New treatment for retinitis pigmentosa

Abstract

An isolated or purified antisense oligomer for use in modifying pre-mRNA splicing in a CNOT3 gene transcript or a portion thereof.

Description

Technical Field

[0001] The present invention relates to the use of antisense oligomers for treating, preventing or ameliorating the effects of retinitis pigmentosa. Background Art

[0002] Retinitis pigmentosa (RP) is a degenerative eye disease that causes severe visual impairment due to progressive degeneration of the rod cells in the retina; most cases of RP are inherited. This form of retinal dystrophy presents with initial symptoms that are not age-related; therefore, the diagnosis of RP occurs anywhere from early infancy to late adulthood. RP is a rare disease, affecting approximately 1 in 4,000 people (over 1.5 million people worldwide). In familial cases of RP, 30%-40% are inherited as an autosomal dominant trait (Hartong et al. 2006). There is currently no cure for RP.

[0003] RP is caused by mutations in more than 50 genes. Heterozygous mutations in the PRPF31 gene cause autosomal dominant retinitis pigmentosa (adRP). In some cases, this mutation shows incomplete penetrance, where some carriers develop retinal degeneration while others have no symptoms at all. Asymptomatic carriers are protected from the disease by above-average expression of the unmutated PRPF31 allele.

[0004] The expression of the PRPF31 gene is controlled by the Ccr4-Not deadenylase complex. Ccr4-Not is a nine-subunit protein complex that is a major regulator of translation and mRNA stability in eukaryotic cells. The core CCR4-Not complex consists of Ccr4p, Caf1p, five Not proteins (CNot1-CNot5), Caf40p, and Caf130p in yeast.

[0005] AAV-mediated gene replacement and CRISPR / Cas9 gene editing are currently being explored as treatments for retinal diseases. Although the coding sequence of PRPF31 is within the capacity of AAV vectors, the consequences of unregulated or overexpressed PRPF31 are unknown. In addition, it is unclear whether intraocular viral-mediated gene therapy can be re-administered, as there have been reports of intraocular viral vector injections leading to seroconversion. In addition, CRISPR / Cas9 gene correction will require a different product of the PRPF31 mutation in each family. In addition, both gene replacement and gene editing approaches require subretinal injection of viral vectors to achieve adequate transfection.

[0006] There is a need for new treatments or preventive measures for retinitis pigmentosa; or at least methods to supplement previously known treatments.

[0007] The present invention seeks to provide an improved or alternative method for treating, preventing or ameliorating the effects of retinitis pigmentosa.

[0008] The preceding discussion of the background art is intended only to assist with understanding the present invention. The discussion is not an acknowledgement or admission that any of the material referred to was or was part of the common general knowledge as at the priority date of the application. SUMMARY OF THE INVENTION

[0010] Broadly, according to one aspect of the present invention, an isolated or purified antisense oligomer is provided for modifying pre-mRNA splicing in a CNOT3 gene transcript or a portion thereof. Preferably, an isolated or purified antisense oligomer is provided for inducing non-productive splicing in a CNOT3 gene transcript or a portion thereof.

[0011] For example, in one aspect of the invention, an antisense oligomer of 10 to 50 nucleotides is provided, which comprises a targeting sequence complementary to a region near an intron or within an intron of a CNOT3 gene transcript or a portion thereof. In another aspect of the invention, an antisense oligomer of 10 to 50 nucleotides is provided, which comprises a targeting sequence complementary to a region near an exon or within an exon of a CNOT3 gene transcript or a portion thereof.

[0012] Preferably, the antisense oligomer is a phosphorodiamidate morpholino oligomer.Preferably, the antisense oligomer has a modified backbone.

[0013] Preferably, the antisense oligomer is selected from the sequences shown in Table 1.

[0014] Preferably, the antisense oligomer is selected from the list comprising the following sequences: SEQ ID NO: 1-74, more preferably SEQ ID NO: 4, 7, 9, 11, 14, 16-18, 27, 30, 34, 35, 64 and 67, even more preferably SEQ ID NO: 4, 7, 27, 30, 34 and 64.

[0015] The antisense oligomer is preferably used to induce the skipping of one or more exons or parts thereof of the CNOT3 gene transcript. For example, the antisense oligomer can induce the skipping of exons 3, 8, 9, 12 and / or 17.

[0016] The antisense oligomers of the present invention can be selected as antisense oligomers capable of binding to selected CNOT3 target sites, wherein the target site is an mRNA splicing site selected from a splicing donor site, a splicing acceptor site or an exon splicing element. When targeting a donor or acceptor splicing site, the target site may also include some flanking intrinsic sequences.

[0017] More specifically, the antisense oligomer can be selected from SEQ ID NO: 1-74, more preferably SEQ ID NO: 4, 7, 9, 11, 14, 16-18, 27, 30, 34, 35, 64 and 67, even more preferably any one or more of SEQ ID NO: 4, 7, 27, 30, 34 and 64, and / or the sequences listed in Table 1 and combinations or mixtures thereof. This includes sequences that can hybridize with these sequences under stringent hybridization conditions, sequences complementary thereto, sequences containing modified bases, modified backbones and functional truncations or extensions thereof, which have or regulate pre-mRNA processing activity in CNOT3 gene transcripts. In certain embodiments, the antisense oligomer can be 100% complementary to the target sequence, or can include mismatches, such as to include variants, as long as the heteroduplex formed between the oligonucleotide and the target sequence is sufficiently stable to withstand the action of cellular nucleases and other degradation modes that may occur in vivo. Thus, certain oligonucleotides can have a sequence complementarity of about or at least about 70%, for example, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity between the oligonucleotide and the target sequence.

[0018] The invention also extends to a combination of two or more antisense oligomers that are capable of binding to a selected target to induce exon exclusion in a CNOT3 gene transcript, including a construct comprising two or more such antisense oligomers. The construct can be used in antisense oligomer-based therapy.

[0019] According to another aspect of the present invention, the present invention extends to cDNA or cloned copies of the antisense oligomer sequences of the present invention, and vectors comprising the antisense oligomer sequences of the present invention. The present invention further extends to cells containing such sequences and / or vectors.

[0020] Also provided is a method for manipulating splicing in a CNOT3 gene transcript, the method comprising the steps of:

[0021] a) providing one or more antisense oligomers as described herein and allowing the oligomers to bind to the target nucleic acid site.

[0022] Also provided is a pharmaceutical, prophylactic or therapeutic composition for treating, preventing or ameliorating the effects of a disease associated with CNOT3 expression in a patient, the composition comprising:

[0023] a) one or more antisense oligomers as described herein, and

[0024] b) one or more pharmaceutically acceptable carriers and / or diluents.

[0025] The composition may contain about 1 nM to 1000 nM of each antisense oligomer desired by the present invention. Preferably, the composition may contain about 10 nM to 500 nM, most preferably 1 nM to 10 nM of each antisense oligomer of the present invention.

[0026] Also provided is a method for treating, preventing or ameliorating the effects of a disease associated with CNOT3 expression, comprising the steps of:

[0027] a) administering to a patient an effective amount of one or more antisense oligomers described herein or a pharmaceutical composition comprising one or more antisense oligomers described herein.

[0028] Also provided is the use of a purified and isolated antisense oligomer as described herein in the preparation of a medicament for treating, preventing or ameliorating the effects of a disease associated with CNOT3 expression.

[0029] Also provided are kits for treating, preventing or ameliorating the effects of a disease associated with CNOT3 expression in a patient, the kits comprising at least one antisense oligomer as described herein, and combinations or mixtures thereof, packaged in a suitable container, and instructions for use thereof.

[0030] Preferably, the disease associated with CNOT3 expression in the patient is retinitis pigmentosa.The subject of the disease associated with CNOT3 expression may be a mammal, including a human.

[0031] Further aspects of the invention will now be described with reference to the accompanying non-limiting examples and figures. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Other features of the invention are more fully described in the following description of several non-limiting embodiments thereof. This description is included only to illustrate the invention. It should not be construed as limiting the broad overview, disclosure or description of the invention described above. The description will be made with reference to the accompanying drawings, in which:

[0033] Figure 1 is a schematic diagram of the CNOT3 reading frame. CNOT3 consists of 18 exons and encodes a protein with 753 amino acids. Figure 1 (a) In-frame exons are indicated by rectangles, while junctions with interrupting codons are indicated by V-shaped edges (blue, red). Figure 1(b) shows the CNOT3 protein showing the functional domains and amino acid positions corresponding to the above exons. NAR: non-anchor region. CS: connecting sequence. NOT box: negative TATA box. Exclusion of exons 2, 3, 8, 9, 11, 12, 13, 14, 15 and 16 will all disrupt the open reading frame.

[0034] Figure 2 is a gel image showing CNOT3 transcripts in RP11 patient fibroblasts 48 hours after 2'O-methyl phosphorothioate AO transfection (50, 25 and 12.5 nM). A control AO targeting an unknown sequence (-ve control AO) was included for comparison.

[0035] Figure 3 is an image of a gel showing CNOT3 transcripts after fibroblasts were transfected for 48 hours with 2'O-methyl phosphorothioate AO, designed to induce terminal intron retention, at concentrations of 50 and 25 nM.

[0036] Figure 4A and 4B : Figure 4A Pedigree 0255: 11 members have the PRPF31 mutation (c.267delA). Figure 4B Pedigree 0080: 13 affected members (c.1205G>A). Arrows = donated dermal fibroblasts, black = patients currently in a natural history study of CRE.

[0037] Figure 5AH shows skin fibroblasts from a CLN3 mutation patient reprogrammed to pluripotency. Patient-iPSCs (CLN3- / -) exhibit typical iPSC morphology and express pluripotency markers, including OCT4, NANOG, SOX2, and SSEA4 (A). Comparison of pluripotency gene expression in six iPSC lines by quantitative RT-PCR showed similar expression patterns in all lines (B). Patient iPSCs exhibit trilineage differentiation potential. After 2 weeks of differentiation of patient iPSCs (CLN3-iPS-EBs), gene-corrected control iPSCs (CLN3HDR-iPS-EBs), and control human iPSCs (WT-iPS-EBs, ThermoFisher) into embryoid bodies, quantitative RT-PCR was used to screen the expression of ectodermal (PAX6, OTX1), mesodermal (SOX17, GATA4, FOX2A), and endoderm (BRACHYURY, FDGFR) lineage markers and pluripotency genes (OCT4, NANOG, SOX2) (C). DH: Retinal differentiation of iPSCs. Retinal organoids have an optic cup-shaped morphology surrounded by a transparent layer of retinal tissue (D), which contains organized top layers of recoverin-expressing photoreceptors (E) and basally located Smi32-expressing retinal ganglion cells (F). Electron microscopy of photoreceptor outer segments from retinal organoids (G) at day 170 showed morphology similar to that of outer segments in the developing (E120) human retina (H).

[0038] Figure 6 shows the screening of AO-induced CNOT3 exon skipping using 2'-O-methyl chemistry on the PS backbone. AOs were designed to target splicing enhancer motifs of CNOT3 exons to mediate the exclusion of target exons during pre-mRNA splicing, thereby mediating knockdown of CNOT3 or disruption of protein function. Dermal fibroblasts were transfected with CNOT3 AOs (2'OMe-PS chemistry) targeting exons (as indicated) for 48 hours. RT-PCR products were separated on 2% agarose gels.

[0039] Figure 7 shows the screening of AO-induced CNOT3 exon skipping using 2'-O-methyl chemistry on the PS backbone. AOs were designed to target splicing enhancer motifs of CNOT3 exons to mediate the exclusion of target exons during pre-mRNA splicing, thereby mediating knockdown of CNOT3 or disruption of protein function. Dermal fibroblasts were transfected with CNOT3 AOs (2'OMe-PS chemistry) targeting exons (as indicated) for 48 hours. RT-PCR products were separated on 2% agarose gels.

[0040] Figure 8 shows the negative correlation between CNOT3 and PRPF31 mRNA expression. Figure 8 (a) qRT-PCR analysis of PRPF31 and CNOT3 mRNA expression in iPSC-derived retinal pigment epithelial cells from RP11, asymptomatic and healthy (WT) individuals normalized to TATA binding protein (TBP) expression. RP11 and asymptomatic subjects were from the same pedigree and were heterozygous for the PRPF31c.1205C>A (Ser402*) mutation. Healthy subjects were from unrelated families. The expression of CNOT3 and PRPF31 mRNA in the healthy control group was set to 1. (n≥2). Figure 8 (b) Dermal fibroblasts from RP11 patients were transfected with CNOT3 AO (2'OMe-PS) targeting exons 4, 6, 7 or 10 for 48 hours. The transcription level of PRPF31 was analyzed by qRT-PCR and normalized to the expression of TBP. PRPF31 expression in cells treated with 25nM control AO was set to 1 (n=1). Figure 8(c) Dermal fibroblasts from RP11 patients were transfected for 48 hours with CNOT3 AO (2'OMe-PS chemistry) targeting exon 3, 8, 9, 16, or 17. PRPF31 transcript levels were analyzed by qRT-PCR and normalized to the expression of TBP, and the results are shown relative to PRPF31 expression in cells treated with 25 nM sham control AO (control PRPF31 expression was set to 1 (n=1).

