T cell antigen receptors, multimeric complexes thereof, and methods of making and using the same

Abstract

The application provides a T cell antigen receptor, an immune cell expressing the T cell antigen receptor (TCR), and a preparation method and application thereof. The TCR disclosed by the application can be specifically activated by a viral antigen peptide presenting cell, the release level of extracellular cytokines IFN gamma, IL2 and the lactate dehydrogenase release amount are improved, and target cells are significantly killed.

Description

Technical Field

[0001] This invention relates to the field of T-cell antigen receptor technology capable of recognizing CMV pp65, and specifically to various TCRs and their use in the treatment and / or prevention of CMV-related diseases. Background Technology

[0002] T cell receptors (TCRs) are crucial for the cellular immune function of the immune system. TCRs are the only receptors for specific antigenic peptides presented on the major histocompatibility complex (MHC). The binding of antigen-specific TCRs to the pMHC complex triggers direct physical contact and interaction between T cells and antigen-presenting cells, leading to a series of subsequent cell signaling and other physiological responses. This allows T cells with different antigen specificities to exert immune effects on their target cells.

[0003] CN107827959A discloses a method for isolating antigen-specific T cells and cloning an antigen-specific TCR gene encoded within these T cells. This TCR can bind to the HBVS183-91 antigen short peptide complex FLLTRILTI-HLA*A0201, and cells transduced with this invention's TCR can be specifically activated and exhibit strong killing activity against target cells. CN106279404A discloses a soluble and stable heterodimeric TCR containing artificial interchain disulfide bonds between the α-chain variable region and the β-chain constant region. This TCR is soluble and stable, can be well renatured, refolded, and purified, and can specifically bind to the original ligand. However, none of the above patents disclose a specific TCR for cytomegalovirus.

[0004] Cytomegalovirus (CMV) is a herpesvirus DNA virus, also known as a cell inclusion body virus. CMV is widely distributed and highly prevalent in the population, with an infection rate exceeding 95% among adults in China. It is usually an asymptomatic infection, and most infected individuals are asymptomatic. However, under certain conditions, it can invade multiple organs and systems, causing inflammatory diseases. CN102656188A discloses a T-cell receptor capable of recognizing antigens from CMV, which specifically binds to a peptide from the CMV phosphoprotein pp65 presented via the major histocompatibility complex (MHC), said peptide having the amino acid sequence NLVPMVATV. However, the T-cell receptor in this application does not exhibit significant cytotoxic activity against target cells.

[0005] Therefore, the present invention provides a T-cell antigen receptor that can be specifically activated by viral antigen peptide presenting cells, increasing the release levels of extracellular cytokines IFNγ and IL2 and the release of lactate dehydrogenase, and significantly killing target cells. Summary of the Invention

[0006] This invention provides multiple T-cell antigen receptors (TCRs) that specifically bind to the cytomegalovirus (CMV) phosphoprotein pp65 antigenic peptide presented by MHC molecules. The CMV phosphoprotein pp65 contains the amino acid sequence shown in SEQ ID NO: 26, and its nucleotide sequence is shown in SEQ ID NO: 27. The TCRs of this invention can specifically recognize the corresponding CMV pp65 antigenic peptide-MHC molecule complex, activate TCR-T cells, and subsequently produce high levels of cytokines IFNγ, IL2, and TNFα, significantly killing tumor cells in both in vivo and in vitro experiments. Details are as follows:

[0007] In a first aspect, the present invention provides a T-cell antigen receptor that specifically binds to CMV pp65, wherein the binding epitope comprises SEQ ID NO: 11.

[0008] Preferably, the T-cell antigen receptor specifically binds to the antigenic peptide from cytomegalovirus (CMV) phosphoprotein pp65 via presentation of the major histocompatibility complex molecule (MHC).

[0009] Preferably, the T-cell antigen receptor comprises at least one α-chain variable region and / or one β-chain variable region.

[0010] Preferably, the T-cell antigen receptor is an αβ heterodimer.

[0011] Preferably, the T-cell antigen receptor comprises α-chain CDR1α-CDR3α and β-chain CDR1β-CDR3β.

[0012] The amino acid sequence of CDR1α contains SEQ ID NO: 1 or contains amino acid sequences with at least 80% homology to the amino acid sequence shown in SEQ ID NO: 1; the amino acid sequence of CDR2α contains SEQ ID NO: 2 or contains amino acid sequences with at least 80% homology to the amino acid sequence shown in SEQ ID NO: 2; the amino acid sequence of CDR3α contains any one of SEQ ID NO: 3-4 or contains amino acid sequences with at least 80% homology to the amino acid sequences shown in any one of SEQ ID NO: 3-4; the amino acid sequence of CDR1β contains any one of SEQ ID NO: 5-6 or contains amino acid sequences with at least 80% homology to the amino acid sequences shown in any one of SEQ ID NO: 5-6; the amino acid sequence of CDR2β contains any one of SEQ ID NO: 7-8 or contains amino acid sequences with at least 80% homology to the amino acid sequences shown in any one of SEQ ID NO: 7-8; and the amino acid sequence of CDR3β contains any one of SEQ ID NO: 9-10 or contains amino acid sequences with at least 80% homology to the amino acid sequences shown in any one of SEQ ID NO: 9-10.

[0013] In one specific embodiment of the present invention, the CDR1α-CDR3α and CDR1β-CDR3β comprise any one of the following groups:

[0014]

[0015] In one specific embodiment of the present invention, the amino acid sequence of its β chain comprises any one of SEQ ID NO: 32-33 or comprises an amino acid sequence having at least 80% homology with any one of SEQ ID NO: 32-33.

[0016] In one specific embodiment of the present invention, the amino acid sequence of its α chain comprises any one of SEQ ID NO: 34-35 or comprises an amino acid sequence having at least 80% homology with any one of SEQ ID NO: 34-35.

[0017] Preferably, the amino acid sequences of the α chain and β chain are directly or indirectly linked, preferably indirectly linked, and more preferably linked through fp2A (furin-SGSG-p2A).

[0018] More preferably, the amino acid sequence of fp2A contains SEQ ID NO: 40.

[0019] In one specific embodiment of the present invention, the connection order of the α chain and the β chain can be α chain, fp2A and β chain, or β chain, fp2A and α chain.

[0020] In one specific embodiment of the present invention, the amino acid sequence comprises any one of SEQ ID NO: 28 or 30 or comprises an amino acid sequence having at least 80% homology with any one of SEQ ID NO: 28 or 30.

[0021] In a second aspect, the present invention provides an antibody or an antigen-binding fragment thereof that specifically binds to CMV pp65.

[0022] Preferably, the epitope includes SEQ ID NO: 11.

[0023] Preferably, the antibody or its antigen-binding fragment comprises CDR1α-CDR3α of the α chain and CDR1β-CDR3β of the β chain.

[0024] In one specific embodiment of the present invention, the amino acid sequence of the antibody or its antigen-binding fragment comprises any one of SEQ ID NO: 28 or 30 or comprises at least 80% homology with the amino acid sequence shown in any one of SEQ ID NO: 28 or 30.

[0025] Preferably, the antibody or its antigen-binding fragment may further comprise fragments such as Fab, Fab', Fab'-SH, Fv, scFv, (Fab')2, single-domain antibody, double antibody (dAb), or linear antibody.

[0026] A third aspect of the present invention provides a nucleic acid encoding the β chain of the T-cell antigen receptor described herein.

[0027] Preferably, the nucleic acid sequence encoding the β chain of the T-cell antigen receptor comprises any one of SEQ ID NO: 36-37 or contains at least 80% homology with the nucleic acid sequences shown in any one of SEQ ID NO: 36-37.

[0028] In a fourth aspect, the present invention provides a nucleic acid encoding the α chain of the T-cell antigen receptor described herein.

[0029] Preferably, the nucleic acid sequence encoding the α chain of the T cell antigen receptor comprises any one of SEQ ID NO: 38-39 or contains at least 80% homology with the nucleic acid sequences shown in any one of SEQ ID NO: 38-39.

[0030] In a fifth aspect, the present invention provides a nucleic acid encoding the T-cell antigen receptor or antibody or antigen-binding fragment thereof described herein.

[0031] Preferably, the α chain and β chain encoding the T-cell antigen receptor are linked by a nucleic acid sequence encoding fp2A. More preferably, the nucleic acid sequence encoding fp2A includes SEQ ID NO: 41.

[0032] Preferably, the nucleic acid sequence encoding the T-cell antigen receptor comprises any one of SEQ ID NO: 29 or 31 or comprises having at least 80% homology with the nucleic acid sequence shown in any one of SEQ ID NO: 29 or 31.

[0033] Preferably, the nucleic acid sequence encoding the antibody or its antigen-binding fragment comprises any one of SEQ ID NO: 29 or 31 or comprises having at least 80% homology with the nucleic acid sequence shown in any one of SEQ ID NO: 29 or 31.

[0034] The nucleic acid sequence described in this invention can be single-stranded or double-stranded, and can be DNA or RNA.

[0035] Preferably, the nucleic acid sequence may be codon-optimized. More preferably, the codon optimization includes replacing a large number of rare codons used by viruses with corresponding mammalian codons and / or removing unstable motifs and / or hidden splicing sites on the mRNA.

[0036] In a sixth aspect, the present invention provides an expression vector comprising any of the nucleic acids described in the present invention.

[0037] Preferably, the expression vector is capable of expression in vivo, in vitro, or outside the body. More preferably, the expression vector is continuously expressed at a high level in in vivo cells.

[0038] Preferably, the expression vector can be a prokaryotic expression vector or a retroviral vector.

[0039] More preferably, the prokaryotic expression vector is an *Escherichia coli* series. In one specific embodiment of the present invention, the expression vector is pET-26b or pET28a+.

[0040] Further preferred vectors may include Raúl's sarcoma virus (RSV), lentivirus, human immunodeficiency virus (HIV), murine leukemia virus (MLV), equine infectious anemia virus (EIAV), mouse mammary cancer virus (MMTV), Fujinami sarcoma virus (FuSV), FBR mouse osteosarcoma virus (FBR MSV), Moloney's murine leukemia virus (Mo-MLV), Moloney's murine sarcoma virus (Mo-MSV), Abelson's murine leukemia virus (A-MLV), avian myeloid cytotoxic virus 29 (MC29), or avian myeloid erythroblastosis virus (AEV), etc. Even more preferably, the expression vector is a lentiviral expression vector.

[0041] In one specific embodiment of the present invention, the expression vector is pHAGE-IRES-RFP.

[0042] More preferably, the connection order of the β chain, α chain and backbone vector in the expression vector is promoter, β chain, fp2A, α chain, IRES and RFP sequence.

[0043] In a seventh aspect, the present invention provides a host cell comprising any of the nucleic acids or expression vectors described in the present invention.

[0044] Preferably, the host cell can be eukaryotic or prokaryotic. More preferably, the host cell is yeast cell, 293 cell, CHO cell, Escherichia coli, etc.

[0045] In one specific embodiment of the present invention, the host cell is Stbl3, BL21 or transetta.

[0046] In an eighth aspect, the present invention provides an immune cell that expresses the T-cell antigen receptor or antibody or antigen-binding fragment thereof described in the present invention.

[0047] Preferably, the immune cells comprise one or more heterologous nucleic acid sequences as described in any of the present invention.

[0048] Preferably, the immune cells include, but are not limited to, stem cells and lymphocytes (including T cells and B cells). Further, the immune cells are B cells, and the B cells express the aforementioned antibodies or their antigen-binding fragments. The immune cells are T cells, and the T cell antigen receptor structure of the T cells is as defined above.

[0049] Preferably, the T cells can be CD4+T, CD8+T, etc.

[0050] More preferably, the immune cells are isolated from the subject's T cells.

[0051] Preferably, the immune cells are T cells derived from CMV serum-negative donors.

[0052] A ninth aspect of the present invention provides a method for preparing immune cells, comprising transfecting an immune cell with a nucleic acid sequence encoding the antibody or its antigen-binding fragment or the T cell antigen receptor described above into the immune cell for expression.

[0053] Preferably, the immune cells include, but are not limited to, stem cells and lymphocytes (including T cells and B cells). Further, the immune cells are B cells, and the B cells express the aforementioned antibodies or their antigen-binding fragments. The immune cells are T cells, and the T cell antigen receptor structure of the T cells is as defined above.

[0054] Preferably, the method also includes a step of knocking out endogenous TCRs in cells. Specifically, this can involve constructing a guide targeting endogenous TCRs into a lentiviral vector, and co-transfecting it into T cells along with a packaging plasmid and transfection reagent.

[0055] In a tenth aspect, the present invention provides a method for preparing recombinant T cells, comprising the following steps:

[0056] 1) Obtain any of the nucleic acids described in this invention from positive T cell clones;

[0057] 2) Isolate and culture primary T cells;

[0058] 3) Deliver the nucleic acid obtained in step 1) into the primary T cells described in step 2) to obtain recombinant T cells expressing any of the T cell antigen receptors described in this invention.

[0059] Preferably, the T cells are selected from hematopoietic stem cells or peripheral blood lymphocyte (PBL) derived T cells.

[0060] In an eleventh aspect, the present invention provides a method for preparing an antibody or its antigen-binding fragment or T-cell antigen receptor, comprising the following steps:

[0061] (1) Obtain any of the nucleic acids described in this invention from positive T cell clones;

[0062] (2) Link the nucleic acid obtained in step (1) to the vector backbone to obtain the expression vector;

[0063] (3) Transform the expression vector obtained in step (2) into the host cell and then induce its expression;

[0064] (4) Obtain antibodies or their antigen-binding fragments or T-cell antigen receptors.

[0065] Preferably, the positive T cells specifically bind to the cytomegalovirus (CMV) phosphoprotein pp65 antigenic peptide presented by MHC. More preferably, the MHC-presented cytomegalovirus (CMV) phosphoprotein pp65 antigenic peptide complex is a monomeric or polymeric complex.

[0066] In a twelfth aspect, the present invention provides a multimeric complex comprising any of the T-cell antigen receptors described herein.

[0067] Preferably, the multimeric complex further includes a monomer, a biotin molecule, and a streptavidin molecule or avidin molecule, wherein the monomer includes the extracellular region of the α-chain of an MHC molecule, the β2m chain, and an antigenic peptide, the monomer is coupled to the biotin molecule, and the biotin molecule is bound to the streptavidin or avidin molecule.

[0068] Preferably, the C-terminus of the extracellular region of the α-chain of the MHC molecule is linked to an avi-tag sequence.

[0069] Preferably, the extracellular region of the α-chain of the MHC molecule does not contain a signal peptide sequence, and an M amino acid is added before the mature peptide sequence.

[0070] Preferably, the β2m chain does not contain a signal peptide sequence. Furthermore, two amino acids, M and A, are added before the mature peptide sequence.

[0071] In one specific embodiment of the present invention, the β2m chain is a chain that does not contain a signal peptide and has two amino acids added before the mature peptide sequence, preferably M and A.

[0072] Preferably, the antigenic peptide comprises SEQ ID NO: 11.

[0073] In one specific embodiment of the present invention, the polymeric complex comprises:

[0074] (1) T-cell antigen receptor; preferably containing any one of SEQ ID NO: 28 or 30 or containing an amino acid sequence that has at least 80% homology with any one of SEQ ID NO: 28 or 30.

