thr Thr Ile Thr Ser Phe Arg Leu Asn Asp Leu Asn Gly Ala Asp Lys 145 150 155 160 Gly Gly Leu Val Pro Phe Cys Gln Asp Ile Ile Asp Ser Leu Asp Lys 165 170 175 Pro Glu Met Thr Phe Phe Ser Val Lys Asn Ile Lys Lys Lys Leu Pro 180 185 190 Ala Lys Asn Arg Lys Gly Phe Leu Ile Lys Arg Ile Pro Met Lys Val 195 200 205 Lys Asp Arg Ile Ser Arg Val Glu Tyr Ile Lys Arg Ala Leu Ser Leu 210 215 220 Asn Thr Met Thr Lys Asp Ala Glu Arg Gly Lys Leu Lys Arg Arg Ala 225 230 235 240 Ile Ala Thr Ala Gly Ile Gln Ile Arg Gly Phe Val Leu Val Val Glu 245 250 255 Asn Leu Ala Lys Asn Ile Cys Glu Asn Leu Glu Gln Ser Gly Leu Pro 260 265 270 Val Gly Gly Asn Glu Lys Lys Ala Lys Leu Ser Asn Ala Val Ala Lys 275 280 285 Met Leu Ser Asn Cys Pro Pro Gly Gly Ile Ser Met Thr Val Thr Gly 290 295 300 Asp Asn Thr Lys Trp Asn Glu Cys Leu Asn Pro Arg Ile Phe Leu Ala 305 310 315 320 Met Thr Glu Arg Ile Thr Arg Asp Ser Pro Ile Trp Phe Arg Asp Phe 325 330 335 Cys Ser Ile Ala Pro Val Leu Phe Ser Asn Lys Ile Ala Arg Leu Gly 340 345 350 Lys Gly Phe Met Ile Thr Ser Lys Thr Lys Arg Leu Lys Ala Gln Ile 355 360 365 Pro Cys Pro Asp Leu Phe Ser Ile Pro Leu Glu Arg Tyr Asn Glu Glu 370 375 380 Thr Arg Ala Lys Leu Lys Arg Leu Lys Pro Phe Phe Asn Glu Glu Gly 385 390 395 400 Thr Ala Ser Leu Ser Pro Gly Met Met Met Gly Met Phe Asn Met Leu 405 410 415 Ser Thr Val Leu Gly Val Ala Ala Leu Gly Ile Lys Asn Ile Gly Asn 420 425 430 Lys Glu Tyr Leu Trp Asp Gly Leu Gln Ser Ser Asp Asp Phe Ala Leu 435 440 445 Phe Val Asn Ala Lys Asp Glu Glu Thr Cys Met Glu Gly Ile Asn Asp 450 455 460 Phe Tyr Arg Thr Cys Lys Leu Leu Gly Ile Asn Met Ser Lys Lys Lys 465 470 475 480 Ser Tyr Cys Asn Glu Thr Gly Met Phe Glu Phe Thr Ser Met Phe Tyr 485 490 495 Arg Asp Gly Phe Val Ser Asn Phe Ala Met Glu Ile Pro Ser Phe Gly 500 505 510 Val Ala Gly Val Asn Glu Ser Ala Asp Met Ala Ile Gly Met Thr Ile 515 520 525 Ile Lys Asn Asn Met Ile Asn Asn Gly Met Gly Pro Ala Thr Ala Gln 530 535 540 Thr Ala Ile Gln Leu Phe Ile Ala Asp Tyr Arg Tyr Thr Tyr Lys Cys 545 550 555 560 His Arg Gly Asp Ser Lys Val Glu Gly Lys Arg Met Lys Ile Ile Lys 565 570 575 Glu Leu Trp Glu Asn Thr Lys Gly Arg Asp Gly Leu Leu Val Ala Asp 580 585 590 Gly Gly Pro Asn Ile Tyr Asn Leu Arg Asn Leu His Ile Pro Glu Ile 595 600 605 Val Leu Lys Tyr Asn Leu Met Asp Pro Glu Tyr Lys Gly Arg Leu Leu 610 615 620 His Pro Gln Asn Pro Phe Val Gly His Leu Ser Ile Glu Gly Ile Lys 625 630 635 640 Glu Ala Asp Ile Thr Pro Ala His Gly Pro Val Arg Lys Met Asp Tyr 645 650 655 Asp Ala Val Ser Gly Thr His Ser Trp Arg Thr Lys Arg Asn Arg Ser 660 665 670 Ile Leu Asn Thr Asp Gln Arg Asn Met Ile Leu Glu Glu Gln Cys Tyr 675 680 685 Ala Lys Cys Cys Asn Leu Phe Glu Ala Cys Phe Asn Ser Ala Ser Tyr 690 695 700 Arg Lys Pro Val Gly Gln His Ser Met Leu Glu Ala Met Ala His Arg 705 710 715 720 Leu Arg Met Asp Ala Arg Leu Asp Tyr Glu Ser Gly Arg Met Ser Lys 725 730 735 Asp Asp Phe Glu Lys Ala Met Ala His Leu Gly Glu Ile Gly Tyr Thr 740 745 750 <210> 15 <211> 2369 <212> DNA <213> Artificial sequence <220> <223> PB1 D67N <400> 15 agcagaagcg gagcctttaa gatgaatata aatccttatt ttctcttcat agatgtaccc 60 atacaggcag caatttcaac aacattccca tacaccggtg ttccccctta ttcccatgga 120 acgggaacag gctacacaat agacaccgtg atcagaacac atgagtactc gaacaaagga 180 aaacagtatg tttctgacat cacaggatgt acaatgataa atccaacaaa tgggccatta 240 cctgaagaca atgagccaag tgcctatgca caattagatt gcgttctgga ggctttggat 300 agaatggatg aggaacatcc aggtctgttt caagcagcct cacagaatgc catggaggca 360 ctaatggtca caactgtaga caaattaacc caggggagac agactttcga ttggacagta 420 tgcagaaacc agcctgctgc aacggcacta aacacaacaa taacctcctt cagattgaat 480 gatttgaatg gagctgacaa gggtggattg gtaccctttt gccaagatat cattgattca 540 ttagacaagc ctgaaatgac tttcttctca gtaaagaata taaagaaaaa attgcctgct 600 aaaaacagaa agggtttcct cataaagaga ataccaatga aagtaaaaga caggatatcc 660 agagtggaat acatcaaaag agcattgtca ttaaacacaa tgacaaaaga tgctgaaagg 720 ggcaaactaa aaagaagagc gattgcaacc gctggaatac aaatcagagg gtttgtatta 780 gtagttgaaa acttggctaa aaacatctgt gaaaatctag aacaaagtgg tttgcccgtg 840 ggtggaaatg aaaagaaggc caaactgtca aatgcagtgg ccaaaatgct cagtaactgc 900 ccaccaggag ggatcagcat gacagtaaca ggagacaata ctaaatggaa tgaatgctta 960 aatccacgaa tctttttggc tatgactgaa agaataacca gagacagccc aatttggttc 1020 cgggattttt gtagtatagc accggtcttg ttctccaaca aaatagccag attggggaaa 1080 ggatttatga taacaagtaa aacaaaaaga ctaaaggctc aaataccttg tcctgatctg 1140 ttcagcatac cattagaaag atataatgaa gaaacaaggg cgaaattaaa aaggctgaag 1200 ccattcttca atgaagaagg aacggcatct ttgtcgcctg ggatgatgat gggaatgttt 1260 aatatgctat ctaccgtgtt gggagtagca gcactaggca tcaaaaacat tggaaacaag 1320 gaatacttat gggatggact gcaatcttcc gatgattttg ctttgtttgt taatgcaaaa 1380 gatgaagaaa catgtatgga agggataaac gatttttacc gaacatgtaa attattggga 1440 ataaacatga gcaaaaagaa aagttactgt aacgaaactg gaatgtttga atttacaagc 1500 atgttctata gagatggatt tgtatctaac tttgcaatgg aaattccttc atttggagtt 1560 gctggagtaa atgaatcagc agatatggca ataggaatga caataataaa gaacaatatg 1620 attaacaatg ggatgggtcc agcaacagca caaacagcca tacaattgtt catagctgat 1680 tataggtaca catacaaatg ccacagagga gattccaaag tggaaggaaa aagaatgaaa 1740 attataaagg agctatggga aaacactaaa ggaagagatg gtctgttagt agcagatggt 1800 gggcccaaca tttacaattt gagaaactta catatcccag aaatagtatt gaagtacaac 1860 ctaatggacc ctgaatacaa agggcggtta cttcaccctc aaaatccctt tgtaggacat 1920 ttgtctattg aaggcatcaa agaagcagat ataaccccag cacatggtcc tgtgaggaaa 1980 atggattatg atgcagtgtc tggaactcat agttggagaa ccaaaaggaa cagatctata 2040 ctaaatactg atcagaggaa catgattctt gaagaacaat gctacgctaa atgttgcaat 2100 ctttttgagg cctgttttaa cagtgcatca tacaggaaac cagtagggca gcatagcatg 2160 cttgaggcta tggcccatag attaagaatg gatgcacgac tagattatga atcaggaaga 2220 atgtcaaagg atgattttga gaaagcaatg gctcaccttg gtgagattgg gtacacataa 2280 gctccgaaga tgtccatggg gttattggtc atcattggat acatgtgata aacaaatgat 2340 taaaatgaaa aaaggctcgt gtttctact 2369 <210> 16 <211> 752 <212> PRT <213> Artificial Sequence <220> <223> PB1 D67N <400> 16 Met Asn Ile Asn Pro Tyr Phe Leu Phe Ile Asp Val Pro Ile Gln Ala 1 5 10 15 Ala Ile Ser Thr Thr Phe Pro Tyr Thr Gly Val Pro Pro Tyr Ser His 20 25 30 Gly Thr Gly Thr Gly Tyr Thr Ile Asp Thr Val Ile Arg Thr His Glu 35 40 45 Tyr Ser Asn Lys Gly Lys Gln Tyr Val Ser Asp Ile Thr Gly Cys Thr 50 55 60 Met Ile Asn Pro Thr Asn Gly Pro Leu Pro Glu Asp Asn Glu Pro Ser 65 70 75 80 Ala Tyr Ala Gln Leu Asp Cys Val Leu Glu Ala Leu Asp Arg Met Asp 85 90 95 Glu Glu His Pro Gly Leu Phe Gln Ala Ala Ser Gln Asn Ala Met Glu 100 105 110 Ala Leu Met Val Thr Thr Val Asp Lys Leu Thr Gln Gly Arg Gln Thr 115 120 125 Phe Asp Trp Thr Val Cys Arg Asn Gln Pro Ala Ala Thr Ala Leu Asn 130 135 140 Thr Thr Ile Thr Ser Phe Arg Leu Asn Asp Leu Asn Gly Ala Asp Lys 145 150 155 160 Gly Gly Leu Val Pro Phe Cys Gln Asp Ile Ile Asp Ser Leu Asp Lys 165 170 175 Pro Glu Met Thr Phe Phe Ser Val Lys Asn Ile Lys Lys Lys Leu Pro 180 185 190 Ala Lys Asn Arg Lys Gly Phe Leu Ile Lys Arg Ile Pro Met Lys Val 195 200 205 Lys Asp Arg Ile Ser Arg Val Glu Tyr Ile Lys Arg Ala Leu Ser Leu 210 215 220 Asn Thr Met Thr Lys Asp Ala Glu Arg Gly Lys Leu Lys Arg Arg Ala 225 230 235 240 Ile Ala Thr Ala Gly Ile Gln Ile Arg Gly Phe Val Leu Val Val Glu 245 250 255 Asn Leu Ala Lys Asn Ile Cys Glu Asn Leu Glu Gln Ser Gly Leu Pro 260 265 270 Val Gly Gly Asn Glu Lys Lys Ala Lys Leu Ser Asn Ala Val Ala Lys 275 280 285 Met Leu Ser Asn Cys Pro Pro Gly Gly Ile Ser Met Thr Val Thr Gly 290 295 300 Asp Asn Thr Lys Trp Asn Glu Cys Leu Asn Pro Arg Ile Phe Leu Ala 305 310 315 320 Met Thr Glu Arg Ile Thr Arg Asp Ser Pro Ile Trp Phe Arg Asp Phe 325 330 335 Cys Ser Ile Ala Pro Val Leu Phe Ser Asn Lys Ile Ala Arg Leu Gly 340 345 350 Lys Gly Phe Met Ile Thr Ser Lys Thr Lys Arg Leu Lys Ala Gln Ile 355 360 365 Pro Cys Pro