Gene editing system for modifying SCN9A or SCN10A gene and method of using the same

Abstract

Disclosed herein is an efficient gene editing system for editing voltage-gated sodium channel genes in vitro or in vivo, such as sodium voltage-gated channel alpha subunit 9 (SCN9A) or sodium voltage-gated channel alpha subunit 10 (SCN10A). The gene editing system disclosed herein comprises an RNA-guided DNA endonuclease and a specific guide RNA. Also provided herein is the use of a gene editing system to modify a target gene, thereby alleviating pain.

Description

[0001] Related Applications

[0002] This application claims the benefit of U.S. Provisional Application No. 62 / 833,523, filed on April 12, 2019, under 35 U.S.C. §119(e), the entire contents of which are incorporated herein by reference. Background Art

[0003] Gene editing (including genome editing) is a type of genetic engineering in which one or more nucleotides / nucleic acids are inserted, deleted / or replaced in a DNA sequence, for example, in the genome of a targeted cell. The gene editing strategy using RNA-guided endonucleases (e.g., Cas9) recently has enabled site-specific DNA modification; however, it has been found that not all RNA-guided endonucleases guide RNA pairs are efficiently edited. Therefore, there is still an urgent need to identify effective RNA-guided endonucleases guide RNA pairs that effectively modify the gene of interest. Summary of the invention

[0004] The present disclosure is based at least in part on the development of an effective gene editing system for modifying voltage-gated sodium channel genes, such as sodium voltage-gated channel alpha subunit 9 (SCN9A) or sodium voltage-gated channel alpha subunit 10 (SCN10A). In some embodiments, the gene editing system relies on the identification of effective RNA-guided nucleases and guide RNA pairs (e.g., those disclosed herein) for effectively modifying voltage-gated sodium channel genes with low off-target incidence.

[0005] Thus, in some aspects, the present disclosure relates to a gene editing system for modifying a voltage-gated sodium channel gene, such as SCN9A or SCN10A. Such a gene editing system may comprise: (a) a first polynucleotide portion comprising a first nucleotide sequence encoding an RNA-guided DNA endonuclease, or an RNA-guided DNA endonuclease; and (b) a second polynucleotide portion comprising a second nucleotide sequence encoding a guide RNA (gRNA).

[0006] In some embodiments, the gene editing system can modify the SCN9A gene and comprises: (a) a first polynucleotide portion comprising a first nucleotide sequence encoding an RNA-guided DNA endonuclease, or an RNA-guided DNA endonuclease; and (b) a second polynucleotide portion comprising a second nucleotide sequence encoding a guide RNA (gRNA), wherein the gRNA comprises a nucleotide sequence of any one of SEQ ID NO: 1-20. As used herein, a polynucleotide portion can be an independent nucleic acid molecule. Alternatively, a polynucleotide portion can be a portion of a nucleic acid molecule that can contain one or more additional polynucleotide portions.

[0007] The RNA-guided endonuclease of this gene editing system can be Staphylococcus pyogenes (SpCas9), which can be paired with a gRNA comprising a nucleotide sequence of any one of SEQ ID NOs: 1-10. Alternatively or additionally, the RNA-guided endonuclease of this gene editing system can be Staphylococcus aureus Cas9 (SaCas9), which can be paired with a gRNA comprising a nucleotide sequence of any one of SEQ ID NOs: 11-20.

[0008] In some embodiments, the gene editing system can modify the SCN10A gene and comprises: (a) a first polynucleotide portion comprising a first nucleotide sequence encoding an RNA-guided DNA endonuclease, or an RNA-guided DNA endonuclease; and (b) a second polynucleotide portion comprising a second nucleotide sequence encoding a guide RNA (gRNA), wherein the gRNA comprises the nucleotide sequence of any one of SEQ ID NOs: 21-40. The RNA-guided endonuclease of such a gene editing system can be SpCas9, which can be paired with a gRNA comprising a nucleotide sequence of any one of SEQ ID NOs: 21-30. Alternatively or additionally, the RNA-guided endonuclease of such a gene editing system can be SaCas9, which can be paired with a gRNA comprising a nucleotide sequence of any one of SEQ ID NOs: 31-40.

[0009] In some embodiments, the first nucleotide sequence encoding the RNA-guided DNA endonuclease in (a) may further comprise a nucleotide sequence encoding a nuclear localization signal (NLS), which is fused in frame to the RNA-guided DNA endonuclease. In some embodiments, the NLS is SV40 NLS.

[0010] In some embodiments, the second nucleotide sequence in (b) may further comprise a scaffold sequence. In some instances, the scaffold sequence may be recognized by SaCas9. Such a scaffold sequence may comprise the nucleotide sequence GUUUUAGUACUCUGGAAACAGAAUCUACUAAAACAAGGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAUUUU (SEQ ID NO: 41). In other instances, the scaffold sequence may be recognized by SpCas9. It should be understood that since the second nucleotide sequence encoding the gRNA may be a DNA sequence or an RNA sequence, any uracil (U) in this sequence may be replaced by thymine (T).

[0011] In some embodiments, the first polynucleotide portion of (a) and the second polynucleotide portion of (b) are different polynucleotides, at least one of which can be a vector. The vector can be a viral vector, such as an adeno-associated virus (AAV) vector. In some embodiments, the first polynucleotide portion of (a) and the second polynucleotide portion of (b) are different AAV vectors.

[0012] In some embodiments, a single polynucleotide comprises a first polynucleotide portion of (a) and a second polynucleotide portion of (b). The single polynucleotide can be a vector, which can be a viral vector, such as an AAV vector. In some embodiments, the AAV is AAV1.

[0013] Also within the scope of the present disclosure are nucleic acids and viral particles or sets of viral particles that collectively comprise any gene editing system disclosed herein. In some embodiments, the viral particle or set of viral particles is one or more AAV particles.

[0014] In other aspects, the present disclosure relates to a method for editing a voltage-gated sodium channel gene, such as SCN9A or SCN10A, comprising contacting a cell with: (i) any gene editing system disclosed herein; (ii) a nucleic acid comprising the gene editing system; or (iii) a viral particle or a group of viral particles that collectively comprise the gene editing system.

[0015] In some embodiments, the contacting step is performed by administering the gene editing system of (a), the nucleic acid of (b), or one or more viral particles of (c) to a subject in need thereof. In some embodiments, the subject is a human patient suffering from pain.

[0016] In some embodiments, the cell is an autologous cell. Alternatively, the cell may be a heterologous cell. In some embodiments, the cell is a stem cell, such as an iPSC cell or a mesenchymal stem cell. In some examples, the method may further include administering a cell having an edited gene to a subject in need (e.g., a human patient suffering from pain).

[0017] Also within the scope of the present disclosure is the use of any gene editing system or components thereof described herein for treating pain, as well as its use in the manufacture of a medicament for an intended medical treatment.

[0018] The details of one or more embodiments of the present disclosure are set forth in the description below. Other features or advantages of the present disclosure will be apparent from the detailed description of several embodiments and the appended claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The following drawings constitute part of this specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by referring to one or more of these drawings in conjunction with the detailed description of specific embodiments presented herein. It should be understood that the data illustrated in the drawings in no way limit the scope of the present disclosure.

[0020] Figures 1A-1D The target editing efficiency of 40 prioritized gRNAs in different cell models is depicted. The prioritized gRNAs include: Figure 1A ) Ten gRNAs for SpCas9 targeting SCN9A, ( Figure 1B ) Ten gRNAs targeting SpCas9 of SCN10A, ( Figure 1C ) Ten gRNAs for SaCas9 targeting SCN9A, and ( Figure 1D ) Ten gRNAs targeting SaCas9 of SCN10A. These gRNAs were screened in iPSCs, iPSCs stably expressing Cas9, and sensory neurons derived from iPSCs. Values ​​represent mean ± standard deviation. DETAILED DESCRIPTION

[0021] Gene editing (including genome editing) is a type of genetic engineering, wherein one or more nucleotides / nucleic acids are inserted, deleted / or replaced in a DNA sequence, for example, in the genome of a targeted cell. Targeted gene editing can insert, delete and / or replace at a preselected site in the genome of a targeted cell (for example, in a targeted gene or a targeted DNA sequence). When, for example, the sequence of an endogenous gene is edited by the deletion, insertion or replacement of one or more nucleotides / nucleic acids, the endogenous gene comprising the affected sequence may be knocked out or knocked down due to sequence variation. Therefore, targeted editing can be used to destroy endogenous gene expression. Alternatively or in addition, the desired nucleic acid can be inserted into a target site in a DNA sequence (for example, in an endogenous gene), referred to as targeted integration. "Targeted integration" refers to the process of involving the insertion of one or more exogenous sequences, and lacking or not lacking an endogenous sequence at the insertion site. When there is a donor template containing an exogenous sequence, targeted integration can be facilitated by targeted gene editing.

[0022] The present disclosure is based at least in part on the development of an effective gene editing system for modifying voltage-gated sodium channel genes, such as sodium voltage-gated channel alpha subunit 9 (SCN9A) or sodium voltage-gated channel alpha subunit 10 (SCN10A). Sodium channels are integral membrane proteins that form ion channels through cell membranes. Voltage-gated sodium channels are sodium channels that "open" (i.e., allow sodium ions to flow through the channel) in response to voltage changes. The alpha subunits of the sodium channels form the core of the channel and function independently (i.e., in the absence of any corresponding beta subunits or other auxiliary proteins). There are nine members of the sodium voltage-gated channel family. The alpha subunits of these channels are Na v 1.1、Na v 1.2 Na v 1.3 Na v 1.4 Na v 1.5 Na v 1.6 Na v 1.7 Na v 1.8 and Na v 1.9, encoded by SCN1A, SCN2A, SCN3A, SCN4A, SCN5A, SCN8A, SCN9A, SCN10A and SCN11A respectively.

[0023] Na v 1.7 (encoded by SCN9A) is expressed, for example, in dorsal root ganglia, trigeminal ganglia, and sympathetic ganglion neurons. v 1.8 (encoded by SCN10A) is expressed, for example, in the dorsal root ganglia, in unmyelinated small-diameter sensory neurons called C fibers. v 1.7 and Na v1.8 Both are involved in nociception (ie, the sensory mechanisms that provide the signals that lead to the sensation of pain).