[0075] (3) Monomer, wherein the monomer comprises an antigenic peptide, an extracellular region of an MHC molecule α chain with an avi-tag sequence linked to its C-terminus, and a β2m chain without a signal peptide; wherein the antigenic peptide is SEQ ID NO: 11;

[0076] (4) Biotin molecules; and

[0077] (5) Streptavidin molecule or avidin molecule; wherein the monomer is coupled to the biotin molecule, and the biotin molecule is bound to the streptavidin or avidin.

[0078] Preferably, the MHC molecule is an MHC class I molecule or an MHC class II molecule. More preferably, the MHC molecule is an MHC class I molecule.

[0079] Preferably, the MHC molecule is HLA-A*2402.

[0080] In one specific embodiment of the present invention, the amino acid sequence of the α chain of the MHC molecule, as shown in SEQ ID NO: 22 or SEQ ID NO: 22, has at least 80% homology.

[0081] In one specific embodiment of the present invention, the nucleotide sequence of the α chain of the MHC molecule, as shown in SEQ ID NO: 23 or SEQ ID NO: 23, has at least 80% homology.

[0082] In one specific embodiment of the present invention, the amino acid sequence of the β2m chain of the MHC molecule, as shown in SEQ ID NO: 24 or SEQ ID NO: 24, has at least 80% homology.

[0083] In one specific embodiment of the present invention, the nucleotide sequence of the β2m chain of the MHC molecule, such as the amino acid sequence shown in SEQ ID NO: 25 or SEQ ID NO: 25, has at least 80% homology.

[0084] To improve the specificity of the binding of the antigen peptide-MHC tetramer to the T-cell antigen receptor, the monomer further includes chemical modification, mutation, insertion and / or deletion of at least one amino acid.

[0085] Preferably, the extracellular region of the α chain and the β2m chain of the MHC molecule are non-covalently bonded.

[0086] Preferably, the polymeric complex contains at least one monomer.

[0087] Preferably, each monomer is coupled with at least one biotin molecule.

[0088] According to a thirteenth aspect of the present invention, a method for preparing any of the polymeric complexes described herein is provided, comprising the following steps:

[0089] I) Expression and purification of the extracellular region of the α chain and the β2m chain of MHC molecules with C-terminal avi-tag sequences;

[0090] II) The extracellular region of the extracellular region of the MHC molecule α chain with an avi-tag sequence linked to the C-terminus is folded and refolded to prepare a monomer;

[0091] III) Biotinylate the monomer prepared in step II) to obtain a biotinylated monomer;

[0092] IV) The biotinylated monomer obtained in step III) is reacted with fluorescently labeled streptavidin or avidin to prepare an antigen peptide-MHC tetramer.

[0093] V) The antigen peptide-MHC tetramer obtained in step IV) is co-incubated with T cells to form a T cell antigen receptor-antigen peptide-MHC tetramer complex.

[0094] Preferably, step I) includes cloning the nucleotide sequences of the extracellular region of the MHC molecule α chain encoding the C-terminus linked avi-tag sequence and the nucleotide sequences of the MHC molecule β2m chain, respectively, ligating them into a vector, transforming them into expression bacteria, adding an inducer, and extracting inclusion bodies.

[0095] More preferably, the expression bacteria are cultured to OD0.05 600 The value is between 0.2 and 0.4.

[0096] More preferably, the final molar concentration of the inducer after its addition is 0.5-1 mM.

[0097] Preferably, expression is induced for 4-6 hours.

[0098] Preferably, step II) includes the folding of the β2m chain, that is, the antigen peptide, the β2m chain of the MHC molecule, and the extracellular region of the α chain of the MHC molecule with the C-terminus linked to the avi-tag sequence are sequentially added to a dilution buffer and incubated in a light-protected water bath. The folding of the β2m chain includes inclusion body denaturation, the addition of a protease inhibitor, and then dialysis.

[0099] Preferably, the molar ratio of the antigen peptide, the β2m chain without the signal peptide, and the α chain with the C-terminus linked to the avi-tag sequence is (30-50):(2-2.5):1. More preferably, it is 40:2:1.

[0100] Preferably, step II) further includes a step of purifying the monomer.

[0101] Preferably, the biotinylation in step III) is performed by binding the monomer with BiomixA and BiomixB under the catalysis of BirA enzyme.

[0102] Preferably, step III) further includes the step of purifying the biotinylated monomer.

[0103] Preferably, the molar ratio of the monomer to streptavidin in step IV) is (4-7):1.

[0104] In a fourteenth aspect, the present invention provides the use of the above-described multimeric complex in the preparation, screening, or detection of the antibody or its antigen-binding fragment or T-cell antigen receptor described herein.

[0105] According to the fifteenth aspect of the present invention, a method for preparing a T-cell antigen receptor is provided, comprising the following steps:

[0106] I) Expression and purification of the extracellular region of the α chain and the β2m chain of MHC molecules with C-terminal avi-tag sequences;

[0107] II) The antigen peptide, the extracellular region of the α chain of the MHC molecule with the avi-tag sequence linked to the C-terminus obtained in step I), and the β2m chain are folded back to prepare a monomer;

[0108] III) Biotinylate the monomer prepared in step II) to obtain a biotinylated monomer;

[0109] IV) The biotinylated monomer obtained in step III) is reacted with fluorescently labeled streptavidin or avidin to prepare an antigen peptide-MHC tetramer.

[0110] V) The antigen peptide-MHC tetramer obtained in step IV) is co-incubated with T cells to form a T cell antigen receptor-antigen peptide-MHC tetramer complex, and the T cell antigen receptor is isolated.

[0111] The sixteenth aspect of the present invention provides the use of any of the T-cell antigen receptors, antibodies or antigen-binding fragments thereof, nucleic acids, expression vectors, host cells, immune cells, and multimeric complexes described in any of the present invention in the preparation of products for diagnosing or treating tumors or CMV-related diseases.

[0112] Preferably, the CMV-related diseases are selected from neonatal CMV inclusion body diseases, acute acquired CMV infection, or diseases caused by CMV infection in immune compromised individuals.

[0113] In one specific embodiment of the present invention, the CMV-related diseases are selected from liver, spleen, or central nervous system diseases, disabilities, infectious mononucleosis, skeletal myalgia, CMV retinitis, gastrointestinal CMV, or encephalitis, etc.

[0114] The seventeenth aspect of the present invention provides the use of any T-cell antigen receptor, any antibody or antigen-binding fragment thereof, any nucleic acid, any expression vector, host cell, immune cell, or multimeric complex of the present invention in T-cell labeling, detection, cell sorting, or activation.

[0115] An eighteenth aspect of the present invention provides a pharmaceutical composition comprising any one of the following groups:

[0116] i) The T-cell antigen receptor described in this invention;

[0117] ii) The nucleic acid described in this invention;

[0118] iii) The expression vector described in this invention;

[0119] iv) The host cell described in this invention;

[0120] v) The immune cells described in this invention;

[0121] vi) the polymeric complex described in this invention; or

[0122] vii) The antibody or its antigen-binding fragment described in this invention.

[0123] Preferably, the pharmaceutical composition may further comprise pharmaceutically acceptable excipients.

[0124] Preferably, the pharmaceutical composition can also be used in combination with other therapeutic agents. More preferably, the therapeutic agent can be an immunomodulator.

[0125] In a nineteenth aspect, the present invention provides a kit comprising any one of the following groups:

[0126] i) The T-cell antigen receptor described in this invention;

[0127] ii) The nucleic acid described in this invention;

[0128] iii) The expression vector described in this invention;

[0129] iv) The host cell described in this invention;

[0130] v) The immune cells described in this invention;

[0131] vi) the polymeric complex described in this invention; or

[0132] vii) The antibody or its antigen-binding fragment described in this invention.

[0133] A twentieth aspect of the present invention provides a method for detecting cytomegalovirus (CMV) phosphoprotein pp65, the method comprising contacting a sample to be tested with an antibody or its antigen-binding fragment or T-cell antigen receptor as described in the present invention, and then detecting the complex formed by cytomegalovirus (CMV) phosphoprotein pp65 with the antibody or its antigen-binding fragment or T-cell antigen receptor.

[0134] Preferably, the detection of cytomegalovirus (CMV) phosphoprotein pp65 refers to the detection of the presence or content of cytomegalovirus (CMV) phosphoprotein pp65. Here, "present" indicates whether the protein is present or absent, and "content" can refer to the expression level or protein concentration, etc.

[0135] Preferably, the antibody or its antigen-binding fragment or T-cell antigen receptor includes a detectable marker.

[0136] In one specific embodiment of the present invention, the marker may be His and / or HA.

[0137] The method for detecting cytomegalovirus (CMV) phosphoprotein pp65 described in this invention is not a method for diagnosing diseases. First, the sample to be tested is not an organism or its isolated tissue or cells. Second, even if cytomegalovirus (CMV) phosphoprotein pp65 is present in an organism or contains a certain concentration or expression level of cytomegalovirus (CMV) phosphoprotein pp65, it does not necessarily indicate a disease, but is only a possibility.

[0138] A twenty-first aspect of the present invention provides a method for treating and / or preventing CMV-related diseases, the method comprising administering to an individual an effective amount of the antibody or antigen-binding fragment thereof described in the present invention, the T-cell antigen receptor, the nucleic acid, the expression vector, the host cell, the immune cell, or the pharmaceutical composition described herein.

[0139] Preferably, the method includes the step of adoptively transferring T cells expressing the T cell antigen receptor of the present invention to a subject.

[0140] Preferably, the method includes positioning the T-cell antigen receptor of the present invention near CMV-related diseases (preferably tumors or metastatic tumors) to enhance the efficacy of toxins or immunostimulants.

[0141] Preferably, it is used for the treatment and / or prevention of CMV reactivation after allogeneic hematopoietic stem cell transplantation.

[0142] Preferably, it is used for the treatment and / or prevention of CMV reactivation after organ transplantation (e.g., kidney, liver, pancreas, intestine, cornea), tissue transplantation, cell transplantation (islet cells, limbal stem cells) or stem cell therapy.

[0143] Preferably, the T cells expressing the T cell antigen receptor of the present invention are derived from the subject.

[0144] Preferably, the T cells expressing the T cell antigen receptor of the present invention are derived from the same donor as the hematopoietic stem cells, organs, tissues, cells or stem cells.

[0145] A twenty-second aspect of the present invention provides a method for diagnosing CMV-related diseases, the method comprising sampling, contacting the sample with an antibody or antigen-binding fragment thereof or a T-cell antigen receptor as described in the present invention, and then detecting a complex formed by CMVpp65 with the antibody or antigen-binding fragment thereof or a T-cell antigen receptor.

[0146] Preferably, the antibody or its antigen-binding fragment or T-cell antigen receptor includes a detectable marker.

[0147] The TCR described in this invention can specifically recognize the corresponding CMV pp65 antigen peptide-MHC molecular complex, activate TCR-T cells, and then produce high levels of cytokines IFNγ, IL2, and TNFα, which significantly kill tumor cells in both in vivo and in vitro experiments.

[0148] The "T-cell antigen receptor" described in this invention is a molecule capable of recognizing peptides presented by MHC molecules or their tetramers.

[0149] The "tumor" mentioned in this invention includes, but is not limited to, pancreatic cancer, liver cancer, colon cancer, rectal cancer, gastric cancer, lymphoma, basal cell carcinoma, non-small cell lung cancer, leukemia, ovarian cancer, nasopharyngeal carcinoma, breast cancer, endometrial cancer, bladder cancer, lung cancer, bronchial cancer, bone cancer, prostate cancer, bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome, and sarcoma. The leukemia is selected from acute lymphoblastic leukemia, acute myeloid leukemia, myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia, and chronic myeloid leukemia. The lymphoma is selected from Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B-cell lymphoma, T-cell lymphoma, and Waldenström macroglobulinemia. The sarcoma is selected from osteosarcoma, Ewing's sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, and chondrosarcoma. Preferably, the tumor is selected from pancreatic cancer, liver cancer, oral squamous cell carcinoma, colon cancer, ovarian cancer, and gastric cancer. In one specific embodiment of the present invention, the tumor is lymphoma.

[0150] The "CMV-related diseases" described in this invention include diseases caused by CMV pp65 infection, including neonatal CMV inclusion body disease, which can severely affect the liver, spleen, and central nervous system, and cause disability. It also includes acute acquired CMV infection, similar to infectious mononucleosis, including fever, musculoskeletal pain, etc. Furthermore, it includes individuals with compromised immune systems, such as organ transplant recipients or those with HIV, where infection can lead to CMV retinitis, gastrointestinal CMV, and encephalitis, etc.

[0151] When the term "comprising" is used in this application to describe a protein or nucleic acid sequence, the protein or nucleic acid may be composed of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the activity described in this invention.

[0152] The term "prevention" as used in this invention refers to all behaviors that suppress or delay specific symptoms of stress by applying the products described in this invention.

[0153] The term "diagnosis" as used in this invention refers to determining whether a patient has had a disease or condition in the past, at the time of diagnosis, or in the future, or determining the progression of a disease or its possible future progression, or assessing the patient's response to treatment.

[0154] The term "treatment" as used in this invention refers to slowing down, interrupting, preventing, controlling, stopping, reducing, or reversing the progression or severity of a sign, symptom, disorder, condition, or disease, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, conditions, or disorders, and refers to therapeutic interventions that improve the signs, symptoms, etc., of a disease or pathological state after the disease has begun to develop.

[0155] The term "effective amount" as used in this invention refers to the amount or dose of the product of this invention that provides the desired treatment or prevention after being administered to a patient or organ in one or more doses.

[0156] The “products” described in this invention include, but are not limited to, the antibodies or antigen-binding fragments thereof described in this invention, the T-cell antigen receptors described in this invention, the nucleic acids described in this invention, the expression vectors described in this invention, the host cells described in this invention, the immune cells described in this invention, or the multimeric complexes described in this invention, as well as other auxiliary or synergistic reagents with the above products.

[0157] The "product" described in this invention can be a pharmaceutical composition such as a reagent kit, chip, antibody-drug conjugate, or multifunctional antibody.

[0158] The "subject" as described in this invention includes, but is not limited to, humans or non-human mammals. Preferably, the non-human mammals include, but are not limited to, mice, rats, monkeys, pigs, or rabbits.

[0159] The "homology" referred to in this invention means that, in using amino acid or nucleotide sequences, those skilled in the art can adjust the sequence according to actual work needs without changing the main structure or function of the original sequence, so that the sequence used has (including but not limited to) 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, or 30% homology compared to the specific sequence described in this invention. 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homology. For example, the "at least 80% homology with the amino acid sequence shown in SEQ ID NO: 1" mentioned in this invention means that, while retaining the binding function with the cytomegalovirus (CMV) phosphoprotein pp65 peptide epitope:MHC complex, SEQ ID NO: 1 can be adjusted according to actual working needs. This includes one or more changes, such as substitution, deletion, and / or insertion of one or more amino acids, truncation, or lengthening at one or both ends, as long as it maintains more than 80% homology and retains the ability to bind to the pp65 epitope:MHC complex or the pp65 epitope:MHC molecule tetramer. The changes can be substitution, addition, or deletion. Substitution can be between amino acids of the same polarity, between amino acids of the same charge, between uncharged amino acids, between aliphatic amino acids, between aromatic amino acids, between nonpolar amino acids, or between amino acids with related side chain portions. Basic side chains include, but are not limited to, lysine, arginine, or histidine. Acidic side chains include, but are not limited to, aspartic acid or glutamic acid. Uncharged amino acids include, but are not limited to, aspartic acid, glutamine, serine, threonine, or tyrosine. Nonpolar side chains include, but are not limited to, glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan, or cysteine. The percentage of at least 80% includes, but is not limited to, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. Attached Figure Description

[0160] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings, wherein:

[0161] Figure 1 SDS-PAGE results of antigen peptide-MHC monomers, where M is the protein marker and bands 1 and 2 are monomers;

[0162] Figure 2 The results of the tetramer-based specific T cell detection are as follows: Specifically, the results of the specific T cell retrieval by the self-developed A2402-QYD tetramer and the commercial tetramer are compared.