Asp Leu Phe Ser Ile Pro Leu Glu Arg Tyr Asn Glu Glu 370 375 380 Thr Arg Ala Lys Leu Lys Arg Leu Lys Pro Phe Phe Asn Glu Glu Gly 385 390 395 400 Thr Ala Ser Leu Ser Pro Gly Met Met Met Gly Met Phe Asn Met Leu 405 410 415 Ser Thr Val Leu Gly Val Ala Ala Leu Gly Ile Lys Asn Ile Gly Asn 420 425 430 Lys Glu Tyr Leu Trp Asp Gly Leu Gln Ser Ser Asp Asp Phe Ala Leu 435 440 445 Phe Val Asn Ala Lys Asp Glu Glu Thr Cys Met Glu Gly Ile Asn Asp 450 455 460 Phe Tyr Arg Thr Cys Lys Leu Leu Gly Ile Asn Met Ser Lys Lys Lys 465 470 475 480 Ser Tyr Cys Asn Glu Thr Gly Met Phe Glu Phe Thr Ser Met Phe Tyr 485 490 495 Arg Asp Gly Phe Val Ser Asn Phe Ala Met Glu Ile Pro Ser Phe Gly 500 505 510 Val Ala Gly Val Asn Glu Ser Ala Asp Met Ala Ile Gly Met Thr Ile 515 520 525 Ile Lys Asn Asn Met Ile Asn Asn Gly Met Gly Pro Ala Thr Ala Gln 530 535 540 Thr Ala Ile Gln Leu Phe Ile Ala Asp Tyr Arg Tyr Thr Tyr Lys Cys 545 550 555 560 His Arg Gly Asp Ser Lys Val Glu Gly Lys Arg Met Lys Ile Ile Lys 565 570 575 Glu Leu Trp Glu Asn Thr Lys Gly Arg Asp Gly Leu Leu Val Ala Asp 580 585 590 Gly Gly Pro Asn Ile Tyr Asn Leu Arg Asn Leu His Ile Pro Glu Ile 595 600 605 Val Leu Lys Tyr Asn Leu Met Asp Pro Glu Tyr Lys Gly Arg Leu Leu 610 615 620 His Pro Gln Asn Pro Phe Val Gly His Leu Ser Ile Glu Gly Ile Lys 625 630 635 640 Glu Ala Asp Ile Thr Pro Ala His Gly Pro Val Arg Lys Met Asp Tyr 645 650 655 Asp Ala Val Ser Gly Thr His Ser Trp Arg Thr Lys Arg Asn Arg Ser 660 665 670 Ile Leu Asn Thr Asp Gln Arg Asn Met Ile Leu Glu Glu Gln Cys Tyr 675 680 685 Ala Lys Cys Cys Asn Leu Phe Glu Ala Cys Phe Asn Ser Ala Ser Tyr 690 695 700 Arg Lys Pro Val Gly Gln His Ser Met Leu Glu Ala Met Ala His Arg 705 710 715 720 Leu Arg Met Asp Ala Arg Leu Asp Tyr Glu Ser Gly Arg Met Ser Lys 725 730 735 Asp Asp Phe Glu Lys Ala Met Ala His Leu Gly Glu Ile Gly Tyr Thr 740 745 750 <210> 17 <211> 32 <212> PRT <213> Influenza B virus <400> 17 Cys Gly Cys Ala Gly Thr Cys Gly Gly Thr Ala Cys Thr Thr Thr Thr 1 5 10 15 Thr Thr Thr Thr Thr Thr Thr Thr Thr Thr Thr Thr Thr Thr Val Asn 20 25 30 <210> 18 <211> 33 <212> PRT <213> Influenza B virus <400> 18 Ala Ala Gly Cys Ala Gly Thr Gly Gly Thr Ala Thr Cys Ala Ala Cys 1 5 10 15 Gly Cys Ala Gly Ala Gly Thr Ala Cys Gly Cys Arg Gly Arg Gly Arg 20 25 30 Gly <210> 19 <211> 1190 <212> DNA <213> Artificial Sequence <220> <223> M1 K93R <400> 19 agcagaagca cgcactttct taaaatgtcg ctgtttggag acacaattgc ctacctgctt 60 tcattgacag aagatggaga aggcaaagca gaactagcag aaaaattaca ctgttggttc 120 ggtgggaaag aatttgacct agactctgcc ttggaatgga taaaaaacaa aagatgctta 180 actgatatac agaaagcact aattggtgcc tctatctgct ttttaaaacc caaagaccag 240 gaaagaaaaa gaagattcat cacagagccc ctatcaggaa tgggaacaac agcaacaaaa 300 aggaagggcc tgattctagc tgagagaaaa atgagaaaat gtgtgagctt ccatgaagca 360 tttgaaatag cagaaggcca tgaaagctca gcgttactat attgtctcat ggtcatgtac 420 ctgaatcctg gaaattattc aatgcaagta aaactaggaa cgctctgtgc tttgtgcgaa 480 aaacaagcat cacattcaca cagggctcat agcagagcag cgagatcttc agtgcccgga 540 gtgagacggg aaatgcagat ggtctcagct atgaacacag caaaaacaat gaatggaatg 600 ggaaaaggag aagacgtcca aaaactggca gaagaactgc aaagcaacat tggagtattg 660 agatctcttg gggcaagtca aaagaatggg gaaggaattg caaaggatgt aatggaagtg 720 ctaaagcaga gctctatggg aaattcagct cttgtgaaga aatacctata atgctcgaac 780 catttcagat tctttcaatt tgttctttta ttttatcagc tctccatttc atggcttgga 840 caataggaca tttaaatcaa ataaaaagag gagtaaacat gaaaatacga ataaaggggc 900 caaataaaga gacaataaac agagaggtat caattttgag acacagttac caaaaagaaa 960 tccaggctaa agaagcaatg aaggaagtac tctctgacaa catggaggta ttgagtgacc 1020 acatagtaat tgaggggctt tctgctgaag agataataaa aatgggtgaa acagttttgg 1080 aggtagaaga atttcattaa attcaatttt tactgtactt cttactatgc atttaagcaa 1140 attgtaatca atgtcagcaa ataaactgga aaaagtgcgt tgtttctact 1190 <210> 20 <211> 248 <212> PRT <213> Artificial Sequence <220> <223> M1 K93R <400> 20 Methionine, Serine, Leucine, Phenylalanine, Glycine, Aspartic acid, Threonine, Isoleucine, Alanine, Tyrosine, Leucine, Leucine, Serine, Leucine, Threonine, Glutamic acid 1 5 10 15 Aspartic acid, Glycine, Glutamic acid, Glycine, Lysine, Alanine, Glutamic acid, Leucine, Alanine, Glutamic acid, Lysine, Leucine, Histidine, Cysteine, Tryptophan, Phenylalanine 20 25 30 Glycine, Glycine, Lysine, Glutamic acid, Phenylalanine, Aspartic acid, Leucine, Aspartic acid, Serine, Alanine, Leucine, Glutamic acid, Tryptophan, Isoleucine, Lysine, Asparagine 35 40 45 Lysine, Arginine, Cysteine, Leucine, Threonine, Aspartic acid, Isoleucine, Glutamine, Lysine, Alanine, Leucine, Isoleucine, Glycine, Alanine, Serine, Isoleucine 50 55 60 Cysteine, Phenylalanine, Leucine, Lysine, Proline, Lysine, Aspartic acid, Glutamine, Glutamic acid, Arginine, Lysine, Arginine, Arginine, Phenylalanine, Isoleucine, Threonine 65 70 75 80 Glutamic acid, Proline, Leucine, Serine, Glycine, Methionine, Glycine, Threonine, Threonine, Alanine, Threonine, Lysine, Arginine, Lysine, Glycine, Leucine 85 90 95 Isoleucine, Leucine, Alanine, Glutamic acid, Arginine, Lysine, Methionine, Arginine, Lysine, Cysteine, Valine, Serine, Phenylalanine, Histidine, Glutamic acid, Alanine 100 105 110 Phenylalanine, Glutamic acid, Isoleucine, Alanine, Glutamic acid, Glycine, Histidine, Glutamic acid, Serine, Serine, Alanine, Leucine, Leucine, Tyrosine, Cysteine, Leucine 115 120 125 Methionine, Valine, Methionine, Tyrosine, Leucine, Asparagine, Proline, Glycine, Asparagine, Tyrosine, Serine, Methionine, Glutamine, Valine, Lysine, Leucine 130 135 140 Gly Thr Leu Cys Ala Leu Cys Glu Lys Gln Ala Ser His Ser His Arg 145 150 155 160 Ala His Ser Arg Ala Ala Arg Ser Ser Val Pro Gly Val Arg Arg Glu 165 170 175 Met Gln Met Val Ser Ala Met Asn Thr Ala Lys Thr Met Asn Gly Met 180 185 190 Gly Lys Gly Glu Asp Val Gln Lys Leu Ala Glu Glu Leu Gln Ser Asn 195 200 205 Ile Gly Val Leu Arg Ser Leu Gly Ala Ser Gln Lys Asn Gly Glu Gly 210 215 220 Ile Ala Lys Asp Val Met Glu Val Leu Lys Gln Ser Ser Met Gly Asn 225 230 235 240 Ser Ala Leu Val Lys Lys Tyr Leu 245 <210> 21 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 21 cccactgctt actggcttat 20 <210> 22 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 22 cagatggctg gcaactagaa 20 <210> 23 <211> 442 <212> DNA <213> Artificial Sequence <220> <223> NS Y117H <400> 23 agcagaagca gaggatttgt ttagtcactg gcaaacagga aaaatggcgg acaatatgac 60 cacaacacaa attgagtgga ggatgaagaa gatggccatc ggatcctcaa ttcactcttc 120 gagcgtctta atgaaggaca ttcaaagcca attcgagcag ctgaaactgc ggtgggagtc 180 ttatcccaat ttggtcaaga gcaccgatta tcaccagaag agggagacaa ttagactggt 240 cacggaagaa ctttatcttt taagtaaaag aattgatgat aacatattgt tccacaaaac 300 agtaatagct aacagctcca taatagctga catggttgta tcattatcat tattagaaac 360 attgtatgaa atgaaggatg tggttgaagt gcacagcagg cagtgcttgt gaatttaaaa 420 taaaaatcct cttgttacta ct 442 <210> 24 <211> 119 <212> PRT <213> Artificial Sequence <220> <223> NS Y117H <400> 24 Met Ala Asp Asn Met Thr Thr Thr Gln Ile Glu Trp Arg Met Lys Lys 1 5 10 15 Met Ala Ile Gly Ser Ser Ile His Ser Ser Ser Val Leu Met Lys Asp 20 25 30 Ile Gln Ser Gln Phe Glu Gln Leu Lys Leu Arg Trp Glu Ser Tyr Pro 35 40 45 Asn Leu Val Lys Ser Thr Asp Tyr His Gln Lys Arg Glu Thr Ile Arg 50 55 60 Leu Val Thr Glu Glu Leu Tyr Leu Leu Ser Lys Arg Ile Asp Asp Asn 65 70 75 80 Ile Leu Phe His Lys Thr Val Ile Ala Asn Ser Ser Ile Ile Ala Asp 85 90 95 Met Val Val Ser Leu Ser Leu Leu Glu Thr Leu Tyr Glu Met Lys Asp 100 105 110 Val Val Glu Val His Ser Arg 115 <210> 25 <211> 2341 <212> DNA <213> Influenza A virus <400> 25 agcgaaagca ggtcaattat attcaatatg gaaagaataa aagaactacg aaatctaatg 60 tcgcagtctc gcacccgcga gatactcaca aaaaccaccg tggaccatat ggccataatc 120 aagaagtaca catcaggaag acaggagaag aacccagcac ttaggatgaa atggatgatg 180 gcaatgaaat atccaattac