[0041] Figure 9 shows the effect of ASO6 (SEQ ID NO: 64, CNOT3_H17A (+83+107), targeting CNOT3 exon 17) synthesized as phosphorodiamidate morpholino oligomers (PMOs) and transfected into RP11 iPSC-derived RPE. (A) CNOT3 exon 17 skipping in cells treated with PMO alone or cell-penetrating peptide-tagged PMO (PPMO) at a concentration of 5 μM. (B) PRPF31 upregulation caused by CNOT3 gene knockdown was determined by qRT-PCR and normalized to the expression of TATA binding protein (TBP). PRPF31 expression of the untreated control group was set to 1.

[0042] Figure 10 shows (A) immunostaining of cilia (red) and basal bodies (green) in wild-type and RP11 RPE treated with antisense oligomers with or without ASO6 (SEQ ID NO: 64, CNOT3_H17A (+83+107), targeting CNOT3 exon 17). (B) Percentage of RPE cells expressing cilia, counted from >1,000 cells. (C) Cilia length was measured using NIS-Elements imaging software. Bar graphs represent mean ± SEM from approximately 300 ciliated cells. Scale bar = 10 μm. Student's t-test. ***P<0.001. DETAILED DESCRIPTION OF THE INVENTION

[0044] Detailed description of the invention

[0045] Antisense Oligonucleotides

[0046] Photoreceptors have increased vulnerability to a general reduction in splicing activity. Mutations in splicing factors can lead to splicing defects in a variety of tissues, with photoreceptor cells being particularly affected due to the high production requirements for mRNAs such as those encoding rhodopsin and other phototransduction proteins. This model assumes that the amount of mRNA produced by the retina greatly exceeds the levels of mRNA produced in other tissues.

[0047] PRPF31 (also known as hPRP31) encodes an essential pre-mRNA splicing factor required for the assembly and recycling of the U4 / U6 RNA complex. Several studies have shown that in RP11 patients, the amount of total PRPF31 mRNA is reduced and the rate of spliceosomal assembly and pre-mRNA processing is delayed. This suggests that the disease occurs through a haploinsufficiency mechanism. The retina expresses seven times more of the major spliceosomal small nuclear RNA (snRNA) than other tissues.

[0048] CCR4-Not transcription complex subunit 3 (CNOT3, one of the five Not proteins of the CCR4-Not deadenylase complex) has been identified as a major modifier gene that determines the penetrance of PRPF31 mutations through a transcriptional repression mechanism, regulating the transcription of PRPF31 by directly binding to the promoter of PRPF31. The expression level of the wild-type PRPF31 allele determines whether carriers of the mutant PRPF31 allele are symptomatic. In asymptomatic carriers, CNOT3 is expressed at low levels, allowing more wild-type PRPF31 transcripts to be produced and preventing the manifestation of retinal degeneration.

[0049] Human CNOT3 is an 18-exon gene that encodes a protein with 753 amino acids. Exclusion of exon 2 results in the removal of the translation start codon from the transcript. Exclusion of exons 4, 5, 6, 7, 10, or 17 may disrupt the functional domains of CNOT3. Exclusion of any of exons 3, 8, 9, and 11-16 will disrupt the open reading frame.

[0050] Knockdown of the CNOT3 gene is embryonic lethal because it is essential for cell cycle progression in various physiological processes by regulating mRNA turnover and modulating mRNA decay. However, if CNOT3 levels could be locally reduced or eliminated in the eye of subjects at risk for or with RP, the progression of the disease would be affected as would the amount of PRPF31 protein that could be produced, mimicking an incomplete penetrance model where asymptomatic carriers are protected from the disease by above average PRPF31 expression over the unmodified gene.

[0051] Thus, the present invention provides antisense oligonucleotides to induce unproductive splicing of CNOT3 (a negative regulator of PRPF31) or functionally impaired CNOT3 protein to lower (but preferably not eliminated) CNOT3 levels and thereby increase transcription and translation of the normal PRPF31 allele.

[0052] Compared to other antisense oligomer-based treatments, the present invention does not induce increased RNA degradation through the recruitment of RNase H, which preferentially binds to and degrades RNA bound to the DNA duplex of the CNOT3 gene. It also does not rely on hybridization of antisense oligomers with CNOT3 genomic DNA or binding of antisense oligomers to mRNA to regulate the production of CNOT3 protein by interfering with normal functions such as replication, transcription, translocation and translation.

[0053] In contrast, antisense oligomers are used to modify pre-mRNA splicing in CNOT3 gene transcripts or portions thereof and induce exon "skipping" and / or terminal intron retention. This strategy preferably reduces total protein expression or produces proteins lacking functional domains, thereby resulting in reduced protein function.

[0054] According to a first aspect of the present invention, an antisense oligomer capable of binding to a selected target on a CNOT3 gene transcript to modify pre-mRNA splicing in a CNOT3 gene transcript or a portion thereof is provided. In a broad sense, an isolated or purified antisense oligomer for inducing targeted exon exclusion and / or terminal intron retention in a CNOT3 gene transcript or a portion thereof is provided.

[0055] In the general population, the expression of PRPF31 is highly variable, with levels being distributed continuously. Expression levels range from 0.53 to 2.48 arbitrary units, representing a 5-fold variation between the lowest and highest expression levels. Thirty percent of PRPF31 mutation carriers are asymptomatic, and these individuals have the wild-type allele, which has expression that is almost 2-fold higher than that of those with symptomatic PRPF31 mutations. Therefore, preferably, regulation of CNOT3 expression allows expression of PRPF31 to be at least two-fold higher than that of those with symptomatic PRPF31 mutations. Preferably, since the AO of the present invention reduces the expression of CNOT3, the expression of PRPF31 is 1.5 to 5 times higher than that of those with symptomatic PRPF31 mutations. For example, the expression of PRPF31 may be 2-4 times higher.

[0056] "Isolated" refers to a material that is substantially or essentially free of components that normally accompany its native state. For example, "isolated polynucleotides" or "isolated oligonucleotides" as used herein may refer to polynucleotides purified or removed from sequences on both sides of them in a naturally occurring state, for example, a DNA fragment removed from a sequence adjacent to the fragment in a genome. The term "isolated" in relation to cells refers to purifying cells (e.g., fibroblasts, lymphocytes) from a source subject (e.g., a subject with a polynucleotide repeat disease). In the context of mRNA or protein, "isolation" refers to recovering mRNA or protein from a source (e.g., a cell).

[0057] The antisense oligomer can be said to be "directed to" or "targeted to" the target sequence to which it hybridizes. In certain embodiments, the target sequence includes a region that includes a 3' or 5' splice site, a branch point, or other sequences involved in splicing regulation of the pretreated mRNA. The target sequence can be within an exon, within an intron, or across an intron / exon boundary.

[0058] In certain embodiments, the antisense oligomer has sufficient sequence complementarity with the target RNA (i.e., the RNA whose splice site selection is regulated) to effectively block a region of the target RNA (e.g., a mRNA precursor). In an exemplary embodiment, this blocking of the CNOT3 mRNA precursor is used to regulate splicing, which is regulated by masking the binding site of the natural protein, otherwise the binding site will regulate splicing, and / or by changing the structure of the target RNA to regulate splicing. In some embodiments, the target RNA is a target mRNA precursor (e.g., a CNOT3 gene mRNA precursor).

[0059] An antisense oligomer having sufficient sequence complementarity to a target RNA sequence to modulate splicing of the target RNA means that the antisense oligomer has a sequence sufficient to trigger masking of a binding site for a native protein that would otherwise modulate splicing and / or alter the three-dimensional structure of the target RNA.

[0060] The antisense oligomer selected can be shorter, e.g., about 12 bases, or longer, e.g., about 50 bases, and include a small number of mismatches, as long as the sequence is sufficiently complementary to achieve splicing modulation when hybridized to the target sequence, and optionally forms a heteroduplex with the RNA having a Tm of 45°C or higher.

[0061] Preferably, the antisense oligomer is selected from the sequences shown in Table 1. Preferably, the antisense oligomer is selected from the sequences in SEQ ID NO: 1-74, more preferably SEQ ID NO: 4, 7, 9, 11, 14, 16-18, 27, 30, 34, 35, 64 and 67, even more preferably SEQ ID NO: 4, 7, 27, 30, 34 and 64.

[0062] In certain embodiments, the degree of complementarity between target sequence and antisense oligomer is enough to form stable duplex.The complementary region of antisense oligomer and target RNA sequence can be as short as 8-11 bases, but can be 12-15 bases or more, for example, 10-50 bases, 10-40 bases, 12-30 bases, 12-25 bases, 15-25 bases, 12-20 bases or 15-20 bases, including all integers between these scopes.The antisense oligomer of about 16-17 bases is usually long enough to have unique complementary sequence.In certain embodiments, as described herein, the complementary base of minimum length may be needed to reach required combination Tm.

[0063] In certain embodiments, oligonucleotides up to 50 bases may be suitable, wherein at least a minimum number of bases, e.g., 10-12 bases, are complementary to the target sequence. However, in general, the promoted or active uptake in cells is optimized when the oligonucleotide length is less than about 30 bases. For phosphorodiamidate morpholino oligonucleotide (PMO) antisense oligomers, the best balance of binding stability and uptake generally occurs at a length of 18-25 bases. Included are antisense oligomers consisting of about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 bases (e.g., CPPMO, PPMO, PMO, PMO-X, PNA, LNA, 2'-OMe).

[0064] In certain embodiments, the antisense oligomer can be 100% complementary to the target sequence, or can include mismatches, for example, to include variants, as long as the heteroduplex formed between the oligonucleotide and the target sequence is stable enough to withstand the action of cellular nucleases and other degradation modes that may occur in vivo. Thus, certain oligonucleotides can have a sequence complementarity of about or at least about 70%, for example, a sequence complementarity of 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% between the oligonucleotide and the target sequence.

[0065] Mismatches, if present, generally cause the terminal regions of the hybridized duplex to be more unstable than the middle regions. According to the known principles of duplex stability, the number of mismatches allowed will depend on the length of the oligonucleotide, the percentage of G:C base pairs in the duplex, and the position of the mismatch in the duplex. Although this antisense oligomer is not necessarily 100% complementary to the target sequence, it can effectively and stably bind to the target sequence and specifically, thereby regulating the splicing of the target pre-RNA.

[0066] The stability of the duplex formed between the antisense oligomer and the target sequence depends on the sensitivity of the duplex to the enzyme cleavage of the cell by binding Tm and duplex. The Tm of the oligonucleotide relative to the complementary sequence RNA can be measured by conventional methods, such as Hames et al., Nucleic Acid Hybridization, IRL Press, 1985, pp.107-108 or as described in Miyada C.G. and Wallace RB, 1987, Oligonucleotide Hybridization Techniques, Methods Enzymol. Vol. 154 pp.94-107. In certain embodiments, the binding Tm of the antisense oligomer relative to the complementary sequence RNA may be greater than body temperature, preferably greater than about 45°C or 50°C. Also included are Tm in the range of 60-80°C or higher temperatures.

[0067] Other examples of variants include antisense oligomers having about or at least about 70% sequence identity or homology, for example, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity or homology over the entire length of SEQ ID No: 1-74, more preferably SEQ ID No: 4, 7, 9, 11, 14, 16-18, 27, 30, 34, 35, 64 and 67, even more preferably SEQ ID No: 4, 7, 27, 30, 34 and 64 or the sequences provided in Table 1.

[0068] More specifically, antisense oligomers are provided that are capable of binding to selected target sites to modify pre-mRNA splicing in CNOT3 gene transcripts or portions thereof. The antisense oligomers are preferably selected from the sequences provided in Table 1 or SEQ ID NOs: 1-74, more preferably SEQ ID NOs: 4, 7, 9, 11, 14, 16-18, 27, 30, 34, 35, 64 and 67, even more preferably SEQ ID NOs: 4, 7, 27, 30, 34 and 64.

[0069] The modification of pre-mRNA splicing preferably induces "skipping", or the removal of one or more exons or introns of the mRNA and / or the retention of the terminal intron. Compared with the parent full-length CNOT3, the length of the resulting protein may be shorter due to internal truncation or premature termination, or the length of the resulting protein may be longer due to the retention of the terminal intron. These CNOT3 proteins can be referred to as subtypes of unmodified CNOT3 proteins.

[0070] The remaining exons of the generated mRNA may be in frame and produce a shorter protein whose sequence is similar to that of the parent full-length protein, except that it has an internal truncation in the region between the original 3' and 5' ends. In another possibility, exon skipping can induce a frameshift, resulting in a first portion of the protein being essentially identical to the parent full-length protein, but wherein the second portion of the protein has a different sequence (e.g., a nonsense sequence) due to the frameshift. Alternatively, exon skipping may result in the production of a prematurely terminated protein due to disruption of the reading frame and premature termination of translation. In addition, antisense oligos can produce artificially extended proteins due to retention of terminal introns.