[0163] Figure 3 : Schematic diagram of TCR β and α chains ligated in pHAGE vector, where the ligation order is promoter, β chain, furin-p2A, α chain, IRES and RFP sequence, respectively;

[0164] Figure 4 Flow cytometry was used to detect the membrane surface expression of TCRs, specifically the membrane surface expression of HLA-A*A2402 QYDPVAALF-specific TCRs (C27, C30). Among them, BV421 is one of the series of luciferins, and the full name of BV is Brilliant Violet.

[0165] Figure 5 Flow cytometry was used to detect the affinity of TCR for the CMV pp65 tetramer probe. Specifically, the affinity of HLA-A*A2402 QYDPVAALF-specific TCR (C27, C30) for the CMV pp65 tetramer probe was measured.

[0166] Figure 6 Figure 1 shows the detection results of the release levels of cytokines IL2, TNFα and IFNγ of C27-TCR-T and C30-TCR-T cells and the luciferase levels of target cells. Among them, C27 and C30 are TCRs prepared in Example 2, NE represents the blank control group, NT represents the T cell group only, Raji is Raji cells that have not been converted to pp65, and 1G4 represents TCRs specific to NY-ESO-1.

[0167] Figure 7 : Evaluation of the effect of C27-TCR on inhibiting tumor growth in mice in a lymphoma animal model;

[0168] Figure 8 Statistical results of tumor growth in mice with lymphoma animal models: no T-cell injection group (PBS), control T-cell injection group (NC), and CMV TCR-T injection group (C27-TCR);

[0169] Figure 9 Statistical results of TCR-T cell-specific proliferation in mice of lymphoma animal models: no T cell injection group (PBS), control T cell injection group (NC), and CMV TCR-T injection group (C27-TCR); Detailed Implementation

[0170] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0171] Example 1: Construction and efficacy testing of CMV antigenic epitope tetramers

[0172] I. Construction of CMV antigenic epitope tetramer

[0173] 1) Expression of the α-chain and β2m-chain (amino acid sequence as shown in SEQ ID NO: 22, nucleotide sequence as shown in SEQ ID NO: 23) of sequence-optimized HLA-A*2402 (amino acid sequence as shown in SEQ ID NO: 24, nucleotide sequence as shown in SEQ ID NO: 25). The α-chain structure consists of the extracellular region sequence of the corresponding HLA-type α-chain linked with an Avi-tag sequence, separated by BamHI restriction sites to provide biotinylation sites. The β2m-chain had its signal peptide sequence removed, and two amino acids (M and A) were added before the mature peptide sequence. The expression vector was PET28a+, and the expression bacteria were transetta or BL21. The IPTG concentration was 0.5 mM, and expression was induced for 4 h. Inclusion bodies of the α-chain and β2m-chain proteins were extracted.

[0174] 2) Selection of CMV antigenic epitope (antigenic peptide): HLA-A*2402 type corresponding antigenic epitope QYDPVAALF (SEQ ID NO: 11).

[0175] 3) pMHC I monomer folding and purification: The antigenic peptide described in step 2), the corresponding β2m renatured protein and α-chain protein described in step 1) were added sequentially to the reduction system in a molar ratio of 40:2:1, and the folding reaction was carried out for 72 h. The obtained product was purified by passing it through a Superdex 75 10 / 300GL column. The purified product was collected and biotinylated using an Avidity kit, and purified again to obtain the biotinylated monomer. The monomer purity was detected by gel electrophoresis.

[0176] 4) The biotinylated monomer described in step 3) is reacted with APC-labeled streptavidin to obtain the corresponding tetramer, named A2402-QYDPVAALF-tetramer (abbreviated as A2402-QYD tetramer).

[0177] II. CMV antigenic epitope tetramer effect detection

[0178] 1. Isolate human peripheral blood mononuclear cells (PBMCs) or prepare TCR-T cells, and prepare a cell suspension with a cell density of 1×10⁻⁶ cells. 6 Cells / mL.

[0179] 2. Centrifuge the cells at 3000 rpm for 5 min. Remove the supernatant and resuspend in 50 μL of PBS containing 1% serum.

[0180] 3. Add 2 μL of tetramer and incubate at room temperature for 30 min.

[0181] 4. Add 2 μL of CD8 antibody and incubate on ice for 20 min.

[0182] 5. Add 1 mL PBS, incubate at 3000 rpm for 5 min.

[0183] 6. Remove the supernatant, add 1 mL PBS, and incubate at 3000 rpm for 5 min.

[0184] 7. Remove the supernatant, resuspend the cells in 500 μL of 4% paraformaldehyde, and filter the cell suspension through a filter membrane.

[0185] 8. Detect positive cells using flow cytometry.

[0186] III. Experimental Results

[0187] The SDS-PAGE results of the monomers are shown below. Figure 1 .like Figure 1 As shown, after refolding and HPLC purification, the obtained monomers clearly show proteins of corresponding sizes for the heavy chain (the extracellular region of the α chain linked to the Avi-tag sequence at the C-terminus) and the light chain (the β2m chain with the signal peptide region removed), and the purity is high.

[0188] The constructed tetramers were co-incubated with corresponding HLA-type PBMC cells to extract specific T cells. For example... Figure 2As shown, the independently developed tetramer has a significant advantage over the commercial tetramer (MBL) in catching specific T cells. The commercial A2402-QYD (MBL, TS-0020-2C) tetramer failed to detect any specific T cells, while the independently developed tetramer detected 0.02-0.05% of positive cells, demonstrating its high sensitivity in sorting specific T cells. Furthermore, data from different batches showed high stability. C27-TCR and C30-TCR cells were successfully caught using this A2402-QYD tetramer.

[0189] Example 2: Construction of pHAGE-TCR-RFP vector

[0190] I. Obtaining β and α gene fragments of CMV pp65 epitope-specific TCRs

[0191] 1) Using HLA-A*2402-QYDPVAALF-tetramer purchased from MBL or prepared by our company, T cells that were tetramer-positive were sorted by flow cytometry according to the product instructions and peripheral blood staining, and cDNA (SuperScript® IV Reverse Transcriptase, Invitrogen) was obtained by reverse transcription. Based on the principle of multiplex PCR, the variable region fragment of the TCRβ gene was amplified by two rounds of PCR (KOD-Plus-Neo, TOYOBO).

[0192] The reverse transcription primer is: TRBC1-TCAGGCAGTATCTGGAGTCATTG (SEQ ID NO: 136)

[0193] The PCR amplification primers are:

[0194] Upstream primer 1: T cell receptor β variable region -- TRBV_F1 (SEQ ID NO: 56 to 95, where SEQ ID NO: 66 and 69 can also be used alone as TRBV_F1 for preparing the variable region fragments of the C27 and C30 β genes, respectively)

[0195] Upstream primer 2: T cell receptor β variable region -- TRBV_F2 (SEQ ID NO: 96 to 135, of which SEQ ID NO: 106 and 112 can also be used alone as TRBV_F2 for preparing the variable region fragments of the C27 and C30 β genes, respectively)

[0196] Downstream primer 1: T cell receptor β constant region -- TRBC2-GCACCTCCTTCCCATTCACC (SEQ ID NO: 137)

[0197] Downstream primer 2: T cell receptor β constant region-TRBC3-GCTTCTGATGGCTCAAACACAG (SEQ ID NO: 138)

[0198] Specifically, according to the KOD-Plus-Neo PCR polymerase product instructions, the first-round PCR system was 20 μL, the annealing temperature was 60℃, and the reaction was repeated for 30 cycles. 1 μL of the product from the first-round PCR reaction was used as the template for the second-round PCR, with a 30 μL system, annealing temperature of 60℃, and 30 cycles. The second-round PCR product was then run on an agarose gel, and the corresponding bands were excised and recovered using a Tiangen agarose gel recovery kit. Sequencing was performed using downstream primer 2. The TCRβ gene sequence was obtained. The β-chain nucleotide sequences of C27 and C30 are shown in SEQ ID NO: 36 and 37.

[0199] 2) As above, tetramer-positive T cells were reverse transcribed to obtain cDNA (SuperScript® IVReverse Transcriptase, Invitrogen). The TCRα gene fragment was amplified by two rounds of PCR (KOD-Plus-Neo, TOYOBO) according to the product instructions.

[0200] The reverse transcription primer was: T cell receptor α constant region-TRAC1-CGACCAGCTTGACATCACAG (SEQ ID NO: 139)

[0201] The PCR amplification primers are:

[0202] Upstream primer 3: T cell receptor α variable region - TRAV_F1 (SEQ ID NO: 142 to 186, of which SEQ ID NO: 172 and 172 can also be used alone as TRAV_F1 for preparing the variable region fragments of the C27 and C30 α genes, respectively)

[0203] Upstream primer 4: T cell receptor α variable region - TRAV_F2 (SEQ ID NO: 42-55, 187 to 214, wherein SEQ ID NO: 42, 42 can also be used alone as TRAV_F2 for preparing the variable region fragments of the C27 and C30 α genes, respectively)

[0204] Downstream primer 3: T cell receptor α constant region-TRAC2-GTTGCTCTTGAAGTCCATAGACCTC (SEQ ID NO: 140)

[0205] Downstream primer 4: T cell receptor α constant region-TRAC3-CAGGGTCAGGGTTCTGGATA (SEQ ID NO: 141)

[0206] Specifically, according to the KOD-Plus-Neo PCR polymerase product instructions, the first-round PCR system was 20 μL, the annealing temperature was 60℃, and the reaction was repeated for 30 cycles. 1 μL of the product from the first-round PCR reaction was used as the template for the second-round PCR, with a 30 μL system, annealing temperature of 60℃, and 30 cycles. The second-round PCR product was then run on an agarose gel, and the corresponding bands were excised and recovered using a Tiangen agarose gel recovery kit. Sequencing was performed using downstream primer 4. The TCRα gene sequence was obtained. Specifically, the α-chain nucleotide sequences of C27 and C30 are shown in SEQ ID NO: 38 and 39.

[0207] II. Construction of pHAGE-TCR Vector

[0208] TCRβ, fp2A, and TCRα were amplified by overlap-PCR using long primers (containing the fp2A sequence) (KOD-Plus-Neo, TOYOBO) to obtain the TCRβ-fp2A-TCRα fragment, which was named C27 or C30, respectively.

[0209] The amplification primers include upstream primer 5 (SEQ ID NO: 12 (C27), SEQ ID NO: 13 (C30)), downstream primer 5 (SEQ ID NO: 16), upstream primer 6 (SEQ ID NO: 14 (C27), SEQ ID NO: 15 (C30)), and downstream primer 6 (SEQ ID NO: 17).

[0210] Specifically, TCRβ and TCRα were first amplified using primers 5 and 6, respectively, in a PCR system of 50 μL. The annealing temperature was 60℃, and the reaction was repeated for 30 cycles. The PCR products were then recovered by gel electrophoresis (using the Tiangen gel recovery kit). 1 μL of the recovered product was used as a template for overlap PCR using upstream primer 5 and downstream primer 6. The PCR system was 50 μL, and the annealing temperature was 60℃, with 30 cycles. An approximately 1800 bp band was obtained by agarose gel electrophoresis, and the band was then excised and recovered.

[0211] The lentiviral vector pHAGE-IRES-RFP was double-digested with NotI and NheI. The digestion system was 40 μL, containing 1.5 μL of NotI and 1.5 μL of NheI, and 2-3 μg of plasmid. Digestion was carried out at 37℃ for 6 h. Then, 1 μL of alkaline phosphatase (NEB) was added to the system and treated for 1 h to reduce plasmid self-ligation. The digested plasmid was recovered by gel electrophoresis and the concentration was measured using nanodrop. It was used as a backbone for plasmid construction.

[0212] According to the Clone Express II One Step Cloning kit product instructions, the TCR was ligated to the enzyme-digested and linearized pHAGE-IRES-RFP vector via overlap (see product instructions). Figure 3 The bacteria were transformed into the Stbl3 strain and cultured on LB agar plates containing ampicillin for 12-16 hours. Single clones were picked and sequenced using primers seq-pHAGE-F and seq-pHAGE-R from the pHAGE vector, as well as downstream primer 4. The corresponding TCRs were obtained, abbreviated as C27 (nucleotide sequence as shown in SEQ ID NO: 29, amino acid sequence as shown in SEQ ID NO: 28) and C30 (nucleotide sequence as shown in SEQ ID NO: 31, amino acid sequence as shown in SEQ ID NO: 30).

[0213] Example 3: Detection of TCR membrane expression and affinity using pMHC tetramer staining method

[0214] 1. Constructing an endogenous TCR knockout Jurkat T cell line

[0215] Based on the sequence characteristics of Jurkat cell TCRs, guide sequences were designed in the constant regions of the α and β chains (TRA_oligo1-CACCGTCTCTCAGCTGGTACACGGC (SEQ ID NO: 18), TRA_oligo2-AAACGCCGTGTACCAGCTGAGAGAC (SEQ ID NO: 19), TRB_oligo1-CACCGGGCTCAAACACAGCGACCTC (SEQ ID NO: 20), TRB_oligo2-AAACGAGGTCGCTGTGTTTGAGCCC (SEQ ID NO: 21)).

[0216] The synthesized guide sequences for the α and β chains were constructed into lentiviral vectors sgRNA-LentiCRISPR-puro and sgRNA-LentiCRISPR-BSD, respectively. These vectors were co-transfected with packaging plasmids psPAX2, pMD2.G, and PEI transfection reagent at a specific ratio into 293T cells. Cell culture supernatants were collected at 48 and 72 hours, and the concentrated viruses were used to simultaneously infect human Jurkat T cell lines. 48 hours after infection, cells were killed with appropriate concentrations of puromycin and blastomycin until all cells in the respective drug control groups died. Surviving cells were sorted by flow cytometry into 96-well plates for culture. For the obtained monoclonal cell lines, the expression of TCR α and β chains was identified using antibodies against each chain. Cell lines deficient in both chains were identified as endogenous TCR knockout Jurkat T cells, named JC5.

[0217] 2. Constructing a stable JC5 cell line integrating CMV TCR

[0218] The pHAGE-TCR plasmids C27 and C30 constructed in Example 2 were mixed with packaging plasmids psPAX2 and pMD2.G, and transfection reagent PEI in a certain ratio, and transfected into 293T cells. Cell culture supernatants were collected at 48h and 72h, concentrated, and used to infect JC5 cells in logarithmic growth phase (MOI=0.3). Three days after infection, the cells were stained with anti-human CD3 and anti-human TCRαβ flow cytometry antibodies. Cells with the same TCR expression level were sorted and cultured to form the JC5-TCR cell line.

[0219] 3. TCR membrane application and affinity testing

[0220] Take 1×10 6 JC5-TCR cells were stained with Brilliant Violet 421™ anti-human TCRαβ (Biolegend) and the corresponding CMV pp65pMHC tetramer-APC (Tetramer-APC) and then analyzed by flow cytometry.