agcagacaag aggataacgg aaatgattcc tgagagaaat 240 gagcaaggac aaactttatg gagtaaaatg aatgattccg gatcagaccg agtgatggta 300 tcacctctgg ctgtgacatg gtggaatagg aatggaccaa taacaaatac agttcattat 360 ccaaaaatct acaaaactta ttttgaaaga gtcgaaaggc taaagcatgg aacctttggc 420 cctgtccatt ttagaaacca agtcaaaata cgtcggagag ttgacataaa tcctggtcat 480 gcagatctca gtgccaagga ggcacaggat gtaatcatgg aagttgtttt ccctaacgaa 540 gtgggagcca ggatactaac atcggaatcg caactaacga taaccaaaga gaagaaagaa 600 gaactccagg attgcaaaat ttctcctttg atggttgcat acatgttgga gagagaactg 660 gtccgcaaaa cgagattcct cccagtggct ggtggaacaa gcagtgtgta cattgaagtg 720 ttgcatttga ctcaaggaac atgctgggaa cagatgtata ctccaggagg ggaagtgagg 780 aatgatgatg ttgatcaaag cttgattatt gctgctagga acatagtgag aagagctgca 840 gtatcagcag atccactagc atctttattg gagatgtgcc acagcacaca gattggtgga 900 attaggatgg tagacatcct taggcagaac ccaacagaag agcaagccgt ggatatatgc 960 aaggctgcaa tgggactgag aattagctca tccttcagtt ttggtggatt cacatttaag 1020 agaacaagcg gatcatcagt caagagagag gaagaggtgc ttacgggcaa tcttcaaaca 1080 ttgaagataa gagtgcatga gggatatgaa gagttcacaa tggttgggag aagagcaaca 1140 gccatactca gaaaagcaac caggagattg attcagctga tagtgagtgg gagagacgaa 1200 cagtcgattg ccgaagcaat aattgtggcc atggtatttt cacaagagga ttgtatgata 1260 aaagcagtca gaggtgatct gaatttcgtc aatagggcaa atcaacgatt gaatcctatg 1320 catcaacttt taagacattt tcagaaggat gcgaaagtgc tttttcaaaa ttggggagtt 1380 gaacctatcg acaatgtgat gggaatgatt gggatattgc ccgacatgac tccaagcatc 1440 gagatgtcaa tgagaggagt gagaatcagc aaaatgggtg tagatgagta ctccagcacg 1500 gagagggtag tggtgagcat tgaccgtttt ttgagaatcc gggaccaacg aggaaatgta 1560 ctactgtctc ccgaggaggt cagtgaaaca cagggaacag agaaactgac aataacttac 1620 tcatcgtcaa tgatgtggga gattaatggt cctgaatcag tgttggtcaa tacctatcaa 1680 tggatcatca gaaactggga aactgttaaa attcagtggt cccagaaccc tacaatgcta 1740 tacaataaaa tggaatttga accatttcag tctttagtac ctaaggccat tagaggccaa 1800 tacagtgggt ttgtaagaac tctgttccaa caaatgaggg atgtgcttgg gacatttgat 1860 accgcacaga taataaaact tcttcccttc gcagccgctc caccaaagca aagtagaatg 1920 cagttctcct catttactgt gaatgtgagg ggatcaggaa tgagaatact tgtaaggggc 1980 aattctcctg tattcaacta taacaaggcc acgaagagac tcacagttct cggaaaggat 2040 gctggcactt taactgaaga cccagatgaa ggcacagctg gagtggagtc cgctgttctg 2100 aggggattcc tcattctggg caaagaagac aagagatatg ggccagcact aagcatcaat 2160 gaactgagca accttgcgaa aggagagaag gctaatgtgc taattgggca aggagacgtg 2220 gtgttggtaa tgaaacggaa acgggactct agcatactta ctgacagcca gacagcgacc 2280 aaaagaattc ggatggccat caattagtgt cgaatagttt aaaaacgacc ttgtttctac 2340 t 2341 <210> 26 <211> 759 <212> PRT <213> Influenza A virus <400> 26 Met Glu Arg Ile Lys Glu Leu Arg Asn Leu Met Ser Gln Ser Arg Thr 1 5 10 15 Arg Glu Ile Leu Thr Lys Thr Thr Val Asp His Met Ala Ile Ile Lys 20 25 30 Lys Tyr Thr Ser Gly Arg Gln Glu Lys Asn Pro Ala Leu Arg Met Lys 35 40 45 Trp Met Met Ala Met Lys Tyr Pro Ile Thr Ala Asp Lys Arg Ile Thr 50 55 60 Glu Met Ile Pro Glu Arg Asn Glu Gln Gly Gln Thr Leu Trp Ser Lys 65 70 75 80 Met Asn Asp Ser Gly Ser Asp Arg Val Met Val Ser Pro Leu Ala Val 85 90 95 Thr Trp Trp Asn Arg Asn Gly Pro Ile Thr Asn Thr Val His Tyr Pro 100 105 110 Lys Ile Tyr Lys Thr Tyr Phe Glu Arg Val Glu Arg Leu Lys His Gly 115 120 125 Thr Phe Gly Pro Val His Phe Arg Asn Gln Val Lys Ile Arg Arg Arg 130 135 140 Val Asp Ile Asn Pro Gly His Ala Asp Leu Ser Ala Lys Glu Ala Gln 145 150 155 160 Asp Val Ile Met Glu Val Val Phe Pro Asn Glu Val Gly Ala Arg Ile 165 170 175 Leu Thr Ser Glu Ser Gln Leu Thr Ile Thr Lys Glu Lys Lys Glu Glu 180 185 190 Leu Gln Asp Cys Lys Ile Ser Pro Leu Met Val Ala Tyr Met Leu Glu 195 200 205 Arg Glu Leu Val Arg Lys Thr Arg Phe Leu Pro Val Ala Gly Gly Thr 210 215 220 Ser Ser Val Tyr Ile Glu Val Leu His Leu Thr Gln Gly Thr Cys Trp 225 230 235 240 Glu Gln Met Tyr Thr Pro Gly Gly Glu Val Arg Asn Asp Asp Val Asp 245 250 255 Gln Ser Leu Ile Ile Ala Ala Arg Asn Ile Val Arg Arg Ala Ala Val 260 265 270 Ser Ala Asp Pro Leu Ala Ser Leu Leu Glu Met Cys His Ser Thr Gln 275 280 285 Ile Gly Gly Ile Arg Met Val Asp Ile Leu Arg Gln Asn Pro Thr Glu 290 295 300 Glu Gln Ala Val Asp Ile Cys Lys Ala Ala Met Gly Leu Arg Ile Ser 305 310 315 320 Ser Ser Phe Ser Phe Gly Gly Phe Thr Phe Lys Arg Thr Ser Gly Ser 325 330 335 Ser Val Lys Arg Glu Glu Glu Val Leu Thr Gly Asn Leu Gln Thr Leu 340 345 350 Lys Ile Arg Val His Glu Gly Tyr Glu Glu Phe Thr Met Val Gly Arg 355 360 365 Arg Ala Thr Ala Ile Leu Arg Lys Ala Thr Arg Arg Leu Ile Gln Leu 370 375 380 Ile Val Ser Gly Arg Asp Glu Gln Ser Ile Ala Glu Ala Ile Ile Val 385 390 395 400 Ala Met Val Phe Ser Gln Glu Asp Cys Met Ile Lys Ala Val Arg Gly 405 410 415 Asp Leu Asn Phe Val Asn Arg Ala Asn Gln Arg Leu Asn Pro Met His 420 425 430 Gln Leu Leu Arg His Phe Gln Lys Asp Ala Lys Val Leu Phe Gln Asn 435 440 445 Trp Gly Val Glu Pro Ile Asp Asn Val Met Gly Met Ile Gly Ile Leu 450 455 460 Pro Asp Met Thr Pro Ser Ile Glu Met Ser Met Arg Gly Val Arg Ile 465 470 475 480 Ser Lys Met Gly Val Asp Glu Tyr Ser Ser Thr Glu Arg Val Val Val 485 490 495 Ser Ile Asp Arg Phe Leu Arg Ile Arg Asp Gln Arg Gly Asn Val Leu 500 505 510 Leu Ser Pro Glu Glu Val Ser Glu Thr Gln Gly Thr Glu Lys Leu Thr 515 520 525 Ile Thr Tyr Ser Ser Ser Met Met Trp Glu Ile Asn Gly Pro Glu Ser 530 535 540 Val Leu Val Asn Thr Tyr Gln Trp Ile Ile Arg Asn Trp Glu Thr Val 545 550 555 560 Lys Ile Gln Trp Ser Gln Asn Pro Thr Met Leu Tyr Asn Lys Met Glu 565 570 575 Phe Glu Pro Phe Gln Ser Leu Val Pro Lys Ala Ile Arg Gly Gln Tyr 580 585 590 Ser Gly Phe Val Arg Thr Leu Phe Gln Gln Met Arg Asp Val Leu Gly 595 600 605 Thr Phe Asp Thr Ala Gln Ile Ile Lys Leu Leu Pro Phe Ala Ala Ala 610 615 620 Pro Pro Lys Gln Ser Arg Met Gln Phe Ser Ser Phe Thr Val Asn Val 625 630 635 640 Arg Gly Ser Gly Met Arg Ile Leu Val Arg Gly Asn Ser Pro Val Phe 645 650 655 Asn Tyr Asn Lys Ala Thr Lys Arg Leu Thr Val Leu Gly Lys Asp Ala 660 665 670 Gly Thr Leu Thr Glu Asp Pro Asp Glu Gly Thr Ala Gly Val Glu Ser 675 680 685 Ala Val Leu Arg Gly Phe Leu Ile Leu Gly Lys Glu Asp Lys Arg Tyr 690 695 700 Gly Pro Ala Leu Ser Ile Asn Glu Leu Ser Asn Leu Ala Lys Gly Glu 705 710 715 720 Lys Ala Asn Val Leu Ile Gly Gln Gly Asp Val Val Leu Val Met Lys 725 730 735 Arg Lys Arg Asp Ser Ser Ile Leu Thr Asp Ser Gln Thr Ala Thr Lys 740 745 750 Arg Ile Arg Met Ala Ile Asn 755 <210> 27 <211> 2341 <212> DNA <213> Artificial sequence <220> <223> PB2 K80R <400> 27 agcgaaagca ggtcaattat attcaatatg gaaagaataa aagaactacg aaatctaatg 60 tcgcagtctc gcacccgcga gatactcaca aaaaccaccg tggaccatat ggccataatc 120 aagaagtaca catcaggaag acaggagaag aacccagcac ttaggatgaa atggatgatg 180 gcaatgaaat atccaattac agcagacaag aggataacgg aaatgattcc tgagagaaat 240 gagcaaggac aaactttatg gagtagaatg aatgattccg gatcagaccg agtgatggta 300 tcacctctgg ctgtgacatg gtggaatagg aatggaccaa taacaaatac agttcattat 360 ccaaaaatct acaaaactta ttttgaaaga gtcgaaaggc taaagcatgg aacctttggc 420 cctgtccatt ttagaaacca agtcaaaata cgtcggagag ttgacataaa tcctggtcat 480 gcagatctca gtgccaagga ggcacaggat gtaatcatgg aagttgtttt ccctaacgaa 540 gtgggagcca ggatactaac atcggaatcg caactaacga taaccaaaga gaagaaagaa 600 gaactccagg attgcaaaat ttctcctttg atggttgcat acatgttgga gagagaactg 660 gtccgcaaaa cgagattcct cccagtggct ggtggaacaa gcagtgtgta cattgaagtg 720 ttgcatttga ctcaaggaac atgctgggaa cagatgtata ctccaggagg ggaagtgagg 780 aatgatgatg ttgatcaaag cttgattatt gctgctagga acatagtgag aagagctgca 840 gtatcagcag atccactagc atctttattg gagatgtgcc acagcacaca gattggtgga 900 attaggatgg tagacatcct taggcagaac ccaacagaag agcaagccgt ggatatatgc 960 aaggctgcaa tgggactgag aattagctca tccttcagtt ttggtggatt cacatttaag 1020 agaacaagcg gatcatcagt caagagagag gaagaggtgc ttacgggcaa tcttcaaaca 1080 ttgaagataa gagtgcatga gggatatgaa gagttcacaa tggttgggag aagagcaaca 1140 gccatactca