[0071] The functional domains of CNOT3 include coiled coil, linker, NAR (non-anchor region), CS (connecting sequence) and NOT box. Exclusion of exon 4 will remove part of the coiled coil domain, loss of exon 9 will disrupt the open reading frame, resulting in mRNA degradation and any encoded protein will be truncated, while skipping exon 17 will change the NOT box, thus affecting the formation of the complex and thus affecting the function of CNOT3.

[0072] Removal of one or more exons may further result in misfolding of the CNOT3 protein and reduced ability of the protein to successfully transport across membranes.

[0073] Preferably, there is an internally truncated protein (i.e., a protein lacking amino acids encoded by one or more exons). If the CNOT3 protein is knocked out, there may be problems with increased CNOT3 transcription as the body attempts to compensate for the reduction in the total amount of CNOT3 protein. In contrast, the presence of an internally truncated protein (preferably lacking one or more features of a complete CNOT3 protein) should be sufficient to prevent increased transcription, but still provide a therapeutic advantage due to the reduction in the total amount of functional CNOT3 protein.

[0074] The exon skipping induced by the antisense oligomers of the present invention does not need to completely or even substantially eliminate the function of the CNOT3 protein. Preferably, the exon skipping process results in a reduction or impairment of the function of the CNOT3 protein.

[0075] The skipping process of the present invention using antisense oligomers can skip a single exon, or can result in the skipping of two or more exons at a time.

[0076] The antisense oligomer of the present invention can be a combination of two or more antisense oligomers that can bind to a selected target to induce exon exclusion in a CNOT3 gene transcript. The combination can be a mixture of two or more antisense oligomers, and / or a construct comprising two or more antisense oligomers linked together.

[0077] Table 1: List of antisense oligomer sequences used in this study and efficacy scores for AO-induced CNOT3 exon skipping. +1: >50% exon skipping, 0: <50% exon skipping, -1: no exon skipping

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084] Also provided is a method for manipulating splicing in a CNOT3 gene transcript, the method comprising the steps of:

[0085] a) providing one or more antisense oligomers as described herein and allowing the oligomers to bind to the target nucleic acid site.

[0086] According to another aspect of the present invention, a splicing manipulation target nucleic acid sequence of CNOT3 is provided, which comprises a DNA equivalent of a nucleic acid sequence selected from Table 1 or selected from SEQ ID NO: 1-74, more preferably SEQ ID NO: 4, 7, 9, 11, 14, 16-18, 27, 30, 34, 35, 64 and 67, more preferably SEQ ID NO: 4, 7, 27, 30, 34 and 64, and a sequence complementary thereto.

[0087] Designing antisense oligomers to completely mask the common splice site may not necessarily result in changes in the splicing of the targeted exon. In addition, the inventors have found that when designing antisense oligomers, the size or length of the antisense oligomer itself is not always a major factor. For some targets, such as IGTA4 exon 3, antisense oligomers as short as 20 bases can induce certain exon skipping, in some cases, more effectively than other longer (such as 25 bases) oligomers for the same exon.

[0088] The inventors have also found that there does not appear to be any standard motif that can be blocked or masked by antisense oligomers to redirect splicing. It has been found that antisense oligomers must be designed and their individual efficacy empirically assessed.

[0089] More specifically, the antisense oligomer can be selected from those listed in Table 1. The sequence is preferably selected from SEQ ID NO: 1-74, more preferably SEQ ID NO: 4, 7, 9, 11, 14, 16-18, 27, 30, 34, 35, 64 and 67, even more preferably SEQ ID NO: 4, 7, 27, 30, 34 and 64, and any one or more of combinations or mixtures thereof. This includes sequences that can hybridize to these sequences under stringent hybridization conditions, sequences complementary thereto, sequences containing modified bases, modified backbones, and functional truncations or extensions thereof, which have or regulate pre-mRNA processing activity in CNOT3 gene transcripts.

[0090] When a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hydrogen bond to each other, the oligonucleotide and the DNA, cDNA or RNA will be complementary to each other. Therefore, "specific hybridization" and "complementarity" are terms used to indicate a sufficient degree of complementarity or pairing so that stable and specific binding occurs between the oligonucleotide and the DNA, cDNA or RNA target. It should be understood in the art that the sequence of the antisense oligomer does not need to be 100% complementary to the target sequence to be specifically hybridized. When the binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA product, the antisense oligomer is specifically hybridized, and under conditions requiring specific binding, that is, under physiological conditions of in vivo testing or treatment, and in the case of in vitro testing under the conditions of conducting the test, there is a sufficient degree of complementarity to avoid non-specific binding of the antisense oligomer to non-target sequences.

[0091] Selective hybridization can be carried out under low, medium or high stringency conditions, but is preferably carried out under high stringency conditions. Those skilled in the art will recognize that, in addition to base composition, complementary strand length and the number of nucleotide base mismatches between hybridizing nucleic acids, the stringency of hybridization will also be affected by conditions such as salt concentration, temperature or organic solvents. Stringent temperature conditions typically include temperatures exceeding 30°C, typically exceeding 37°C, preferably exceeding 45°C, preferably at least 50°C, typically 60°C-80°C or higher. Stringent salt conditions are typically less than 1000mM, typically less than 500mM, and preferably less than 200mM. However, the combination of parameters is much more important than the measure of any single parameter. An example of stringent hybridization conditions is 65°C and 0.1×SSC (1×SSC=0.15MNaCI, 0.015M sodium citrate, pH 7.0). Therefore, the antisense oligomers described in the present invention may include oligonucleotides that selectively hybridize to the sequences provided in Table 1 or SEQ ID NOs: 1-74, more preferably SEQ ID NOs: 4, 7, 9, 11, 14, 16-18, 27, 30, 34, 35, 64 and 67, and even more preferably SEQ ID NOs: 4, 7, 27, 30, 34 and 64.

[0092] It should be understood that the codon arrangement at the end of the exon in the structural protein is not always broken at the codon end, so it may be necessary to delete more than one exon from the mRNA precursor to ensure in-frame reading of the mRNA. In this case, it may be necessary to select multiple antisense oligomers by the method of the present invention, wherein each antisense oligomer is directed to a different region responsible for inducing the inclusion of the desired exon and / or intron. At a given ionic strength and pH value, Tm is the temperature at which 50% of the target sequence hybridizes to the complementary polynucleotide. This hybridization can occur when the antisense oligomer is "close" or "substantially" complementary to the target sequence, or it can occur when it is completely complementary.

[0093] Typically, selective hybridization will occur when there is at least about 55% identity, preferably at least about 65%, more preferably at least about 75%, most preferably at least about 90%, 95%, 98% or 99% identity with the nucleotides of the antisense oligomer over a segment of at least about 14 nucleotides. As described above, the length of homology comparison can be longer sequences, and in certain embodiments, typically at least about nine nucleotides, typically at least about 12 nucleotides, more typically at least about 20, typically at least about 21, 22, 23 or 24 nucleotides, at least about 25, 26, 27 or 28 nucleotides, at least about 29, 30, 31 or 32 nucleotides, at least about 36 or more nucleotides.

[0094] Therefore, the antisense oligomer sequence of the present invention preferably has at least 75% with the sequence shown in the sequence table of this paper, more preferably at least 85%, more preferably at least 86%, 87%, 88%, 89% or 90% homology. More preferably, there is at least 91%, 92%, 93%, 94% or 95%, more preferably at least 96%, 97%, 98% or 99% homology. Generally, the shorter the length of the antisense oligomer, the greater the homology required for selective hybridization. Therefore, in the case where the antisense oligomer of the present invention is composed of less than about 30 nucleotides, compared with the antisense oligomer listed in the sequence table of this paper, the preferred percentage identity is greater than 75%, preferably greater than 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. Nucleotide homology comparisons can be performed by sequence comparison programs, such as the GCG Wisconsin Bestfit program or GAP (Deveraux et al., 1984, Nucleic Acids Research 12, 387-395). In this way, sequences similar or substantially different in length to those cited herein can be compared by inserting gaps in the alignment, such gaps being determined by the comparison algorithm used by GAP.

[0095] The antisense oligomers of the present invention may have regions that reduce homology, as well as regions that are completely homologous to the target sequence. It is not necessary for the oligonucleotide to have complete homology over its entire length. For example, the oligonucleotide may have a continuous segment of at least 4 or 5 bases identical to the target sequence, preferably a continuous segment of at least 6 or 7 bases identical to the target sequence, and more preferably a continuous segment of at least 8 or 9 bases identical to the target sequence. The oligonucleotide may have a segment of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 bases identical to the target sequence. The remaining segments of the oligonucleotide sequence may be intermittently identical to the target sequence; for example, the remaining sequence may have the same bases, followed by non-identical bases, and then the same bases. Or (or and) the oligonucleotide sequence may have segments of several identical sequences (e.g., 3, 4, 5 or 6 bases), interspersed with segments of incomplete homology. Such sequence mismatches will preferably result in no or little loss of splice switching activity.

[0096] The term "regulate" or "modulate" includes "increasing" or "decreasing" one or more quantifiable parameters, optionally "increasing" or "decreasing" by a defined and / or statistically significant amount. The term "increase", "enhance" or "enhance" or "stimulate" or "promote" generally refers to the ability of one or more antisense oligomers or compositions to produce or cause a greater physiological response (i.e., a downstream effect) in a cell or subject relative to the response caused by no antisense oligomers or a control compound. The term "reduce" or "reduce" generally refers to the ability of one or more antisense oligomers or compositions to produce or cause a reduced physiological response (i.e., a downstream effect) in a cell or subject relative to the response caused by no antisense oligomers or a control compound.

[0097] The relevant physiological or cellular response (in vivo or in vitro) is obvious to those skilled in the art and may include an increase in the exclusion of a specific exon in a CNOT3-encoding mRNA precursor, a reduction in the amount of an mRNA precursor encoding CNOT3, or a reduction in the expression of a functional CNOT3 protein in a cell, tissue, or subject in need thereof. The amount of "reduction" or "reduction" is usually a statistically significant amount and may include a reduction of 1.1, 1.2, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50 times or more (e.g., 500, 1000 times) (including all integers and decimals between and above 1, such as 1.5, 1.6, 1.7, 1.8) less than the amount produced when the antisense oligomer is not present (no reagent) or the control compound is used.

[0098] The term "reducing" or "inhibiting" may generally relate to the ability of one or more antisense oligomers or compositions to "reduce" the ability of a relevant physiological or cellular response, such as a symptom of a disease or disorder described herein measured according to conventional techniques in the field of diagnosis. The relevant physiological or cellular response (in vivo or in vitro) is obvious to those skilled in the art and may include alleviation of symptoms or pathology of a disease such as retinitis pigmentosa.

[0099] A "reduction" in a response can be statistically significant, compared to a response produced in the absence of the antisense oligomer or a control composition, and can include a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% reduction, including all integers in between.

[0100] The length of antisense oligomer can be changed, as long as it can selectively bind to the expected position in the mRNA precursor molecule. The length of these sequences can be determined according to the selection process described herein. Usually, the length of antisense oligomer is from about 10 nucleotides to about 50 nucleotides. However, it should be understood that the nucleotide of any length within the scope can be used for this method. The length of the preferred antisense oligomer is between 10 to 40, 10 to 35, 15 to 30 nucleotide lengths or 20 to 30 nucleotide lengths, most preferably about 25 to 30 nucleotide lengths. For example, the length of the oligomer can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides.

[0101] As used herein, "antisense oligomer" refers to a linear sequence of nucleotides or nucleotide analogs that allows a nuclease to hybridize to a target sequence in RNA by Watson-Crick base pairing to form an oligonucleotide: RNA heteroduplex within the target sequence. The terms "antisense oligomer", "antisense oligonucleotide", "oligomer (oligomer)" and "antisense compound" are used interchangeably to refer to oligonucleotides. The ring subunit can be based on ribose or another pentose, or in certain embodiments based on a morpholino group (see below for a description of morpholino oligonucleotides). Also included are peptide nucleic acids (PNA), locked nucleic acids (LNA) and 2'-O-methyl oligonucleotides, as well as other antisense agents known in the art.

[0102] Non-naturally occurring antisense oligomers or "oligonucleotide analogs" are included, including antisense oligomers or oligonucleotides having (i) modified backbone structures, e.g., backbones other than the standard phosphodiester bonds found in naturally occurring oligonucleotides and polynucleotides, and / or (ii) modified sugar moieties, e.g., morpholino moieties instead of ribose or deoxyribose moieties. Oligonucleotide analogs support bases that are capable of hydrogen bonding with standard polynucleotide bases via Watson-Crick base pairing, wherein the analog backbone presents the bases in a manner that allows such hydrogen bonding between the oligonucleotide analog molecule and bases in a standard polynucleotide (e.g., single-stranded RNA or single-stranded DNA) in a sequence-specific manner. Preferred analogs are those having substantially uncharged, phosphorus-containing backbones.

[0103] One method of producing antisense oligomers is to methylate the 2' hydroxyribose position and incorporation of a phosphorothioate backbone produces a molecule that superficially resembles RNA but is more resistant to nuclease degradation, but those skilled in the art will be aware of other forms of suitable backbones that can be used for the purposes of the present invention.