[0221] Depend on Figure 4 , 5 It can be seen that the prepared specific C27-TCR and C30-TCR targeting CMV pp65 HLA-A*A2402 QYDPVAALF can be correctly expressed and displayed outside the cell membrane, and have a certain affinity for the corresponding tetramer probe. In summary, the results indicate that the TCRs prepared in this application have good affinity.

[0222] Example 4: Construction and in vitro functional testing of primary human TCR-T cells

[0223] 1. Isolation, culture, and lentiviral infection of primary human T cells

[0224] To further verify the recognition and killing function of the selected TCRs against CMV pp65 antigen, mononuclear cells (PBMCs) were isolated from the peripheral blood of volunteers using Ficoll lymphocyte separation medium. Then, according to the EasySepHuman T cell isolation kit (stem cell technologies) product instructions, T cells were obtained from the PBMCs through negative selection. The cells were resuspended in 1640 complete medium containing 100 U / mL IL2 to a concentration of 1×10⁻⁶ cells / mL. 6 Cells / mL were cultured in culture dishes coated with anti-CD3 / CD28 antibody for activation. After 48 h of activation, T cells were infected with TCR-loaded viral particles (prepared in Example 2) using a lentiviral system. The infection method was centrifugation at 1500 rpm for 2 h at 32 °C, followed by incubation at 37 °C for 10 h. Infection was then terminated by adding and replacing the culture medium, and the cells were continued to be cultured at 37 °C. Three days after infection, TCR-positive cells were sorted by flow cytometry to obtain TCR-T cells (including C27 and C30 mentioned above).

[0225] 2. Construction of target cells

[0226] Raji cells in logarithmic growth phase were infected using a lentiviral system with viral particles loaded with pp65-PURO, HLA-A*2402-BSD, and luciferase-GFP, respectively. Through drug screening and flow cytometry sorting, Raji cells that stably expressed pp65, HLA-A*2402, and luciferase-GFP were obtained and named Raji-A2402-pp65-luciferase.

[0227] 3. In vitro functional validation of TCR in human primary T cells

[0228] Raji / HLA2402 / pp65 cells and Raji cells not converted to pp65 (named Raji) were co-cultured with 1G4-TCR-T, C27-TCR-T, and C30-TCR-T cells at a 1:1 ratio for 24 hours. Cells and supernatants were collected after each co-culture. The activation status of C27-TCR-T and C30-TCR-T cells and the viability of target cells were preliminarily assessed. Extracellular cytokines TNFα, IL2, and IFNγ (see...) were also evaluated. Figure 6In terms of luciferase release levels, C27-TCR-T and C30-TCR-T cells, after co-incubation with target cells, significantly induced T cell activation compared to the control group 1G4-TCR-T. Furthermore, the amount of luciferase released after target cell lysis reflects that C27-TCR-T and C30-TCR-T cells can significantly kill target cells (see...). Figure 6 Experimental results demonstrate that the C27-TCR-T and C30-TCR-T cells constructed in the embodiments of this invention can be specifically activated by CMV pp65 antigen peptide-presenting cells and can significantly kill target cells.

[0229] Meanwhile, the CDR3 hypervariable regions of the TCR α and β chains have the greatest impact on TCR function. Experiments have confirmed that even highly similar CDR3 hypervariable regions, differing by only one amino acid, can result in significant functional differences. For example, by sequentially mutating the first and last amino acids of the CDR3 regions of the TCR E141 α and β chains to alanine, and constructing TCR-T cells on lentiviral vectors, the corresponding TCR-T cells were prepared. These cells were co-cultured with target cells at a 1:1 ratio, and the levels of luciferase and the secretion of cytokines TNFα, IL2, and IFNγ were measured. The results showed that unmutated E141 cells, upon encountering HLA-matched Raji, effectively cleared target cells and specifically produced large amounts of the cytokine IL2. Furthermore, mutations of a single amino acid at sites a3, a5, a6, and b6, b7, b8 were sufficient to completely inactivate TCR-T cells (see patent CN202010373100.4 for details). Correspondingly, the mutated TCR, although differing by only one amino acid, is enough to completely inactivate TCR-T cells. This demonstrates that even with the same target, a difference of just one amino acid can cause two nearly identical TCRs to produce completely different technical effects, let alone differences of multiple amino acids.

[0230] Example 5: Animal Model Construction and In Vivo Functional Detection of CMV TCR-T

[0231] 3×10 5 Raji-HLA-A*2402-pp65-luciferase tumor cells were injected via tail vein into 5-6 week old NOD / Scid IL-2Rγ null (NCG) female mice to establish a lymphoma model (see...). Figure 7 (Day 1) On day 6, the mice were divided into three groups: A: PBS injection group (injected with an equal volume of PBS); B: control NC cell injection group (NC T cells); C: CMV TCR-T injection group (C27-TCR-T cells). Mice in group B were injected with 1×10⁻⁶ PBS via the tail vein. 7 NC T cells, C group mice were injected with 1×10 T cells via the tail vein. 7TCR-T cells were injected into group A with an equal volume of 200 μL PBS. For specific infusion volumes and times of other TCR-T cells, please refer to [link to relevant documentation]. Figure 7 Over the next few weeks, monitor tumor cell growth, T cell proliferation, and mouse survival in mice, such as... Figure 7-9 As shown, compared with the control group, the CMV-specific C27-TCR-T cells constructed in this embodiment of the invention can also significantly kill tumor cells in mice.