gaaaagcaac caggagattg attcagctga tagtgagtgg gagagacgaa 1200 cagtcgattg ccgaagcaat aattgtggcc atggtatttt cacaagagga ttgtatgata 1260 aaagcagtca gaggtgatct gaatttcgtc aatagggcaa atcaacgatt gaatcctatg 1320 catcaacttt taagacattt tcagaaggat gcgaaagtgc tttttcaaaa ttggggagtt 1380 gaacctatcg acaatgtgat gggaatgatt gggatattgc ccgacatgac tccaagcatc 1440 gagatgtcaa tgagaggagt gagaatcagc aaaatgggtg tagatgagta ctccagcacg 1500 gagagggtag tggtgagcat tgaccgtttt ttgagaatcc gggaccaacg aggaaatgta 1560 ctactgtctc ccgaggaggt cagtgaaaca cagggaacag agaaactgac aataacttac 1620 tcatcgtcaa tgatgtggga gattaatggt cctgaatcag tgttggtcaa tacctatcaa 1680 tggatcatca gaaactggga aactgttaaa attcagtggt cccagaaccc tacaatgcta 1740 tacaataaaa tggaatttga accatttcag tctttagtac ctaaggccat tagaggccaa 1800 tacagtgggt ttgtaagaac tctgttccaa caaatgaggg atgtgcttgg gacatttgat 1860 accgcacaga taataaaact tcttcccttc gcagccgctc caccaaagca aagtagaatg 1920 cagttctcct catttactgt gaatgtgagg ggatcaggaa tgagaatact tgtaaggggc 1980 aattctcctg tattcaacta taacaaggcc acgaagagac tcacagttct cggaaaggat 2040 gctggcactt taactgaaga cccagatgaa ggcacagctg gagtggagtc cgctgttctg 2100 aggggattcc tcattctggg caaagaagac aagagatatg ggccagcact aagcatcaat 2160 gaactgagca accttgcgaa aggagagaag gctaatgtgc taattgggca aggagacgtg 2220 gtgttggtaa tgaaacggaa acgggactct agcatactta ctgacagcca gacagcgacc 2280 aaaagaattc ggatggccat caattagtgt cgaatagttt aaaaacgacc ttgtttctac 2340 t 2341 <210> 28 <211> 759 <212> PRT <213> Artificial Sequence <220> <223> PB2 K80R <400> 28 Met Glu Arg Ile Lys Glu Leu Arg Asn Leu Met Ser Gln Ser Arg Thr 1 5 10 15 Arg Glu Ile Leu Thr Lys Thr Thr Val Asp His Met Ala Ile Ile Lys 20 25 30 Lys Tyr Thr Ser Gly Arg Gln Glu Lys Asn Pro Ala Leu Arg Met Lys 35 40 45 Trp Met Met Ala Met Lys Tyr Pro Ile Thr Ala Asp Lys Arg Ile Thr 50 55 60 Glu Met Ile Pro Glu Arg Asn Glu Gln Gly Gln Thr Leu Trp Ser Arg 65 70 75 80 Met Asn Asp Ser Gly Ser Asp Arg Val Met Val Ser Pro Leu Ala Val 85 90 95 Thr Trp Trp Asn Arg Asn Gly Pro Ile Thr Asn Thr Val His Tyr Pro 100 105 110 Lys Ile Tyr Lys Thr Tyr Phe Glu Arg Val Glu Arg Leu Lys His Gly 115 120 125 Thr Phe Gly Pro Val His Phe Arg Asn Gln Val Lys Ile Arg Arg Arg 130 135 140 Val Asp Ile Asn Pro Gly His Ala Asp Leu Ser Ala Lys Glu Ala Gln 145 150 155 160 Asp Val Ile Met Glu Val Val Phe Pro Asn Glu Val Gly Ala Arg Ile 165 170 175 Leu Thr Ser Glu Ser Gln Leu Thr Ile Thr Lys Glu Lys Lys Glu Glu 180 185 190 Leu Gln Asp Cys Lys Ile Ser Pro Leu Met Val Ala Tyr Met Leu Glu 195 200 205 Arg Glu Leu Val Arg Lys Thr Arg Phe Leu Pro Val Ala Gly Gly Thr 210 215 220 Ser Ser Val Tyr Ile Glu Val Leu His Leu Thr Gln Gly Thr Cys Trp 225 230 235 240 Glu Gln Met Tyr Thr Pro Gly Gly Glu Val Arg Asn Asp Asp Val Asp 245 250 255 Gln Ser Leu Ile Ile Ala Ala Arg Asn Ile Val Arg Arg Ala Ala Val 260 265 270 Ser Ala Asp Pro Leu Ala Ser Leu Leu Glu Met Cys His Ser Thr Gln 275 280 285 Ile Gly Gly Ile Arg Met Val Asp Ile Leu Arg Gln Asn Pro Thr Glu 290 295 300 Glu Gln Ala Val Asp Ile Cys Lys Ala Ala Met Gly Leu Arg Ile Ser 305 310 315 320 Ser Ser Phe Ser Phe Gly Gly Phe Thr Phe Lys Arg Thr Ser Gly Ser 325 330 335 Ser Val Lys Arg Glu Glu Glu Val Leu Thr Gly Asn Leu Gln Thr Leu 340 345 350 Lys Ile Arg Val His Glu Gly Tyr Glu Glu Phe Thr Met Val Gly Arg 355 360 365 Arg Ala Thr Ala Ile Leu Arg Lys Ala Thr Arg Arg Leu Ile Gln Leu 370 375 380 Ile Val Ser Gly Arg Asp Glu Gln Ser Ile Ala Glu Ala Ile Ile Val 385 390 395 400 Ala Met Val Phe Ser Gln Glu Asp Cys Met Ile Lys Ala Val Arg Gly 405 410 415 Asp Leu Asn Phe Val Asn Arg Ala Asn Gln Arg Leu Asn Pro Met His 420 425 430 Gln Leu Leu Arg His Phe Gln Lys Asp Ala Lys Val Leu Phe Gln Asn 435 440 445 Trp Gly Val Glu Pro Ile Asp Asn Val Met Gly Met Ile Gly Ile Leu 450 455 460 Pro Asp Met Thr Pro Ser Ile Glu Met Ser Met Arg Gly Val Arg Ile 465 470 475 480 Ser Lys Met Gly Val Asp Glu Tyr Ser Ser Thr Glu Arg Val Val Val 485 490 495 Ser Ile Asp Arg Phe Leu Arg Ile Arg Asp Gln Arg Gly Asn Val Leu 500 505 510 Leu Ser Pro Glu Glu Val Ser Glu Thr Gln Gly Thr Glu Lys Leu Thr 515 520 525 Ile Thr Tyr Ser Ser Ser Met Met Trp Glu Ile Asn Gly Pro Glu Ser 530 535 540 Val Leu Val Asn Thr Tyr Gln Trp Ile Ile Arg Asn Trp Glu Thr Val 545 550 555 560 Lys Ile Gln Trp Ser Gln Asn Pro Thr Met Leu Tyr Asn Lys Met Glu 565 570 575 Phe Glu Pro Phe Gln Ser Leu Val Pro Lys Ala Ile Arg Gly Gln Tyr 580 585 590 Ser Gly Phe Val Arg Thr Leu Phe Gln Gln Met Arg Asp Val Leu Gly 595 600 605 Thr Phe Asp Thr Ala Gln Ile Ile Lys Leu Leu Pro Phe Ala Ala Ala 610 615 620 Pro Pro Lys Gln Ser Arg Met Gln Phe Ser Ser Phe Thr Val Asn Val 625 630 635 640 Arg Gly Ser Gly Met Arg Ile Leu Val Arg Gly Asn Ser Pro Val Phe 645 650 655 Asn Tyr Asn Lys Ala Thr Lys Arg Leu Thr Val Leu Gly Lys Asp Ala 660 665 670 Gly Thr Leu Thr Glu Asp Pro Asp Glu Gly Thr Ala Gly Val Glu Ser 675 680 685 Ala Val Leu Arg Gly Phe Leu Ile Leu Gly Lys Glu Asp Lys Arg Tyr 690 695 700 Gly Pro Ala Leu Ser Ile Asn Glu Leu Ser Asn Leu Ala Lys Gly Glu 705 710 715 720 Lys Ala Asn Val Leu Ile Gly Gln Gly Asp Val Val Leu Val Met Lys 725 730 735 Arg Lys Arg Asp Ser Ser Ile Leu Thr Asp Ser Gln Thr Ala Thr Lys 740 745 750 Arg Ile Arg Met Ala Ile Asn 755 <210> 29 <211> 2341 <212> DNA <213> 甲型流感病毒 <400> 29 agcgaaagca ggcaaaccat ttgaatggat gtcaatccga ctttactttt cttgaaaatt 60 ccagcgcaaa atgccataag caccacattc ccttatactg gagatcctcc atacagccat 120 ggaacaggaa caggatacac catggacaca gttaacagaa cacatcaata ttcagaaaaa 180 gggaaatgga caacaaacac agaaactggg gcgccccaac ttaacccgat tgatggacca 240 ctacctgagg ataatgagcc aagtggatat gcacaaacag actgtgtcct ggaagctatg 300 gctttccttg aggaatccca cccagggatc tttgaaaact cgtgccttga aacaatggaa 360 gtcgttcaac aaacaagagt ggacagactg acccaaggtc gtcagaccta tgattggaca 420 ttaaacagaa atcaaccagc cgcaactgca ttagccaaca ctatagaagt tttcagatcg 480 aatggtctaa cagctaatga gtcgggaagg ctaatagatt tcctcaagga tgtgatggaa 540 tcaatggata aagaggaaat agagataaca acacacttcc aaagaaaaag aagagtaaga 600 gacaacatga ccaagaaaat ggtcacacaa agaacaatag gaaagaaaaa gcagagagtg 660 aacaagagaa gctatctaat aagagcatta actttgaaca caatgaccaa agatgcagaa 720 agaggtaaat taaagagaag agctattgca acacccggga tgcaaatcag agggttcgtg 780 tactttgttg aaactctagc taggagcatt tgtgagaagc ttgaacagtc tggacttcca 840 gtaggaggta atgaaaagaa ggccaaactg gcaaatgttg tgagaaagat gatgactaat 900 tcacaagaca cagagctttc tttcacaatt actggagaca atactaagtg gaatgaaaat 960 caaaatcctc gaatgttcct ggcgatgatt acatatatca caaaaaatca acctgaatgg 1020 ttcagaaaca tcctgagcat cgcacccata atgttctcaa acaaaatggc gagactaggg 1080 aaaggataca tgttcgaaag taagagaatg aagctccgaa cacaaatacc agcagaaatg 1140 ctagcaagca ttgacctaaa gtatttcaat gaatcaacaa gaaagaaaat tgagaaaata 1200 aggcctcttc taatagatgg cacagcgtca ttgagccctg gaatgatgat gggcatgttc 1260 aacatgctaa gtacggtttt aggagtctca atactgaatc ttgggcaaaa gaaatacacc 1320 aaaacaacat actggtggga tgggcttcaa tcctctgatg attttgctct catagtgaat 1380 gcaccaaatc atgagggaat acaagcagga gtggatagat tctacagaac ctgcaagcta 1440 gtcggaatca atatgagcaa gaagaagtcc tatataaata ggacaggaac atttgaattc 1500 acaagctttt tttatcgcta tggatttgtg gccaatttta gcatggagct gcccagtttt 1560 ggagtgtctg ggattaatga atcagctgat atgagcattg gagtaacagt gataaagaac 1620 aacatgataa acaatgacct tggaccagca acagcccaga tggctcttca actgttcatc 1680 aaggactaca gatatacata tcggtgccac agaggagaca cacaaattca gacgaggaga 1740 tcatttgagc taaagaagct gtgggagcaa acccgatcaa aggcaggact attggtttca 1800 gatggaggac cgaacttata caatatccgg aatcttcaca tccctgaagt ctgcttaaag 1860 tgggagctaa tggatgaaga ctatcaggga agactttgta atcccctgaa tccatttgtc 1920 agccataaag agattgagtc tgtaaacaat gctgtggtaa tgccagctca tggtccagcc 1980 aagagcatgg aatatgacgc tgttgcaact acacactcct ggattcccaa gaggaaccgc 2040 tctattctca acacaagcca aaggggaatt cttgaggatg aacagatgta tcagaagtgc 