[0024] Editing the SCN9A and / or SCN10A genes using any of the methods described herein can be used to treat, prevent and / or alleviate the symptoms of diseases and disorders such as, but not limited to, congenital insensitivity to pain, anosmia, as if personality, borderline personality disorder, breast malignancy, non-small cell lung cancer, cold intolerance, febrile seizures, Diabetes, Diabetes Mellitus, dissociative disorders, epilepsy, erythromelalgia, primary erythromelalgia, facial pain, herpesvirus infection, hereditary sensory autonomic neuropathy type 5, hyperplasia, neuralgia, hereditary sensory and autonomic neuropathy, degenerative polyarthritis, pain, limb pain, postoperative pain, Parkinson's disease, Disease), postherpetic neuralgia, prostate tumors, pruritus, seizures, somatoform disorders, tobacco use disorders, trigeminal neuralgia, synovial cysts, chronic pain, acute-onset pain, paramyotonia congenita (disorder), malaise, sensory discomfort, burning pain, pain indifference, inflammatory pain, mechanical pain, scalp pain, hereditary motor and sensory neuropathy type II, common migraine, anesthesia, prostate malignancy, pain disorders, knee osteoarthritis, neuropathy, complex regional pain syndrome, tonic-clonic seizures, hereditary neuropathy, prostate cancer, breast cancer, severe myoclonic seizures in infancy, myxoid cysts, channelopathy, paroxysmal extreme pain disorder, painful neuropathy, compression neuropathy, autosomal recessive congenital pain indifference, generalized epilepsy with febrile seizures plus type 2, generalized epilepsy with febrile seizures plus 7, familial febrile seizures 3B, and small fiber neuropathy (adult-onset form is called small fiber neuropathy).

[0025] Mutations in the known SCN9A gene can lead to pain perception disorders, including primary erythromelalgia, paroxysmal extreme pain disorder, congenital pain insensitivity and small fiber neuropathy. Functional gain mutations in the SCN9A gene lead to spontaneous pain, as observed in primary erythromelalgia and paroxysmal extreme pain disorder. Therefore, knockout or knocking out of the SCN9A gene in patients suffering from primary erythromelalgia or paroxysmal pain disorder can be used to treat, prevent and / or alleviate related symptoms.

[0026] Primary erythromelalgia is a rare, autosomal dominant disorder characterized by burning pain in the feet and hands in response to heat and movement. Affected individuals typically develop signs and symptoms in early childhood, but in milder cases, symptoms may appear later in life. Management of this condition is primarily symptomatic. In addition to avoiding pain triggers such as heat, exercise, and alcohol, treatment options include cooling and elevation of the limb, use of anesthetics such as lidocaine and mexilitine, and, in extreme cases, opioids.

[0027] Paroxysmal extreme pain disorder is another rare condition characterized by severe paroxysmal pain in the rectum, eyes, and jaw areas and redness of the skin. The symptoms of this condition often begin in the neonatal period or early childhood and may remain throughout life. Agents used to treat chronic neuropathic pain disorders are often used to alleviate the pain attacks caused by the disease. The sodium channel blocker carbamazepine has been shown to be the most effective of these treatments.

[0028] Mutations in the SCN10A gene are also known to cause pain perception disorders, including familial episodic pain syndrome type 2 and small fiber neuropathy. Therefore, knockout or knockdown of the SCN10A gene in patients with familial episodic pain syndrome type 2 or small fiber neuropathy can be used to treat, prevent and / or alleviate the associated symptoms.

[0029] Familial episodic pain syndrome type 2 is a rare autosomal dominant neurological disorder characterized by adult-onset paroxysmal pain in the foot area. Attacks are generally triggered by heat, cold, chemicals, and certain surfaces. Patients may also develop hypersensitivity to touch and an elevated response to painful stimuli. There is currently no treatment available for this disease. Warming has been shown to relieve painful attacks.

[0030] Small fiber neuropathy is a condition characterized by severe pain episodes and pain insensitivity. Pain episodes are often described as numbness, tingling, or burning, or unusual skin sensations, such as tingling or itching. Currently, there is no cure for small fiber peripheral neuropathy. Treatment options include intravenous immunoglobulin (IVIG) and plasmapheresis.

[0031] As described herein, the indel rate and indel pattern of a gene editing system comprising an RNA-guided endonuclease (e.g., SpCas9 or SaCas9) and a specific guide RNA pair are determined. The gene editing system described herein relies on the identification of specific pairs (e.g., those disclosed herein) of effective RNA-guided endonucleases and guide RNA pairs that promote efficient modification of voltage-gated sodium channel genes, such as SCN9A or SCN10A, with low off-target incidence.

[0032] Therefore, the present invention provides a gene editing system for effectively modifying a voltage-gated sodium channel gene and its use. The components of the gene editing system and the gene-modified cells produced by the gene editing system are also within the scope of the present disclosure.

[0033] I. Gene Editing System for Gene Modification of Voltage-Gated Sodium Channel Genes

[0034] In some aspects, the present disclosure relates to a gene editing system for modifying a voltage-gated sodium channel gene, such as sodium voltage-gated channel alpha subunit 9 (SCN9A) or sodium voltage-gated channel alpha subunit 10 (SCN10A). A "gene editing system" refers to a combination of components used to edit a target gene (e.g., SCN9A or SCN10A), or one or more agents for producing such components. For example, a gene editing system can include: (a) a nuclease, or an agent for producing such an enzyme (e.g., a nucleic acid encoding a nuclease); and / or (b) a guide RNA (gRNA), or an agent for producing such a gRNA (e.g., a vector capable of expressing a gRNA).

[0035] The gene editing system as described herein can exhibit one or more advantages in modifying voltage-gated sodium channel genes, such as SCN9A or SCN10A. For example, the gene editing system will achieve a high gene editing rate, such as an indel rate that causes a frameshift (e.g., at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 30%, at least 35%, or at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75%, as assessed by methods described herein or known in the art) or, for example, an overall indel rate (e.g., at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 30%, at least 35%, or at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 85%, as assessed by methods described herein or known in the art). In addition, cells edited by the gene editing systems disclosed herein can have a high survival rate relative to unedited controls (e.g., at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 85%, at least 90%, at least 95%, or at least 99%).

[0036] In an exemplary embodiment, a gene editing system as described herein may include: (a) an endonuclease (e.g., an RNA-guided DNA endonuclease) or an agent that produces such an enzyme (e.g., a polynucleotide encoding an endonuclease); and (b) a gRNA or an agent that produces such a gRNA (e.g., a vector for expressing a gRNA). In addition, any gene editing system described herein may also include a polynucleotide sequence encoding a donor template. In some examples, the gene editing system described herein includes an endonuclease, a gRNA, and an optional donor template. This gene editing system may include a polynucleotide that provides a donor template and produces a gRNA. Alternatively, the gene editing system may include a donor template and a separate nucleic acid, which may be a gRNA itself or a polynucleotide that produces a gRNA. In other examples, the gene editing system may include one or more polynucleotides that jointly produce an endonuclease, a gRNA, and an optional donor template. In some examples, the gene editing system may include a polynucleotide that includes a first polynucleotide sequence encoding an endonuclease and a second polynucleotide sequence encoding a gRNA. Alternatively, the gene editing system can comprise two polynucleotides: the first comprising a first polynucleotide sequence encoding a nuclease, and the second comprising a second polynucleotide sequence encoding a gRNA.

[0037] A. RNA-guided endonuclease

[0038] RNA-guided endonucleases are enzymes that utilize RNA:DNA base pairing to target polynucleotides and cleave them. RNA-guided endonucleases can cleave at least one strand of a single-stranded polynucleotide or a double-stranded polynucleotide. The gene editing system can include an RNA-guided endonuclease. Alternatively, the gene editing system can include at least two (e.g., two, three, four, five, six, seven, eight, nine, ten, or more than ten) RNA-guided endonucleases.

[0039] CRISPR-Cas9 system is a naturally occurring defense mechanism in prokaryotes, and the mechanism has been re-intended as a DNA targeting platform guided by RNA for gene editing. The system relies on DNA nuclease Cas9 and two non-coding RNAs-crisprRNA (crRNA) and trans-activating RNA (tracrRNA)-to target DNA cracking. CrRNA is usually carried out Watson-Crick base pairing (Watson-Crick base pairing) with the sequence of 20 nucleotides (nt) in target DNA to drive the sequence recognition and specificity of CRISPR-Cas9 complex. The sequence of 5'20nt in crRNA is changed to allow CRISPR-Cas9 complex targeting specific locus. CRISPR-Cas9 complex only combines the DNA sequence containing the sequence matched with the first 20nt of crRNA, and the condition is that the target sequence is followed by a specific short DNA motif (with sequence NGG), referred to as the protospacer sequence adjacent motif (PAM). The tracrRNA hybridizes with the 3' end of the crRNA to form an RNA duplex structure, which binds to the Cas9 endonuclease to form a catalytically active CRISPR-Cas9 complex, which can then cleave the target DNA.

[0040] Once the CRISPR-Cas9 complex binds to the DNA at the target site, two independent nuclease domains within the Cas9 enzyme each cleave one of the DNA strands upstream of the PAM site, leaving a double-strand break (DSB) in which both strands of the DNA terminate with base pairs (blunt ends).

[0041] The gene editing system may include a CRISPR endonuclease (e.g., CRISPR-associated protein 9 or Cas9 nuclease). In some embodiments, the endonuclease is from Streptococcus aureus (e.g., saCas9) or Streptococcus pyogenes (e.g., spCas9), but other CRISPR homologs may be used. It should be understood that Cas9 may be replaced by another RNA-guided endonuclease known in the art, such as Cpf1. Finally, it should be understood that a wild-type RNA-guided endonuclease may be used or a modified version (e.g., Cas9, Cas9 orthologs, Cas9 chimeric / fusion proteins, or other Cas9 functional variants) may be used. For example, in some embodiments, an RNA-guided endonuclease is modified to include a nuclear localization signal (NLS), such as an SV40 NLS or a nucleoplasm protein (NucleoPlasmine) NLS. Examples of other nuclear localization signals are known to those skilled in the art. In some embodiments, the NLS comprises an SV40 NLS and a nucleoplasmin NLS.