[0232] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0233] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately. sequence list <110> Huaxia Yingtai (Beijing) Biotechnology Co., Ltd. Tsinghua University <120> T-cell antigen receptor, its multimeric complex, its preparation method and application <130> 1 <160> 214 <170> SIPOSequenceListing 1.0 <210> 1 <211> 6 <212> PRT <213> Artificial Sequence <400> 1 Ser Ser Asn Phe Tyr Ala 1 5 <210> 2 <211> 7 <212> PRT <213> Artificial Sequence <400> 2 Met Thr Leu Asn Gly Asp Glu 1 5 <210> 3 <211> 8 <212> PRT <213> Artificial Sequence <400> 3 Ala Ser Gly Thr Tyr Tyr Lys Tyr Ile 1 5 <210> 4 <211> 8 <212> PRT <213> Artificial Sequence <400> 4 Ala Arg Tyr Gly Asn Lys Leu Val 1 5 <210> 5 <211> 5 <212> PRT <213> Artificial Sequence <400> 5 Met Asn His Glu Tyr 1 5 <210> 6 <211> 5 <212> PRT <213> Artificial Sequence <400> 6 Ser Gly His Val Ser 1 5 <210> 7 <211> 6 <212> PRT <213> Artificial Sequence <400> 7 Ser Val Gly Ala Gly Ile 1 5 <210> 8 <211> 6 <212> PRT <213> Artificial Sequence <400> 8 Phe Gln Asn Glu Ala Gln 1 5 <210> 9 <211> 12 <212> PRT <213> Artificial Sequence <400> 9 Ala Ser Arg Pro Leu Gly Val Gly Glu Thr Gln Tyr 1 5 10 <210> 10 <211> 12 <212> PRT <213> Artificial Sequence <400> 10 Ala Ser Ser Phe Tyr Thr Gly Gln Glu Thr Gln Tyr 1 5 10 <210> 11 <211> 9 <212> PRT <213> Artificial Sequence <400> 11 Gln Tyr Asp Pro Val Ala Ala Leu Phe 1 5 <210> 12 <211> 48 <212> DNA <213> Artificial Sequence <400> 12 atttcaggtg tcgtgaagcg gccgcgccac catgagcatc ggcctcct 48 <210> 13 <211> 48 <212> DNA <213> Artificial Sequence <400> 13 atttcaggtg tcgtgaagcg gccgcgccac catgggcacc aggctcct <210> 14 <211> 71 <212> DNA <213> Artificial Sequence <400> 14 tcagcctgct gaagcaggct ggagacgtgg aggagacc tggacctatg gagaagaatc ctttggcagc c <210> 15 <211> 71 <212> DNA <213> Artificial Sequence <400> 15 tcagcctgct gaagcaggct ggagacgtgg aggagacc tggacctatg gagaagaatc ctttggcagc c <210> 16 <211> 81 <212> DNA <213> Artificial Sequence <400> 16 tctccagcct gcttcagcag gctgaagtta gtagctccgc ttccgctccg tttccgccgg aaatcctttc tcttgaccat g <210> 17 <211> 45 <212> DNA <213> Artificial Sequence <400> 17 agggatcctc tagactcgag ctagctcagc tggaccacag ccgca <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <400> 18 caccgtctct cagctggtac acggc 25 <210> 19 <211> 25 <212> DNA <213> Artificial Sequence <400> 19 aaacgccgtg taccagctga gagac 25 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <400> 20 caccgggctc aaacacagcg acctc 25 <210> twenty one <211> 25 <212> DNA <213> Artificial Sequence <400> twenty one aaacgaggtc gctgtgtttg agccc 25 <210> twenty two <211> 294 <212> PRT <213> Artificial Sequence <400> twenty two Met Gly Ser His Ser Met Arg Tyr Phe Ser Thr Ser Val Ser Arg Pro 1 5 10 15 Gly Arg Gly Glu Pro Arg Phe Ile Ala Val Gly Tyr Val Asp Asp Thr 20 25 30 Gln Phe Val Arg Phe Asp Ser Asp Ala Ala Ser Gln Arg Met Glu Pro 35 40 45 Arg Ala Pro Trp Ile Glu Gln Glu Gly Pro Glu Tyr Trp Asp Glu Glu 50 55 60 Thr Gly Lys Val Lys Ala His Ser Gln Thr Asp Arg Glu Asn Leu Arg 65 70 75 80 Ile Ala Leu Arg Tyr Tyr Asn Gln Ser Glu Ala Gly Ser His Thr Leu 85 90 95 Gln Met Met Phe Gly Cys Asp Val Gly Ser Asp Gly Arg Phe Leu Arg 100 105 110 Gly Tyr His Gln Tyr Ala Tyr Asp Gly Lys Asp Tyr Ile Ala Leu Lys 115 120 125 Glu Asp Leu Arg Ser Trp Thr Ala Ala Asp Met Ala Ala Gln Ile Thr 130 135 140 Lys Arg Lys Trp Glu Ala Ala His Val Ala Glu Gln Gln Arg Ala Tyr 145 150 155 160 Leu Glu Gly Thr Cys Val Asp Gly Leu Arg Arg Tyr Leu Glu Asn Gly 165 170 175 Lys Glu Thr Leu Gln Arg Thr Asp Pro Pro Lys Thr His Met Thr His 180 185 190 His Pro Ile Ser Asp His Glu Ala Thr Leu Arg Cys Trp Ala Leu Gly 195 200 205 Phe Tyr Pro Ala Glu Ile Thr Leu Thr Trp Gln Arg Asp Gly Glu Asp 210 215 220 Gln Thr Gln Asp Thr Glu Leu Val Glu Thr Arg Pro Ala Gly Asp Gly 225 230 235 240 Thr Phe Gln Lys Trp Val Ala Val Val Val Pro Ser Gly Glu Glu Gln 245 250 255 Arg Tyr Thr Cys His Val Gln His Glu Gly Leu Pro Lys Pro Leu Thr 260 265 270 Leu Arg Trp Glu Pro Gly Ser Gly Leu Asn Asp Ile Phe Glu Ala Gln 275 280 285 Lys Ile Glu Trp His Glu 290 <210> 23 <211> 885 <212> DNA <213> Artificial Sequence <400> 23 atgggcagcc acagtatgcg ctacttcagc accagcgtta gtcgcccggg tcgtggtgaa 60 ccgcgtttta tcgcagtggg ctatgtggac gatacccagt tcgttcgctt cgacagtgat 120 gccgcaagtc agcgcatgga accgcgtgcc ccgtggatcg aacaggaagg cccggaatac 240. tgggatgagg aaaccggcaa ggtgaaagca cacagccaga ccgaccgtga aaaacctgcgc attgccctgc gctattacaa tcagagcga gccggcagcc acaccctgca gatgatgttt ggttgcgatg tgggcagtga tggtcgcttt ctgcgcggct atcaccagta cgcctacgac 360 ggcaaggatt atatcgccct gaaagaagac ctgcgtagct ggaccgcagc cgatatggcc 420 gcccagatta ccaaacgcaa atgggaggcc gcacatgttg ccgaacaaca gcgcgcatat 480 ctggaaggta cctgtgtgga tggtctgcgt cgctatctgg aaaacggcaa agaaaccctg cagcgcaccg atcctccga aacccacatg acccaccacc cgatcagcga ccatgaagcc acactgcgtt gctgggccct gggcttttac ccggccgaaa tcaccctgac ctggcagcgc 660 gatggcgaag atcagaccca ggacaccgaa ctggtggaaa cccgtccggc aggtgatggc 720 acctttcaga aatgggtggc agtggttgtg ccgagcggcg aagaacagcg ttatacctgc 780 catgtgcagc acgaaggtct gccgaaccg ctgaccctgc gctgggaacc tggatccggt 840 ttgaacgaca tcttcgaagc tcagaaaatc gaatggcacg aataa 885 <210> 24 <211> 101 <212> PRT <213> Artificial Sequence <400> 24 Met Ala Ile Gln Arg Thr Pro Lys Ile Gln Val Tyr Ser Arg His Pro 1 5 10 15 Ala Glu Asn Gly Lys Ser Asn Phe Leu Asn Cys Tyr Val Ser Gly Phe 20 25 30 His Pro Ser Asp Ile Glu Val Asp Leu Leu Lys Asn Gly Glu Arg Ile 35 40 45 Glu Lys Val Glu His Ser Asp Leu Ser Phe Ser Lys Asp Trp Ser Phe 50 55 60 Tyr Leu Leu Tyr Tyr Thr Glu Phe Thr Pro Thr Glu Lys Asp Glu Tyr 65 70 75 80 Ala Cys Arg Val Asn His Val Thr Leu Ser Gln Pro Lys Ile Val Lys 85 90 95[[ID=​​​​​​​​​​​​​​atggcaatcc agcgtactcc aaagattcag gtttactcac gtcatccagc agagaatgga 60 aagtcaaatt tcctgaattg ctatgtgtct gggtttcatc catccgacat tgaagttgac 120 ttactgaaga atggagagag aattgaaaaa gtggagcatt cagacttgtc tttcagcaag 180 gactggtctt tctatctctt gtactacact gaattcaccc ccactgaaaa agatgagtat 240 gcctgccgtg tgaaccatgt gactttgtca cagcccaaga tagttaagtg ggatcgagac 300 atgtaa 306 <210> 26 <211> 561 <212> PRT <213> Artificial Sequence <400> 26 Met Glu Ser Arg Gly Arg Arg Cys Pro Glu Met Ile Ser Val Leu Gly 1 5 10 15 Pro Ile Ser Gly His Val Leu Lys Ala Val Phe Ser Arg Gly Asp Thr 20 25 30 Pro Val Leu Pro His Glu Thr Arg Leu Leu Gln Thr Gly Ile His Val 35 40 45 Arg Val Ser Gln Pro Ser Leu Ile Leu Val Ser Gln Tyr Thr Pro Asp 50 55 60 Ser Thr Pro Cys His Arg Gly Asp Asn Gln Leu Gln Val Gln His Thr 65 70 75 80 Tyr Phe Thr Gly Ser Glu Val Glu Asn Val Ser Val Asn Val His Asn 85 90 95 Pro Thr Gly Arg Ser Ile Cys Pro Ser Gln Glu Pro Met Ser Ile Tyr 100 105 110 Val Tyr Ala Leu Pro Leu Lys Met Leu Asn Ile Pro Ser Ile Asn Val 115 120 125 His His Tyr Pro Ser Ala Ala Glu Arg Lys His Arg His Leu Pro Val 130 135 140 Ala Asp Ala Val Ile His Ala Ser Gly Lys Gln Met Trp Gln Ala Arg 145 150 155 160 Leu Thr Val Ser Gly Leu Ala Trp Thr Arg Gln Gln Asn Gln Trp Lys 165 170 175 Glu Pro Asp Val Tyr Tyr Thr Ser Ala Phe Val Phe Pro Thr Lys Asp 180 185 190 Val Ala Leu Arg His Val Val Cys Ala His Glu Leu Val Cys Ser Met 195 200 205 Glu Asn Thr Arg Ala Thr Lys Met Gln Val Ile Gly Asp Gln Tyr Val 210 215 220 Lys Val Tyr Leu Glu Ser Phe Cys Glu Asp Val Pro Ser Gly Lys Leu 225 230 235 240 Phe Met His Val Thr Leu Gly Ser Asp Val Glu Glu Asp Leu Thr Met 245 250 255 Thr Arg Asn Pro Gln Pro Phe Met Arg Pro His Glu Arg Asn Gly Phe 260 265 270 Thr Val Leu Cys Pro Lys Asn Met Ile Ile Lys Pro Gly Lys Ile Ser 275 280 285 His Ile Met Leu Asp Val Ala Phe Thr Ser His Glu His Phe Gly Leu 290 295 300 Leu Cys Pro Lys Ser Ile Pro Gly Leu Ser Ile Ser Gly Asn Leu Leu 305 310 315 320 Met Asn Gly Gln Gln Ile Phe Leu Glu Val Gln Ala Ile Arg Glu Thr 325 330 335 Val Glu Leu Arg Gln Tyr Asp Pro Val Ala Ala Leu Phe Phe Phe Asp 340 345 350 Ile Asp Leu Leu Leu Gln Arg Gly Pro Gln Tyr Ser Glu His Pro Thr 355 360 365 Phe Thr Ser Gln Tyr Arg Ile Gln Gly Lys Leu Glu Tyr Arg His Thr 370 375 380 Trp Asp Arg His Asp Glu Gly Ala Ala Gln Gly Asp Asp Asp Val Trp 385 390 395 400 Thr Ser Gly Ser Asp Ser Asp Glu Glu Leu Val Thr Thr Glu Arg Lys 405 410 415 Thr Pro Arg Val Thr Gly Gly Gly Ala Met Ala Ser Ala Ser Thr Ser 420 425 430 Ala Gly Arg Lys Arg Lys Ser Ala Ser Ser Ala Thr Ala Cys Thr Ala 435 440 445 Gly Val Met Thr Arg Gly Arg Leu Lys Ala Glu Ser Thr Val Ala Pro 450 455 460 Glu Glu Asp Thr Asp Glu Asp Ser Asp Asn Glu Ile His Asn Pro Ala 465 470 475 480 Val Phe Thr Trp Pro Pro Trp Gln Ala Gly Ile Leu Ala Arg Asn Leu 485 490 495 Val Pro Met Val Ala Thr Val Gln Gly Gln Asn Leu Lys Tyr Gln Glu 500 505 510 Phe Phe Trp Asp Ala Asn Asp Ile Tyr Arg Ile Phe Ala Glu Leu Glu 515 520 525 Gly Val Trp Gln Pro Ala Ala Gln Pro Lys Arg Arg Arg His Arg Gln 530 535 540 Asp Ala Leu Pro Gly Pro Cys Ile Ala Ser Thr Pro Lys Lys His Arg 545 550 555 560 Gly <210> 27 <211> 1686 <212> DNA <213> Artificial Sequence <400> 27 atggagtcgc gcggtcgccg ttgtcccgaa atgatatccg tactgggtcc catttcgggg 60 cacgtgctga aagccgtgtt tagtcgcggc gatacgccgg tgctgccgca cgagacgcga 120 ctcctgcaga cgggtatcca cgtacgcgtg agccagccct cgctgatcct ggtgtcgcag 180 tacacgcccg actcgacgcc atgccaccgc ggcgacaatc agctgcaggt gcagcacacg 240 tactttacgg gcagcgaggt ggagaacgtg tcggtcaacg tgcacaaccc cacgggccga 300 agcatctgcc ccagccaaga gcccatgtcg atctatgtgt acgcgctgcc gctcaagatg 360 ctgaacatcc ccagcatcaa cgtgcaccac tacccgtcgg cggccgagcg caaacaccga 420 cacctgcccg tagccgacgc tgttattcac gcgtcgggca agcagatgtg gcaggcgcgt 480 ctcacggtct cgggactggc ctggacgcgt cagcagaacc agtggaaaga gcccgacgtc 540 tactacacgt cagcgttcgt gtttcccacc aaggacgtgg cactgcggca cgtggtgtgc 600 gcgcacgagc tggtttgctc catggagaac acgcgcgcaa ccaagatgca ggtgataggt 660 gaccagtacg tcaaggtgta cctggagtcc ttctgcgagg acgtgccctc cggcaagctc 720 tttatgcacg tcacgctggg ctctgacgtg gaagaggacc taacgatgac ccgcaacccg 780 caacccttca tgcgccccca cgagcgcaac ggctttacgg tgttgtgtcc caaaaatatg 840 ataatcaaac cgggcaagat ctcgcacatc atgctggatg tggcttttac ctcacacgag 900 cattttgggc tgctgtgtcc caagagcatc ccgggcctga gcatctcagg taacctgttg 960 atgaacgggc agcaaatctt cctggaggta caagcgatac gcgagaccgt ggaactgcgt 1020 cagtacgatc ccgtggctgc gctcttcttt ttcgatatcg acttgttgct gcagcgcggg 1080 cctcagtaca gcgagcaccc caccttcacc agccagtatc gcatccaggg caagcttgag 1140 taccgacaca cctgggaccg gcacgacgag ggtgccgccc agggcgacga cgacgtctgg 1200 accagcggat cggactccga cgaagaactc gtaaccaccg agcgtaagac gccccgcgtc 1260 accggcggcg gcgccatggc gagcgcctcc acttccgcgg gccgcaaacg caaatcagca 1320 tcctcggcga cggcgtgcac ggcgggcgtt atgacacgcg gccgccttaa ggccgagtcc 1380 accgtcgcgc ccgaagagga caccgacgag gattccgaca acgaaatcca caatccggcc 1440 gtgttcacct ggccgccctg gcaggccggc atcctggccc gcaacctggt gcccatggtg 1500 gctacggttc agggtcagaa tctgaagtac caggagttct tctgggacgc caacgacatc 1560 taccgcatct tcgccgaatt ggaaggcgta tggcagcccg ctgcgcaacc caaacgtcgc 1620 cgccaccggc aagacgcctt gcccgggcca tgcatcgcct cgacgcccaa aaagcaccga 1680 ggttga 1686 <210> 28 <211> 608 <212> PRT <213> Artificial Sequence <400> 28 Met Ser Ile Gly Leu Leu Cys Cys Ala Ala Leu Ser Leu Leu Trp Ala 1 5 10 15 Gly Pro Val Asn Ala Gly Val Thr Gln Thr Pro Lys Phe Gln Val Leu 20 25 30 Lys Thr Gly Gln Ser Met Thr Leu Gln Cys Ala Gln Asp Met Asn His 35 40 45 Glu Tyr Met Ser Trp Tyr Arg Gln Asp Pro Gly Met Gly Leu Arg Leu 50 55 60 Ile His Tyr Ser Val Gly Ala Gly Ile Thr Asp Gln Gly Glu Val Pro 65 70 75 80 Asn Gly Tyr Asn Val Ser Arg Ser Thr Thr Glu Asp Phe Pro Leu Arg 85 90 95 Leu Leu Ser Ala Ala Pro Ser Gln Thr Ser Val Tyr Phe Cys Ala Ser 100 105 110 Arg Pro Leu Gly Val Gly Glu Thr Gln Tyr Phe Gly Pro Gly Thr Arg 115 120 125 Leu Leu Val Leu Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala 130 135 140 Val Phe Glu Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr 145 150 155 160 Leu Val Cys Leu Ala Thr Gly Phe Phe Pro Asp His Val Glu Leu Ser 165 170 175 Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro 180 185 190 Gln Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu 195 200 205 Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn 210 215 220 His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu 225 230 235 240 Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu 245 250 255 Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Val Ser Tyr Gln Gln 260 265 270 Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala 275 280 285 Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val 290 295 300 Lys Arg Lys Asp Phe Arg Arg Lys Arg Ser Gly Ser Gly Ala Thr Asn 305 310 315 320 Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro 325 330 335 Met Glu Lys Asn Pro Leu Ala Ala Pro Leu Leu Ile Leu Trp Phe His 340 345 350 Leu Asp Cys Val Ser Ser Ile Leu Asn Val Glu Gln Ser Pro Gln Ser 355 360 365 Leu His Val Gln Glu Gly Asp Ser Thr Asn Phe Thr Cys Ser Phe Pro 370 375 380 Ser Ser Asn Phe Tyr Ala Leu His Trp Tyr Arg Trp Glu Thr Ala Lys 385 390 395 400 Ser Pro Glu Ala Leu Phe Val Met Thr Leu Asn Gly Asp Glu Lys Lys 405 410 415 Lys Gly Arg Ile Ser Ala Thr Leu Asn Thr Lys Glu Gly Tyr Ser Tyr 420 425 430 Leu Tyr Ile Lys Gly Ser Gln Pro Glu Asp Ser Ala Thr Tyr Leu Cys 435 440 445 Ala Ser Gly Thr Tyr Lys Tyr Ile Phe Gly Thr Gly Thr Arg Leu Lys 450 455 460 Val Leu Ala Asn Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg 465 470 475 480 Asp Ser Lys Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe Asp 485 490 495 Ser Gln Thr Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr 500 505 510 Asp Lys Thr Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser 515 520 525 Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe 530 535 540 Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser 545 550 555 560 Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn 565 570 575 Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu 580 585 590 Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser 595 600 605 <210> 29 <211> 1827 <212> DNA <213> Artificial Sequence <400> 29 atgagcatcg gcctcctgtg ctgtgcagcc ttgtctctcc tgtgggcagg tccagtgaat 60 gctggtgtca ctcagacccc aaaattccag gtcctgaaga caggacagag catgacactg 120 cagtgtgccc aggatatgaa ccatgaatac atgtcctggt atcgacaaga cccaggcatg 180 gggctgaggc tgattcatta ctcagttggt gctggtatca ctgaccaagg agaagtcccc 240 aatggctaca atgtctccag atcaaccaca gaggatttcc cgctcaggct gctgtcggct 300 gctccctccc agacatctgt gtacttctgt gccagcagac cactgggggt cggcgagacc 360 cagtacttcg ggccaggcac gcggctcctg gtgctcgagg acctgaaaaa cgtgttccca 420 cccgaggtcg ctgtgtttga gccatcagaa gcagagatct cccacaccca aaaggccaca 480 ctggtgtgcc tggccacagg cttcttcccc gaccacgtgg agctgagctg gtgggtgaat 540 gggaaggagg tgcacagtgg ggtcagcaca gacccgcagc ccctcaagga gcagcccgcc 600 ctcaatgact ccagatactg cctgagcagc cgcctgaggg tctcggccac cttctggcag 660 aacccccgca accacttccg ctgtcaagtc cagttctacg ggctctcgga gaatgacgag 720 tggacccagg atagggccaa acccgtcacc cagatcgtca gcgccgaggc ctggggtaga 780 gcagactgtg gctttacctc ggtgtcctac cagcaagggg tcctgtctgc caccatcctc 840 tatgagatcc tgctagggaa ggccaccctg tatgctgtgc tggtcagcgc ccttgtgttg 900 atggccatgg tcaagagaaa ggatttccgg cggaaacgga gcggaagcgg agctactaac 960 ttcagcctgc tgaagcaggc tggagacgtg gaggagaacc ctggacctat ggagaagaat 1020 cctttggcag ccccattact aatcctctgg tttcatcttg actgcgtgag cagcatactg 1080 aacgtggaac aaagtcctca gtcactgcat gttcaggagg gagacagcac caatttcacc 1140 tgcagcttcc cttccagcaa tttttatgcc ttacactggt acagatggga aactgcaaaa 1200 agccccgagg ccttgtttgt aatgacttta aatggggatg aaaagaagaa aggacgaata 1260 agtgccactc ttaataccaa ggagggttac agctatttgt acatcaaagg atcccagcct 1320 gaagactcag ccacatacct ctgtgcttca ggaacctaca aatacatctt tggaacaggc 1380 accaggctga aggttttagc aaatatccag aaccctgacc ctgccgtgta ccagctgaga 1440 gactctaaat ccagtgacaa gtctgtctgc ctattcaccg attttgattc tcaaacaaat 1500 gtgtcacaaa gtaaggattc tgatgtgtat atcacagaca aaactgtgct agacatgagg 1560 tctatggact tcaagagcaa cagtgctgtg gcctggagca acaaatctga ctttgcatgt 1620 gcaaacgcct tcaacaacag cattattcca gaagacacct tcttccccag cccagaaagt 1680 tcctgtgatg tcaagctggt cgagaaaagc tttgaaacag atacgaacct aaactttcaa 1740 aacctgtcag tgattgggtt ccgaatcctc ctcctgaaag tggccgggtt taatctgctc 1800 atgacgctgc ggctgtggtc cagctga 1827 <210> 30 <211> 609 <212> PRT <213> Artificial Sequence <400> 30 Met Gly Thr Arg Leu Leu Cys Trp Val Val Leu Gly Phe Leu Gly Thr 1 5 10 15 Asp His Thr Gly Ala Gly Val Ser Gln Ser Pro Arg Tyr Lys Val Ala 20 25 30 Lys Arg Gly Gln Asp Val Ala Leu Arg Cys Asp Pro Ile Ser Gly His 35 40 45 Val Ser Leu Phe Trp Tyr Gln Gln Ala Leu Gly Gln Gly Pro Glu Phe 50 55 60 Leu Thr Tyr Phe Gln Asn Glu Ala Gln Leu Asp Lys Ser Gly Leu Pro 65 70 75 80 Ser Asp Arg Phe Phe Ala Glu Arg Pro Glu Gly Ser Val Ser Thr Leu 85 90 95 Lys Ile Gln Arg Thr Gln Gln Glu Asp Ser Ala Val Tyr Leu Cys Ala 100 105 110 Ser Ser Phe Tyr Thr Gly Gln Glu Thr Gln Tyr Phe Gly Pro Gly Thr 115 120 125 Arg Leu Leu Val Leu Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val 130 135 140 Ala Val Phe Glu Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala 145 150 155 160 Thr Leu Val Cys Leu Ala Thr Gly Phe Phe Pro Asp His Val Glu Leu 165 170 175 Ser Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr Asp 180 185 190 Pro Gln Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys 195 200 205 Leu Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg 210 215 220 Asn His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp 225 230 235 240 Glu Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala 245 250 255 Glu Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Val Ser Tyr Gln 260 265 270 Gln Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys 275 280 285 Ala Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met 290 295 300 Val Lys Arg Lys Asp Phe Arg Arg Lys Arg Ser Gly Ser Gly Ala Thr 305 310 315 320 Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly 325 330 335 Pro Met Glu Lys Asn Pro Leu Ala Ala Pro Leu Leu Ile Leu Trp Phe 340 345 350 His Leu Asp Cys Val Ser Ser Ile Leu Asn Val Glu Gln Ser Pro Gln 355 360 365 Ser Leu His Val Gln Glu Gly Asp Ser Thr Asn Phe Thr Cys Ser Phe 370 375 380 Pro Ser Ser Asn Phe Tyr Ala Leu His Trp Tyr Arg Trp Glu Thr Ala 385 390 395 400 Lys Ser Pro Glu Ala Leu Phe Val Met Thr Leu Asn Gly Asp Glu Lys 405 410 415 Lys Lys Gly Arg Ile Ser Ala Thr Leu Asn Thr Lys Glu Gly Tyr Ser 420 425 430 Tyr Leu Tyr Ile Lys Gly Ser Gln Pro Glu Asp Ser Ala Thr Tyr Leu 435 440 445 Cys Ala Arg Tyr Gly Asn Lys Leu Val Phe Gly Ala Gly Thr Ile Leu 450 455 460 Arg Val Lys Ser Tyr Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu 465 470 475 480 Arg Asp Ser Lys Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe 485 490 495 Asp Ser Gln Thr Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile 500 505 510 Thr Asp Lys Thr Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn 515 520 525 Ser Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala 530 535 540 Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu 545 550 555 560 Ser Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr 565 570 575 Asn Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu 580 585 590 Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser 595 600 605 Ser <210> 31 <211> 1830 <212> DNA <213> Artificial Sequence <400> 31 atgggcacca ggctcctctg ctgggtggtc ctgggtttcc tagggacaga tcacacaggt 60 gctggagtct cccagtcccc taggtacaaa gtcgcaaaga gaggacagga tgtagctctc 120 aggtgtgatc caatttcggg tcatgtatcc cttttttggt accaacaggc cctggggcag 180 gggccagagt ttctgactta tttccagaat gaagctcaac tagacaaatc ggggctgccc 240 agtgatcgct tctttgcaga aaggcctgag ggatccgtct ccactctgaa gatccagcgc 300 acacagcagg aggactccgc cgtgtatctc tgtgccagca gcttttatac ggggcaagag 360 acccagtact tcgggccagg cacgcggctc ctggtgctcg aggacctgaa aaacgtgttc 420 480. cccccgagg tcgctgtgtt tgagccatca gagcagaga tctcccacac ccaaaaggcc acactggtgt gcctggccac aggcttcttc cccgaccacg tggagctgag ctggtgggtg 540 aatgggaagg aggtgcacag tggggtcagc acagacccgc agcccctcaa ggagcagccc gccctcaatg actccagata ctgcctgagc agccgcctga gggtctcggc caccttctgg 660 cagaacccc gcaaccactt ccgctgtcaa gtccagttct acgggctctc ggagaatgac gagtggaccc aggatagggc caaacccgtc acccagatcg tcagcgccga ggcctggggt 780 840. 840. 840. 840. 840. 840. 840. 840. 840 ctctatgaga tcctgctagg gaaggccacc ctgtatgctg tgctggtcag cgcccttgtg 900 ttgatggcca tggtcaagag aaaggatttc cggcggaac ggagcggaag cggagctact 960 aacttcagcc tgctgaagca ggctggagac gtggaggaga accctggacc tatggagaag 1020 aatcctttgg cagccccatt actaatcctc tggtttcatc ttgactgcgt gagcagcata 1080. ctgaacgtgg aacaaagtcc tcagtcactg catgttcagg agggacag caccaatttc 1140 acctgcagct tcccttccag caatttttat gccttacact ggtacagatg ggaaactgca 1200 aaaagccccg aggccttgtt tgtaatgact ttaaatgggg atgaaaagaa gaaggacga 1260 ataagtgcca ctcttaatac caaggagggt tacagctatt tgtacatcaa aggatcccag 1320 cctgaagaact cagccacata cctctgtgcc cgatatggaa acaagctggt ctttggcgca 1380 ggaaccattc tgagagtcaa gtcctatatc cagaaccctg accctgccgt gtaccagctg 1440 1500 aatgtgtcac aaagtaag ttctgatgtg tatatcacag acaaaactgt gctagacatg 1560 aggtctatgg acttcaagag caacagtgct gtggcctgga gcaacaaatc tgactttgca 1620 tgtgcaaacg ccttcaacaa cagcattatt ccagaagaca ccttcttccc cagcccaagaa 1680 agttcctgtg atgtcaagct ggtcgagaaa agctttgaaa cagatacgaa cctaaacttt 1740 caaaacctgt cagtgattgg gttccgaatc ctcctcctga aagtggccgg gtttaatctg 1800 ctcatgacgc tgcggctgtg gtccagctga 1830 <210> 32 <211> 309 <212> PRT <213> Artificial Sequence <400> 32 Met Ser Ile Gly Leu Leu Cys Cys Ala Ala Leu Ser Leu Leu Trp Ala 1 5 10 15 Gly Pro Val Asn Ala Gly Val Thr Gln Thr Pro Lys Phe Gln Val Leu 20 25 30 Lys Thr Gly Gln Ser Met Thr Leu Gln Cys Ala Gln Asp Met Asn His 35 40 45 Glu Tyr Met Ser Trp Tyr Arg Gln Asp Pro Gly Met Gly Leu Arg Leu 50 55 60 Ile His Tyr Ser Val Gly Ala Gly Ile Thr Asp Gln Gly Glu Val Pro 65 70 75 80 Asn Gly Tyr Asn Val Ser Arg Ser Thr Thr Glu Asp Phe Pro Leu Arg 85 90 95 Leu Leu Ser Ala Ala Pro Ser Gln Thr Ser Val Tyr Phe Cys Ala Ser 100 105 110 Arg Pro Leu Gly Val Gly Glu Thr Gln Tyr Phe Gly Pro Gly Thr Arg 115 120 125 Leu Leu Val Leu Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala 130 135 140 Val Phe Glu Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr 145 150 155 160 Leu Val Cys Leu Ala Thr Gly Phe Phe Pro Asp His Val Glu Leu Ser 165 170 175 Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro 180 185 190 Gln Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu 195 200 205 Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn 210 215 220 His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu 225 230 235 240 Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu 245 250 255 Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Val Ser Tyr Gln Gln 260 265 270 Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala 275 280 285 Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val 290 295 300 Lys Arg Lys Asp Phe 305 <210> 33 <211> 310 <212> PRT <213> Artificial Sequence <400> 33 Met Gly Thr Arg Leu Leu Cys Trp Val Val Leu Gly Phe Leu Gly Thr 1 5 10 15 Asp His Thr Gly Ala Gly Val Ser Gln Ser Pro Arg Tyr Lys Val Ala 20 25 30 Lys Arg Gly Gln Asp Val Ala Leu Arg Cys Asp Pro Ile Ser Gly His 35 40 45 Val Ser Leu Phe Trp Tyr Gln Gln Ala Leu Gly Gln Gly Pro Glu Phe 50 55 60 Leu Thr Tyr Phe Gln Asn Glu Ala Gln Leu Asp Lys Ser Gly Leu Pro 65 70 75 80 Ser Asp Arg Phe Phe Ala Glu Arg Pro Glu Gly Ser Val Ser Thr Leu 85 90 95 Lys Ile Gln Arg Thr Gln Gln Glu Asp Ser Ala Val Tyr Leu Cys Ala 100 105 110 Ser Ser Phe Tyr Thr Gly Gln Glu Thr Gln Tyr Phe Gly Pro Gly Thr 115 120 125 Arg Leu Leu Val Leu Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val 130 135 140 Ala Val Phe Glu Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala 145 150 155 160 Thr Leu Val Cys Leu Ala Thr Gly Phe Phe Pro Asp His Val Glu Leu 165 170 175 Ser Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr Asp 180 185 190 Pro Gln Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys 195 200 205 Leu Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg 210 215 220 Asn His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp 225 230 235 240 Glu Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala 245 250 255 Glu Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Val Ser Tyr Gln 260 265 270 Gln Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys 275 280 285 Ala Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met 290 295 300 Val Lys Arg Lys Asp Phe 305 310 <210> 34 <211> 272 <212> PRT <213> Artificial Sequence <400> 34 Met Glu Lys Asn Pro Leu Ala Ala Pro Leu Leu Ile Leu Trp Phe His 1 5 10 15 Leu Asp Cys Val Ser Ser Ile Leu Asn Val Glu Gln Ser Pro Gln Ser 20 25 30 Leu His Val Gln Glu Gly Asp Ser Thr Asn Phe Thr Cys Ser Phe Pro 35 40 45 Ser Ser Asn Phe Tyr Ala Leu His Trp Tyr Arg Trp Glu Thr Ala Lys 50 55 60 Ser Pro Glu Ala Leu Phe Val Met Thr Leu Asn Gly Asp Glu Lys Lys 65 70 75 80 Lys Gly Arg Ile Ser Ala Thr Leu Asn Thr Lys Glu Gly Tyr Ser Tyr 85 90 95 Leu Tyr Ile Lys Gly Ser Gln Pro Glu Asp Ser Ala Thr Tyr Leu Cys 100 105 110 Ala Ser Gly Thr Tyr Lys Tyr Ile Phe Gly Thr Gly Thr Arg Leu Lys 115 120 125 Val Leu Ala Asn Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg 130 135 140 Asp Ser Lys Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe Asp 145 150 155 160 Ser Gln Thr Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr 165 170 175 Asp Lys Thr Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser 180 185 190 Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe 195 200 205 Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser 210 215 220 Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn 225 230 235 240 Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu 245 250 255 Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser 260 265 270 <210> 35 <211> 272 <212> PRT <213> Artificial Sequence <400> 35 Met Glu Lys Asn Pro Leu Ala Ala Pro Leu Leu Ile Leu Trp Phe His 1 5 10 15 Leu Asp Cys Val Ser Ser Ile Leu Asn Val Glu Gln Ser Pro Gln Ser 20 25 30 Leu His Val Gln Glu Gly Asp Ser Thr Asn Phe Thr Cys Ser Phe Pro 35 40 45 Ser Ser Asn Phe Tyr Ala Leu His Trp Tyr Arg Trp Glu Thr Ala Lys 50 55 60 Ser Pro Glu Ala Leu Phe Val Met Thr Leu Asn Gly Asp Glu Lys Lys 65 70 75 80 Lys Gly Arg Ile Ser Ala Thr Leu Asn Thr Lys Glu Gly Tyr Ser Tyr<​​​​​​​​115 120 125 Val Lys Ser Tyr Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg 130 135 140 Asp Ser Lys Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe Asp 145 150 155 160 Ser Gln Thr Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr 165 170 175 Asp Lys Thr Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser 180 185 190 Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe 195 200 205 Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser 210 215 220 Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn 225 230 235 240 Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu 245 250 255 Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser 260 265 270 <210> 36 <211> 927 <212> DNA <213> Artificial Sequence <400> 36 atgagcatcg gcctcctgtg ctgtgcagcc ttgtctctcc tgtgggcagg tccagtgaat gctggtgtca ctcagacccc aaaattccag gtcctgaga caggacagag catgacactg cagtgtgccc aggatatgaa ccatgaatac atgtcctggt atcgacaaga cccaggcatg gggctgaggc tgattcatta ctcagttggt gctggtatca ctgaccaagg agaagtcccc 240 300. aatggctaca atgtctccag atcaaccaca gaggatttcc cgctcaggct gctgtcggct gctccctccc agacatctgt gtacttctgt gccagcagac cactgggggt cggcgagacc 360 cagtacttcg ggccaggcac gcggctcctg gtgctcgagg acctgaaaaa cgtgttccca 420 cccgaggtcg ctgtgtttga gccatcagaa gcagagatct cccacaccca aaaggccaca 480 ctggtgtgcc tggccacagg cttcttcccc gaccacgtgg agctgagctg gtgggtgaat 540 gggaaggagg tgcacagtgg ggtcagcaca gacccgcagc ccctcaagga gcagcccgcc ctcaatgact ccagatactg cctgagcagc cgcctgaggg tctcggccac cttctggcag aacccccgca accacttccg ctgtcaagtc cagttctacg ggctctcgga gaatgacgag 720 tggacccagg atagggccaa acccgtcacc cagatcgtca gcgccgaggc ctggggtaga 780 gcagactgtg gctttacctc ggtgtcctac cagcaagggg tcctgtctgc caccatcctc 840 tatgagatcc tgctagggaa ggccaccctg tatgctgtgc tggtcagcgc ccttgtgttg 900 atggccatgg tcaagagaaa ggatttc 927 <210> 37 <211> 930 <212> DNA <213> Artificial Sequence <400> 37 atgggcacca ggctcctctg ctgggtggtc ctgggtttcc tagggacaga tcacacaggt 60 gctggagtct cccagtcccc taggtacaaa gtcgcaaaga gaggacagga tgtagctctc 120 aggtgtgatc caatttcggg tcatgtatcc cttttttggt accaacaggc cctggggcag 180 gggccagagt ttctgactta tttccagaat gaagctcaac tagacaaatc ggggctgccc 240 agtgatcgct tctttgcaga aaggcctgag ggatccgtct ccactctgaa gatccagcgc 300 acacagcagg aggactccgc cgtgtatctc tgtgccagca gcttttatac ggggcaagag 360 acccagtact tcgggccagg cacgcggctc ctggtgctcg aggacctgaa aaacgtgttc 420 480. cccccgagg tcgctgtgtt tgagccatca gagcagaga tctcccacac ccaaaaggcc acactggtgt gcctggccac aggcttcttc cccgaccacg tggagctgag ctggtgggtg 540 aatgggaagg aggtgcacag tggggtcagc acagacccgc agcccctcaa ggagcagccc gccctcaatg actccagata ctgcctgagc agccgcctga gggtctcggc caccttctgg 660 cagaacccc gcaaccactt ccgctgtcaa gtccagttct acgggctctc ggagaatgac gagtggaccc aggatagggc caaacccgtc acccagatcg tcagcgccga ggcctggggt 780 840. 840. 840. 840. 840. 840. 840. 840. 840 ctctatgaga tcctgctagg gaaggccacc ctgtatgctg tgctggtcag cgcccttgtg 900 ttgatggcca tggtcaagag aaaggatttc 930 <210> 38 <211> 819 <212> DNA <213> Artificial Sequence <400> 38 atggagaaga atcctttggc agccccatta ctaatcctct ggtttcatct tgactgcgtg agcagcatac tgaacgtgga acaaagtcct cagtcactgc atgttcagga gggagacagc 120 accaatttca cctgcagctt cccttccagc aatttttatg ccttacactg gtacagatgg 180 gaaactgcaa aaagccccga ggccttgttt gtaatgactt taaatgggga tgaaaagaag 240 aaaggacgaa taagtgccac tcttaatacc aagggggtt acagctattt gtacatcaaa 300 ggatcccagc ctgaagactc agccacatac ctctgtgctt caggaaccta caaatacatc 360 tttggaacag gcaccaggct gaaggtttta gcaaatatcc agaaccctga ccctgccgtg 420 taccagctga gagactctaa atccagtgac aagtctgtct gcctattcac cgattttgat 480 tctcaacaa atgtgtcaca aagtaaggat tctgatgtgt atatcacaga caaaactgtg 540 ctagacatga ggtctatgga cttcaagagc aacagtgctg tggcctggag caacaaatct 600 gactttgcat gtgcaaacgc cttcaacaac agcattattc cagaagacac cttcttcccc 660 agcccagaaa gttcctgtga tgtcaagctg gtcgagaaaa gctttgaaac agatacgaac 720 ctaaactttc aaaacctgtc agtgattggg ttccgaatcc tcctcctgaa agtggccggg 780 tttaatctgc tcatgacgct gcggctgtgg tccagctga 819 <210> 39 <211> 819 <212> DNA <213> Artificial Sequence <400> 39 atggagaaga atcctttggc agccccatta ctaatcctct ggtttcatct tgactgcgtg 60 agcagcatac tgaacgtgga acaaagtcct cagtcactgc atgttcagga gggagacagc 120 accaatttca cctgcagctt cccttccagc aatttttatg ccttacactg gtacagatgg 180 gaaactgcaa aaagccccga ggccttgttt gtaatgactt taaatgggga tgaaaagaag 240 aaaggacgaa taagtgccac tcttaatacc aaggagggtt acagctattt gtacatcaaa 300 ggatcccagc ctgaagactc agccacatac ctctgtgccc gatatggaaa caagctggtc 360 tttggcgcag gaaccattct gagagtcaag tcctatatcc agaaccctga ccctgccgtg 420 taccagctga gagactctaa atccagtgac aagtctgtct gcctattcac cgattttgat 480 tctcaaacaa atgtgtcaca aagtaaggat tctgatgtgt atatcacaga caaaactgtg 540 ctagacatga ggtctatgga cttcaagagc aacagtgctg tggcctggag caacaaatct 600 gactttgcat gtgcaaacgc cttcaacaac agcattattc cagaagacac cttcttcccc agcccagaaa gttcctgtga tgtcaagctg gtcgagaaaa gctttgaaac agatacgaac 720 ctaaactttc aaaacctgtc agtgattggg ttccgaatcc tcctcctgaa agtggccggg 780 tttaatctgc tcatgacgct gcggctgtgg tccagctga 819 <210> 40 <211> 27 <212> PRT <213> Artificial Sequence <400> 40 Arg Arg Lys Arg Ser Gly Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys 1 5 10 15 Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro 20 25 <210> 41 <211> 81 <212> DNA <213> Artificial Sequence <400> 41 60. cggcggaac ggagcggaac cggagctact aacttcagcc tgctgaagca ggctggagac gtgaggaga accctggacc t <210> 42 <211> 24 <212> DNA <213> Artificial Sequence <400> 42 gaagaaagga cgaataagtg ccac 24 <210> 43 <211> twenty two <212> DNA <213> Artificial Sequence <400> 43 acatcacagc cacccagact ac 22 <210> 44 <211> twenty four <212> DNA <213> Artificial Sequence <400> 44 cacagaagac agaaagtcca gcac 24 <210> 45 <211> twenty three <212> DNA <213> Artificial Sequence <400> 45 gcaatcgctg aagacagaaa gtc 23 <210> 46 <211> 25 <212> DNA <213> Artificial Sequence <400> 46 gaaaggacag ttctctccac atcac 25 <210> 47 <211> twenty two <212> DNA <213> Artificial Sequence <400> 47 aaaagtgcca agcacctctc tc 22 <210> 48 <211> twenty two <212> DNA <213> Artificial Sequence <400> 48 gcaaagctcc ctgtacctta cg 22 <210> 49 <211> 25 <212> DNA <213> Artificial Sequence <400> 49 aaagataact gccaagttgg atgag 25 <210> 50 <211> 26 <212> DNA <213> Artificial Sequence <400> 50 cttcctgaat atctcagcat ccatac 26 <210> 51 <211> twenty two <212> DNA <213> Artificial Sequence <400> 51 gcatcctgaa catcacagcc ac 22 <210> 52 <211> 25 <212> DNA <213> Artificial Sequence <400> 52 gaatcgtttc tctgtgaact tccag 25 <210> 53 <211> twenty one <212> DNA <213> Artificial Sequence <400> 53 tctcagcacc ctccacatca c 21 <210> 54 <211> twenty four <212> DNA <213> Artificial Sequence <400> 54 caggtatcag actcagccgt gtac 24 <210> 55 <211> 25 <212> DNA <213> Artificial Sequence <400> 55 gccacaataa acatacagga aaagc 25 <210> 56 <211> twenty one <212> DNA <213> Artificial Sequence <400> 56 atggatacct ggctcgtatg c 21 <210> 57 <211> 18 <212> DNA <213> Artificial Sequence <400> 57 atgggctgca ggctcctc 18 <210> 58 <211> 18 <212> DNA <213> Artificial Sequence <400> 58 atgggctgca ggctgctc 18 <210> 59 <211> 19 <212> DNA <213> Artificial Sequence <400> 59 atgggctcca ggctgctct 19 <210> 60 <211> 14 <212> DNA <213> Artificial Sequence <400> 60 atgggccccg ggct 14 <210> 61 <211> 17 <212> DNA <213> Artificial Sequence <400> 61 atgggccctg ggctcct 17 <210> 62 <211> 19 <212> DNA <213> Artificial Sequence <400> 62 atgggaccca ggctcctct 19 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <400> 63 atgagcatcg ggctcctgtg 20 <210> 64 <211> 18 <212> DNA <213> Artificial Sequence <400> 64 atgagcctcg ggctcctg 18 <210> 65 <211> twenty one <212> DNA <213> Artificial Sequence <400> 65 atgagaatca ggctcctgtg c 21 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <400> 66 atgagcatcg gcctcctgtg 20 <210> 67 <211> 20 <212> DNA <213> Artificial Sequence <400> 67 atgagcatca gcctcctgtg 20 <210> 68 <211> 20 <212> DNA <213> Artificial Sequence <400> 68 atgggcacaa ggctcctctg 20 <210> 69 <211> 18 <212> DNA <213> Artificial Sequence <400> 69 atgggcacca ggctcctc 18 <210> 70 <211> twenty one <212> DNA <213> Artificial Sequence <400> 70 atgggcacca gtctcctatg c 21 <210> 71 <211> twenty three <212> DNA <213> Artificial Sequence <400> 71 atgggtacca gtctcctatg ctg 23 <210> 72 <211> 18 <212> DNA <213> Artificial Sequence <400> 72 atgggcacca gcctcctc 18 <210> 73 <211> 20 <212> DNA <213> Artificial Sequence <400> 73 atgggcttca ggctcctctg 20 <210> 74 <211> twenty one <212> DNA <213> Artificial Sequence <400> 74 atgggcacga ggctcttctt c 21 <210> 75 <211> twenty one <212> DNA <213> Artificial Sequence <400> 75 atgggcacca ggctcttctt c 21 <210> 76 <211> twenty one <212> DNA <213> Artificial Sequence <400> 76 atgggcacaa ggttgttctt c 21 <210> 77 <211> twenty one <212> DNA <213> Artificial Sequence <400> 77 atgagcacca ggcttctctg c 21 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <400> 78 atgggtacca ggctcctctg 20 <210> 79 <211> twenty two <212> DNA <213> Artificial Sequence <400> 79 atggactcct ggaccttctg ct 22 <210> 80 <211> 20 <212> DNA <213> Artificial Sequence <400> 80 atggactcct ggaccctctg 20 <210> 81 <211> 18 <212> DNA <213> Artificial Sequence <400> 81 atggccacca ggctcctc 18 <210> 82 <211> twenty two <212> DNA <213> Artificial Sequence <400> 82 atgcttagtc ctgacctgcc tg 22 <210> 83 <211> twenty two <212> DNA <213> Artificial Sequence <400> 83 atggtttcca ggcttctcag tt 22 <210> 84 <211> 19 <212> DNA <213> Artificial Sequence <400> 84 atgggtcctg ggcttctcc 19 <210> 85 <211> twenty two <212> DNA <213> Artificial Sequence <400> 85 atgagcccaa tattcacctg ca 22 <210> 86 <211> twenty two <212> DNA <213> Artificial Sequence <400> 86 atggatatct ggctcctctg ct 22 <210> 87 <211> twenty three <212> DNA <213> Artificial Sequence <400> 87 atggacacca gagtactctg ctg 23 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <400> 88 atgagcaacc aggtgctctg 20 <210> 89 <211> 19 <212> DNA <213> Artificial Sequence <400> 89 atgctgctgc ttctgctgc 19 <210> 90 <211> twenty one <212> DNA <213> Artificial Sequence <400> 90 atggcctccc tgctcttctt c 21 <210> 91 <211> twenty four <212> DNA <213> Artificial Sequence <400> 91 atgactatca ggctcctctg ctac 24 <210> 92 <211> 16 <212> DNA <213> Artificial Sequence <400> 92 atgggccccc agctcc 16 <210> 93 <211> twenty two <212> DNA <213> Artificial Sequence <400> 93 atgggaatca ggctcctctg tc 22 <210> 94 <211> twenty four <212> DNA <213> Artificial Sequence <400> 94 atgctgagtc ttctgctcct tctc 24 <210> 95 <211> 20 <212> DNA <213> Artificial Sequence <400> 95 atgctctgct ctctccttgc 20 <210> 96 <211> twenty two <212> DNA <213> Artificial Sequence <400> 96 tcactctgaa gatccggtcc ac 22 <210> 97 <211> twenty two <212> DNA <213> Artificial Sequence <400> 97 cttcacatca attccctgga gc 22 <210> 98 <211> 19 <212> DNA <213> Artificial Sequence <400> 98 cacctgaatg ccccaacag 19 <210> 99 <211> twenty one <212> DNA <213> Artificial Sequence <400> 99 agtcgcttct cacctgaatg c 21 <210> 100 <211> twenty four <212> DNA <213> Artificial Sequence <400> 100 gagatgaatg tgagcacctt ggag 24 <210> 101 <211> twenty four <212> DNA <213> Artificial Sequence <400> 101 gagatgaatg tgagtgcctt ggag 24 <210> 102 <211> twenty two <212> DNA <213> Artificial Sequence <400> 102 gctctgagct gaatgtgaac gc 22 <210> 103 <211> twenty two <212> DNA <213> Artificial Sequence <400> 103 gaagtcccca atggctacaa tg 22 <210> 104 <211> twenty one <212> DNA <213> Artificial Sequence <400> 104 aggtccctga tggctacaat g 21 <210> 105 <211> 20 <212> DNA <213> Artificial Sequence <400> 105 tggcgtctgc tgtaccctct 20 <210> 106 <211> 20 <212> DNA <213> Artificial Sequence <400> 106 acagaggatt tcccgctcag 20 <210> 107 <211> 20 <212> DNA <213> Artificial Sequence <400> 107 cccctcaagc tggagtcagc 20 <210> 108 <211> twenty three <212> DNA <213> Artificial Sequence <400> 108 acacagagga tttcccactc agg 23 <210> 109 <211> twenty two <212> DNA <213> Artificial Sequence <400> 109 ttctctgcac agaggtctga gg 22 <210> 110 <211> 20 <212> DNA <213> Artificial Sequence <400> 110 gctgcccagt gatcgcttct 20 <210> 111 <211> twenty two <212> DNA <213> Artificial Sequence <400> 111 actctgaaga tccagcgcac ag 22 <210> 112 <211> twenty three <212> DNA <213> Artificial Sequence <400> 112 cgtctccact ctgaagatcc agc 23 <210> 113 <211> 20 <212> DNA <213> Artificial Sequence <400> 113 ggcctgaggg atccatctcc 20 <210> 114 <211> 20 <212> DNA <213> Artificial Sequence <400> 114 ggctgctcag tgatcggttc 20 <210> 115 <211> twenty two <212> DNA <213> Artificial Sequence <400> 115 gaacgattct ccgcacaaca gt 22 <210> 116 <211> twenty four <212> DNA <213> Artificial Sequence <400> 116 acaaaggaga agtctcagat ggct 24 <210> 117 <211> twenty two <212> DNA <213> Artificial Sequence <400> 117 ccctcactct ggagtcagct ac 22 <210> 118 <211> twenty one <212> DNA <213> Artificial Sequence <400> 118 cctcactctg gagtccgcta c 21 <210> 119 <211> twenty four <212> DNA <213> Artificial Sequence <400> 119 gcagagaggc tcaaaggagt agac 24 <210> 120 <211> 20 <212> DNA <213> Artificial Sequence <400> 120 atccagccct cagaacccag 20 <210> 121 <211> 25 <212> DNA <213> Artificial Sequence <400> 121 atcattctga actgaacatg agctc 25 <210> 122 <211> 25 <212> DNA <213> Artificial Sequence <400> 122 tggagggacg tattctactc tgaag 25 <210> 123 <211> twenty four <212> DNA <213> Artificial Sequence <400> 123 gacacccctg ataacttcca atcc 24 <210> 124 <211> 20 <212> DNA <213> Artificial Sequence <400> 124 tgcctcccaa attcaccctg 20 <210> 125 <211> 17 <212> DNA <213> Artificial Sequence <400> 125 catcccgcag agccgag 17 <210> 126 <211> twenty one <212> DNA <213> Artificial Sequence <400> 126 gcaggtagtg cgaggagatt c 21 <210> 127 <211> 20 <212> DNA <213> Artificial Sequence <400> 127 ctgtgacatc ggcccaaaag 20 <210> 128 <211> 20 <212> DNA <213> Artificial Sequence <400> 128 acagtgacca gtgcccatcc 20 <210> 129 <211> 19 <212> DNA <213> Artificial Sequence <400> 129 caatgcccca agaacgcac 19 <210> 130 <211> twenty one <212> DNA <213> Artificial Sequence <400> 130 tagagtctgc catccccaac c 21 <210> 131 <211> twenty one <212> DNA <213> Artificial Sequence <400> 131 gacggagcat tttcccctga c 21 <210> 132 <211> 20 <212> DNA <213> Artificial Sequence <400> 132 gccagcacca accagacatc 20 <210> 133 <211> 20 <212> DNA <213> Artificial Sequence <400> 133 ctgatcctgg agtcgcccag 20 <210> 134 <211> 20 <212> DNA <213> Artificial Sequence <400> 134 atcagccgcc caaacctaac 20 <210> 135 <211> twenty four <212> DNA <213> Artificial Sequence <400> 135 cggcagttca tcctgagttc taag 24 <210> 136 <211> twenty three <212> DNA <213> Artificial Sequence <400> 136 tcaggcagta tctggagtca ttg 23 <210> 137 <211> 20 <212> DNA <213> Artificial Sequence <400> 137 gcacctcctt cccattcacc 20 <210> 138 <211> twenty two <212> DNA <213> Artificial Sequence <400> 138 gcttctgatg gctcaaacac ag 22 <210> 139 <211> 20 <212> DNA <213> Artificial Sequence <400> 139 cgaccagctt gacatcacag 20 <210> 140 <211> 25 <212> DNA <213> Artificial Sequence <400> 140 gttgctcttg aagtccatag acctc 25 <210> 141 <211> 20 <212> DNA <213> Artificial Sequence <400> 141 cagggtcagg gttctggata 20 <210> 142 <211> twenty two <212> DNA <213> Artificial Sequence <400> 142 atgtggggag ctttccttct ct 22 <210> 143 <211> 25 <212> DNA <213> Artificial Sequence <400> 143 atgtggggag ttttccttct ttatg 25 <210> 144 <211> twenty one <212> DNA <213> Artificial Sequence <400> 144 atggctttgc agagcactct g 21 <210> 145 <211> 20 <212> DNA <213> Artificial Sequence <400> 145 atggcctctg cacccatctc 20 <210> 146 <211> 20 <212> DNA <213> Artificial Sequence <400> 146 atgaggcaag tggcgagagt 20 <210> 147 <211> twenty four <212> DNA <213> Artificial Sequence <400> 147 atgaagacat ttgctggatt ttcg 24 <210> 148 <211> twenty two <212> DNA <213> Artificial Sequence <400> 148 atggagtcat tcctgggagg tg 22 <210> 149 <211> twenty two <212> DNA <213> Artificial Sequence <400> 149 atggagaaga tgcggagacc tg 22 <210> 150 <211> twenty two <212> DNA <213> Artificial Sequence <400> 150 atgctcctgt tgctcatacc ag 22 <210> 151 <211> 19 <212> DNA <213> Artificial Sequence <400> 151 atgctcctgc tgctcgtcc 19 <210> 152 <211> twenty one <212> DNA <213> Artificial Sequence <400> 152 atgctcctgg agcttatccc a 21 <210> 153 <211> twenty four <212> DNA <213> Artificial Sequence <400> 153 atgctcttag tggtcattct gctg 24 <210> 154 <211> twenty three <212> DNA <213> Artificial Sequence <400> 154 atgaattctt ctccaggacc agc 23 <210> 155 <211> 28 <212> DNA <213> Artificial Sequence <400> 155 atgaactatt ctccaggctt agtatctc 28 <210> 156 <211> twenty four <212> DNA <213> Artificial Sequence <400> 156 atgaaaaagc atctgacgac cttc 24 <210> 157 <211> 27 <212> DNA <213> Artificial Sequence <400> 157 atgatatccttgagagtttt actggtg 27 <210> 158 <211> 30 <212> DNA <213> Artificial Sequence <400> 158 atgaaatcct tgagagtttt actagtgatc 30 <210> 159 <211> 28 <212> DNA <213> Artificial Sequence <400> 159 atgatgaaat ccttgagagttttactgg 28 <210> 160 <211> 26 <212> DNA <213> Artificial Sequence <400> 160 atgacatcca ttcgagctgt atttat 26 <210> 161 <211> 19 <212> DNA <213> Artificial Sequence <400> 161 atggcaggca ttcgagctt 19 <210> 162 <211> twenty four <212> DNA <213> Artificial Sequence <400> 162 atgtcacttt ctagcctgct gaag 24 <210> 163 <211> twenty two <212> DNA <213> Artificial Sequence <400> 163 atgaagccca ccctcatctc ag 22 <210> 164 <211> twenty three <212> DNA <213> Artificial Sequence <400> 164 atggaaactc tcctgggagt gtc 23 <210> 165 <211> twenty two <212> DNA <213> Artificial Sequence <400> 165 atgctgtctg cttcctgctc ag 22 <210> 166 <211> 19 <212> DNA <213> Artificial Sequence <400> 166 atgctgactg ccagcctgt 19 <210> 167 <211> twenty three <212> DNA <213> Artificial Sequence <400> 167 atggagaaaa tgttggagtg tgc 23 <210> 168 <211> 20 <212> DNA <213> Artificial Sequence <400> 168 atggagaccc tcttgggcct 20 <210> 169 <211> twenty four <212> DNA <213> Artificial Sequence <400> 169 atgaagagga tattgggagc tctg 24 <210> 170 <211> 25 <212> DNA <213> Artificial Sequence <400> 170 atggacaaga tcttaggagc atcat 25 <210> 171 <211> 20 <212> DNA <213> Artificial Sequence <400> 171 atgctgttct ccagcctgct 20 <210> 172 <211> twenty two <212> DNA <213> Artificial Sequence <400> 172 atggagaaga atcctttggc ag 22 <210> 173 <211> 25 <212> DNA <213> Artificial Sequence <400> 173 atgctactca tcacatcaat gttgg 25 <210> 174 <211> twenty three <212> DNA <213> Artificial Sequence <400> 174 atgaggctgg tggcaagagt aac 23 <210> 175 <211> 25 <212> DNA <213> Artificial Sequence <400> 175 atgaagttgg tgacaagcat tactg 25 <210> 176 <211> twenty three <212> DNA <213> Artificial Sequence <400> 176 atggtcctga aattctccgt gtc 23 <210> 177 <211> 17 <212> DNA <213> Artificial Sequence <400> 177 atggccatgc tcctggg 17 <210> 178 <211> twenty three <212> DNA <213> Artificial Sequence <400> 178 atggagactc tcctgaaagt gct 23 <210> 179 <211> 25 <212> DNA <213> Artificial Sequence <400> 179 atggagactg ttctgcaagt actcc 25 <210> 180 <211> 28 <212> DNA <213> Artificial Sequence <400> 180 atgctccttg aacatttatt aataatct 28 <210> 181 <211> 25 <212> DNA <213> Artificial Sequence <400> 181 atgatgaagt gtccacaggc tttac 25 <210> 182 <211> twenty three <212> DNA <213> Artificial Sequence <400> 182 atgacacgag ttagcttgct gtg 23 <210> 183 <211> 18 <212> DNA <213> Artificial Sequence <400> 183 atggcatgcc ctggcttc 18 <210> 184 <211> 27 <212> DNA <213> Artificial Sequence <400> 184 atgaagaagc tactagcaat gattctg 27 <210> 185 <211> 28 <212> DNA <213> Artificial Sequence <400> 185 atgaactcctctctggactttctaattc 28 <210> 186 <211> 20 <212> DNA <213> Artificial Sequence <400> 186 atggtgaaga tccggcaatt 20 <210> 187 <211> 26 <212> DNA <213> Artificial Sequence <400> 187 tccttagtcg ctctgatagt tatggt 26 <210> 188 <211> 27 <212> DNA <213> Artificial Sequence <400> 188 tttcttcatt ccttagtcgg tctaaag 27 <210> 189 <211> twenty two <212> DNA <213> Artificial Sequence <400> 189 ctcttcatcg ctgctcatcc tc 22 <210> 190 <211> 20 <212> DNA <213> Artificial Sequence <400> 190 gccaaacctc cttccacctg 20 <210> 191 <211> 20 <212> DNA <213> Artificial Sequence <400> 191 cctgccgaca gaaagtccag 20 <210> 192 <211> 20 <212> DNA <213> Artificial Sequence <400> 192 cgcattgcag acacccagac 20 <210> 193 <211> 26 <212> DNA <213> Artificial Sequence <400> 193 ttgataccacccttaaacagagtttg 26 <210> 194 <211> 25 <212> DNA <213> Artificial Sequence <400> 194 attackgaag aatggaagca gcttg 25 <210> 195 <211> 25 <212> DNA <213> Artificial Sequence <400> 195 tcctttaatc tgaggaaacc ctctg 25 <210> 196 <211> twenty two <212> DNA <213> Artificial Sequence <400> 196 gtgaaacctc cttccacctg ac 22 <210> 197 <211> twenty four <212> DNA <213> Artificial Sequence <400> 197 aggctttgag gctgaattta agag 24 <210> 198 <211> 27 <212> DNA <213> Artificial Sequence <400> 198 ggctgaattt aacaagagtc aaacttc 27 <210> 199 <211> twenty two <212> DNA <213> Artificial Sequence <400> 199 gagcgaaacc tccttctacc tg 22 <210> 200 <211> twenty three <212> DNA <213> Artificial Sequence <400> 200 aaaccacttc tttccacttg gag 23 <210> 201 <211> twenty three <212> DNA <213> Artificial Sequence <400> 201 caaagcaaag ctctctgcac atc 23 <210> 202 <211> twenty two <212> DNA <213> Artificial Sequence <400> 202 cagtgattca gccacctacc tc 22 <210> 203 <211> 26 <212> DNA <213> Artificial Sequence <400> 203 cgaattgctg ttacattgaa caagac 26 <210> 204 <211> twenty three <212> DNA <213> Artificial Sequence <400> 204 ttgcagctac tcaacctgga gac 23 <210> 205 <211> twenty one <212> DNA <213> Artificial Sequence <400> 205 atccgccaac cttgtcatct c 21 <210> 206 <211> twenty one <212> DNA <213> Artificial Sequence <400> 206 aaggcgagac atctttccac c 21 <210> 207 <211> 26 <212> DNA <213> Artificial Sequence <400> 207 agattaagag tcacgcttga cacttc 26 <210> 208 <211> 26 <212> DNA <213> Artificial Sequence <400> 208 gccagtccta tcaagagtga cagttc 26 <210> 209 <211> twenty three <212> DNA <213> Artificial Sequence <400> 209 caacttcacc atcacagcct cac 23 <210> 210 <211> twenty two <212> DNA <213> Artificial Sequence <400> 210 cacatcacag cccctaaacc tg 22 <210> 211 <211> twenty two <212> DNA <213> Artificial Sequence <400> 211 tggaagactt aatgcctcgc tg 22 <210> 212 <211> twenty one <212> DNA <213> Artificial Sequence <400> 212 tgtcgctacg gaacgctaca g 21 <210> 213 <211> 25 <212> DNA <213> Artificial Sequence <400> 213 cttcaataaa agtgccaagc agttc 25 <210> 214 <211> 25 <212> DNA <213> Artificial Sequence <400> 214 aaaaagtggt cgctattctg tcaac 25