[0104] In order to avoid the degradation of the mRNA precursor during the formation of the duplex with the antisense oligomer, the antisense oligomer used in the present method can be adapted to minimize or prevent the cleavage of endogenous RNase H. This feature is highly preferred because the treatment of RNA with non-methylated oligomers (whether in cells or in crude extracts containing RNase H) leads to the degradation of the mRNA precursor: antisense oligomer duplex. Any form of modified antisense oligomers that can bypass or do not induce such degradation can be used in the present method. The antisense oligomers described in the present invention can be modified to include partially unsaturated fatty hydrocarbon chains and one or more polar or charged groups, including carboxylic acid groups, ester groups and alcohol groups, to achieve nuclease resistance.

[0105] The antisense oligomers that do not activate RNase H can be prepared according to known techniques (see, for example, U.S. Patent No. 5,149,797). Such antisense oligomers can be deoxyribonucleotides or ribonucleotide sequences, simply comprising any structural modification that spatially hinders or prevents the binding of RNase H to a duplex molecule comprising an oligomer as one of its members, and the structural modification does not substantially hinder or destroy the formation of the duplex. Since the part of the oligomer involved in duplex formation is substantially different from the part involved in the RNase H bound thereto, many antisense oligomers that do not activate RNase H can be obtained. For example, such antisense oligomers can be oligonucleotides in which at least one or all of the internucleotide bridging phosphate residues are modified phosphate esters, such as methyl phosphate, methyl thiophosphate, phosphoromorpholinoate, phosphoropiperazidates boranophosphates, amide bonds and phosphoramidates. For example, each of the other residues in the internucleotide bridging phosphate residues can be modified as described. In another non-limiting example, such antisense oligomers are molecules in which at least one or all nucleotides contain a 2' lower alkyl moiety (e.g., C1-C4, straight or branched, saturated or unsaturated alkyl, such as methyl, ethyl, vinyl, propyl, 1-propenyl, 2-propenyl and isopropyl). For example, each of the nucleotides can be modified as described.

[0106] Examples of antisense oligomers that are not cleaved by cellular RNase H when forming a duplex with RNA are 2'-O-methyl derivatives. Such 2'-O-methyl-oligoribonucleotides are stable in cellular environments and animal tissues, and their duplexes with RNA have higher Tm values ​​than their ribose or deoxyribose counterparts. Alternatively, the nuclease-resistant antisense oligomers of the present invention may have at least one last 3'-terminal nucleotide fluorinated. In addition, the nuclease-resistant antisense oligomers of the present invention have a thiophosphate bond connected between at least two of the last 3'-terminal nucleotide bases, preferably a thiophosphate bond connected between the last four 3'-terminal nucleotide bases.

[0107] Increased splice switching can also be achieved through alternative oligonucleotide chemistries. For example, the antisense oligomer can be selected from the list including: phosphoramidate or phosphorodiamidate morpholino oligonucleotides (PMO); PMO-X; PPMO; peptide nucleic acids; locked nucleic acids (LNA) and their derivatives, including α-L-LNA, 2'-amino LNA, 4'-methyl LNA and 4'-O-methyl LNA; ethylene-bridged nucleic acids (ENA) and their derivatives; phosphorothioate oligomers; tricyclic DNA oligomers (tcDNA); tricyclic phosphorothioate oligomers; 2'O-methyl modified oligomers (2'-OMe); 2'-O-methoxyethyl (2'-MOE); 2'-fluoro, 2'-fluoroarabino (2'-fluroarabino FANA); unlocked nucleic acids (UNA); hexitol nucleic acids (HNA); cyclohexenyl nucleic acids (CeNA); 2'-amino (2'-NH2); 2'-O-ethyleneamine or any combination of the above as a mixture or as a gapmer. In order to further improve the delivery efficiency, the above-mentioned modified nucleotides are usually conjugated to sugar or nucleobase moieties with fatty acids / lipids / cholesterol / amino acids / carbohydrates / polysaccharides / nanoparticles, etc. These conjugated nucleotide derivatives can also be used to construct exon skipping antisense oligomers. Antisense oligomer-induced human CNOT3 gene transcript splicing modification usually uses bases on the thiophosphate backbone modified by oligonucleotides, PNA, 2OMe or MOE. Although 2OMeAO is used for oligomer design, due to its efficient absorption in vitro when delivered as a cationic lipid complex, these compounds are easily degraded by nucleases and are not ideal for in vivo or clinical applications. When other chemical methods are used to produce the antisense oligomers of the present invention, the uracil (U) of the sequence provided herein can be replaced by thymine (T).

[0108] While the above-described antisense oligomers are the preferred form of antisense oligomers described herein, the present invention encompasses other antisense oligomeric molecules, including but not limited to oligomer mimetics as described below.

[0109] The specific examples that can be used for preferred antisense oligomers of the present invention include the oligonucleotides containing the main chain or non-natural internucleoside bond of modification.As defined in this specification, the oligomers with the main chain of modification include those oligomers that retain phosphorus atom in the main chain and those oligomers that do not have phosphorus atom in the main chain.For the purpose of this specification, and as mentioned sometimes in this area, the oligomers that do not have the modification of phosphorus atom in their internucleoside main chain can also be considered as antisense oligomers.

[0110] In other preferred oligomer mimetics, the sugar and internucleoside bonds (i.e., backbone) of the nucleotide units are replaced by new groups. The base units are retained to hybridize with appropriate nucleic acid target compounds. One such oligomeric compound, an oligomer mimetic that has been shown to have excellent hybridization properties, is referred to as peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of the oligomer is replaced by a backbone containing amides, particularly by an aminoethylglycine backbone. The core base is retained and is directly or indirectly combined with the nitrogen heteroatom of the backbone amide portion.

[0111] Another preferred chemical is phosphorodiamidate morpholino oligonucleotide (PMO) oligomeric compounds, which are not degraded by any known nuclease or protease. These compounds are uncharged, do not activate RNase H activity when bound to RNA chains, and have been shown to exert sustained splicing regulation after in vivo administration (Summerton and Weller, Antisense Nucleic Acid Drug Development, 7, 187-197).

[0112] Modified oligomers may also contain one or more substituted sugar moieties. Oligomers may also include modifications or substitutions of nucleobases (commonly referred to in the art as "bases"). Certain nucleobases are particularly useful for improving the binding affinity of the oligomeric compounds of the present invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propyluracil, and 5-propylcytosine. 5-methylcytosine substitutions can increase nucleic acid duplex stability by 0.6-1.2°C, especially when combined with 2'-O-methoxyethyl sugar modifications.

[0113] Another modification of the oligomers of the present invention involves chemical attachment to one or more moieties or conjugates of the oligomers that enhance the activity, cellular distribution or cellular uptake of the oligomers. These moieties include, but are not limited to, lipid moieties, such as cholesterol moieties, cholic acid, thioethers, such as hexyl-S-tritylthiol, thiocholesterol, fatty chains, such as dodecanediol or undecyl residues, phospholipids, such as di-hexadecyl-rac glycerol or triethylammonium 1,2-di-O-hexadecyl-rac glycerol-3-H-phosphate, polyamines or polyethylene glycol chains, or adamantaneacetic acid, palmityl moieties, myristyl, or octadecylamine or hexylamino-carbonyl-oxycholesterol moieties.

[0114] Cell penetrating peptides have been added to phosphorodiamidate morpholino oligomers to enhance cellular uptake and nuclear localization. Different peptide tags have been shown to affect uptake efficiency and target tissue specificity, as shown by Jearawiriyapaisarn et al. (2008), Mol. Ther. 16 9, 1624 1629.

[0115] It is not necessary to uniformly modify all positions in a given compound, and in fact, more than one of the above modifications may be incorporated into a single compound or even a single nucleoside within an oligomer. The present invention also includes antisense oligomers as chimeric compounds. In the context of the present invention, a "chimeric" antisense oligomer or "chimera" is an antisense oligomer, particularly an oligomer, comprising two or more chemically different regions, each region consisting of at least one monomeric unit, i.e., in the case of an oligomeric compound, consisting of at least one nucleotide. These oligomers typically include at least one region, wherein the oligomer is modified to impart resistance to nuclease degradation to the oligomer or antisense oligomer, increase cellular uptake, and increase additional regions of binding affinity to the target nucleic acid.

[0116] The activity of antisense oligomers and variants thereof can be determined according to routine techniques in the art. For example, the splicing forms and expression levels of the detected RNA and proteins can be assessed by any of a variety of well-known methods for detecting splicing forms and / or expression of transcribed nucleic acids or proteins. Non-limiting examples of these methods include RT-PCR of spliced ​​RNA, followed by size separation of the PCR products, nucleic acid hybridization methods such as Northern blotting and / or the use of nucleic acid arrays; nucleic acid amplification methods; immunological methods for protein detection; protein purification methods; and protein function or activity assays.

[0117] RNA expression levels can be assessed by preparing mRNA / cDNA (i.e., transcribed polynucleotides) from cells, tissues, or organisms and hybridizing the mRNA / cDNA with a reference polynucleotide or fragment thereof that is the complement of the nucleic acid being tested. Prior to hybridization with the complementary polynucleotide, the cDNA can optionally be amplified using any of a variety of polymerase chain reactions or in vitro transcription methods; preferably, it is not amplified. Quantitative PCR can also be used to detect the expression of one or more transcripts to assess the expression level of the transcripts.

[0118] The present invention provides antisense oligomer-induced splicing switching of CNOT3 gene transcripts, clinically relevant oligomer chemistry, and a delivery system that directs CNOT3 splicing manipulation to therapeutic levels. The significant reduction in the amount of full-length CNOT3 mRNA and CNOT3 protein transcribed by the CNOT3 gene is achieved by the following methods:

[0119] 1) using a fibroblast cell line to refine oligomers in vitro, experimentally evaluating (i) intron-enhancer targeting motifs, (ii) antisense oligomer length and formation of oligomer mixtures, (iii) choice of chemistry, and (iv) addition of a cell-penetrating peptide (CPP) to enhance oligomer delivery; and

[0120] 2) Detailed evaluation of new methods to generate CNOT3 transcripts with one or more exons deleted.

[0121] Thus, we demonstrate here that the processing of the CNOT3 mRNA precursor can be manipulated using specific antisense oligomers. In this way, a functionally significant reduction in the amount of CNOT3 protein can be obtained, thereby reducing the severe pathology associated with retinitis pigmentosa.

[0122] The antisense oligomer used according to the present invention can be easily prepared by well-known solid phase synthesis techniques. Equipment for this synthesis is sold by several suppliers, for example, including Applied Biosystems (Foster City, Calif.). A method for synthesizing oligonucleotides on a modified solid support has been described in U.S. Patent No. 4,458,066.

[0123] Can adopt any other method known in the art for this synthesis additionally or alternatively.It is well known that similar technology is used to prepare oligomers, such as thiophosphates and alkylated derivatives.In such an automated embodiment, diethyl-phosphoramide is used as starting material, and can be synthesized as described in Beaucage, et al., (1981) Tetrahedron Letters, 22:1859-1862.

[0124] The antisense oligomers of the present invention are synthesized in vitro and do not include antisense compositions of biological origin or genetic vector constructs designed to direct the in vivo synthesis of antisense oligomers. The molecules of the present invention can also be mixed, encapsulated, conjugated or otherwise combined with other molecules, molecular structures or mixtures of compounds, such as liposomes, receptor targeting molecules, etc.

[0125] Antisense oligomers can be formulated for oral, topical, parenteral or other delivery, particularly for topical ocular delivery and injectable ocular delivery. The formulation of the formulation can be used to assist in the uptake, distribution and / or absorption at the delivery or active site. Preferably, the antisense oligomers of the present invention are formulated for topical delivery to the eye or by intraocular injection or intraocular implantation, so that the effect on CNOT3 is spatially limited and not systemic.

[0126] Treatment

[0127] According to another aspect of the present invention, one or more antisense oligomers as described herein are provided for use in antisense oligomer-based therapies. Preferably, the therapy is used for conditions associated with CNOT3 expression. More preferably, the therapy for conditions associated with CNOT3 expression is a therapy for retinitis pigmentosa.

[0128] More specifically, the antisense oligomer can be selected from Table 1, or SEQ ID NO: 1-74, more preferably SEQ ID NO: 4, 7, 9, 11, 14, 16-18, 27, 30, 34, 35, 64 and 67, even more preferably any one or more of SEQ ID NO: 4, 7, 27, 30, 34 and 64, and combinations or mixtures thereof. This includes sequences that can hybridize to these sequences under stringent hybridization conditions, sequences complementary thereto, sequences containing modified bases, modified backbones, and functional truncations or extensions thereof, which have or regulate pre-mRNA processing activity in CNOT3 gene transcripts.

[0129] The present invention also extends to a combination of two or more antisense oligomers that can bind to a selected target to induce exon exclusion in a CNOT3 gene transcript. The combination can be a mixture of two or more antisense oligomers, comprising two or more constructs combined together for antisense oligomer-based therapy.