[0042] B. Guide RNA

[0043] The present disclosure provides genome-targeting nucleic acids or agents for producing such nucleic acids (e.g., polynucleotides comprising nucleotide sequences encoding gRNAs), which can direct the activity of related polypeptides (e.g., RNA-guided endonucleases) to specific target sequences within target nucleic acids. Genome-targeting nucleic acids can be RNA. Genome-targeting RNAs are referred to herein as "guide RNAs" or "gRNAs." In some embodiments, the gene editing system comprises one gRNA. In other embodiments, the gene editing system comprises at least two gRNAs (e.g., two, three, four, five, six, seven, eight, nine, ten, or more than ten gRNAs).

[0044] The gRNA of the gene editing system can be provided in a synthetic form. For example, the guide RNA can be synthesized chemically, as described below and described in the art. Although the chemical synthesis procedure continues to expand, as the polynucleotide length increases significantly to more than about one hundred nucleotides, it often becomes more challenging to purify such RNA by procedures such as high performance liquid chromatography (avoiding the use of gels, such as PAGE). One method for producing RNA with longer length is to produce two or more molecules joined together. Much longer RNA is more easily produced enzymatically. Various types of RNA modifications can be introduced during or after chemical synthesis and / or enzymatic production of RNA, for example, to enhance stability, reduce the possibility or degree of innate immune response and / or enhance modifications of other properties, as described in the art.

[0045] Alternatively, the gene editing system can include an agent for producing a gRNA. For example, the gene editing system can include a nucleotide sequence encoding a nucleotide sequence of a gRNA and an additional nucleotide sequence that promotes gRNA expression / production.

[0046] The gRNA can be a bimolecular guide RNA. The bimolecular gRNA comprises two strands of RNA. The first strand can comprise an optional spacer extension sequence, a spacer sequence, and a scaffold sequence comprising a minimal CRISPR repeat sequence in the 5' to 3' direction. The second strand comprises a minimal tracrRNA sequence (complementary to the minimal CRISPR repeat sequence), a 3' tracrRNA sequence, and an optional tracrRNA extension sequence.

[0047] Alternatively, gRNA can be a single molecule guide RNA (sgRNA) comprising a spacer sequence and a scaffold sequence. The scaffold sequence can include a tracrRNA sequence as described herein. sgRNA (e.g., in a type II system) can include an optional spacer extension sequence, a spacer sequence, a minimum CRISPR repeat sequence, a single molecule guide joint, a minimum tracrRNA sequence, a 3'tracrRNA sequence, and an optional tracrRNA extension sequence in the 5' to 3' direction. The optional tracrRNA extension can include an element that contributes additional functionality (e.g., stability) to the guide RNA. The single molecule guide joint connects the minimum CRISPR repeat and the minimum tracrRNA sequence to form a hairpin structure. The optional tracrRNA extension includes one or more hairpins. Alternatively, sgRNA (e.g., in a type V system) can include a minimum CRISPR repeat sequence and a spacer sequence in the 5' to 3' direction.

[0048] The single-molecule gRNA may not contain uracil at the 3' end of the gRNA sequence. Alternatively, the gRNA may contain one or more uracils at the 3' end of the gRNA sequence. For example, the gRNA may contain 1 uracil (U) at the 3' end of the gRNA sequence. The gRNA may contain 2 uracils (UU) at the 3' end of the gRNA sequence. The gRNA may contain 3 uracils (UUU) at the 3' end of the gRNA sequence. The gRNA may contain 4 uracils (UUUU) at the 3' end of the gRNA sequence. The gRNA may contain 5 uracils (UUUUU) at the 3' end of the gRNA sequence. The gRNA may contain 6 uracils (UUUUUU) at the 3' end of the gRNA sequence. The gRNA may contain 7 uracils (UUUUUUU) at the 3' end of the gRNA sequence. The gRNA may contain 8 uracils (UUUUUUUU) at the 3' end of the gRNA sequence.

[0049] It should be further understood that the nucleotides of the gRNA described above may include modified nucleic acids at any nucleotide position. Therefore, the gRNA may be unmodified or modified. For example, the modified gRNA may include one or more 2'-O-methyl phosphorothioate nucleotides. Examples of additional modified nucleic acids are known to those skilled in the art. See, for example, WO2018007976 and WO2018007980, each of which is incorporated by reference for the purposes and / or themes mentioned herein.

[0050] (i) gRNA spacer

[0051] As is known to those of ordinary skill in the art, each gRNA is designed to include a spacer sequence complementary to its genomic target sequence. See Jinek et al., Science, 337, 816-821 (2012) and Deltcheva et al., Nature, 471, 602-607 (2011). The spacer sequence is a nucleotide sequence that defines the target sequence (e.g., DNA target sequence, such as a genomic target sequence) of the target nucleic acid of interest. The gRNA may be included in a variable length spacer sequence having 17-30 nucleotides at the 5' end of the gRNA sequence. In some embodiments, the spacer sequence is 15 to 30 nucleotides. In some embodiments, the spacer sequence is 15, 16, 17, 18, 19, 29, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides. In some embodiments, the spacer sequence is 20 nucleotides.

[0052] "Target sequence" is adjacent to the PAM sequence and is a sequence modified by a nuclease (e.g., Cas9) guided by RNA. "Target nucleic acid" is a double-stranded molecule: one chain contains the target sequence and is referred to as the "PAM chain", and the other complementary chain is referred to as the "non-PAM chain". It is recognized by those skilled in the art that the gRNA spacer sequence hybridizes with the reverse complementary sequence of the target sequence in the non-PAM chain of the target nucleic acid of interest. Therefore, the gRNA spacer sequence is the RNA equivalent of the target sequence. For example, if the target sequence is 5'-AGAGCAACAGTGCTGTGGCC-3' (SEQ ID NO: 498), then the gRNA spacer sequence is 5'-AGAGCAACAGUGCUGUGGCC-3' (SEQ ID NO: 499). The spacer of gRNA interacts with the target nucleic acid of interest in a sequence-specific manner via hybridization (i.e., base pairing). Therefore, the nucleotide sequence of the spacer varies depending on the target sequence of the target nucleic acid of interest.

[0053] The spacer sequence is designed to hybridize with the target nucleic acid region located 5' of the PAM of the Cas9 enzyme used in the system. The spacer may perfectly match the target sequence or may have a mismatch. Each Cas9 enzyme has a specific PAM sequence that is recognized in the target DNA. For example, Streptococcus pyogenes (S.pyogenes) Cas9 recognizes a PAM comprising the sequence 5'-NRG-3' in the target nucleic acid, wherein R comprises A or G, wherein N is any nucleotide and N is adjacent to the 3' of the target nucleic acid sequence targeted by the spacer sequence. The typical PAM of Streptococcus pyogenes Cas9 is 5'-NGG-3', but as indicated in the previous sentence, Streptococcus pyogenes Cas9 can also recognize atypical PAM 5'-NAG-3'. Similarly, for Staphylococcus aureus (S.aureus) Cas9, the PAM comprises the sequence 5'-NNGRRT-3'.

[0054] In some embodiments, the target nucleic acid sequence comprises 20-22 nucleotides. In some embodiments, the target nucleic acid comprises less than 20 nucleotides. In some embodiments, the target nucleic acid comprises more than 20 nucleotides. In some embodiments, the target nucleic acid comprises at least: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. In some embodiments, the target nucleic acid comprises at most: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. In some embodiments, the target nucleic acid sequence comprises 20-22 bases 5' of the first nucleotide immediately adjacent to the PAM. For example, in the sequence comprising 5'-NNNNNNNNNNNNNNNNNNNN NRG -3'(SEQ ID NO:489) or 5'-NNNNNNNNNNNNNNNNNNNNNN NNGRRT -3' (SEQ ID NO: 490), the target nucleic acid comprises a sequence corresponding to N without an underline, wherein N is any nucleotide, and the underlined NRG sequence and NNGRRT sequence are Streptococcus pyogenes PAM and Staphylococcus aureus PAM, respectively.

[0055] In some embodiments, the gRNA used herein may include a spacer sequence of 20 nucleotides. In some embodiments, this gRNA is used with SpCas9. In other embodiments, the gRNA used herein may include a spacer sequence of 22 nucleotides. In some embodiments, this gRNA is used with SaCas9.

[0056] In some embodiments, the gRNA used herein may include the spacer sequences listed in Tables 1-4. In some examples, the gRNA used herein may include the spacer sequences listed in Table 1 in combination with SpCas9 for editing SCN9A. In some examples, the gRNA used herein may include the spacer sequences listed in Table 2 in combination with SaCas9 for editing SCN9A. In some examples, the gRNA used herein may include the spacer sequences listed in Table 3 in combination with SpCas9 for editing SCN10A. In some examples, the gRNA used herein may include the spacer sequences listed in Table 4 in combination with SaCas9 for editing SCN10A. Any of these gRNAs may comprise a spacer sequence listed in any one of Tables 1 and 3 (in combination with a SpCas9 enzyme) with an average total indel percentage greater than 40% (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80% or more) and / or an average indel percentage causing frameshifts greater than 40% (e.g., 50%, 55%, 60%, 65%, 70%, 75% or more). Alternatively, any of these gRNAs may comprise a spacer sequence listed in any one of Tables 2 and 4 (in combination with a SaCas9 enzyme) with an average total indel percentage greater than 15% (e.g., 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55% or more) and / or an average indel percentage causing frameshifts greater than 15% (e.g., 20%, 25%, 30%, 35%, 40%, 45% or more).