Claims

1. A T-cell antigen receptor, characterized in that, The T-cell antigen receptor specifically binds to CMV pp65, and the T-cell antigen receptor comprises α-chain CDR1α-CDR3α and β-chain CDR1β-CDR3β, wherein the amino acid sequence of CDR1α is SEQ ID NO: 1, the amino acid sequence of CDR2α is SEQ ID NO: 2, the amino acid sequence of CDR3α is SEQ ID NO: 3, the amino acid sequence of CDR1β is SEQ ID NO: 5, the amino acid sequence of CDR2β is SEQ ID NO: 7, and the amino acid sequence of CDR3β is SEQ ID NO: 9; or, The amino acid sequence of CDR1α is SEQ ID NO: 1, the amino acid sequence of CDR2α is SEQ ID NO: 2, the amino acid sequence of CDR3α is SEQ ID NO: 4, the amino acid sequence of CDR1β is SEQ ID NO: 6, the amino acid sequence of CDR2β is SEQ ID NO: 8, and the amino acid sequence of CDR3β is SEQ ID NO:

10.

2. The T-cell antigen receptor according to claim 1, characterized in that, Its β-chain amino acid sequence is SEQ ID NO: 32, and its α-chain amino acid sequence is SEQ ID NO: 34; or, The amino acid sequence of its β chain is SEQ ID NO: 33, and the amino acid sequence of its α chain is SEQ ID NO:

35.

3. The T-cell antigen receptor according to claim 2, characterized in that, The amino acid sequences of its α chain and β chain are directly or indirectly linked.

4. The T-cell antigen receptor according to claim 3, characterized in that, The amino acid sequences of the α chain and β chain are indirectly linked.

5. The T-cell antigen receptor according to claim 4, characterized in that, The amino acid sequences of the α chain and β chain are linked by fp2A.

6. The T-cell antigen receptor according to claim 1, characterized in that, The amino acid sequence of the T-cell antigen receptor is either SEQ ID NO: 28 or 30.

7. A nucleic acid encoding the T-cell antigen receptor of any one of claims 1-6.

8. An expression carrier, characterized in that, The expression vector comprises the nucleic acid as described in claim 7.

9. An immune cell, characterized in that, The immune cells express the T-cell antigen receptor as described in any one of claims 1-6.

10. The immune cells according to claim 9, characterized in that, The immune cells mentioned are selected from T cells or stem cells.

11. The immune cell according to claim 10, characterized in that, The immune cells were isolated from the subject's T cells.

12. A host cell, characterized in that, The host cell comprises the nucleic acid of claim 7 or the expression vector of claim 8.

13. A method for preparing recombinant T cells, characterized in that, Includes the following steps: 1) Obtain the nucleic acid of claim 7 from a positive T cell clone; 2) Isolate and culture primary T cells; 3) Deliver the nucleic acid obtained in step 1) into the primary T cells described in step 2) to obtain recombinant T cells expressing any of the T cell antigen receptors described in claims 1-6.

14. The preparation method according to claim 13, characterized in that, The preparation method also includes the step of knocking out endogenous TCRs in cells.

15. A method for preparing a T-cell antigen receptor, characterized in that, Includes the following steps: (1) Obtain the nucleic acid of claim 7 from a positive T cell clone; (2) Link the nucleic acid obtained in step (1) to the vector backbone to obtain the expression vector; (3) Transform the expression vector obtained in step (2) into the host cell and then induce its expression; (4) Obtain T cell antigen receptors.

16. A polymeric complex, characterized in that, The multimeric complex comprises the T-cell antigen receptor as described in any one of claims 1-6.

17. The polymeric complex according to claim 16, characterized in that, The multimeric complex further includes a monomer, a biotin molecule, and a streptavidin molecule or avidin molecule, wherein the monomer includes the extracellular region of the α chain of an MHC molecule, the β2m chain, and an antigenic peptide, the monomer is coupled to the biotin molecule, and the biotin molecule is bound to the streptavidin or avidin molecule.

18. The polymeric complex according to claim 17, characterized in that, The antigenic peptide described herein contains SEQ ID NO:

11.

19. The polymeric complex according to claim 17, characterized in that, The MHC molecule mentioned is HLA-A*2402.

20. A method for preparing the multipolymer complex according to any one of claims 16-19, characterized in that, Includes the following steps: I) Expression and purification of the extracellular region of the α chain and the β2m chain of MHC molecules with C-terminal avi-tag sequences; II) The extracellular region of the extracellular region of the MHC molecule α chain with an avi-tag sequence linked to the C-terminus is folded and refolded to prepare a monomer; III) Biotinylate the monomer prepared in step II) to obtain a biotinylated monomer; IV) The biotinylated monomer obtained in step III) is reacted with fluorescently labeled streptavidin or avidin to prepare an antigen peptide-MHC tetramer. V) The antigen peptide-MHC tetramer obtained in step IV) is co-incubated with T cells to form a T cell antigen receptor-antigen peptide-MHC tetramer complex.

21. The use of the T-cell antigen receptor of any one of claims 1-6, the nucleic acid of claim 7, the expression vector of claim 8, the host cell of claim 12, the immune cell of any one of claims 9-11, or the multimeric complex of any one of claims 16-19 in the preparation of products for the diagnosis or treatment of tumors or CMV-related diseases, or in the labeling, detection, cell sorting, or activation of T cells, wherein the use is for non-disease treatment and / or diagnostic purposes.

22. A pharmaceutical composition comprising any one of the following groups: i) The T-cell antigen receptor according to any one of claims 1-6; ii) The nucleic acid as described in claim 7; iii) The expression vector as described in claim 8; iv) The host cell as described in claim 12; v) The immune cells according to any one of claims 9-11; or vi) The polymeric complex according to any one of claims 16-19.

23. A kit comprising any one of the following groups: i) The T-cell antigen receptor according to any one of claims 1-6; ii) The nucleic acid as described in claim 7; iii) The expression vector as described in claim 8; iv) The host cell as described in claim 12; v) The immune cells according to any one of claims 9-11; or vi) The polymeric complex according to any one of claims 16-19.

Images