[0130] Thus, provided is a method for treating, preventing or ameliorating the effects of a disease associated with CNOT3 expression, comprising the steps of:

[0131] a) administering to a patient an effective amount of one or more antisense oligomers or a pharmaceutical composition comprising one or more antisense oligomers described herein.

[0132] Preferably, the disease associated with CNOT3 expression in the patient is retinitis pigmentosa.

[0133] Therefore, the present invention provides a method for treating, preventing or ameliorating the effects of retinitis pigmentosa, comprising the steps of:

[0134] a) administering to a patient an effective amount of one or more antisense oligomers or a pharmaceutical composition comprising one or more antisense oligomers described herein.

[0135] Preferably, the therapy is for reducing the level of functional CNOT4 protein by an exon skipping strategy. The reduction of CNOT3 levels is preferably achieved by reducing transcript levels by modifying pre-mRNA splicing in the CNOT3 gene transcript or a portion thereof.

[0136] Reduction of CNOT3 will preferably result in a reduction in the number, duration or severity of symptoms of a CNOT3-related disorder or pathology (eg, retinitis pigmentosa).

[0137] As used herein, "treatment" of a subject (e.g., a mammal such as a human) or a cell is any type of intervention used in an attempt to alter the natural course of an individual or cell. Treatment includes, but is not limited to, the administration of a pharmaceutical composition, and may be performed prophylactically or after the onset of a pathological event or contact with a pathogen. Also included is "preventative" treatment, the purpose of which is to reduce the rate of progression of the disease or condition being treated, delay the onset of the disease or condition, or reduce the severity of its onset. "Treatment" or "prevention" does not necessarily mean complete eradication, cure, or prevention of a disease or condition or associated symptoms.

[0138] The subject suffering from a disease associated with CNOT3 expression may be a mammal, including a human.

[0139] The antisense oligomers of the present invention may also be used in combination with other therapies, such as drug therapy.

[0140] Therefore, the present invention provides a method for treating, preventing or ameliorating the effects of a disease or condition associated with CNOT3 expression, wherein the antisense oligomer of the present invention and another alternative therapy associated with treating, preventing or ameliorating the effects of a disease or condition associated with CNOT3 expression are administered sequentially or simultaneously. Preferably, the disease or condition is retinitis pigmentosa.

[0141] deliver

[0142] The antisense oligomers of the present invention can also be used as preventive or therapeutic agents, which can be used for the purpose of treating diseases. Therefore, in one embodiment, the present invention provides a therapeutically effective amount of antisense oligomers mixed with a pharmaceutically acceptable carrier, diluent or excipient, which binds to a selected target in the CNOT3 mRNA precursor to induce effective and consistent exon skipping as described herein.

[0143] Also provided is a pharmaceutical, prophylactic or therapeutic composition for treating, preventing or ameliorating the effects of a disease associated with CNOT3 expression in a patient, the composition comprising:

[0144] a) one or more antisense oligomers described herein; and

[0145] b) one or more pharmaceutically acceptable carriers and / or diluents.

[0146] Preferably, the antisense oligomers of the present invention are delivered via a local ocular route to avoid systemic effects. The routes of administration include, but are not limited to, intravitreal, intracameral, subconjunctival, subfascial, retrobulbar, near scleral, or topical (drops, eye wash, emulsion, etc.). Delivery methods include, for example, injection via a syringe and a drug delivery device, such as an implanted vitreous delivery device (i.e., ).

[0147] In one embodiment, the antisense oligomer is injected intravenously at a dose of 20 mg / kg. For example, the antisense oligomer can be injected intravenously in mice at a dose of 20 mg / kg.

[0148] Preferably, antisense oligomer is administered by intravitreal injection with 0.01-1.5mg / kg body weight, 0.1-0.1mg / kg body weight, 0.2-0.8mg / kg body weight, 0.4-0.7mg / kg body weight or more preferably 0.4-0.6mg / kg body weight. Antisense oligomer can be administered by intravitreal injection, for example, with a dosage of about 0.05mg / kg body weight, 0.1mg / kg body weight, 0.2mg / kg body weight, 0.3mg / kg body weight, 0.4mg / kg body weight, 0.5mg / kg body weight, 0.6mg / kg body weight, 0.7mg / kg body weight, 0.8mg / kg body weight, 0.9mg / kg body weight, 1.0mg / kg body weight, 1.1mg / kg body weight, 1.2mg / kg body weight, 1.3mg / kg body weight, 1.4mg / kg body weight, 1.5mg / kg body weight. Preferably, antisense oligomer is administered by intravitreal injection with about 0.5mg / kg body weight. For example, antisense oligomers can be administered to mice by intravitreal injection at about 0.5 mg / kg body weight.

[0149] More preferably, the antisense oligomer is administered by intravitreal injection at a dose of 0.5-50 mg / eye, 0.5-40 mg / eye, 0.5-30 mg / eye, 2-30 mg / eye, 2-20 mg / eye, 0.5-20 mg / eye or more preferably 5-20 mg / eye. The antisense oligomers can be administered by intravitreal injection at, for example, about 0.5 mg / eye, 1.0 mg / eye, 2.0 mg / eye, 3.0 mg / eye, 4.0 mg / eye, 5.0 mg / eye, 6.0 mg / eye, 7.0 mg / eye, 8.0 mg / eye, 9.0 mg / eye, 10.0 mg / eye, 11.0 mg / eye, 12.0 mg / eye, 13.0 mg / eye, 14.0 mg / eye, 15.0 mg / eye, 16.0 mg / eye, 17.0 mg / eye, 18.0 mg / eye, 19.0 mg / eye, 20.0 mg / eye, 21 mg / eye, 22 mg / eye, 23 mg / eye, 24 mg / eye, 25 mg / eye, 30 mg / eye, 35 mg / eye, 40 mg / eye, 45 mg / eye, or 50 mg / eye. Preferably, the antisense oligomer is administered by intravitreal injection at about 5-20 mg / eye.

[0150] Antisense oligomers can be applied at specified intervals in a short period of time, such as daily, for two weeks or less. However, in many cases, oligomers are applied intermittently in a longer period of time. Antibiotics or other treatments are applied after or simultaneously with application. The treatment regimen can be adjusted (dosage, frequency, approach, etc.) according to the results of immunoassays, other biochemical tests, and physiological examinations of the subjects being treated.

[0151] The dosage may depend on the severity and responsiveness of the disease state to be treated, and the course of treatment may last from a few days to several months, or until a cure or alleviation of the disease state is achieved. Alternatively, the administration may be titrated for the rate of disease progression. A baseline progression is established. The rate of progression after the initial one-time drug withdrawal is then monitored to check whether the rate has decreased. Preferably, there is no progression after administration. Preferably, re-administration is required only when the rate of progression remains unchanged. Successful treatment preferably does not lead to further progression of the disease, and even vision is restored. The optimal dosing regimen may be calculated from measurements of drug accumulation in the patient. The optimal dose, method of administration, and repetition rate may be easily determined by a person of ordinary skill.

[0152] Optimal dosages may depend on the relative potencies of individual oligomers and can generally be estimated based on EC50s found to be effective in in vitro and in vivo animal models.

[0153] Typically, the dosage is 0.01-1.5 mg / kg body weight or is administered by intravitreal injection of 0.5-50 mg / eye, and can be administered once or more every day, every week, every month or every year, or even once every 2-20 years. The repetition rate of administration depends on the progression rate of the disease. Those of ordinary skill in the art can easily estimate the repetition rate of administration based on the residence time and concentration of the measured drug in body fluids or tissues. After successful treatment, it may be desirable for the patient to receive maintenance therapy to prevent the recurrence of the disease state, wherein the oligomer is administered at a maintenance dose, and the dosage can be 0.01-1.5 mg / kg body weight or is administered by intravitreal injection of 0.5-50 mg / eye, and can be administered once or more every day, every week, every month or every year, or even once every 2-20 years.

[0154] The effective in vivo treatment regimen using the antisense oligomers of the present invention can vary according to the duration, dosage, frequency and route of administration and the condition of the subject being treated (i.e., prophylactic administration is administration for localized or systemic infection). Therefore, such in vivo treatment usually needs to be monitored by tests suitable for the specific type of disease being treated, and the dosage or treatment regimen is adjusted accordingly to achieve the best treatment outcome.

[0155] Treatment can be monitored, for example, by general indicators of the disease known in the art. The efficacy of the antisense oligomers of the present invention administered in vivo can be determined by biological samples (tissues, blood, urine, etc.) taken from the subject before, during, and after the administration of the antisense oligomers. Assays for such samples include: (1) monitoring the presence or absence of heteroduplex nucleic acid molecules formed with target and non-target sequences using methods known to those skilled in the art, such as electrophoretic gel mobility shift assays; (2) monitoring the amount of mutant mRNA relative to reference normal mRNA or protein by standard techniques such as RT-PCR, Northern blotting, ELISA, or Western blotting.

[0156] The intranuclear delivery of oligomers is a major challenge for antisense oligomers. Different cell penetrating peptides (CPPs) position PMOs to varying degrees in different conditions and cell lines, and the inventors have evaluated the ability of new CPPs to deliver PMOs to target cells. The terms CPP or "peptide moieties that enhance cellular uptake" are used interchangeably and refer to cationic cell penetrating peptides, also referred to as "transport peptides," "carrier peptides," or "peptide transduction domains." As shown herein, the peptides have the ability to induce cell penetration in about or at least about 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of cells in a given cell culture population, and allow macromolecules to translocate in multiple tissues in vivo when administered systemically. CPPs are well known in the art and are disclosed, for example, in U.S. Application No. 2010 / 0016215, which is incorporated herein by reference in its entirety.

[0157] Therefore, the present invention provides an antisense oligomer of the present invention for use in combination with a cell penetrating peptide for the preparation of a therapeutic pharmaceutical composition.

[0158] excipient

[0159] Antisense oligomers of the present invention are preferably delivered with pharmaceutically acceptable compositions. Compositions may include every kind of antisense oligomers required for the present invention of about 1nM to 1000nM. Preferably, compositions may include about 1nM to 500nM, 10nM to 500nM, 50nM to 750nM, 10nM to 500nM, 1nM to 100nM, 1nM to 50nM, 1nM to 40nM, 1nM to 30nM, 1nM to 20nM, most preferably every kind of antisense oligomers of the present invention between 1nM to 10nM.

[0160] The composition may contain about 1 nM, 2 nM, 3 nM, 4 nM, 5 nM, 6 nM, 7 nM, 8 nM, 9 nM, 10 nM, 20 nM, 50 nM, 75 nM, 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM or 1000 nM of each antisense oligomer desired by the invention.

[0161] The present invention also provides one or more antisense oligomers suitable for aiding in the prophylactic or therapeutic treatment, prevention or amelioration of symptoms of a disease, such as a disease or pathology associated with CNOT3 expression, in a form suitable for delivery to a patient.

[0162] The phrase "pharmaceutically acceptable" refers to physiologically tolerable molecular entities and compositions that, when administered to a patient, generally do not produce allergic or similar adverse reactions, such as stomach discomfort, etc. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including oils of petroleum, animal, plant, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, etc. Water or saline solutions and aqueous glucose and glycerol solutions are preferably used as carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in Remington: The Science and Practice of Pharmacy, 22nd Ed., Pharmaceutical Press, PA (2013).

[0163] In a more specific form of the present invention, a pharmaceutical composition comprising one or more antisense oligomers of the present invention and a pharmaceutically acceptable diluent, preservative, solubilizer, emulsifier, adjuvant and / or carrier of a therapeutically effective amount is provided. Such compositions include diluents and additives of various buffer contents (such as Tris-HCl, acetate, phosphate), pH and ionic strength, such as detergents and solubilizers (such as Tween80, polysorbate 80), antioxidants (such as ascorbic acid, sodium pyrosulfite), preservatives (such as Thimersol, benzyl alcohol) and fillers (such as lactose, mannitol). The material can be incorporated into the granular preparation of polymers such as polylactic acid, polyglycolic acid, etc. or into liposomes. Hyaluronic acid can also be used. These compositions may affect the physical state, stability, in vivo release rate and in vivo clearance rate of existing proteins and derivatives. See, for example, Remington: The Science and Practice of Pharmacy, 22nd Ed., Pharmaceutical Press, PA (2013). The composition may be prepared in liquid form, or may be prepared in dry powder form, such as lyophilized form.

[0164] It should be understood that the pharmaceutical composition provided according to the present invention can be administered by any method known in the art. The pharmaceutical composition administered is administered by injection, oral, topical or by pulmonary or nasal route. For example, the antisense oligomer can be delivered by intravenous, arterial, abdominal, intramuscular or subcutaneous administration. The appropriate route can be determined by a person skilled in the art according to the condition of the subject being treated. Preferably, the antisense oligomer is delivered locally to the eye or by intraocular injection or intraocular implantation, so that the effect on CNOT3 is spatially limited and not systemic.