2100 tgcaacctgt tcgagaaatt tttccccagt agttcataca ggagaccggt tggaatttcc 2160 agcatggtgg aggccatggt gtctagggcc cggattgatg ccagaattga cttcgagtct 2220 ggacggatta agaaagaaga gttctccgag atcatgaaga tctgttccac cattgaagag 2280 ctcagacggc aaaaacaatg aatttagctt gtccttcatg aaaaaatgcc ttgtttctac 2340 t 2341 <210> 30 <211> 758 <212> PRT <213> Influenza A virus <400> 30 Met Asp Val Asn Pro Thr Leu Leu Phe Leu Lys Ile Pro Ala Gln Asn 1 5 10 15 Ala Ile Ser Thr Thr Phe Pro Tyr Thr Gly Asp Pro Pro Tyr Ser His 20 25 30 Gly Thr Gly Thr Gly Tyr Thr Met Asp Thr Val Asn Arg Thr His Gln 35 40 45 Tyr Ser Glu Lys Gly Lys Trp Thr Thr Asn Thr Glu Thr Gly Ala Pro 50 55 60 Gln Leu Asn Pro Ile Asp Gly Pro Leu Pro Glu Asp Asn Glu Pro Ser 65 70 75 80 Gly Tyr Ala Gln Thr Asp Cys Val Leu Glu Ala Met Ala Phe Leu Glu 85 90 95 Gly Ser His Pro Gly Ile Phe Glu Asn Ser Cys Leu Glu Thr Met Glu 100 105 110 Val Val Gln Gln Thr Arg Val Asp Arg Leu Thr Gln Gly Arg Gln Thr 115 120 125 Tyr Asp Trp Thr Leu Asn Arg Asn Gln Pro Ala Ala Thr Ala Leu Ala 130 135 140 Asn Thr Ile Glu Val Phe Arg Ser Asn Gly Leu Thr Ala Asn Glu Ser 145 150 155 160 Gly Arg Leu Ile Asp Phe Leu Lys Asp Val Met Glu Ser Met Asp Lys 165 170 175 Glu Glu Ile Glu Ile Thr Thr His Phe Gln Arg Lys Arg Arg Val Arg 180 185 190 Asp Asn Met Thr Lys Lys Met Val Thr Gln Arg Thr Ile Gly Lys Lys 195 200 205 Lys Gln Arg Val Asn Lys Arg Ser Tyr Leu Ile Arg Ala Leu Thr Leu 210 215 220 Asn Thr Met Thr Lys Asp Ala Glu Arg Gly Lys Leu Lys Arg Arg Ala 225 230 235 240 Ile Ala Thr Pro Gly Met Gln Ile Arg Gly Phe Val Tyr Phe Val Glu 245 250 255 Thr Leu Ala Arg Ser Ile Cys Glu Lys Leu Glu Gln Ser Gly Leu Pro 260 265 270 Val Gly Gly Asn Glu Lys Lys Ala Lys Leu Ala Asn Val Val Arg Lys 275 280 285 Met Met Thr Asn Ser Gln Asp Thr Glu Leu Ser Phe Thr Ile Thr Gly 290 295 300 Asp Asn Thr Lys Trp Asn Glu Asn Gln Asn Pro Arg Met Phe Leu Ala 305 310 315 320 Met Ile Thr Tyr Ile Thr Lys Asn Gln Pro Glu Trp Phe Arg Asn Ile 325 330 335 Leu Ser Ile Ala Pro Ile Met Phe Ser Asn Lys Met Ala Arg Leu Gly 340 345 350 Lys Gly Tyr Met Phe Glu Ser Lys Arg Met Lys Leu Arg Thr Gln Ile 355 360 365 Pro Ala Glu Met Leu Ala Ser Ile Asp Leu Lys Tyr Phe Asn Glu Ser 370 375 380 Thr Arg Lys Lys Ile Glu Lys Ile Arg Pro Leu Leu Ile Asp Gly Thr 385 390 395 400 Ala Ser Leu Ser Pro Gly Met Met Met Gly Met Phe Asn Met Leu Ser 405 410 415 Thr Val Leu Gly Val Ser Ile Leu Asn Leu Gly Gln Lys Lys Tyr Thr 420 425 430 Lys Thr Thr Tyr Trp Trp Asp Gly Leu Gln Ser Ser Asp Asp Phe Ala 435 440 445 Leu Ile Val Asn Ala Pro Asn His Glu Gly Ile Gln Ala Gly Val Asp 450 455 460 Arg Phe Tyr Arg Thr Cys Lys Leu Val Gly Ile Asn Met Ser Lys Lys 465 470 475 480 Lys Ser Tyr Ile Asn Arg Thr Gly Thr Phe Glu Phe Thr Ser Phe Phe 485 490 495 Tyr Arg Tyr Gly Phe Val Ala Asn Phe Ser Met Glu Leu Pro Ser Phe 500 505 510 Gly Val Ser Gly Ile Asn Glu Ser Ala Asp Met Ser Ile Gly Val Thr 515 520 525 Val Ile Lys Asn Asn Met Ile Asn Asn Asp Leu Gly Pro Ala Thr Ala 530 535 540 Gln Met Ala Leu Gln Leu Phe Ile Lys Asp Tyr Arg Tyr Thr Tyr Arg 545 550 555 560 Cys His Arg Gly Asp Thr Gln Ile Gln Thr Arg Arg Ser Phe Glu Leu 565 570 575 Lys Lys Leu Trp Glu Gln Thr Arg Ser Lys Ala Gly Leu Leu Val Ser 580 585 590 Asp Gly Gly Pro Asn Leu Tyr Asn Ile Arg Asn Leu His Ile Pro Glu 595 600 605 Val Cys Leu Lys Trp Glu Leu Met Asp Glu Asp Tyr Gln Gly Arg Leu 610 615 620 Cys Asn Pro Leu Asn Pro Phe Val Ser His Lys Glu Ile Glu Ser Val 625 630 635 640 Asn Asn Ala Val Val Met Pro Ala His Gly Pro Ala Lys Ser Met Glu 645 650 655 Tyr Asp Ala Val Ala Thr Thr His Ser Trp Ile Pro Lys Arg Asn Arg 660 665 670 Ser Ile Leu Asn Thr Ser Gln Arg Gly Ile Leu Glu Asp Glu Gln Met 675 680 685 Tyr Gln Lys Cys Cys Asn Leu Phe Glu Lys Phe Phe Pro Ser Ser Ser 690 695 700 Tyr Arg Arg Pro Val Gly Ile Ser Ser Met Val Glu Ala Met Val Ser 705 710 715 720 Arg Ala Arg Ile Asp Ala Arg Ile Asp Phe Glu Ser Gly Arg Ile Lys 725 730 735 Lys Glu Glu Phe Ser Glu Ile Met Lys Ile Cys Ser Thr Ile Glu Glu 740 745 750 Leu Arg Arg Gln Lys Gln 755 <210> 31 <211> 2341 <212> DNA <213> Artificial sequence <220> <223> PB1 E97G S678N <400> 31 agcgaaagca ggcaaaccat ttgaatggat gtcaatccga ctttactttt cttgaaaatt 60 ccagcgcaaa atgccataag caccacattc ccttatactg gagatcctcc atacagccat 120 ggaacaggaa caggatacac catggacaca gttaacagaa cacatcaata ttcagaaaaa 180 gggaaatgga caacaaacac agaaactggg gcgccccaac ttaacccgat tgatggacca 240 ctacctgagg ataatgagcc aagtggatat gcacaaacag actgtgtcct ggaagctatg 300 gctttccttg agggatccca cccagggatc tttgaaaact cgtgccttga aacaatggaa 360 gtcgttcaac aaacaagagt ggacagactg acccaaggtc gtcagaccta tgattggaca 420 ttaaacagaa atcaaccagc cgcaactgca ttagccaaca ctatagaagt tttcagatcg 480 aatggtctaa cagctaatga gtcgggaagg ctaatagatt tcctcaagga tgtgatggaa 540 tcaatggata aagaggaaat agagataaca acacacttcc aaagaaaaag aagagtaaga 600 gacaacatga ccaagaaaat ggtcacacaa agaacaatag gaaagaaaaa gcagagagtg 660 aacaagagaa gctatctaat aagagcatta actttgaaca caatgaccaa agatgcagaa 720 agaggtaaat taaagagaag agctattgca acacccggga tgcaaatcag agggttcgtg 780 tactttgttg aaactctagc taggagcatt tgtgagaagc ttgaacagtc tggacttcca 840 gtaggaggta atgaaaagaa ggccaaactg gcaaatgttg tgagaaagat gatgactaat 900 tcacaagaca cagagctttc tttcacaatt actggagaca atactaagtg gaatgaaaat 960 caaaatcctc gaatgttcct ggcgatgatt acatatatca caaaaaatca acctgaatgg 1020 ttcagaaaca tcctgagcat cgcacccata atgttctcaa acaaaatggc gagactaggg 1080 aaaggataca tgttcgaaag taagagaatg aagctccgaa cacaaatacc agcagaaatg 1140 ctagcaagca ttgacctaaa gtatttcaat gaatcaacaa gaaagaaaat tgagaaaata 1200 aggcctcttc taatagatgg cacagcgtca ttgagccctg gaatgatgat gggcatgttc 1260 aacatgctaa gtacggtttt aggagtctca atactgaatc ttgggcaaaa gaaatacacc 1320 aaaacaacat actggtggga tgggcttcaa tcctctgatg attttgctct catagtgaat 1380 gcaccaaatc atgagggaat acaagcagga gtggatagat tctacagaac ctgcaagcta 1440 gtcggaatca atatgagcaa gaagaagtcc tatataaata ggacaggaac atttgaattc 1500 acaagctttt tttatcgcta tggatttgtg gccaatttta gcatggagct gcccagtttt 1560 ggagtgtctg ggattaatga atcagctgat atgagcattg gagtaacagt gataaagaac 1620 aacatgataa acaatgacct tggaccagca acagcccaga tggctcttca actgttcatc 1680 aaggactaca gatatacata tcggtgccac agaggagaca cacaaattca gacgaggaga 1740 tcatttgagc taaagaagct gtgggagcaa acccgatcaa aggcaggact attggtttca 1800 gatggaggac cgaacttata caatatccgg aatcttcaca tccctgaagt ctgcttaaag 1860 tgggagctaa tggatgaaga ctatcaggga agactttgta atcccctgaa tccatttgtc 1920 agccataaag agattgagtc tgtaaacaat gctgtggtaa tgccagctca tggtccagcc 1980 aagagcatgg aatatgacgc tgttgcaact acacactcct ggattcccaa gaggaaccgc 2040 tctattctca acacaaacca aaggggaatt cttgaggatg aacagatgta tcagaagtgc 2100 tgcaacctgt tcgagaaatt tttccccagt agttcataca ggagaccggt tggaatttcc 2160 agcatggtgg aggccatggt gtctagggcc cggattgatg ccagaattga cttcgagtct 2220 ggacggatta agaaagaaga gttctccgag atcatgaaga tctgttccac cattgaagag 2280 ctcagacggc aaaaacaatg aatttagctt gtccttcatg aaaaaatgcc ttgtttctac 2340 t 2341 <210> 32 <211> 758 <212> PRT <213> Artificial Sequence <220> <223> PB1 E97G S678N <400> 32 Met Asp Val Asn Pro Thr Leu Leu Phe Leu Lys Ile Pro Ala Gln Asn 1 5 10 15 Ala Ile Ser Thr Thr Phe Pro Tyr Thr Gly Asp Pro Pro Tyr Ser His 20 25 30 Gly Thr Gly Thr Gly Tyr Thr Met Asp Thr Val Asn Arg Thr His Gln 35 40 45 Tyr Ser Glu Lys Gly Lys Trp Thr Thr Asn Thr Glu Thr Gly Ala Pro 50 55 60 Gln Leu Asn Pro Ile Asp Gly Pro Leu Pro Glu Asp Asn Glu Pro Ser 65 70 75 80 Gly Tyr Ala Gln Thr Asp Cys Val Leu Glu Ala Met Ala Phe Leu Gly 85 90 95 Gly Ser His Pro Gly Ile Phe Glu Asn Ser Cys Leu Glu Thr Met Glu 100 105 110 Val Val Gln Gln Thr Arg Val Asp Arg Leu Thr Gln Gly Arg Gln Thr 115 120 125 Tyr Asp Trp Thr Leu Asn Arg Asn Gln Pro Ala Ala Thr Ala Leu Ala 130 135 140 Asn Thr Ile Glu Val Phe Arg Ser Asn Gly Leu