[0057] An exemplary gRNA may comprise one of the following spacer sequences:

[0058] ·CAAUUUGGGUGGUACCUGAU(SEQ ID NO:1);

[0059] ·GCUUCGCCUUGCAGAAAACA(SEQ ID NO:2);

[0060] ·GCCUAUGCCCUUCGACACCA(SEQ ID NO:3);

[0061] ·AUAGGCGAGCACAUGAAAAG (SEQ ID NO: 4);

[0062] ·CGGCUGAAUAUACAAGUAUU (SEQ ID NO: 5);

[0063] ·GGAACACCACCCAAUGACUG(SEQ ID NO:6);

[0064] ·CAGGCCUGAAGACAAUUGUA(SEQ ID NO:7);

[0065] ·GGAAUGUCCCCAUAGAUGAA(SEQ ID NO:8);

[0066] ·CCACCAAUGCUGCCGGUGAA(SEQ ID NO:9);

[0067] ·CAGUCACCACUCAGCAUUCG(SEQ ID NO:10);

[0068] ·AAGCAGAAUUAUGGGCCUCUCA(SEQ ID NO:11);

[0069] ·GCCUUGCAGAAAACAAGGAGCC(SEQ ID NO:12);

[0070] ·ACGACAAAAUCCAGCCAGUUCC(SEQ ID NO:13);

[0071] ·CUGGGAAAACCUUUACCAACAG(SEQ ID NO:14);

[0072] ·UCCCAACCUCAGACAGAGAGCA(SEQ ID NO:15);

[0073] ·GAUGUUACUGCUGCGUCGCUCC(SEQ ID NO:16);

[0074] ·CAUGAUCCUGACUGUGUUCUGU(SEQ ID NO:17);

[0075] ·CUCGUGUGUAGUCAGUGUCCAG(SEQ ID NO:18);

[0076] ·AAACUGAUUGCCAUGGAUCCAU(SEQ ID NO:19);

[0077] ·AGAAAACAAGGAGCCACGAAUG(SEQ ID NO:20);

[0078] ·GCUCCCCGAUCAGUUCUGCU(SEQ ID NO:21);

[0079] ·UGUAGUCACCAUGGCGUAUG(SEQ ID NO:22);

[0080] ·GGAAGCUCCGCAGCACAGAC(SEQ ID NO:23);

[0081] ·UCCUUACAACCAGCGCAGGA(SEQ ID NO:24);

[0082] ·ACUUCUGACCCCUUACUGUG (SEQ ID NO:25);

[0083] ·GAGCUCCCAGCAGAACUGAU(SEQ ID NO:26);

[0084] ·CCGAGACAUCGACAGCUCCA(SEQ ID NO:27);

[0085] ·AUCCGUUCUACAGCACACAC(SEQ ID NO:28);

[0086] ·UCACGUACCUGAGAGAUCCU(SEQ ID NO:29);

[0087] ·CGCAGGUGCUAGCAGCACUA(SEQ ID NO:30);

[0088] ·CCCUGGAGCUGUCGAUGUCUCG(SEQ ID NO:31);

[0089] ·UAGAUCCGUUCUACAGCACACA(SEQ ID NO:32);

[0090] ·AGUGAGAGGAAAGCCCAAGCAA(SEQ ID NO:33);

[0091] ·ACCUUUCCGGGCCCAAAGGGCA(SEQ ID NO:34);

[0092] ·CUUUGACUGCAUCAUCGUCACU(SEQ ID NO:35);

[0093] ·CACUUCUUCUGGAAAUAAUAGU(SEQ ID NO:36);

[0094] ·AUUUUAGCCGUCAUUACCCUGGC(SEQ ID NO:37);

[0095] ·AACAACUUCCGUCGCUUUACUC(SEQ ID NO:38);

[0096] ·GCCGAGAUAUCUCACUCCCUGA(SEQ ID NO:39);

[0097] ·UGGUGUUCAUCUUCUCCAUGCC (SEQ ID NO: 40).

[0098] (ii) gRNA scaffold

[0099] In some embodiments, the gRNA further comprises a scaffold sequence. The scaffold sequence may comprise a sequence of a minimal CRISPR repeat sequence, a single molecule guide linker, a minimal tracrRNA sequence, a 3' tracrRNA sequence, and / or an optional tracrRNA extension sequence. Exemplary scaffold sequences for various CRISPR proteins are known to those of ordinary skill in the art.

[0100] The selection of the scaffold sequence can depend on the RNA-guided DNA endonuclease to be used in the gene editing system as used herein, for example, SaCas9 or SpCas9 known to those skilled in the art. For example, if SpCas9 is to be used, a scaffold sequence recognizable by SpCas9 can be selected. Examples of SpCas9 scaffold sequences are known in the art. See, for example, Zhang et al., Plant Mol Biol. 2018; 96(4): 445-456; www.addgene.org. An exemplary scaffold sequence in a single-molecule guide RNA can include the nucleotide sequence GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCC GTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO: 42).

[0101] Alternatively, if a SaCas9 endonuclease is to be used, a scaffold sequence that can be recognized by SaCas9 can be selected. The scaffold sequence in the single-molecule guide RNA of SaCas9 can include the nucleic acid sequence GUUUUAGUACUCUGGAAACAGAAUCUACUAAAACAAGGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAUUUU (SEQ ID NO: 41). The single-molecule guide RNA can also include an optional spacer extension.

[0102] It should be understood that since the nucleotide sequence encoding the gRNA can be a DNA sequence or an RNA sequence, any uracil (U) in the sequence describing the gRNA can be replaced by thymine (T). Similarly, any T (thymine) in the sequence referring to the gRNA will refer to U (or uracil) in the case of RNA molecules. The sequence containing T (thymine) herein will cover both DNA molecules and RNA molecules (wherein T refers to U).

[0103] (iii) Exemplary RNA-guided endonuclease-gRNA pairs

[0104] In some embodiments, the gene editing system relies on the identification of efficient RNA-guided endonuclease guide RNA pairs (e.g., those disclosed herein) for efficient modification of voltage-gated sodium channel genes.

[0105] For example, a gene editing system for modifying a sodium voltage-gated channel alpha subunit 9 (SCN9A) gene may include Staphylococcus pyogenes (SpCas9) and a gRNA comprising a nucleotide sequence of any one of SEQ ID NOs: 1-10. Alternatively or additionally, a gene editing system for modifying a sodium voltage-gated channel alpha subunit 9 (SCN9A) gene may include Staphylococcus aureus (SaCas9) and a gRNA comprising a nucleotide sequence of any one of SEQ ID NOs: 11-20.

[0106] In another example, the gene editing system for modifying the sodium voltage-gated channel alpha subunit 10 (SCN10A) gene may include SpCas9 and a gRNA comprising a nucleotide sequence of any one of SEQ ID NOs: 21-30. Alternatively or additionally, the gene editing system for modifying the sodium voltage-gated channel alpha subunit 10 (SCN10A) gene may include SaCas9 and a gRNA comprising a nucleotide sequence of any one of SEQ ID NOs: 31-40.

[0107] (iv) Ribonucleoprotein complex

[0108] In some cases, the gene editing system disclosed herein may include a ribonucleoprotein complex (RNP), wherein the gRNA and the nuclease (e.g., as described above) form a complex. As used herein, the term "ribonucleoprotein" or "RNP" refers to a protein structurally associated with a nucleic acid (DNA or RNA). For example, in some embodiments, the Cas9 RNA-guided endonuclease and gRNA of the gene editing system are in the form of RNPs.

[0109] C. Donor Template

[0110] The donor template comprises a nucleic acid sequence at a target site to be inserted into a DNA sequence (e.g., an endogenous gene). The donor template of the gene editing system can be provided in a synthetic form. Alternatively, the gene editing system can include an agent (e.g., a nucleic acid, such as a vector) for producing the donor template. For example, the gene editing system can include a nucleic acid (e.g., a vector) for producing the donor template.

[0111] The donor template may comprise one or more homology arms to allow for effective homology-dependent recombination (HDR) at the genomic location of interest. The length of the homology arms may vary. For example, the length of the homology arms may be at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, or at least 1000 nucleotides. Likewise, the length of the homology arms can be 50 to 100, 50 to 200, 50 to 300, 50 to 400, 50 to 500, 50 to 600, 50 to 700, 50 to 800, 50 to 900, 50 to 1000, 100 to 200, 100 to 300, 100 to 400, 100 to 500. 0, 100 to 600, 100 to 700, 100 to 800, 100 to 900, 100 to 1000, 200 to 300, 200 to 400, 200 to 500, 200 to 600, 200 to 700, 200 to 800, 200 to 900, 200 to 1000, 300 to 40 0, 300 to 500, 300 to 600, 300 to 700, 300 to 800, 300 to 900, 300 to 1000, 400 to 500, 400 to 600, 400 to 700, 400 to 800, 400 to 900, 400 to 1000, 500 to 600, 500 to 700 In some embodiments, the homology arm may be 500 to 800, 500 to 900, 500 to 1000, 600 to 700, 600 to 800, 600 to 900, 600 to 1000, 700 to 800, 700 to 900, 700 to 1000, 800 to 900, 800 to 1000 or 900 to 1000 nucleotides. ...

[0112] For example, in some embodiments, the donor template comprises a 5' homology arm (i.e., located upstream of the first nucleotide sequence) and a 3' homology arm (i.e., located downstream of the first nucleotide sequence), wherein the 5' homology arm comprises a nucleic acid sequence homologous to a region upstream of the genomic location of interest, and wherein the 3' homology arm comprises a nucleic acid sequence homologous to a region downstream of the genomic location of interest.

[0113] In other embodiments, the donor template may comprise a 5' homology arm and lack a 3' homology arm. In other embodiments, the donor template may comprise a 3' homology arm and lack a 5' homology arm.

[0114] Alternatively, the donor template may lack homology arms. For example, in some cases, the donor template can be integrated by NHEJ-dependent end joining after cleavage at the target site.

[0115] The donor template may also include a polynucleotide sequence encoding a gene of interest or a portion thereof (e.g., SCN9A, SCN10A, or a portion thereof). Alternatively or additionally, the donor template may include a polynucleotide sequence encoding a regulatory element (e.g., a regulatory element of SCN9A or SCN10A).

[0116] The donor template can be single-stranded and / or double-stranded DNA or RNA and can be introduced into the cell in a linear or circular form. If introduced in a linear form, the ends of the donor sequence can be protected by methods known to those skilled in the art (e.g., from exonucleolytic degradation). For example, one or more dideoxynucleotide residues are added to the 3' end of the linear molecule and / or a self-complementary oligonucleotide is joined to one or both ends. See, for example, Chang et al., (1987) Proc. Natl. Acad. Sci. USA 84: 4959-4963; Nehls et al., (1996) Science 272: 886-889. Additional methods for protecting exogenous polynucleotides from degradation include, but are not limited to, adding one or more terminal amino groups and using modified internucleotide bonds, such as phosphorothioates, phosphoramidates, and O-methyl ribose or deoxyribose residues.