[0165] Preparations for topical administration include preparations in which the oligomers described in the present disclosure are mixed with topical delivery agents such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Lipids and liposomes include neutral (such as dioleoylphosphatidyl (dioleoylphosphatidyl) DOPE ethanolamine, dimyristoylphosphatidylcholine DMPC, distearoylphosphatidyl (distearolyphosphatidyl) choline), negative (such as dimyristoylphosphatidylglycerol DMPG) and cationic (such as dioleoyltetramethylaminopropyl (dioleoyltetramethylaminopropyl) DOTAP and dioleoylphosphatidylethanolamine (dioleoylphosphatidyl) DOTMA). For topical administration or other modes of administration, the oligomers of the present disclosure can be encapsulated in liposomes, or can form complexes with liposomes, particularly with cationic liposomes. Alternatively, the oligomers can be complexed with lipids, particularly with cationic lipids. Fatty acids and esters, pharmaceutically acceptable salts thereof, and uses thereof are further described in U.S. Patent No. 6,287,860 and / or U.S. Patent Application Serial No. 09 / 315,298 filed May 20,1999.

[0166] In certain embodiments, the antisense oligomers described in the present disclosure can be delivered by topical or transdermal methods (e.g., by incorporating the antisense oligomer into, for example, an emulsion, which is optionally packaged in liposomes), including delivery to the ocular surface. Such topical or transdermal and emulsion / liposome-mediated delivery methods are described in the art for delivery of antisense oligomers, e.g., U.S. Patent No. 6,965,025. Preferably, topical delivery is delivery to the eye.

[0167] The antisense oligomers described herein can also be delivered via an implantable device. The design of such a device is well known in the art, such as the synthetic implant design described in U.S. Patent No. 6,969,400. Preferably, the implant can be implanted into the eye to deliver the antisense oligomer continuously.

[0168] Compositions and formulations for ocular administration (including ocular injection, topical ocular delivery and ocular implantation) may include sterile aqueous solutions, which may also contain buffers, diluents and other suitable additives, such as but not limited to penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

[0169] The delivery of therapeutically effective antisense oligomers can be achieved by previously disclosed methods. For example, the delivery of antisense oligomers can be achieved by a composition comprising a mixture of the antisense oligomer and an effective amount of a block copolymer. An example of this method is described in U.S. Patent Application US20040248833. Other methods for delivering antisense oligomers to the nucleus are described in Mann CJ et al. (2001) Proc, Natl. Acad. Science, 98 (1) 42-47 and Gebski et al. (2003) Human Molecular Genetics, 12 (15): 1801-1811. A method for introducing a nucleic acid molecule into a cell as naked DNA or a lipid carrier complex via an expression vector is described in US 6,806,084.

[0170] Antisense oligomers can be introduced into cells using techniques recognized in the art (e.g., transfection, electroporation, fusion, liposomes, colloidal polymer particles and viral and non-viral vectors and other methods known in the art). The selected delivery method will depend at least on the cells to be treated and the location of the cells, and will be apparent to those skilled in the art. For example, positioning can be achieved by liposomes with specific markers on the surface to guide the liposomes, direct injection into tissues containing target cells, specific receptor-mediated uptake, etc.

[0171] It may be desirable to deliver the antisense oligomer in a colloidal dispersion system. Colloidal dispersion systems include macromolecular complexes, nanocapsules, microspheres, microbeads, and lipid systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes or liposomal preparations. These colloidal dispersion systems can be used to prepare therapeutic pharmaceutical compositions.

[0172] Liposomes are artificial membrane vesicles that can be used as delivery vehicles both in vitro and in vivo. These preparations can have net cationic, anionic or neutral charge characteristics and have useful properties for in vitro, in vivo and ex vivo delivery methods. Existing studies have shown that large unilamellar vesicles can encapsulate a considerable percentage of aqueous buffers containing macromolecules. RNA and DNA can be encapsulated in the aqueous interior and delivered to cells in a biologically active form (Fraley, et al., Trends Biochem. Sci. 6: 77, 1981).

[0173] In order for liposomes to be effective gene transfer vectors, they should have the following characteristics: (1) efficiently encapsulate the antisense oligomers of interest without compromising their biological activity; (2) preferentially bind to target cells compared to non-target cells; (3) efficiently deliver the aqueous contents of the vesicles to the cytoplasm of target cells; and (4) accurately and effectively express genetic information (Mannino, et al., Biotechniques, 6:682, 1988). The composition of liposomes is usually a combination of phospholipids (especially high phase transition temperature phospholipids), usually in combination with steroids (especially cholesterol). Other phospholipids or other lipids can also be used. The physical properties of liposomes depend on pH, ionic strength and the presence of divalent cations. Cationic liposomes are positively charged liposomes that are believed to interact with negatively charged DNA molecules to form stable complexes. pH-sensitive or negatively charged liposomes are believed to capture DNA rather than complex with it. Both cationic liposomes and non-cationic liposomes have been used to deliver DNA to cells.

[0174] Liposomes also include "sterically stabilized" liposomes, which, as used herein, refer to liposomes comprising one or more specific lipids that, when incorporated into liposomes, result in increased circulation life relative to liposomes lacking such specific lipids. Examples of sterically stabilized liposomes are those in which a portion of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derived from one or more hydrophilic polymers such as polyethylene glycol (PEG) moieties. Liposomes and their uses are further described in US6,287,860.

[0175] As is known in the art, antisense oligomers can be delivered using methods involving, for example, liposome-mediated uptake, lipid conjugates, polylysine-mediated uptake, nanoparticle-mediated uptake, and receptor-mediated endocytosis, as well as additional non-endocytic modes of delivery, such as microinjection, permeabilization (e.g., streptolysin-O permeabilization, anionic peptide permeabilization), electroporation, and various non-invasive, non-endocytic delivery methods known in the art (see Dokka and Rojanasakul, Advanced Drug Delivery Reviews 44, 35-49, incorporated herein by reference in its entirety).

[0176] Antisense oligomers can also be combined with other pharmaceutically acceptable carriers or diluents to prepare pharmaceutical compositions. Suitable carriers and diluents include isotonic saline solutions, such as phosphate buffered saline. The composition can be formulated for parenteral, intramuscular, intravenous, subcutaneous, intraocular, oral or transdermal administration.

[0177] The administration routes described are intended as a guide only, as one skilled in the art will be able to readily determine the optimal administration route and any dosage for any particular animal and condition.

[0178] Various approaches have been attempted to introduce functional new genetic material into cells both in vitro and in vivo (Friedmann (1989) Science, 244: 1275-1280). These methods include incorporating the gene to be expressed into a modified retrovirus (Friedmann (1989) supra; Rosenberg (1991) Cancer Research 51(18), suppl.:5074S-5079S); into a non-retroviral vector (Rosenfeld, et al. (1992) Cell, 68:143-155; Rosenfeld, et al. (1991) Science, 252:431-434); or delivering the transgene linked to a heterologous promoter-enhancer element via liposomes (Friedmann (1989), supra; Brigham, et al. (1989) Am. J. Med. Sci., 298:278-281; ​​Nabel, et al. (1990) Science, 249:1285-1288; Hazinski, et al. (1991) Science, 250:1345-1350). al. (1991) Am. J. Resp. Cell Molec. Biol., 4:206-209; and Wang and Huang (1987) Proc. Natl. Acad. Sci. (USA), 84:7851-7855); coupling with a ligand-specific, cation-based transport system (Wu and Wu (1988) J. Biol. Chem., 263:14621-14624) or the use of naked DNA, expression vectors (Nabel et al. (1990), supra); Wolff et al. (1990) Science, 247:1465-1468). Direct injection of transgenes into tissues results in only local expression (Rosenfeld (1992) supra); Rosenfeld et al. (1991) supra; Brigham et al. (1989) supra; Nabel (1990) supra; and Hazinski et al. (1991) supra). The Brigham et al. group (Am. J. Med. Sci. (1989) 298:278-281 and Clinical Research (1991) 39 (Abstract)) reported in vivo transfection of only the lungs of mice following intravenous or intratracheal administration of DNA liposome complexes.Examples of review articles on human gene therapy procedures are: Anderson, Science (1992) 256:808-813; Barteau et al. (2008), Curr Gene Ther; 8(5):313-23; Mueller et al. (2008). Clin Rev Allergy Immunol; 35(3):164-78; Li et al. (2006) Gene Ther., 13(18):1313-9; Simoes et al. (2005) Expert Opin Drug Deliv; 2(2):237-54.

[0179] The antisense oligomers described in the present invention include any pharmaceutically acceptable salts, esters or salts of such esters, or any other compounds, which can (directly or indirectly) provide biologically active metabolites or residues thereof when administered to animals (including humans). Therefore, as an example, the present disclosure also relates to prodrugs and pharmaceutically acceptable salts of the compounds of the present invention, pharmaceutically acceptable salts of such prodrugs and other bioequivalents.

[0180] The term "pharmaceutically acceptable salt" refers to a physiologically and pharmaceutically acceptable salt of the compound of the present invention: that is, a salt that retains the desired biological activity of the parent compound and does not produce undesirable toxicological effects thereon. For oligomers, preferred examples of pharmaceutically acceptable salts include, but are not limited to, (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, such as hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, etc.; (c) salts formed with organic acids, such as acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalene disulfonic acid, polygalacturonic acid, etc.; and (d) salts formed with elemental anions such as chloride, bromide and iodine. The pharmaceutical composition of the present invention can be applied in a variety of ways, depending on whether local treatment or systemic treatment is needed and the area to be treated. Application can be by topical (including eyes and mucous membranes, and rectal administration), pulmonary (for example, by inhalation or blowing into powder or aerosol, including by nebulizer, intratracheal, intranasal, epidermal and transdermal), oral or parenteral routes. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, intraocular or intramuscular injection or infusion; or intracranial, such as intrathecal or intraventricular administration. Oligomers with at least one 2'-O-methoxyethyl modification are considered to be particularly suitable for intraocular administration. Preferably, the antisense oligomer is delivered by an intraocular route.

[0181] The pharmaceutical preparations of the present invention can be conveniently presented in unit dosage form and can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of combining the active ingredient with a pharmaceutical carrier or excipient. Typically, the preparation is prepared by uniformly and closely combining the active ingredient with a liquid carrier or a fine solid carrier or both, and then molding the product if necessary.

[0182] Swiss-type pharmaceutical use

[0183] According to another aspect of the present invention, there is provided a use of one or more antisense oligomers described herein in the preparation of a medicament for regulating or controlling a disease associated with CNOT3 expression.

[0184] The present invention also provides the use of the purified and isolated antisense oligomer as described herein in the preparation of a medicament for treating a disease associated with CNOT3 expression.

[0185] Also provided is the use of a purified and isolated antisense oligomer as described herein in the preparation of a medicament for treating, preventing or ameliorating the effects of a disease associated with CNOT3 expression.

[0186] Preferably, the CNOT3-associated pathology or disease is retinitis pigmentosa.

[0187] According to another aspect of the present invention, the present invention extends to cDNA or cloned copies of the antisense oligomer sequences of the present invention, and vectors comprising the antisense oligomer sequences of the present invention. The present invention further extends to cells containing such sequences and / or vectors.

[0188] Reagent test kit

[0189] Also provided are kits for treating, preventing or ameliorating the effects of a disease associated with CNOT3 expression in a patient, the kits comprising at least one antisense oligomer as described herein, and combinations or mixtures thereof, packaged in a suitable container, and instructions for use thereof.

[0190] In a preferred embodiment, the kit will contain at least one antisense oligomer as described herein or as shown in Table 1, or an antisense oligomer or mixture of antisense oligomers of SEQ ID NOs: 1-74, more preferably SEQ ID NOs: 4, 7, 9, 11, 14, 16-18, 27, 30, 34, 35, 64 and 67, even more preferably SEQ ID NOs: 4, 7, 27, 30, 34 and 64 as described herein. The kit may also contain peripheral reagents, such as buffers, stabilizers, etc.

[0191] Therefore, a kit for treating, preventing or ameliorating a disease or condition associated with CNOT3 expression in a patient is provided, the kit comprising at least one antisense oligomer described herein or shown in Table 1 and a combination or mixture thereof, and instructions for use thereof, packaged in a suitable container.

[0192] Also provided is a kit for treating, preventing or ameliorating a disease or condition associated with CNOT3 expression in a patient, the kit comprising at least one antisense oligomer packaged in a suitable container, which is selected from SEQ ID NO: 1-74, more preferably SEQ ID NO: 4, 7, 9, 11, 14, 16-18, 27, 30, 34, 35, 64 and 67, even more preferably any one or more of SEQ ID NO: 4, 7, 27, 30, 34 and 64, and combinations or mixtures thereof, as well as instructions for use thereof.

[0193] Preferably, the disease or condition is retinitis pigmentosa.

[0194] The contents of the kit may be lyophilized, and the kit may additionally contain a suitable solvent for reconstituting the lyophilized components. The individual components of the kit will be packaged in separate containers, and associated with these containers will be a notice in the form prescribed by a governmental agency regulating the manufacture, use, or sale of drugs or biological products, which notice reflects approval by the agency for manufacture, use, or sale for human administration.