Thr Ala Asn Glu Ser 145 150 155 160 Gly Arg Leu Ile Asp Phe Leu Lys Asp Val Met Glu Ser Met Asp Lys 165 170 175 Glu Glu Ile Glu Ile Thr Thr His Phe Gln Arg Lys Arg Arg Val Arg 180 185 190 Asp Asn Met Thr Lys Lys Met Val Thr Gln Arg Thr Ile Gly Lys Lys 195 200 205 Lys Gln Arg Val Asn Lys Arg Ser Tyr Leu Ile Arg Ala Leu Thr Leu 210 215 220 Asn Thr Met Thr Lys Asp Ala Glu Arg Gly Lys Leu Lys Arg Arg Ala 225 230 235 240 Ile Ala Thr Pro Gly Met Gln Ile Arg Gly Phe Val Tyr Phe Val Glu 245 250 255 Thr Leu Ala Arg Ser Ile Cys Glu Lys Leu Glu Gln Ser Gly Leu Pro 260 265 270 Val Gly Gly Asn Glu Lys Lys Ala Lys Leu Ala Asn Val Val Arg Lys 275 280 285 Met Met Thr Asn Ser Gln Asp Thr Glu Leu Ser Phe Thr Ile Thr Gly 290 295 300 Asp Asn Thr Lys Trp Asn Glu Asn Gln Asn Pro Arg Met Phe Leu Ala 305 310 315 320 Met Ile Thr Tyr Ile Thr Lys Asn Gln Pro Glu Trp Phe Arg Asn Ile 325 330 335 Leu Ser Ile Ala Pro Ile Met Phe Ser Asn Lys Met Ala Arg Leu Gly 340 345 350 Lys Gly Tyr Met Phe Glu Ser Lys Arg Met Lys Leu Arg Thr Gln Ile 355 360 365 Pro Ala Glu Met Leu Ala Ser Ile Asp Leu Lys Tyr Phe Asn Glu Ser 370 375 380 Thr Arg Lys Lys Ile Glu Lys Ile Arg Pro Leu Leu Ile Asp Gly Thr 385 390 395 400 Ala Ser Leu Ser Pro Gly Met Met Met Gly Met Phe Asn Met Leu Ser 405 410 415 Thr Val Leu Gly Val Ser Ile Leu Asn Leu Gly Gln Lys Lys Tyr Thr 420 425 430 Lys Thr Thr Tyr Trp Trp Asp Gly Leu Gln Ser Ser Asp Asp Phe Ala 435 440 445 Leu Ile Val Asn Ala Pro Asn His Glu Gly Ile Gln Ala Gly Val Asp 450 455 460 Arg Phe Tyr Arg Thr Cys Lys Leu Val Gly Ile Asn Met Ser Lys Lys 465 470 475 480 Lys Ser Tyr Ile Asn Arg Thr Gly Thr Phe Glu Phe Thr Ser Phe Phe 485 490 495 Tyr Arg Tyr Gly Phe Val Ala Asn Phe Ser Met Glu Leu Pro Ser Phe 500 505 510 Gly Val Ser Gly Ile Asn Glu Ser Ala Asp Met Ser Ile Gly Val Thr 515 520 525 Val Ile Lys Asn Asn Met Ile Asn Asn Asp Leu Gly Pro Ala Thr Ala 530 535 540 Gln Met Ala Leu Gln Leu Phe Ile Lys Asp Tyr Arg Tyr Thr Tyr Arg 545 550 555 560 Cys His Arg Gly Asp Thr Gln Ile Gln Thr Arg Arg Ser Phe Glu Leu 565 570 575 Lys Lys Leu Trp Glu Gln Thr Arg Ser Lys Ala Gly Leu Leu Val Ser 580 585 590 Asp Gly Gly Pro Asn Leu Tyr Asn Ile Arg Asn Leu His Ile Pro Glu 595 600 605 Val Cys Leu Lys Trp Glu Leu Met Asp Glu Asp Tyr Gln Gly Arg Leu 610 615 620 Cys Asn Pro Leu Asn Pro Phe Val Ser His Lys Glu Ile Glu Ser Val 625 630 635 640 Asn Asn Ala Val Val Met Pro Ala His Gly Pro Ala Lys Ser Met Glu 645 650 655 Tyr Asp Ala Val Ala Thr Thr His Ser Trp Ile Pro Lys Arg Asn Arg 660 665 670 Ser Ile Leu Asn Thr Asn Gln Arg Gly Ile Leu Glu Asp Glu Gln Met 675 680 685 Tyr Gln Lys Cys Cys Asn Leu Phe Glu Lys Phe Phe Pro Ser Ser Ser 690 695 700 Tyr Arg Arg Pro Val Gly Ile Ser Ser Met Val Glu Ala Met Val Ser 705 710 715 720 Arg Ala Arg Ile Asp Ala Arg Ile Asp Phe Glu Ser Gly Arg Ile Lys 725 730 735 Lys Glu Glu Phe Ser Glu Ile Met Lys Ile Cys Ser Thr Ile Glu Glu 740 745 750 Leu Arg Arg Gln Lys Gln 755 <210> 33 <211> 442 <212> DNA <213> Artificial Sequence <220> <223> NS2 NS2 R76G <400> 33 agcagaagca gaggatttgt ttagtcactg gcaaacagga aaaatggcgg acaatatgac 60 cacaacacaa attgagtgga ggatgaagaa gatggccatc ggatcctcaa ttcactcttc 120 gagcgtctta atgaaggaca ttcaaagcca attcgagcag ctgaaactgc ggtgggagtc 180 ttatcccaat ttggtcaaga gcaccgatta tcaccagaag agggagacaa ttagactggt 240 cacggaagaa ctttatcttt taagtaaagg aattgatgat aacatattgt tccacaaaac 300 agtaatagct aacagctcca taatagctga catggttgta tcattatcat tattagaaac 360 attgtatgaa atgaaggatg tggttgaagt gtacagcagg cagtgcttgt gaatttaaaa 420 taaaaatcct cttgttacta ct 442 <210> 34 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> NS2 NS2 R76G <400> 34 Met Ala Asp Asn Met Thr Thr Thr Gln Ile Glu Trp Arg Met Lys Lys 1 5 10 15 Met Ala Ile Gly Ser Ser Ile His Ser Ser Ser Val Leu Met Lys Asp 20 25 30 Ile Gln Ser Gln Phe Glu Gln Leu Lys Leu Arg Trp Glu Ser Tyr Pro 35 40 45 Asn Leu Val Lys Ser Thr Asp Tyr His Gln Lys Arg Glu Thr Ile Arg 50 55 60 Leu Val Thr Glu Glu Leu Tyr Leu Leu Ser Lys Gly Ile Asp Asp Asn 65 70 75 80 Ile Leu Phe His Lys Thr Val Ile Ala Asn Ser Ser Ile Ile Ala Asp 85 90 95 Met Val Val Ser Leu Ser Leu Leu Glu Thr Leu Tyr Glu Met Lys Asp 100 105 110 Val Val Glu Val Tyr Ser Arg Gln Cys Leu 115 120 <210> 35 <211> 1716 <212> DNA <213> Artificial Sequence <220> <223> PB1 E97G <400> 35 cacaaagaac aataggaaag aaaaagcaga gagtgaacaa gagaagctat ctaataagag 60 cattaacttt gaacacaatg accaaagatg cagaaagagg taaattaaag agaagagcta 120 ttgcaacacc cgggatgcaa atcagagggt tcgtgtactt tgttgaaact ctagctagga 180 gcatttgtga gaagcttgaa cagtctggac ttccagtagg aggtaatgaa aagaaggcca 240 aactggcaaa tgttgtgaga aagatgatga ctaattcaca agacacagag ctttctttca 300 caattactgg agacaatact aagtggaatg aaaatcaaaa tcctcgaatg ttcctggcga 360 tgattacata tatcacaaaa aatcaacctg aatggttcag aaacatcctg agcatcgcac 420 ccataatgtt ctcaaacaaa atggcgagac tagggaaagg atacatgttc gaaagtaaga 480 gaatgaagct ccgaacacaa ataccagcag aaatgctagc aagcattgac ctaaagtatt 540 tcaatgaatc aacaagaaag aaaattgaga aaataaggcc tcttctaata gatggcacag 600 cgtcattgag ccctggaatg atgatgggca tgttcaacat gctaagtacg gttttaggag 660 tctcaatact gaatcttggg caaaagaaat acaccaaaac aacatactgg tgggatgggc 720 ttcaatcctc tgatgatttt gctctcatag tgaatgcacc aaatcatgag ggaatacaag 780 caggagtgga tagattctac agaacctgca agctagtcgg aatcaatatg agcaagaaga 840 agtcctatat aaataggaca ggaacatttg aattcacaag ctttttttat cgctatggat 900 ttgtggccaa ttttagcatg gagctgccca gttttggagt gtctgggatt aatgaatcag 960 ctgatatgag cattggagta acagtgataa agaacaacat gataaacaat gaccttggac 1020 cagcaacagc ccagatggct cttcaactgt tcatcaagga ctacagatat acatatcggt 1080 gccacagagg agacacacaa attcagacga ggagatcatt tgagctaaag aagctgtggg 1140 agcaaacccg atcaaaggca ggactattgg tttcagatgg aggaccgaac ttatacaata 1200 tccggaatct tcacatccct gaagtctgct taaagtggga gctaatggat gaagactatc 1260 agggaagact ttgtaatccc ctgaatccat ttgtcagcca taaagagatt gagtctgtaa 1320 acaatgctgt ggtaatgcca gctcatggtc cagccaagag catggaatat gacgctgttg 1380 caactacaca ctcctggatt cccaagagga accgctctat tctcaacaca agccaaaggg 1440 gaattcttga ggatgaacag atgtatcaga agtgctgcaa cctgttcgag aaatttttcc 1500 ccagtagttc atacaggaga ccggttggaa tttccagcat ggtggaggcc atggtgtcta 1560 gggcccggat tgatgccaga attgacttcg agtctggacg gattaagaaa gaagagttct 1620 ccgagatcat gaagatctgt tccaccattg aagagctcag acggcaaaaa caatgaattt 1680 agcttgtcct tcatgaaaaa atgccttgtt tctact 1716 <210> 36 <211> 2341 <212> DNA <213> Artificial Sequence <220> <223> PB1 S678N <400> 36 agcgaaagca ggcaaaccat ttgaatggat gtcaatccga ctttactttt cttgaaaatt 60 ccagcgcaaa atgccataag caccacattc ccttatactg gagatcctcc atacagccat 120 ccagcgcaaa atgccataag caccacattc ccttatactg gagatcctcc atacagccat 120 ggaacaggaa caggatacac catggacaca gttaacagaa cacatcaata ttcagaaaaa 180 ggaacaggaa caggatacac catggacaca gttaacagaa cacatcaata ttcagaaaaa 180 gggaaatgga caacaaacac agaaactggg gcgccccaac ttaacccgat tgatggacca 240 gggaaatgga caacaaacac agaaactggg gcgccccaac ttaacccgat tgatggacca 240 ctacctgagg ataatgagcc aagtggatat gcacaaacag actgtgtcct ggaagctatg 300 ctacctgagg ataatgagcc aagtggatat gcacaaacag actgtgtcct ggaagctatg 300 gctttccttg aggaatccca cccagggatc tttgaaaact cgtgccttga aacaatggaa 360 gctttccttg aggaatccca cccagggatc tttgaaaact cgtgccttga aacaatggaa 360 gtcgttcaac aaacaagagt ggacagactg acccaaggtc gtcagaccta tgattggaca 420 gtcgttcaac aaacaagagt ggacagactg acccaaggtc gtcagaccta tgattggaca 420 ttaaacagaa atcaaccagc cgcaactgca ttagccaaca ctatagaagt tttcagatcg 480 ttaaacagaa atcaaccagc cgcaactgca ttagccaaca ctatagaagt tttcagatcg 480 aatggtctaa cagctaatga gtcgggaagg ctaatagatt tcctcaagga tgtgatggaa 540 aatggtctaa cagctaatga gtcgggaagg ctaatagatt tcctcaagga tgtgatggaa 540 tcaatggata aagaggaaat agagataaca acacacttcc aaagaaaaag aagagtaaga 600 tcaatggata aagaggaaat agagataaca