[0117] Donor templates can be introduced into cells as part of a vector molecule having additional sequences, such as an origin of replication, a promoter, and genes encoding antibiotic resistance. In addition, donor templates can be introduced as naked nucleic acids, as nucleic acids complexed with agents such as liposomes or poloxamers, or can be delivered by viruses (e.g., adenoviruses, AAVs, herpes viruses, retroviruses, lentiviruses, and integrase-deficient lentiviruses (IDLVs)).

[0118] In some embodiments, the donor template is inserted so that its expression is driven by an endogenous promoter, such as a promoter that drives expression of the endogenous gene into which the donor is inserted.

[0119] In addition, the exogenous sequence may also include transcriptional or translational regulatory sequences, such as promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides and / or polyadenylation signals.

[0120] It will be appreciated that the nucleotides of the donor template described above may comprise modified nucleic acids at any nucleotide position.

[0121] D. Gene editing systems based on viral vectors / viral particles

[0122] In some embodiments, the gene editing system disclosed herein can include polynucleic acids (e.g., vectors, such as viral vectors) or viral particles comprising such polynucleic acids. One or more polynucleic acids produce components (e.g., nucleases and gRNA) for editing voltage-gated sodium channel genes as described herein.

[0123] In some examples, the gene editing system comprises a polynucleic acid capable of producing all components of the gene editing system (including nucleases and gRNA). In other examples, the gene editing system comprises two polynucleic acids, one encoding a nuclease and the other encoding a gRNA.

[0124] The nucleic acid (or at least one of the nucleic acid group) can be a vector, for example a viral vector, such as a retroviral vector, an adenoviral vector, an adeno-associated virus (AAV) vector and a herpes simplex virus (HSV) vector.

[0125] In some examples, the gene editing system may include one or more viral particles carrying genetic material for producing components of a gene editing system as disclosed herein. A viral particle (e.g., an AAV particle) may include one or more components (or an agent for producing one or more components) of a gene editing system (e.g., as described herein). A viral particle (or virion) includes a shell (i.e., capsid) of nucleic acid and protein encoding a viral genome. In some cases, the viral particle also includes a lipid envelope surrounding a protein shell.

[0126] In some examples, the viral particle comprises a polynucleic acid capable of producing all components of a gene editing system (including nucleases and gRNA). In other examples, the viral particle comprises a polynucleic acid capable of producing one or more components of a gene editing system. For example, the viral particle may comprise a polynucleic acid capable of producing a nuclease. Alternatively, the viral particle may comprise a polynucleic acid capable of producing a gRNA.

[0127] The viral particles described herein can be derived from any viral particles known in the art, including but not limited to retroviral particles, adenoviral particles, adeno-associated virus (AAV) particles, or herpes simplex virus (HSV) particles. In some embodiments, the viral particles are AAV particles. In some embodiments, the AAV particles are AAV1 particles.

[0128] In some embodiments, the viral particle group comprises more than one gene editing system. In some embodiments, each viral particle in the viral particle group is an AAV particle. In other embodiments, the viral particle group comprises more than one type of viral particle (e.g., retroviral particles, adenoviral particles, adeno-associated virus (AAV) particles, or herpes simplex virus (HSV) particles).

[0129] E. Additional Exemplary Gene Editing Systems

[0130] In addition, the gene editing system disclosed herein may include a nuclease (e.g., Cas9 enzyme) as disclosed herein. This gene editing system may also include gRNA. The nuclease and gRNA may form RNPs for delivery. In addition, the gene editing system may also include gRNA and polynucleic acids (e.g., vectors, such as those described herein) for producing donor templates. Nucleases and gRNA may form RNP complexes. Alternatively, the gene editing system may also include one or more polynucleic acids for producing gRNA and donor templates.

[0131] Alternatively, the gene editing system disclosed herein may include an agent for producing a nuclease, such as an expression vector, such as a viral vector as disclosed herein capable of expressing a nuclease. Such a gene editing system may also include a gRNA or an agent for producing such a gRNA.

[0132] Any other form of a gene editing system comprising components as disclosed herein for modifying a voltage-gated sodium channel gene, or agents that produce such components, is within the scope of the present disclosure.

[0133] II. Methods for editing voltage-gated sodium channel genes

[0134] In some aspects, the present disclosure relates to methods for editing voltage-gated sodium channel genes, such as sodium voltage-gated channel alpha subunit 9 (SCN9A) or sodium voltage-gated channel alpha subunit 10 (SCN10A) using any gene editing system disclosed herein. The editing event can introduce a mutation or correct a mutation in a sodium voltage-gated channel (e.g., SCN9A or SCN10A). One or more copies (i.e., alleles) of a gene (e.g., SCN9A or SCN10A) can be corrected and / or mutated.

[0135] Methods for editing voltage-gated sodium channel genes may include contacting cells with: a gene editing system as described herein; a viral particle or a viral particle group comprising a gene editing system as described herein; and / or a nucleic acid or a nucleic acid group comprising a gene editing system as described herein. For example, these methods may be performed on one or more cells present in a living subject (e.g., in vivo). Alternatively or in addition, these methods may be performed on one or more cells present in a culture (e.g., ex vivo). In some cases, cells edited in culture are then administered to the subject (classified herein as "cell-based therapy").

[0136] A. Delivery Method

[0137] Cells (or subjects) can be contacted with gene editing systems, viral particles or viral particle groups and / or nucleic acids or nucleic acid groups via various delivery methods. For example, nucleases and / or gRNAs can be delivered using vector systems, including but not limited to plasmid vectors, DNA minicircles, retroviral vectors, lentiviral vectors, adenoviral vectors, poxvirus vectors; herpesvirus vectors and adeno-associated virus vectors, and combinations thereof.

[0138] Conventional viral and non-viral gene transfer methods can be used to introduce nucleic acids encoding nucleases and gRNAs into cells. Non-viral vector delivery systems include DNA plasmids, DNA minicircles, naked nucleic acids, and nucleic acids complexed with delivery vehicles such as liposomes or poloxamers. Viral vector delivery systems include DNA and RNA viruses that have free genomes or integrated genomes after delivery to cells.

[0139] Non-viral delivery methods for nucleic acids include, but are not limited to, electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycations or lipid: nucleic acid conjugates, naked DNA, naked RNA, capped RNA, artificial virions, and agent-enhanced uptake of DNA. Acoustic perforation using, for example, the Sonitron 2000 system (Rich-Mar) can also be used to deliver nucleic acids.

[0140] Methods for delivering proteins (eg, RNA-guided endonucleases) include, but are not limited to, the use of cell-penetrating peptides and nanocarriers.

[0141] (i) Adeno-associated virus delivery

[0142] Adeno-associated virus (AAV) can be used to deliver one or more components of the gene editing system to cells. AAV is a small virus that integrates into the host genome in a site-specific manner and can therefore deliver transgenics. Inverted terminal repeats (ITRs) are present in the flanks of the AAV genome and / or transgenics of interest and are used as a replication origin. Rep and cap proteins are also present in the AAV genome, which form a capsid that is wrapped around the AAV genome for delivery to the target cell when transcribed. The surface receptors on these capsids confer AAV serotypes, which determine which target organs the capsid will mainly bind to and therefore determine which cells AAV will most effectively infect. Twelve human AAV serotypes are currently known. In some embodiments, AAV is AAV serotype 6 (AAV6). In some embodiments, AAV is AAV serotype 1 (AAV1).

[0143] Adeno-associated virus is one of the most frequently used viruses in gene therapy for a variety of reasons. First, AAV does not cause an immune response after administration to mammals (including humans). Second, AAV is effectively delivered to target cells, especially when considering the selection of appropriate AAV serotypes. Finally, AAV has the ability to infect both dividing and non-dividing cells because the genome can persist in host cells without integration. This property makes them ideal candidates for gene therapy.

[0144] (ii) Homology-directed repair (HDR)

[0145] One or more components of the gene editing system can be inserted into the target genomic region of the edited cell by homology directed repair (HDR). Both DNA chains in the target genomic region are cut by the CRISPR Cas9 enzyme. HDR then occurs to repair double-strand breaks (DSBs) and insert donor DNA. In order to correctly occur this situation, the donor sequence is designed to have flanking residues (hereinafter referred to as "homology arms") complementary to the sequence around the DSB site in the target gene. These homology arms are used as templates for DSB repair and allow HDR to become a substantially error-free mechanism. The rate of homology directed repair (HDR) is a function of the distance between the mutation and the cleavage site, and therefore it is important to select overlapping or nearby target sites. The template can include additional sequences flanking the homology region, or can contain sequences different from the genomic sequence, thereby allowing sequence editing.

[0146] (iii) Non-homologous end joining (NHEJ)

[0147] The NHEJ pathway can also generate, at very low frequency, inserts containing exons 11-27. When the insert is in the sense strand orientation, this repair should correct expression.

[0148] III. Therapeutic Applications

[0149] The gene editing methods disclosed herein can be applied to treat patients suffering from pain. In some embodiments, the present invention provides a therapy based on ex vivo cells. In other embodiments, the present invention provides an in vivo gene therapy.

[0150] (i) Cell-based therapies

[0151] Gene-edited cells can be generated using any of the methods described herein.In some embodiments, one or more gene edits within a population of edited cells result in a phenotype associated with a change in voltage-gated sodium channel function.

[0152] In some embodiments, the gene-edited cells of the present disclosure exhibit reduced voltage-gated sodium channel activity relative to unedited controls (e.g., reduced by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100%). For example, Na v 1.7 and / or Na v The level of 1.8 activity can be reduced by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% relative to unedited control cells. In some embodiments, Na v 1.7 and / or Na v 1.8 The level of activity can be reduced by 5%-10%, 5%-20%, 5%-30%, 5%-40%, 5%-50%, 5%-60%, 5%-70%, 5%-80%, 5%-90%, 10%-20%, 10%-30%, 10%-40%, 10%-50%, 10%-60%, 10%-70%, 10%-80%, 10%-90%, 20%-30%, 20%-40 %, 20%-50%, 20%-60%, 20%-70%, 20%-80%, 20%-90%, 30%-40%, 30%-50%, 30%-60%, 30%-70%, 30%-80%, 30%-90%, 40%-50%, 40%-60%, 40%-70%, 40%-80%, 40%-90%, 50%-50%, 50%-70%, 50%-80% or 50%-90%.