[0195] When the components of the kit are provided in one or more liquid solutions, the liquid solution can be an aqueous solution, such as a sterile aqueous solution. For in vivo use, the expression construct can be formulated into a pharmaceutically acceptable injectable composition. In this case, the container device itself can be an inhaler, syringe, pipette, eye dropper or other similar device, from which the preparation can be applied to the affected area of ​​the animal, such as the lungs, injected into the animal, or even applied to and mixed with other components of the kit.

[0196] In one embodiment, the kit of the present invention comprises a composition comprising a therapeutically effective amount of an antisense oligomer capable of binding to a selected target on a CNOT3 gene transcript to modify mRNA pre-splicing in a CNOT3 gene transcript or a portion thereof. In another embodiment, the formulation is pre-measured, pre-mixed and / or pre-packaged. Preferably, the intraocular solution is sterile.

[0197] Test kit of the present invention can also include instructions designed to promote user compliance. As used herein, instructions refer to any label, insert etc., and can be positioned on one or more surfaces of packaging material, or instructions can be provided on an independent thin sheet, or on its any combination. For example, in one embodiment, test kit of the present invention includes instructions for managing preparation of the present invention. In one embodiment, instructions show that preparation of the present invention is applicable to the treatment of retinitis pigmentosa. Such instructions can also include the explanation of dosage, and by topical delivery to eyes or by the explanation of intraocular injection administration.

[0198] Antisense oligomers and suitable excipients can be packaged separately so that practitioners or users can prepare pharmaceutically acceptable compositions as needed. Alternatively, antisense oligomers and suitable excipients can be packaged together, thereby requiring a physician or user to perform micro-preparation. In any case, the packaging should maintain the active ingredients of chemical, physical and aesthetic integrity.

[0199] General

[0200] Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. The invention includes all such variations and modifications. The invention also includes all steps, features, formulations and compounds mentioned or indicated in the specification, either individually or collectively, and any and all combinations or any two or more steps or features.

[0201] Each document, reference, patent application or patent cited in this article is expressly incorporated herein in its entirety by reference, which means that it should be read by the reader and considered as a part of this article. The documents, references, patent applications or patents cited in this article are not repeated in this article just for simplicity.

[0202] Any manufacturer's instructions, descriptions, product specifications, and products for any products mentioned herein, or any products in any literature cited herein, are incorporated herein by reference and may be used in the practice of the present invention.

[0203] The present invention is not limited to the scope of any specific embodiment described herein. These examples are for illustrative purposes only. Functionally equivalent products, formulations and methods are clearly within the scope of the invention described herein.

[0204] The invention described herein may include one or more ranges of values ​​(e.g., size, displacement, and field strength, etc.). The range of values ​​will be understood to include all values ​​within the range, including the values ​​defining the range, and the values ​​adjacent to the range, which result in the same or substantially the same result as the values ​​immediately adjacent to the values ​​defining the boundaries of the range. Therefore, unless otherwise indicated, the numerical parameters set forth in this specification and claims are approximate values, which may vary according to the desired properties sought to be obtained by the present invention. Therefore, "about 80%" means "about 80%" as well as "80%". At least, each numerical parameter should be interpreted according to the number of significant figures and ordinary rounding methods.

[0205] In this specification, unless the context requires otherwise, the word "comprise" or variations such as "comprises" or "comprising" will be understood to imply the inclusion of a specified integer or group of integers but not the exclusion of any other integer or group of integers. It is also noted that in this disclosure, particularly in the claims and / or paragraphs, terms such as "comprises", "comprised", "comprising", etc. may have the meanings ascribed to them in U.S. patent law; for example, they may mean "includes", "included", "including", etc.; and terms such as "consisting essentially of" and "consists essentially of" have the meanings ascribed to them in U.S. patent law, for example, they allow elements not expressly recited but exclude elements found in the prior art or that affect the basic or novel characteristics of the invention.

[0206] Other definitions of selected terms used herein can be found in the detailed description of the present invention and apply throughout the entire text. Unless otherwise defined, all other scientific and technical terms used herein have the same meanings as those of ordinary skill in the art to which the present invention belongs. The term "active agent" may refer to one active agent, or may encompass two or more active agents.

[0207] The sequence identification numbers ("SEQ ID NO:") containing the nucleotide and amino acid sequence information in this specification are collected at the end of the specification and prepared using the program PatentIn Version 3.0. Each nucleotide or amino acid sequence is indicated in the sequence listing by a numerical indicator. <210> This is followed by a sequence identifier (e.g. <210> 1. <210> 2, etc. The length, sequence type, and source organism of each nucleotide or amino acid sequence are indicated by a number. <211> , <212> and <213> The nucleotide and amino acid sequences mentioned in this specification are indicated by numbers in the field <400> , followed by a sequence identifier (e.g. <400> 1. <400> 2, etc.).

[0208] A nomenclature system for antisense oligomers has been proposed and published to distinguish different antisense oligomers (see Mann et al., (2002) J Gen Med 4, 644-654). This nomenclature becomes particularly relevant when testing several slightly different antisense oligomers, all directed against the same target region, as shown below:

[0209] H#A / D(x:y)

[0210] The first letter indicates the species (e.g., H: human, M: mouse)

[0211] “#” indicates the target exon number

[0212] "A / D" indicates the acceptor or donor splice sites located at the beginning and end of the exon, respectively

[0213] (x, y) represents the annealing coordinates, where "-" or "+" represents the intron or exon sequence, respectively. For example, A(-6+18) represents the last 6 bases of the intron before the target exon and the first 18 bases of the target exon. The closest splice site is the acceptor, so these coordinates are preceded by "A". The annealing coordinates describing the donor splice site can be D(+2-18), where the last 2 exon bases and the first 18 intron bases correspond to the annealing sites of the antisense oligomer. The complete exon annealing coordinates will be represented by A(+65+85), that is, the site between the 65th and 85th nucleotides (including the end values) from the beginning of the exon.

[0214] The following examples are used to more fully describe the manner of using the above invention, and to illustrate the best mode for implementing various aspects of the invention. It should be understood that these methods are by no means intended to limit the true scope of the invention, but are presented for illustrative purposes. Example

[0215] Example 1

[0216] AO mediates exon skipping to induce frameshift of CNOT3

[0217] The exon structure of CNOT3 is as follows Figure 1 Design of splice switching AO to target enhancer sites within frameshift exons in CNOT3 mRNA precursor ( Figure 1 ) to induce exon skipping, resulting in loss of the open reading frame and knockdown of CNOT3.

[0218] Normal human fibroblasts and fibroblasts from RP11 patients (PRPF31c.1205C>ASer402*) were obtained from skin biopsies and cultured in DMEM supplemented with 10% FBS. Antisense sequences synthesized in-house as 2'O-methyl phosphorothioate oligomers (Table 1) were transfected into fibroblasts in 24-well plates as lipid complexes using Lipofectamine3000 (Life Technologies) according to the manufacturer's instructions. Sequences that effectively altered target exon selection were then synthesized as phosphorodiamidate morpholino oligomers (PMOs) and transfected into fibroblasts in the following ways: as i) uncomplexed, ii) annealed with sense ODN strips (ODN leash) and delivered with Lipofectamine 3000 (as above), or iii) nuclear transfection using P2 primary cell 4-D NucleofectorX kit S (Lonza) according to the manufacturer's instructions.

[0219] Total RNA was extracted from transfected and control cells using the MagMax RNA extraction system (Life Technologies). Transcripts of interest were first evaluated by semiquantitative RT-PCR and then by qRT-PCR. cDNA (RNA 300 ng) was synthesized using the SuperScript IV Reverse Transcriptase Kit (Life Technologies) according to the manufacturer's instructions. RT-PCR was performed using LA Taq DNA polymerase and GC buffer I (TAKARA) according to the manufacturer's instructions.

[0220] Three different primer sets were used to assess CNOT3 transcripts after transfection of cells with CNOT3 exon skipping AO:

[0221] 1. For AO targeting exon 3, a forward primer annealing to exon 2 was paired with a reverse primer in exon 6.

[0222] 2. For AO targeting exons 8 and 9, the forward primer in exon 7 was paired with the exon 11 reverse primer.

[0223] 3. For AO targeting exons 16 and 17, the forward primer in exon 15 was paired with the reverse primer in exon 18.

[0224] qRT-PCR was used to quantify the transcript levels of PRPF31 after transfection with CNOT3 exon skipping AO. A forward primer across the junction of PRPF31 exons 2 and 3 was paired with a reverse primer across the junction of exons 3 and 4 (Table 2). Results from all CNOT3 AO-treated cells were normalized to the expression of two housekeeping genes, TBP and GAPDH, and compared to cells treated with anti-ISS-N1 and sham AO to calculate the fold change of PRPF31 transcripts.

[0225] Table 2: RT-PCR and qRT-PCR primers for CNOT3, PRPF31 and the housekeeping genes TBP and GAPDH.

[0226]

[0227]

[0228] The induced (smaller) CNOT3 transcripts were sequenced, and predictions of the results from induced exon skipping indicated that AO 3697 and 3698 mediated exon 3 skipping, AO 3702 mediated partial and complete skipping of exon 8, and AO3703 mediated dose-dependent exon 8 skipping (data not shown). AOs that effectively mediated CNOT3 exon 3, 8, or 9 skipping were then transfected into RP patient fibroblasts for 48 hours, and CNOT3 transcripts were analyzed by RT-PCR (Figure 2). 48 hours after transfection, CNOT3 exon skipping was obvious, and the level of full-length transcripts decreased. Exon 3 was excluded by AO 3697, exon 8 was skipped by AO3702 and 3703, and exon 9 was skipped by AO 3706.

[0229] It has been previously shown that phosphorodiamidate morpholino (PMO) chemistry mediates splicing modifications more efficiently than the same sequence synthesized as 2'O-methyl PS chemistry. Therefore, the most promising AO sequences for CNOT3 transcript knockdown will be synthesized as PMOs and transfected into normal fibroblasts either uncomplexed, using leash / lipid complexes, or by nucleofection (Nucleofector, Lonza). Evaluation and optimization of AO sequences targeting CNOT3 are ongoing.

[0230] SH-SY5Y cells are commonly used as an in vitro model of neuronal function and differentiation. They are of an adrenergic phenotype but also express dopaminergic markers. The ability of AO, which modifies CNOT3 transcripts in fibroblasts, to downregulate CNOT3 and increase PRPF31 expression (transcript and protein) will be assessed in differentiated SH-SY5Y cells.

[0231] Example 2

[0232] AO mediates terminal intron retention to knockdown CNOT3

[0233] The antisense sequence was designed to target the CNOT3 terminal exon to induce retention of the CNOT3 terminal intron and knockdown of CNOT3.

[0234] AdRP11 patient fibroblasts were transfected with 2'O-methyl AO targeting the terminal exon of CNOT3 for 48 h. RT-PCR analysis of CNOT3 transcripts showed that AO 3887, 3888, and 3889 (Table 1) induced retention of the terminal intron and decreased levels of the full-length transcript in a dose-dependent manner ( Figure 3 ).

[0235] Example 3

[0236] Recruitment and screening of families with RP

[0237] PRPF31 mutations were detected in 3 generations in 2 families from WA (1 Caucasian and 1 Aboriginal) (Figure 4). Dermal fibroblasts were obtained from 7 patients and monitoring for disease progression was initiated in 10 of the 24 affected individuals in these families.

[0238] Table 3: Identified RP11-causing mutations and the corresponding number of patients with each confirmed mutation (information from the Australian Inherited Retinal Disease Registry as of 2018).

[0239] mutation Protein changes Phenotype Number of people affected (status) PRPF31.1205C>A Ser402* Dominant RP 9(WA) PRPF31.267delA Glu89Aspfs Dominant RP 8(WA,Vic) PRPF31.527+3A>G N / A:SPLICE Dominant RP 3(NSW) PRPF31.319C>G Leu107Val Dominant RP 1(SA) PRPF31.527+1G>T N / A:SPLICE Dominant RP 1(WA) PRPF31.1289_1290insA X Dominant RP 1(SA)

[0240] Example 4

[0241] Generation of induced pluripotent stem cells from RP11 patient and control fibroblasts and evaluation of the effects of CNOT3 knockdown Gene expression

[0242] Induced pluripotent stem cells will be generated from patient and control fibroblasts. Electroporation system, using reprogrammed episomes In a typical reprogramming experiment, 12-15 iPSC-like clones were harvested 3-4 weeks after transfection and subcultured to assess pluripotency gene expression by immunostaining and RT-PCR analysis ( Figure 5AC). Three clones were then selected for additional testing including gene expression profiling by TaqMan arrays (Human Stem Cell Pluripotency Array, ThermoFisher) and virtual karyotyping by chromosome G-banding analysis using QuantiSNP analysis (AGRF).

[0243] To demonstrate trilineage differentiation potential, iPSCs were cultured as embryoid bodies for 2-4 weeks and assayed by RT-PCR for the expression of ectoderm, mesoderm, and endoderm differentiation markers, as well as downregulation of pluripotency markers ( Figure 5 C). iPSCs were differentiated into retinal organoids using the protocol published by CIF (Mellough et al., Efficient stage-specific differentiation of human pluripotent stem cells toward retinal photoreceptor cells. Stem Cells, 2012. 30(4): p. 673-86.) Figure 5 DH).