acacacttcc aaagaaaaag aagagtaaga 600 gacaacatga ccaagaaaat ggtcacacaa agaacaatag gaaagaaaaa gcagagagtg 660 gacaacatga ccaagaaaat ggtcacacaa agaacaatag gaaagaaaaa gcagagagtg 660 aacaagagaa gctatctaat aagagcatta actttgaaca caatgaccaa agatgcagaa 720 aacaagagaa gctatctaat aagagcatta actttgaaca caatgaccaa agatgcagaa 720 agaggtaaat taaagagaag agctattgca acacccggga tgcaaatcag agggttcgtg 780 agaggtaaat taaagagaag agctattgca acacccggga tgcaaatcag agggttcgtg 780 tactttgttg aaactctagc taggagcatt tgtgagaagc ttgaacagtc tggacttcca 840 gtaggaggta atgaaaagaa ggccaaactg gcaaatgttg tgagaaagat gatgactaat 900 tcacaagaca cagagctttc tttcacaatt actggagaca atactaagtg gaatgaaaat 960 caaaatcctc gaatgttcct ggcgatgatt acatatatca caaaaaatca acctgaatgg 1020 ttcagaaaca tcctgagcat cgcacccata atgttctcaa acaaaatggc gagactaggg 1080 aaaggataca tgttcgaaag taagagaatg aagctccgaa cacaaatacc agcagaaatg 1140 ctagcaagca ttgacctaaa gtatttcaat gaatcaacaa gaaagaaaat tgagaaaata 1200 aggcctcttc taatagatgg cacagcgtca ttgagccctg gaatgatgat gggcatgttc 1260 aacatgctaa gtacggtttt aggagtctca atactgaatc ttgggcaaaa gaaatacacc 1320 aaaacaacat actggtggga tgggcttcaa tcctctgatg attttgctct catagtgaat 1380 gcaccaaatc atgagggaat acaagcagga gtggatagat tctacagaac ctgcaagcta 1440 gtcggaatca atatgagcaa gaagaagtcc tatataaata ggacaggaac atttgaattc 1500 acaagctttt tttatcgcta tggatttgtg gccaatttta gcatggagct gcccagtttt 1560 ggagtgtctg ggattaatga atcagctgat atgagcattg gagtaacagt gataaagaac 1620 aacatgataa acaatgacct tggaccagca acagcccaga tggctcttca actgttcatc 1680 aaggactaca gatatacata tcggtgccac agaggagaca cacaaattca gacgaggaga 1740 tcatttgagc taaagaagct gtgggagcaa acccgatcaa aggcaggact attggtttca 1800 gatggaggac cgaacttata caatatccgg aatcttcaca tccctgaagt ctgcttaaag 1860 tgggagctaa tggatgaaga ctatcaggga agactttgta atcccctgaa tccatttgtc 1920 agccataaag agattgagtc tgtaaacaat gctgtggtaa tgccagctca tggtccagcc 1980 aagagcatgg aatatgacgc tgttgcaact acacactcct ggattcccaa gaggaaccgc 2040 tctattctca acacaaacca aaggggaatt cttgaggatg aacagatgta tcagaagtgc 2100 tgcaacctgt tcgagaaatt tttccccagt agttcataca ggagaccggt tggaatttcc 2160 agcatggtgg aggccatggt gtctagggcc cggattgatg ccagaattga cttcgagtct 2220 ggacggatta agaaagaaga gttctccgag atcatgaaga tctgttccac cattgaagag 2280 ctcagacggc aaaaacaatg aatttagctt gtccttcatg aaaaaatgcc ttgtttctac 2340 t 2341 <210> 37 <211> 758 <212> PRT <213> Artificial Sequence <220> <223> PB1 E97G <400> 37 Met Asp Val Asn Pro Thr Leu Leu Phe Leu Lys Ile Pro Ala Gln Asn 1 5 10 15 Ala Ile Ser Thr Thr Phe Pro Tyr Thr Gly Asp Pro Pro Tyr Ser His 20 25 30 Gly Thr Gly Thr Gly Tyr Thr Met Asp Thr Val Asn Arg Thr His Gln 35 40 45 Tyr Ser Glu Lys Gly Lys Trp Thr Thr Asn Thr Glu Thr Gly Ala Pro 50 55 60 Gln Leu Asn Pro Ile Asp Gly Pro Leu Pro Glu Asp Asn Glu Pro Ser 65 70 75 80 Gly Tyr Ala Gln Thr Asp Cys Val Leu Glu Ala Met Ala Phe Leu Gly 85 90 95 Gly Ser His Pro Gly Ile Phe Glu Asn Ser Cys Leu Glu Thr Met Glu 100 105 110 Val Val Gln Gln Thr Arg Val Asp Arg Leu Thr Gln Gly Arg Gln Thr 115 120 125 Tyr Asp Trp Thr Leu Asn Arg Asn Gln Pro Ala Ala Thr Ala Leu Ala 130 135 140 Asn Thr Ile Glu Val Phe Arg Ser Asn Gly Leu Thr Ala Asn Glu Ser 145 150 155 160 Gly Arg Leu Ile Asp Phe Leu Lys Asp Val Met Glu Ser Met Asp Lys 165 170 175 Glu Glu Ile Glu Ile Thr Thr His Phe Gln Arg Lys Arg Arg Val Arg 180 185 190 Asp Asn Met Thr Lys Lys Met Val Thr Gln Arg Thr Ile Gly Lys Lys 195 200 205 Lys Gln Arg Val Asn Lys Arg Ser Tyr Leu Ile Arg Ala Leu Thr Leu 210 215 220 Asn Thr Met Thr Lys Asp Ala Glu Arg Gly Lys Leu Lys Arg Arg Ala 225 230 235 240 Ile Ala Thr Pro Gly Met Gln Ile Arg Gly Phe Val Tyr Phe Val Glu 245 250 255 Thr Leu Ala Arg Ser Ile Cys Glu Lys Leu Glu Gln Ser Gly Leu Pro 260 265 270 Val Gly Gly Asn Glu Lys Lys Ala Lys Leu Ala Asn Val Val Arg Lys 275 280 285 Met Met Thr Asn Ser Gln Asp Thr Glu Leu Ser Phe Thr Ile Thr Gly 290 295 300 Asp Asn Thr Lys Trp Asn Glu Asn Gln Asn Pro Arg Met Phe Leu Ala 305 310 315 320 Met Ile Thr Tyr Ile Thr Lys Asn Gln Pro Glu Trp Phe Arg Asn Ile 325 330 335 Leu Ser Ile Ala Pro Ile Met Phe Ser Asn Lys Met Ala Arg Leu Gly 340 345 350 Lys Gly Tyr Met Phe Glu Ser Lys Arg Met Lys Leu Arg Thr Gln Ile 355 360 365 Pro Ala Glu Met Leu Ala Ser Ile Asp Leu Lys Tyr Phe Asn Glu Ser 370 375 380 Thr Arg Lys Lys Ile Glu Lys Ile Arg Pro Leu Leu Ile Asp Gly Thr 385 390 395 400 Ala Ser Leu Ser Pro Gly Met Met Met Gly Met Phe Asn Met Leu Ser 405 410 415 Thr Val Leu Gly Val Ser Ile Leu Asn Leu Gly Gln Lys Lys Tyr Thr 420 425 430 Lys Thr Thr Tyr Trp Trp Asp Gly Leu Gln Ser Ser Asp Asp Phe Ala 435 440 445 Leu Ile Val Asn Ala Pro Asn His Glu Gly Ile Gln Ala Gly Val Asp 450 455 460 Arg Phe Tyr Arg Thr Cys Lys Leu Val Gly Ile Asn Met Ser Lys Lys 465 470 475 480 Lys Ser Tyr Ile Asn Arg Thr Gly Thr Phe Glu Phe Thr Ser Phe Phe 485 490 495 Tyr Arg Tyr Gly Phe Val Ala Asn Phe Ser Met Glu Leu Pro Ser Phe 500 505 510 Gly Val Ser Gly Ile Asn Glu Ser Ala Asp Met Ser Ile Gly Val Thr 515 520 525 Val Ile Lys Asn Asn Met Ile Asn Asn Asp Leu Gly Pro Ala Thr Ala 530 535 540 Gln Met Ala Leu Gln Leu Phe Ile Lys Asp Tyr Arg Tyr Thr Tyr Arg 545 550 555 560 Cys His Arg Gly Asp Thr Gln Ile Gln Thr Arg Arg Ser Phe Glu Leu 565 570 575 Lys Lys Leu Trp Glu Gln Thr Arg Ser Lys Ala Gly Leu Leu Val Ser 580 585 590 Asp Gly Gly Pro Asn Leu Tyr Asn Ile Arg Asn Leu His Ile Pro Glu 595 600 605 Val Cys Leu Lys Trp Glu Leu Met Asp Glu Asp Tyr Gln Gly Arg Leu 610 615 620 Cys Asn Pro Leu Asn Pro Phe Val Ser His Lys Glu Ile Glu Ser Val 625 630 635 640 Asn Asn Ala Val Val Met Pro Ala His Gly Pro Ala Lys Ser Met Glu 645 650 655 Tyr Asp Ala Val Ala Thr Thr His Ser Trp Ile Pro Lys Arg Asn Arg 660 665 670 Ser Ile Leu Asn Thr Ser Gln Arg Gly Ile Leu Glu Asp Glu Gln Met 675 680 685 Tyr Gln Lys Cys Cys Asn Leu Phe Glu Lys Phe Phe Pro Ser Ser Ser 690 695 700 Tyr Arg Arg Pro Val Gly Ile Ser Ser Met Val Glu Ala Met Val Ser 705 710 715 720 Arg Ala Arg Ile Asp Ala Arg Ile Asp Phe Glu Ser Gly Arg Ile Lys 725 730 735 Lys Glu Glu Phe Ser Glu Ile Met Lys Ile Cys Ser Thr Ile Glu Glu 740 745 750 Leu Arg Arg Gln Lys Gln 755 <210> 38 <211> 758 <212> PRT <213> Artificial Sequence <220> <223> PB1 S678N <400> 38 Met Asp Val Asn Pro Thr Leu Leu Phe Leu Lys Ile Pro Ala Gln Asn 1 5 10 15 Ala Ile Ser Thr Thr Phe Pro Tyr Thr Gly Asp Pro Pro Tyr Ser His 20 25 30 Gly Thr Gly Thr Gly Tyr Thr Met Asp Thr Val Asn Arg Thr His Gln 35 40 45 Tyr Ser Glu Lys Gly Lys Trp Thr Thr Asn Thr Glu Thr Gly Ala Pro 50 55 60 Gln Leu Asn Pro Ile Asp Gly Pro Leu Pro Glu Asp Asn Glu Pro Ser 65 70 75 80 Gly Tyr Ala Gln Thr Asp Cys Val Leu Glu Ala Met Ala Phe Leu Glu 85 90 95 Gly Ser His Pro Gly Ile Phe Glu Asn Ser Cys Leu Glu Thr Met Glu 100 105 110 Val Val Gln Gln Thr Arg Val Asp Arg Leu Thr Gln Gly Arg Gln Thr 115 120 125 Tyr Asp Trp Thr Leu Asn Arg Asn Gln Pro Ala Ala Thr Ala Leu Ala 130 135 140 Asn Thr Ile Glu Val Phe Arg Ser Asn Gly Leu Thr Ala Asn Glu Ser 145 150 155 160 Gly Arg Leu Ile Asp Phe Leu Lys Asp Val Met Glu Ser Met Asp Lys 165 170 175 Glu Glu Ile Glu Ile Thr Thr His Phe Gln Arg Lys Arg Arg Val Arg 180 185 190 Asp Asn Met Thr Lys Lys Met Val Thr Gln Arg Thr Ile Gly Lys Lys 195 200 205 Lys Gln Arg Val Asn Lys Arg Ser Tyr Leu Ile Arg Ala Leu Thr Leu 210 215 220 Asn Thr Met Thr Lys Asp Ala Glu Arg Gly Lys Leu Lys Arg Arg Ala 225 230 235 240 Ile Ala Thr Pro Gly Met Gln Ile Arg Gly Phe Val Tyr Phe Val Glu 245 250 255 Thr Leu Ala Arg Ser Ile Cys Glu Lys Leu Glu Gln Ser Gly Leu Pro 260 265 270 Val Gly Gly Asn Glu Lys Lys Ala Lys Leu Ala Asn Val Val Arg Lys 275 280 285 Met Met Thr Asn Ser Gln Asp Thr Glu Leu Ser Phe Thr Ile Thr Gly 290 295 300 Asp Asn Thr Lys Trp Asn Glu Asn Gln Asn Pro Arg Met Phe Leu Ala 305 310 315 320 Met Ile Thr Tyr Ile