[0153] In other embodiments, the gene-edited cells of the present disclosure exhibit increased voltage-gated sodium channel activity relative to unedited controls (e.g., an increase of at least 30%, 50%, 100%, 2-fold, 5-fold, or 10-fold). v 1.7 and / or Na vThe level of 1.8 activity can be increased by at least 30%, at least 50%, at least 100%, at least 200%, at least 500%, at least 1000% relative to an unedited control cell. In some embodiments, Na v 1.7 and / or Na v 1.8 The level of activity may be increased by 30%-50%, 30%-100%, 30%-200%, 30%-500%, 30%-1000%, 50%-100%, 50%-200%, 50%-500%, 50%-1000%, 100%-200%, 100%-500%, 100%-1000%, 200%-500%, 200%-1000% or 500%-1000% relative to unedited control cells.

[0154] In some embodiments, a biopsy of a patient's peripheral nerves can be performed. Nervous tissue can be separated from the patient's skin or legs. Then, cells of the peripheral nervous system (e.g., neurons or glial cells, such as Schwann cells in nerves or satellite glial cells in ganglia) are separated from the biopsy material. Then, the chromosome DNA of peripheral nervous system cells (e.g., neurons or glial cells, such as Schwann cells in nerves or satellite glial cells in ganglia) can be edited using materials and methods described herein. Finally, the edited cells (e.g., neurons or glial cells, such as Schwann cells in nerves or satellite glial cells in ganglia) of the peripheral nervous system are implanted in the patient. Cells of any source or type can be used as progenitor cells.

[0155] In other embodiments, patient-specific induced pluripotent stem cells (iPSC) can be created. Then, the chromosomal DNA of these iPSC cells can be edited using the materials and methods described herein. Next, the iPSC of genome editing can be differentiated into cells of the peripheral nervous system (e.g., neurons or glial cells, such as Schwann cells in nerves or satellite glial cells in ganglia). Finally, the differentiated cells of the peripheral nervous system (e.g., neurons or glial cells, such as Schwann cells in nerves or satellite glial cells in ganglia) are implanted in the patient.

[0156] Alternatively, mesenchymal stem cells can be separated from patients, and the mesenchymal stem cells can be separated from the bone marrow or peripheral blood of patients. Next, the chromosomal DNA of these mesenchymal stem cells can be edited using materials and methods described herein. Next, the mesenchymal stem cells of genome editing can be differentiated into cells (such as neurons or glial cells, such as Schwann cells in nerves or satellite glial cells in ganglia) of the peripheral nervous system. Finally, the differentiated cells (such as neurons or glial cells, such as Schwann cells in nerves or satellite glial cells in ganglia) of the peripheral nervous system are implanted in patients.

[0157] Any gene-edited cells can be administered to a subject. The administration step may include placing (e.g., transplanting) genetically engineered cells in a subject by a method or approach that causes the introduced cells to be at least partially positioned at a desired site, thereby producing one or more desired effects and wherein at least a portion of the implanted cells or components of the cells remain alive. The survival period of the cells after administration to the subject can be as short as a few hours, such as twenty-four hours, to a few days, to up to several years, or even the life span of the subject, that is, long-term implantation. In some embodiments, the respiratory tract of the subject is administered.

[0158] Modes of administration include injection, infusion, instillation or ingestion. Injection includes, but is not limited to, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcutaneous, intraarticular, subcapsular, subarachnoid, intraspinal, intracerebrospinal and intrasternal injection and infusion. In some embodiments, the route is intravenous.

[0159] In some embodiments, the genetically engineered cells are administered systemically, which refers to administering a population of cells in a manner other than directly to a target site, tissue, or organ, thereby instead allowing them to enter the subject's circulatory system and thereby undergo metabolism and other similar processes.

[0160] For use in the various aspects described herein, an effective amount of genetically engineered cells comprises at least 10 2 cells, at least 5X10 2 cells, at least 10 3 cells, at least 5X10 3 cells, at least 10 4 cells, at least 5X10 4 cells, at least 10 5 cells, at least 2X10 5 cells, at least 3X10 5 cells, at least 4X10 5 cells, at least 5X10 5 cells, at least 6X10 5cells, at least 7X10 5 cells, at least 8X10 5 cells, at least 9X10 5 cells, at least 1X10 6 cells, at least 2X10 6 cells, at least 3X10 6 cells, at least 4X10 6 cells, at least 5X10 6 cells, at least 6X10 6 cells, at least 7X10 6 cells, at least 8X10 6 cells, at least 9X10 6 In some examples described herein, the cells are expanded in culture prior to administration to a subject in need thereof.

[0161] (ii) In vivo gene therapy

[0162] Alternatively, the gene editing methods and materials disclosed herein can be applied to genetically modify the target gene (SCN9A or SCN10A) in vivo. The chromosomal DNA of cells in patients can be edited using materials and methods described herein. In some aspects, the target cells in the in vivo therapy can be neurons of the peripheral nervous system.

[0163] Although some cells present attractive targets for ex vivo treatment and therapy, the increase in delivery efficiency can allow direct in vivo delivery to such cells. Ideally, targeting and editing will be directed to relevant cells. Cleavage in other cells can also be prevented by targeted delivery and / or the use of promoters that are only active in certain cells and or developmental stages. Other promoters are inducible, and therefore if the nuclease is delivered as a plasmid, the promoter can be controlled in time. The amount of time that the delivered RNA and protein remain in the cell can also be adjusted using treatment or domains added to change the half-life. In vivo treatment will eliminate many treatment steps, but lower delivery rates may require higher editing rates. In vivo treatment can eliminate problems and losses caused by in vitro treatment and proper implantation and integration of neurons and glial cells into existing brain circuits after implantation.

[0164] In some aspects, the present disclosure relates to a method of administering an effective amount of a gene editing system as described herein, a viral particle or a set of viral particles comprising a gene editing system as described herein, a nucleic acid or a set of nucleic acids comprising a gene editing system as described herein, or a composition for editing cells as described herein to a subject in need thereof.

[0165] The subject can be any subject in need of diagnosis, treatment or therapy. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the subject is a human patient suffering from pain. In some embodiments, the human patient is a child.

[0166] An effective amount refers to the amount of a gene editing system, a viral particle or viral particle group comprising a gene editing system, a nucleic acid or nucleic acid group comprising a gene editing system, or a genetically engineered cell population required to prevent or alleviate at least one or more signs or symptoms of a medical disorder (i.e., pain), and relates to the amount of a composition sufficient to provide the desired effect (i.e., treating a subject suffering from pain). An effective amount also includes an amount sufficient to prevent or delay the development of disease symptoms, to change the course of disease symptoms (such as, but not limited to, to slow the progression of disease symptoms), or to reverse disease symptoms. It should be understood that for any given situation, a person of ordinary skill in the art can determine an appropriate effective amount using routine experiments.

[0167] The efficacy of a treatment comprising a composition for treating a medical condition can be determined by a skilled clinician. If any or all of the signs or symptoms, such as the level of a functional target, are altered in a beneficial manner (e.g., increased by at least 10%), or other clinically accepted symptoms or markers of the disease (e.g., pain) are improved or ameliorated, then the treatment is considered "effective treatment". Efficacy can also be measured by the subject not experiencing a deterioration (e.g., interrupting or at least slowing the progression of the disease) as assessed by hospitalization or the need for medical intervention. Methods for measuring these indicators are known to those skilled in the art and / or described herein. Treatment includes any treatment of a subject's disease and includes: (1) inhibiting the disease, such as preventing or slowing the progression of symptoms; or (2) alleviating the disease, such as causing the symptoms to subside; and (3) preventing or reducing the likelihood of symptom development.

[0168] IV. Therapeutic Kits

[0169] The present disclosure also provides a kit for using the composition described herein. For example, the present disclosure provides a kit comprising: a gene editing system as described herein; a viral particle or a viral particle group comprising a gene editing system as described herein; a nucleic acid or a nucleic acid group comprising a gene editing system as described herein; and / or a gene-edited cell population as described herein.

[0170] In some embodiments, the kit may further include instructions for use in any of the methods described herein. The included instructions may include a description of: (i) delivering a gene editing system as described herein; a viral particle or set of viral particles comprising a gene editing system as described herein; and / or a nucleic acid or set of nucleic acids comprising a gene editing system as described herein; and / or (ii) administering a gene-edited cell population as described herein.

[0171] The kit may also include a description of selecting a subject suitable for treatment based on identifying whether the subject needs treatment. The instructions may include information about the dosage, dosing schedule, and route of administration for the intended treatment. The container may be a unit dose, bulk package (e.g., multi-dose package), or subunit dose. The instructions provided in the kit of the present disclosure are typically written instructions on a label or package insert. The label or package insert indicates that the pharmaceutical composition is used to treat a disease or condition of a subject, delay the onset of the disease or condition, and / or alleviate the disease or condition.

[0172] The kit provided herein is in a suitable package. Suitable packages include, but are not limited to, vials, bottles, jars, soft packages, etc. It is also contemplated that the packaging used in combination with a particular device, such as an inhaler, a nasal applicator, or an infusion device. The kit can have a sterile access port (e.g., the container can be an intravenous solution bag or a vial with a stopper that a hypodermic needle can pierce). The container can also have a sterile access port.

[0173] The kit may optionally provide additional components, such as buffers and interpretative information. Typically, the kit includes a container and a label or package insert on or associated with the container. In some embodiments, the disclosure provides an article comprising the contents of the kit described above.

[0174] General techniques

[0175] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques are fully explained in the literature, for example, Molecular Cloning: A Laboratory Manual, 2nd Edition (Sambrook et al., 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (MJ Gait, ed., 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (JE Cellis, ed., 1989) Academic Press; Animal Cell Culture (RI Freshney, ed., 1987); Introduction to Cell and Tissue Culture (JP Meltzer and PE Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A. Doyle, JB Griffiths and DG Newell, eds., 1993-8) J. Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.): Gene Transfer Vectors for Mammalian Cells. Cells (JMMiller and MPCalos, 1987); CurrentProtocols in Molecular Biology (FMAusubel et al., 1987); PCR: The Polymerase ChainReaction, (Mullis et al., 1994); Current Protocols in Immunology (JEColigan et al., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (CA Janeway and P. Travers, 1997); Antibodies (P.Finch, 1997); Antibodies: a practice approach (D. Catty. ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean ed., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and JD Capra ed., Harwood Academic Publishers, 1995); DNA Cloning: A practical Approach, Volumes I and II (D. N. Glover ed., 1985); Nucleic Acid Hybridization (B. D. Hames and S. J. Higgins ed. (1985); Transcription and Translation (B. D. Hames and S. J. Higgins ed. (1984); Animal Cell Culture (R. I. Freshney ed. (1986); Immobilized Cells and Enzymes (lRL Press, (1986); and B. Perbal, A Practical Guide To Molecular Cloning (1984); FM Ausubel et al. (eds.).