[0244] Differentiated cells were transfected with lead CNOT3-targeting AOs synthesized as morpholino compounds, and each analysis was performed in triplicate.

[0245] Analysis of CNOT3, PRPF31, and other splicing factor transcripts CNOT3, PRPF31, and selected paraspeckle proteins and splicing factors were assessed by Western blotting and immunofluorescence to reflect the integrity of splicing machinery and pathways.

[0246] Example 5

[0247] Dose dependence test of AO

[0248] AO sequences were designed to skip selected exons of CNOT3 messenger RNA and transfected into fibroblasts in the form of 2'O-methyl phosphorothioate AO after complexing with cationic liposomes to obtain efficient transfection. The skipping of the target exon resulted in a shortened messenger RNA RT-PCR product, which was identified by separation and staining of the product on a 2% agarose gel (Figures 6 and 7).

[0249] Preferred sequences showed dose-dependent target exon skipping.The leader sequences were then synthesized as phosphorodiamidate morpholino oligomers (PPMOs) for testing by transfection into patient fibroblasts.

[0250] PRPF31 levels in RP11 patients are approximately 50% of those in healthy people. The messenger RNA of CNOT3 and PRPF31 was quantified by reverse transcription quantitative PCR (qRT-PCR) in RP11 family members and healthy controls. Figure 8a showed that in heterozygous PRPF31 mutation carriers, higher CNOT3 expression was associated with PRPF31 reduction and clinical outcomes. Targeted CNOT3 exon skipping was determined by qRT-PCR ( Figure 8b , 8c) were evaluated, and PRPF31 expression after AO treatment was shown relative to expression in cells treated with a control AO sequence (control AO25nM transfection value set to 1), which does not target any region of the healthy human genome (no expected effect - negative control). Data from untreated cells are included for comparison.

[0251] RP11 patients have PRPF31 levels that are approximately 50% of healthy people, whereas asymptomatic PRPF31 mutation carriers have levels that are at least 70% or higher of healthy levels. A 1.5-fold increase in PRPF31 expression (e.g. Figure 8b CNOT3 exon 3 or 10 skipping, and Figure 8c CNOT3 exon 9, 16, or 17 skipping rescued splicing function in RP11 retinal pigment epithelial cells.

[0252] Example 6

[0253] Antisense oligomer-mediated CNOT3 exon skipping upregulates RP11 patient iPSC-derived retinal pigment epithelial cells Expression of PRPF31 in RPE cells rescues primary cilia length and number

[0254] ASO6 (SEQ ID NO: 64, CNOT3_H17A (+83+107), targeting CNOT3 exon 17) was synthesized as a phosphorodiamidate morpholino oligomer (PMO) and transfected into RP11 iPSC-derived RPE by direct transfection using 5 uM of ASO.

[0255] Immunocytochemistry was used to immunostain cilia and basal bodies of wild-type and RP11 RPE treated or not with translation oligomers.

[0256] Cilia immunostaining protocol

[0257] RPE cells on slides were fixed with ice-cold acetone-methanol (1:1) for 4 min and then air-dried. Cells were blocked in PBS containing 10% filtered goat serum for 30 min. For basal body staining, cells were incubated with mouse anti-pericentriolin antibody (1:100) for 1 h at room temperature. Primary antibodies were detected with AlexaFluoro488 anti-mouse (1:400). For cilia staining, cells were incubated with rabbit anti-ARL13B antibody (1:500) at 4°C overnight. Secondary antibodies were detected with AlexaFluoro568 anti-rabbit (1:400) for 1 h at room temperature and counterstained with Hoechst to detect nuclei (dilution 1:125). Coverslips were mounted on slides with Prolong Gold Antifade Medium.

[0258] Confocal analysis and quantification

[0259] The function of PRPF31 was assessed by examining the primary cilia of the RPE using confocal microscopy. The cilia length of approximately 300 RPE cells / sample was measured using NIS Original Imaging software. Sequence Listing <110> Vision Pharmaceuticals Pte Ltd <120> New treatment for retinitis pigmentosa <130> http: / / WRA-110.US <140> US 17 / 614495 <141> 2021-11-26 <150> PCT / AU20 / 50516 <151> 2020-05-25 <150> AU 2019901804 <151> 2019-05-27 <150> AU 2019903812 <151> 2019-10-10 <160> 89 <170> PatentIn Version 3.5 <210> 1 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 1 acucucuugg agacggacgcugcua 25 <210> 2 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 2 aucuucccugcccuacagacgcacu 25 <210> 3 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 3 guaccuuggaguuugcgcuuguccg 25 <210> 4 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 4 cggacaccuu cuugaggcag cgauc 25 <210> 5 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 5 gccaaauauc uucaaacugc uccac 25 <210> 6 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 6 uuggcugcau uguggagcug aggga 25 <210> 7 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 7 cuuuucuuuc ugguucgcgu uggcu 25 <210> 8 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 8 aucuccuucu uuaggucagccucau 25 <210> 9 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 9 cagccccccuc acuuguagcu ucuua 25 <210> 10 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 10 uuuggucccu cagccgcugc agaug 25 <210> 11 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 11 cugccucuug uccuugaucu cguug 25 <210> 12 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 12 uugcgguugu cuaaagcug ccucu 25 <210> 13 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 13 cugggcuccu accgucucaa ugagc 25 <210> 14 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 14 acuuugaaccguuccauuugcugua 25 <210> 15 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 15 ggucucucguuccacaacuuugaac 25 <210> 16 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 16 ccucuuugcuguaagcuuugguuuu 25 <210> 17 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 17 accucuuccuucuccuucugggcag 25 <210> 18 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 18 cccaacucac cgugagccac uggcc 25 <210> 19 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 19 ugagcguguc gaugguauuc uaggg 25 <210> 20 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 20 caaacugguc caccugcaug uugag 25 <210> twenty one <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> twenty one cccuucuucu ugcgugucug cacug 25 <210> twenty two <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> twenty two ccucacucac auccuugucg cccuu 25 <210> twenty three <211> 25 <212> DNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> twenty three ccgcttcaag ccctcgccca gggcc 25 <210> twenty four <211> twenty four <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> twenty four gugguagcgg ugcuucucga ugug 24 <210> 25 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 25 uggucucuag caugcgcacg uggua 25 <210> 26 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 26 ggcgucaacg aggauggagu cauug 25 <210> 27 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 27 cuccucgaag ucgggguccu gggau 25 <210> 28 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 28 guggcgacca gcgccugugcugugg 25 <210> 29 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 29 cucauccucc auguggcugu ggcug 25 <210> 30 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 30 gggcgugcug cuggacuggu ugaag 25 <210> 31 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 31 ggcugggcug ggcggggaugg gagag 25 <210> 32 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 32 gugcugcugg acugguugaa gaucu 25 <210> 33 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 33 aucuucagag uuuuccugag guagg 25 <210> 34 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 34 cuguggaacguccccucuucuuauc 25 <210> 35 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 35 ucacacccac cuggcugacu ucacu 25 <210> 36 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 36 aggugggcgg cacagcuggg gacug 25 <210> 37 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 37 gagggguagg ugggcggcac agcug 25 <210> 38 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 38 gcagcaggcg gggggccgga ggggu 25 <210> 39 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 39 ccguuuuugg cuggagacug cgggu 25 <210> 40 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 40 guggcuggga gcuggacugg ccuug 25 <210> 41 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 41 cugucugcca caacugagcuguaac 25 <210> 42 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 42 ggguugugggggccggaaggggggc 25 <210> 43 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 43 acucacgagg ugcugggagg ugggu 25 <210> 44 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 44 ugccgcacug gguuccuucc uggag 25 <210> 45 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 45 uguucccuga gccuggggcc acgcc 25 <210> 46 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 46 gaggauucac aggcaguggc accag 25 <210> 47 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 47 cucagaggcu caggggccug gggag 25 <210> 48 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 48 aggguccuca augccagagc ugaug 25 <210> 49 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 49 gcauguggug ccaggcggcc ucuuc 25 <210> 50 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 50 gaggggugag gcauguggug ccagg 25 <210> 51 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 51 cgaauacgcu cagagucaga ggggu 25 <210> 52 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 52 gcucaggaug augucugugg ggagg 25 <210> 53 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 53 aggugcugau guacugcuca ggaug 25 <210> 54 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 54 ccucugacag cugcaggggc ggcug 25 <210> 55 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 55 ccauggacag acacccagcg acagc 25 <210> 56 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 56 agagcugcuccuuggugaggggcac 25 <210> 57 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 57 agucagaggg gugaggcaug uggug 25 <210> 58 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 58 gggggaggua cugccuguga gagca 25 <210> 59 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 59 gguggcaucu ggugguggua gg 22 <210> 60 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 60 cuccagauag uagaagauga agaag 25 <210> 61 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 61 gccaugacug cuucuuuagg gccuu 25 <210> 62 <400> 62 000 <210> 63 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 63 gaaccacauc auguacuugg ugugg 25 <210> 64 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 64 auggucuugg gcuccucgug ccucu 25 <210> 65 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 65 cuugggcucc ucgugccucu ggaac 25 <210> 66 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 66 cagugauggucuugggcuccucgug 25 <210> 67 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 67 cugcucaaac ucgucaguga ugguc 25 <210> 68 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 68 guagauguag gugcccuggc cgggg 25 <210> 69 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 69 gcuggcccca cuucucguag ucaaa 25 <210> 70 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 70 ucaaagguga agccuuccuu cuucc 25 <210> 71 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 71 gucccggucc uccagguagc gguac 25 <210> 72 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 72 ggggaggugg cgaccagcgc cugu 25 <210> 73 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 73 ucucgugcc ucuggaacca cauca 25 <210> 74 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Antisense Oligonucleotides <400> 74 gggcccucac cugcucaaac ucguc 25 <210> 75 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Primers <400> 75 gaagatggcg gacaagcgca a 21 <210> 76 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Primers <400> 76 ctggccaacc tcttccttct c 21 <210> 77 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 77 ctgtcagtgc agacacgcaa 20 <210> 78 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 78 ggacaggctg gagccgttt 19 <210> 79 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Primers <400> 79 catcctgagc agtacatcag c 21 <210> 80 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 80 ctccaggtag cggtactcaa 20 <210> 81 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Primers <400> 81 gggatagtaa gatgtttgct gag 23 <210> 82 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Primers <400> 82 gtcccatcac ttctgaagct ttgg 24 <210> 83 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Primers <400> 83 tcaggcgttc ggtggatcga gt 22 <210> 84 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Primers <400> 84 agtgatgctg ggcactgcgg agaa 24 <210> 85 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 85 acagtcagcc gcatcttctt 20 <210> 86 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 86 aggggtctac atggcaactg 20 <210> 87 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Primers <400> 87 gacgttccac agacagtgaa g 21 <210> 88 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Primers <400> 88 gtggtagcgg tgcttctcga tg 22 <210> 89 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 89 tatattcggg actcggggg 19

Claims

1. An isolated or purified antisense oligomer for modifying pre-mRNA splicing in a CNOT3 gene transcript or a portion thereof, wherein the antisense oligomer is selected from the list consisting of SEQ ID NO: 4, 7-9, 11, 14-18, 26, 27, 30-35, 39, 40, 44-48, 53-57, 59, 60, 64, 67, 69, 70 and 72-74.

2. The antisense oligomer according to claim 1, wherein the sequence of the antisense oligomer is selected from SEQ ID NO: 4, 7, 9, 11, 15, 16-18, 27, 30, 34, 35 and 64.

3. The antisense oligomer according to claim 1, wherein the sequence of the antisense oligomer is selected from SEQ ID NO: 4, 7, 27, 30, 34 and 64.

4. The antisense oligomer of claim 1, comprising one or more nucleotide positions having alternative chemistries or modifications selected from: (i) modified backbone structures; (ii) modified sugar moieties; (iii) resistance to RNase H; and (iv) oligomer mimetic chemistry.

5. The antisense oligomer of claim 1, wherein the antisense oligomer further comprises: (i) a chemical conjugation moiety; or (ii) a cell penetrating peptide. The antisense oligomer of claim 1 , wherein the antisense oligomer is a phosphorodiamidate morpholino oligomer.

7. The antisense oligomer according to claim 1, wherein any uracil (U) in the nucleotide sequence is substituted with thymine (T).

8. The antisense oligomer of claim 1, wherein the antisense oligomer increases the expression of PRPF31 protein in a subject having a symptomatic PRPF31 mutation by 1.5 to 5 fold.

9. A pharmaceutical composition comprising: a) one or more antisense oligomers according to any one of claims 1 to 8, and b) one or more pharmaceutically acceptable carriers or diluents.

10. Use of one or more antisense oligomers according to any one of claims 1 to 8 in the preparation of a medicament for treating or preventing retinitis pigmentosa.

11. The use according to claim 10, wherein the medicament is for the treatment of a human subject.

Images