Thr Lys Asn Gln Pro Glu Trp Phe Arg Asn Ile 325 330 335 Leu Ser Ile Ala Pro Ile Met Phe Ser Asn Lys Met Ala Arg Leu Gly 340 345 350 Lys Gly Tyr Met Phe Glu Ser Lys Arg Met Lys Leu Arg Thr Gln Ile 355 360 365 Pro Ala Glu Met Leu Ala Ser Ile Asp Leu Lys Tyr Phe Asn Glu Ser 370 375 380 Thr Arg Lys Lys Ile Glu Lys Ile Arg Pro Leu Leu Ile Asp Gly Thr 385 390 395 400 Ala Ser Leu Ser Pro Gly Met Met Met Gly Met Phe Asn Met Leu Ser 405 410 415 Thr Val Leu Gly Val Ser Ile Leu Asn Leu Gly Gln Lys Lys Tyr Thr 420 425 430 Lys Thr Thr Tyr Trp Trp Asp Gly Leu Gln Ser Ser Asp Asp Phe Ala 435 440 445 Leu Ile Val Asn Ala Pro Asn His Glu Gly Ile Gln Ala Gly Val Asp 450 455 460 Arg Phe Tyr Arg Thr Cys Lys Leu Val Gly Ile Asn Met Ser Lys Lys 465 470 475 480 Lys Ser Tyr Ile Asn Arg Thr Gly Thr Phe Glu Phe Thr Ser Phe Phe 485 490 495 Tyr Arg Tyr Gly Phe Val Ala Asn Phe Ser Met Glu Leu Pro Ser Phe 500 505 510 Gly Val Ser Gly Ile Asn Glu Ser Ala Asp Met Ser Ile Gly Val Thr 515 520 525 Val Ile Lys Asn Asn Met Ile Asn Asn Asp Leu Gly Pro Ala Thr Ala 530 535 540 Gln Met Ala Leu Gln Leu Phe Ile Lys Asp Tyr Arg Tyr Thr Tyr Arg 545 550 555 560 Cys His Arg Gly Asp Thr Gln Ile Gln Thr Arg Arg Ser Phe Glu Leu 565 570 575 Lys Lys Leu Trp Glu Gln Thr Arg Ser Lys Ala Gly Leu Leu Val Ser 580 585 590 Asp Gly Gly Pro Asn Leu Tyr Asn Ile Arg Asn Leu His Ile Pro Glu 595 600 605 Val Cys Leu Lys Trp Glu Leu Met Asp Glu Asp Tyr Gln Gly Arg Leu 610 615 620 Cys Asn Pro Leu Asn Pro Phe Val Ser His Lys Glu Ile Glu Ser Val 625 630 635 640 Asn Asn Ala Val Val Met Pro Ala His Gly Pro Ala Lys Ser Met Glu 645 650 655 Tyr Asp Ala Val Ala Thr Thr His Ser Trp Ile Pro Lys Arg Asn Arg 660 665 670 Ser Ile Leu Asn Thr Asn Gln Arg Gly Ile Leu Glu Asp Glu Gln Met 675 680 685 Tyr Gln Lys Cys Cys Asn Leu Phe Glu Lys Phe Phe Pro Ser Ser Ser 690 695 700 Tyr Arg Arg Pro Val Gly Ile Ser Ser Met Val Glu Ala Met Val Ser 705 710 715 720 Arg Ala Arg Ile Asp Ala Arg Ile Asp Phe Glu Ser Gly Arg Ile Lys 725 730 735 Lys Glu Glu Phe Ser Glu Ile Met Lys Ile Cys Ser Thr Ile Glu Glu 740 745 750 Leu Arg Arg Gln Lys Gln 755
Claims
1. A recombinant influenza B virus with increased growth rate, which lacks a functional NS1 protein (delNS1 influenza), and the recombinant influenza B virus comprises: - an M1 protein as shown in amino acid sequence SEQ ID No. 8, and - PB and NS gene segments containing one or more nucleotide modifications, resulting in - an NS2 protein as shown in either amino acid sequence SEQ ID No. 12 or amino acid sequence SEQ ID No. 34, and - a PB2 protein as shown in amino acid sequence SEQ ID No.
4.
2. The recombinant influenza B virus according to claim 1, which comprises amino acid sequences SEQ ID No. 4, SEQ ID No. 8, and SEQ ID No.
12.
3. The recombinant influenza B virus according to claim 1, which comprises amino acid sequences SEQ ID No. 4, SEQ ID No. 8, and SEQ ID No.
34.
4. The recombinant influenza B virus according to any one of claims 1 to 3, wherein the virus is a reassortant virus.
5. The recombinant influenza B virus according to claim 4, wherein the virus comprises at least two gene segments from seasonal or pandemic strains.
6. The recombinant influenza B virus according to claim 4, wherein the virus is attenuated or replication-deficient.
7. The recombinant influenza B virus according to claim 4, wherein the virus is completely replication-deficient.
8. The recombinant influenza B virus according to any one of claims 1 to 3, wherein the recombinant influenza B virus comprises a modified NS1 gene segment, and the gene segment encodes an NS1 protein lacking a functional RNA-binding domain and / or a functional carboxyl-terminal domain.
9. The recombinant influenza B virus according to any one of claims 1 to 3, which contains a group 1 HA gene.
10. The recombinant influenza B virus according to any one of claims 1 to 3, which contains a group 2 HA gene.
11. A vaccine composition, which comprises an immunogenicity-inducing effective amount of the recombinant influenza B virus according to any one of claims 1 to 7 mixed with a pharmaceutically acceptable carrier.
12. An isolated nucleic acid, which encodes the recombinant influenza B virus according to any one of claims 1 to 7.
13. Use of the recombinant influenza B virus according to any one of claims 1 to 7 in the preparation of a vaccine for preventing influenza B virus infection.
14. Multiple influenza virus vectors for preparing the recombinant influenza B virus according to any one of claims 1 to 3, which include Vectors for vRNA production comprising a promoter operably linked to influenza virus PA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus PB1 DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus PB2 DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus HA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus NP DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus NA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus M DNA linked to a transcription termination sequence, and vectors for vRNA production comprising a promoter operably linked to influenza virus NS cDNA linked to a transcription termination sequence, wherein the M DNA in the vectors for vRNA production encodes M1 shown by the amino acid sequence SEQ ID No. 8, and the NS cDNA encodes NS2 shown by either of the amino acid sequences SEQ ID No. 12 or amino acid sequence SEQ ID No. 34, and the PB2 DNA encodes PB2 shown by the amino acid sequence SEQ ID No.
4.
15. A method for preparing a recombinant influenza B virus according to any one of claims 1 to 3, which is carried out by contacting a cell with the following: Vectors for vRNA production comprising a promoter operably linked to influenza virus PA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus PB1 DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus PB2 DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus HA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus NP DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus NA DNA linked to a transcription termination sequence, vectors for vRNA production comprising a promoter operably linked to influenza virus M DNA linked to a transcription termination sequence, and vectors for vRNA production comprising a promoter operably linked to influenza virus NS cDNA linked to a transcription termination sequence, wherein the M DNA in the vectors for vRNA production encodes M1 shown by amino acid sequence SEQ ID No. 8, and the NS cDNA encodes NS2 shown by either amino acid sequence SEQ ID No. 12 or amino acid sequence SEQ ID No. 34, and the PB2 DNA encodes PB2 shown by amino acid sequence SEQ ID No.
4.
16. A method for preparing a recombinant influenza B virus according to any one of claims 1 to 7, wherein the method comprises introducing the influenza virus vector of claim 14 that expresses influenza virus particles into a reverse genetics system.
17. A method for increasing the growth rate of influenza virus, wherein the method comprises the following steps: Introducing modifications into the influenza virus PB2, M, and / or NS genes to produce a recombinant influenza B virus according to any one of claims 1 to 7.
18. A recombinant influenza B virus obtained by the method according to any one of claims 15 to 17.
Citation Information
Patent Citations
Attenuated negative strand viruses with altered interferon antagonist activity for use as vaccines and pharmaceuticals
WO1999064068A1
Interferon inducing genetically engineered attenuated viruses
WO1999064571A1
Modified influenza virus
WO2009080806A2
Novel method for generation of RNA virus
WO2010063804A1
Modified influenza virus
CN101903043A