[0176] Without further elaboration, it is believed that one skilled in the art can utilize the present disclosure to the greatest extent based on the above description. Therefore, the following specific embodiments should be interpreted as being merely illustrative and not limiting the remainder of the present disclosure in any way. All publications cited herein are incorporated by reference for the purposes or themes mentioned herein.

[0177] Example

[0178] Example 1. Efficacy screening of SpCas9 and SaCas9 gRNAs targeting SCN9A and SCN10A in iPSCs.

[0179] method

[0180] Guide RNA design and synthesis

[0181] In silico guide RNA design was performed by CRISPR Therapeutics. SpCas9 and SaCas9 guide RNAs targeting exons 2-15 of SCN9A and exons 1-14 of SCN10A were designed in silico and evaluated using an off-target prediction algorithm. Guide RNAs with good off-target profiles were selected for synthesis and further on-target evaluation. The selected gRNAs included 99 SpCas9 gRNAs (Table 1) and 68 SaCas9 gRNAs (Table 2) targeting SCN9A and 166 SpCas9 gRNAs (Table 3) and 73 SaCas9 gRNAs (Table 4) targeting SCN10A.

[0182] Guide RNAs were custom ordered for synthesis by Synthego Corporation. Guide RNAs were ordered using standard chemical modifications including 2'-O-methyl 3' phosphorothioate modifications in the first and last 3 nucleotides. For SpCas9 gRNAs, the 20 nucleotide genomic targeting sequences listed in Tables 1 and 3 were added to the standard 80-mer SpCas9 scaffold sequence to create guide RNAs. For SaCas9 gRNAs, the 22 nucleotide genomic targeting sequences listed in Tables 2 and 4 were used for synthesis with the following SaCas9 scaffold sequence to generate guide RNAs: GUUUUAGUACUCUGGAAACAGAAUCUACUAAAACAA

[0183] GGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAUUUU (SEQ ID NO: 41).

[0184] use System for nucleofection of iPSCs

[0185] Wild-type iPSC and engineered iPSCs stably expressing Cas9 are used for different steps of gRNA screening. iPSCs expressing SpCas9 or SaCas9 under the control of doxycycline are produced from wild-type iPSC by inserting the targeting construct into the AAVS-1 locus. In this construct, two boxes are expressed in opposite directions separated by IS2 insulator elements. The first expression cassette is TetOn3G protein-2A-Puro under the control of CASI promoter, and the second expression cassette is SpCas9 or SaCas9 under the control of TRE3G promoter.

[0186] Using Lonza System and P3 Primary Cell 96-Well Nucleofector TMThe iPSCs were electroporated with a kit (Lonza, catalog number: V4SP-3096) and program CM137. iPSCs were cultured in mTeSR1 (Stemcell Technologies, catalog number: 85850). Before nuclear transfection, cells were dissociated using Accutase (Stemcell Technologies, catalog number: 07920) and resuspended in P3 nuclear transfection solution. In a 96-well format, 180,000 cells per well were electroporated using 400 ng Cas9 mRNA (TriLink) and 400 ng synthetic gRNA (Synthego) per well according to the manufacturer's instructions. After nuclear transfection, iPSCs were maintained in mTeSR1 supplemented with 10uMY27632 (Stemcell Technologies, catalog number: 72308) for 72 hours in 96-well cell culture plates pre-coated with matrigel before DNA extraction and insertion / deletion (indel) detection based on next-generation sequencing (NGS). Two replicates were included in each electroporation experiment, and two independent experiments were performed. For stable SpCas9 and SaCas9 cell line experiments, cells were treated with 1ug / ul doxycycline for 72 hours before Amaxa nuclear transfection.

[0187] Using Lonza Nucleofection of iPSC-derived sensory neurons by Y-cell

[0188] In order to generate sensory neuron cultures (iSN) derived from iPSC, iPSC cells were differentiated in a flask coated with matrigel in the presence of a small molecule developmental pathway inhibitor cocktail. At differentiation DIV11, cells were dissociated and seeded into 384 plates and maintained in a maturation medium containing a mixture of growth factors, where the cells matured to DIV26-28. These neurons express typical markers of nociceptors, including TRPV1, Brn3A, peripheral markers Isl1, neuN and SCN9A (NaV1.7), and the functional properties of physiologically relevant neuronal subtypes can be summarized.

[0189] Using Lonza Y unit and AD14D-NucleofectorTM Y kit (Lonza, catalog number: V4YP-1A24) are electroporated with program EH158 for sensory neurons (iSN) derived from iPSC. In a 24-well format, cells are electroporated with ribonucleoprotein complexes (RNPs) according to the manufacturer's instructions. RNP complexes are produced by incubating 425pmol SpCas9 or SaCas9 protein (Aldevron) with 531pmol synthetic gRNA (Synthego) at room temperature for 20 minutes. After nuclear transfection, iSNs are maintained in culture for 72 hours before DNA extraction and insertion / deletion (indel) detection based on next-generation sequencing (NGS). Two replicates were included in each electroporation experiment, and two independent experiments were performed.

[0190] Transduction of iPSC-derived sensory neurons with AAV

[0191] In a 384-well format, approximately 12,000 iSNs per well were transduced with AAV-1 vectors expressing SaCas9 and SaCas9 gRNA in a single vector. iSNs were transduced with AAV vectors at a multiplicity of infection (MOI) of 750,000. After transduction, iSNs were maintained in culture for 7 days prior to DNA extraction and NGS-based insertion / deletion (indel) detection. Two replicates were included in each transduction experiment, and two independent experiments were performed.

[0192] Next-generation sequencing (NGS)-based insertion / deletion (indel) detection

[0193] According to the manufacturer's instructions, DNA was extracted from iPSCs 72 hours after electroporation using Lucigen Quick Extract 2X DNA extraction solution (Lucigen, catalog number: QE09050). Then, a two-step PCR method using KAPA2G RobustHotStart ReadyMix (Sigma Aldrich, catalog number: KK5702) was used to generate NGS libraries. The first PCR was used to create an amplicon, and the second PCR was used to add Nextera DNA Index (i7 / i5) adapter sequences. The reaction of PCR#1 included 1uL of extracted gDNA, 1X KAPA2G Robust HotStart ReadyMix, 0.5uM forward primer, and 0.5uM reverse primer. Primer sequences are listed in Tables 5 and 6. The reaction of PCR#2 included 1ul PCR#1 product, 1X KAPA2G Robust HotStart ReadyMix, 0.5uM Index 1 N7xx adapter, and 0.5uM Index 2 N5xx adapter. The cycling conditions for both PCR#1 and PCR#2 were as follows: (1) 95°C for 3 minutes, (2) 95°C for 15 seconds, (3) 60°C for 15 seconds, (4) 72°C for 15 seconds, (5) repeat steps (2)-(4) 20 times, (6) 72°C for 1 minute, (7) 4°C indefinitely. The samples were then pooled and purified using the Zymo DNA Clean and Concentrate Kit (Zymo, D4034) and quantified on an Agilent 2100 Bioanalyzer (Agilent, catalog number: G2939BA). The libraries were then run on Illumina's MiSeq to obtain paired-end reads (2x150).

[0194] For each sample, reads were then filtered to obtain a minimum Phred33 quality score of 30. Paired-end reads were then merged using FLASH (Short Read Fast Length Adjustment), requiring at least 1 bp of overlap. The resulting merged reads were then optimally aligned to the corresponding reference amplicon sequence using the Needleman-Wunsch algorithm. Reads aligned to indels within 3 bp of the expected cut site were counted, and only frameshift indels were filtered, where the indel length was not a multiple of 3. The estimate of total editing was calculated as the proportion of reads with indels close to the cut site, while productive editing was calculated as the proportion of reads with frameshift indels close to the cut site for each sample.

[0195] Once each sample was analyzed, quality control of the samples was then performed by requiring each sample to have at least 90% successfully merged sequencing reads and 70% successfully aligned sequencing reads. Additionally, samples were required to have at least 1000 successfully aligned reads. Finally, quality control was performed in a batch-aware manner by discarding any sample whose final aligned read count differed by more than 2 standard deviations from the mean of its corresponding batch of samples. The samples that passed were averaged and the standard deviation was calculated. Positive and negative controls were included, with the negative control required to exhibit an indel rate below 2%, indicating a low level of background noise, while the positive control sample must show editing levels above background. Additionally, reproducibility was confirmed by comparing corresponding samples between our two technical replicates; a strong linear fit was observed with a high R of 0.85 2 .

[0196] Off-target evaluation of SpCas9 gRNA targeting SCN9A and SCN10A in iPSCs

[0197] For the initial off-target evaluation, a computer nomination step was performed in which candidate off-target sequences were predicted based on sequence similarity. These sites were then directly evaluated via targeted next-generation sequencing to identify which sites, if any, showed evidence of CRISPR-Cas-induced off-target editing.

[0198] a) Computational prediction of off-target sites

[0199] Three computational algorithms were used to predict off-target sites based on sequence similarity. Specifically, CCTop and COSMID were each used to identify candidate off-target sites with up to 3 mismatches or up to 2 mismatches, with 1 DNA or RNA protruding from the on-target sequence. The PAM sequences used to identify off-target sites were NRG for SpCas9 guides and NNGRRT for SaCas9 guides. The guides identified from the two algorithms were then merged together, including deduplication of sites with the same genomic coordinates. A total list of 1,471 putative off-target sites predicted in 40 guides is provided in Table 7.

[0200] b) Hybridization capture of iPSCs

[0201] iPSC transfection using two different wild-type donors was performed using Lonza conditions described above. Two biological replicates were used, and genomic DNA was pooled to obtain the amount necessary for hybrid capture. DNA was extracted from iPSC 72 hours after electroporation using DNeasy 96 blood and tissue kits (Qiagen, catalog number: 69581). Samples were quantified by 4PL calculation using Qubit 1x dsDNAHS assay (ThermoFisher, catalog number: Q33231) and EnVision plate reader. Each sample of at least 200ng was obtained and processed for hybrid capture using SureSelect XT kit (Aglient, catalog number: G9704A). In brief, Covaris LE220 was used to fragment the sample into 150-200bp and end repair, dA tailing and adapter junction were performed. The library was then amplified using Herculase II Fusion DNA polymerase under the following cycling conditions: (1) 98°C for 2 minutes, (2) 98°C for 30 seconds, (3) 65°C for 30 seconds, (4) 72°C for 1 minute, (5) repeat steps (2)-(4) 10 times, (6) 72°C for 5 minutes, (7) 4°C indefinitely. The library was purified using bead-based cleanup, AMPure XP (Beckman Coulter, catalog number: A63881). The library was hybridized with a target-specific capture library, and the target molecules were captured using streptavidin-coated magnetic beads. The captured library was then amplified and purified using the same conditions as above. Samples were QCed using a DNA High Sensitivity Kit on a TapeStation (Agilent, Catalog No. 5067-5584) and / or Bioanalyzer (Agilent, Catalog No. 5067-1504) and sequenced on an Illumina HiSeq platform, achieving a median sequencing coverage of 2,272x per candidate off-target site.

[0202] c) Computational analysis of targeted next-generation sequencing

[0203] For each putative off-target site included in this study, the following analysis was performed to determine the strength of evidence for off-target editing induced by CRISPR-Cas treatment. First, the next generation sequencing reads were aligned to the hg38 human reference genome using the alignment tool bwa in mem mode using default parameters, followed by conversion and classification of SAM and BAM files, and read duplication removal by samtools. Then, the indel formation rate was measured by stacking reads with indels within 3 bp of the expected cut site using the Python package pysam and dividing the number of indel reads by the total number of reads covering that site.

[0204] Then, the indel rate measured at each predicted off-target site is compared between the treated sample of each iPSC donor and the untreated (electroporated only) negative control sample matched by the same iPSC donor. If the indel rate at the site is observed to be greater than the degree of the negative control sample>0.2%, the data of that candidate site enters the statistical test. The only exception is the observation of candidate sites with germline indel gene variants, in which indel rates of about 50% or about 100% are observed in the matched untreated and treated samples of one or more donors. For the sites entering the statistical test, a paired t-test is performed on the two donors to determine the indel rate treated and untreated at that site. Any test site that makes the p value less than 0.05 is considered to have confirmed off-target editing. A large number of on-target editing (average indel rate of 9.35%-52.25%) is confirmed as a positive control for this study in the guide.

[0205] Table 1: Targeted SCN9A gene (Na V 1.7) Name and sequence of the SpCas9 guide RNA

[0206]

[0207]

[0208]

[0209]

[0210]

[0211] Table 2: Targeted SCN9A gene (Na V 1.7) Name and sequence of SaCas9 guide RNA

[0212]

[0213]

[0214]

[0215] Table 3: Targeting SCN10A gene (Na V 1.8) Name and sequence of the SpCas9 guide RNA

[0216]

[0217]

[0218]

[0219]

[0220]

[0221]

[0222]

[0223]

[0224]

[0225] Table 4: Targeting SCN10A gene (Na V 1.8) Name and sequence of SaCas9 guide RNA

[0226]

[0227]

[0228]

[0229]

[0230]

[0231] Table 5: CRISPR-mediated SCN9A gene (Na V 1.7) Edit the names, sequences and targeted exons of the primers used for sequencing analysis

[0232]

[0233]

[0234]

[0235]

[0236] Table 6: CRISPR-mediated SCN10A gene (Na V 1.8) Edit the names, sequences and targeted exons of the primers used for sequencing analysis

[0237]

[0238]

[0239]

[0240]

[0241] Table 7: Total list of 1,471 putative off-target sites predicted in 40 guides

[0242]

[0243]

[0244]

[0245]

[0246]

[0247]

[0248]

[0249]

[0250]

[0251]

[0252]

[0253]

[0254]

[0255]

[0256]

[0257]

[0258]

[0259]

[0260]

[0261]

[0262]

[0263]

[0264] result

[0265] Screening of SpCas9 and SaCas9 gRNAs targeting SCN9A and SCN10A in iPSCs

[0266] After two rounds of gRNA screening and sequencing analysis in iPSC, under the total percentage of insertion and deletion (indel) at the predicted cleavage site of each gRNA, the average cutting efficiency was calculated based on four repetitions of each sample. For the purpose of knocking out SCN9A and SCN10A genes, the average percentage of the indel that will cause frameshift mutations was also calculated. Guide RNA is ranked by the average total indel percentage and the average indel percentage causing frameshift. Guide RNA is listed in rank order based on the average indel percentage causing frameshift, and non-targeted gRNA and untreated cells including disorder are used as negative controls (Tables 8-11).

[0267] Table 8: Average total indel percentage and average indel percentage causing frameshifts generated by SpCas9 gRNA targeting SCN9A in iPSCs

[0268]

[0269]

[0270]

[0271]

[0272]

[0273] Table 9: Average total indel percentage and average indel percentage causing frameshifts generated by SaCas9 gRNA targeting SCN9A in iPSCs

[0274]

[0275]

[0276]

[0277]

[0278]

[0279] Table 10: Average total indel percentage and average indel percentage causing frameshifts generated by SpCas9 gRNA targeting SCN10A in iPSCs

[0280]

[0281]

[0282]

[0283]

[0284]

[0285]

[0286]

[0287]

[0288]

[0289]

[0290]

[0291]

[0292] Table 11: Average total indel percentage and average indel percentage causing frameshifts generated by SaCas9 gRNA targeting SCN10A in iPSCs

[0293]

[0294]

[0295]

[0296]

[0297] Screening for top gRNAs targeting SCN9A and SCN10A in iPSCs stably expressing SpCas9 or SaCas9 and in sensory neurons derived from iPSCs

[0298] Based on the on-target efficacy of the initial gRNA screen in iPSCs, 40 guides were prioritized for further on-target editing studies in additional cell models, such as iPSCs stably expressing Cas9 and iPSC-derived sensory neurons (iSNs) ( Figures 1A-1D). Specifically, ten guides were selected from each of the four categories: 1) ten gRNAs targeting SpCas9 of SCN9A, 2) ten gRNAs targeting SpCas9 of SCN10a, 3) ten gRNAs targeting SaCas9 of SCN9A, and 4) ten gRNAs targeting SaCas9 of SCN10a (Tables 12 and 13).

[0299] The 40 prioritized gRNAs were screened in engineered iPSCs stably expressing SpCas9 or SaCas9. The synthesized gRNAs were electroporated into the corresponding cell lines. The 40 gRNAs have been screened for on-target editing efficiency in iSNs. In iSNs, the RNP complex was electroporated into adherent neuronal cultures of all 40 gRNAs. In addition, 20 SaCas9 gRNAs were also delivered to iSNs by an integrated AAV vector expressing SaCas9 and gRNA. As described in the methods, genomic DNA was purified from the treated cells for sequencing analysis.

[0300] In each model, two independent experiments were performed. The average cutting efficiency was calculated based on four replicates of each sample, while examining the total percentage of insertions and deletions (indels) at the predicted cleavage site of each gRNA. For the purpose of knocking out the SCN9A and SCN10A genes, the average percentage of indels that would cause frameshift mutations was also calculated. The guide RNAs were ranked according to the average indel percentage that caused frameshifts. A summary of the on-target editing efficiencies of these 40 prioritized gRNAs in different cell models can be found in Figures 1A-1D and Tables 12 and 13.

[0301] Table 12: Summary of on-target editing efficiencies of prioritized SpCas9 gRNAs in different cell models

[0302]

[0303]

[0304]

[0305] Table 13: Summary of on-target editing efficiencies of prioritized SaCas9 gRNAs in different cell models

[0306]

[0307]

[0308]

[0309]

[0310] Off-target evaluation of SpCas9 and SaCas9 gRNAs targeting SCN9A and SCN10A in iPSCs

[0311] Based on the on-target efficacy of the initial gRNA screen in iPSCs, the 40 guides were also prioritized for off-target evaluation. Specifically, ten guides were selected from each of four categories: 1) ten gRNAs targeting SpCas9 of SCN9A, 2) ten gRNAs targeting SpCas9 of SCN10a, 3) ten gRNAs targeting SaCas9 of SCN9A, and 4) ten gRNAs targeting SaCas9 of SCN10a.

[0312] Among the 40 gRNAs included in the study, 29 gRNAs were classified as "level 1" (Table 14), where the off-target sites included in the study did not enter the statistical test; these 29 gRNAs included 4 gRNAs that did not predict off-target sites under the sequence similarity criterion. Based on this study, these 29 gRNAs are considered to have no evidence of off-target editing. In addition, seven gRNAs were classified as "level 2" (Table 15), where at least one off-target site associated with the gRNA may have entered the statistical test, but no statistically significant was found. These off-target patterns of these gRNAs are considered to be non-deterministic in this study. In addition, four gRNAs were classified as "level 3" (Table 16), where at least one off-target site was found to have statistically significant off-target editing. Based on these off-target editing results, these gRNA priorities were greatly reduced. It was found that all combinations of target genes (SCN9A or SCN10A) and enzymes (SpCas9 or SaCas9) had at least 5 level 1 guides.

[0313] Table 14: 29 gRNAs classified as Level 1 with no evidence of off-target editing

[0314]

[0315]

[0316] *Scn10a Sp exon 10_T7 had one tested site due to the 0.2% threshold requirement, but that site was ultimately excluded due to germline mutation.

[0317] Table 15: Seven gRNAs classified as Level 2 with uncertain off-target editing profiles

[0318]

[0319]

[0320] Table 16: Four gRNAs classified as Grade 3 with confirmed off-target editing at one or more sites (p<0.05)

[0321]

[0322]

[0323] Other Implementations

[0324] All features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature for the same, equivalent or similar purpose. Therefore, unless otherwise expressly provided, each feature disclosed is merely an example of a general series of equivalent or similar features.

[0325] From the foregoing description, those skilled in the art can easily determine the essential characteristics of the present disclosure, and without departing from the spirit and scope of the present invention, various changes and modifications can be made to the present disclosure to adapt it to various usages and conditions. Therefore, other embodiments are also within the claims.

[0326] Equivalent solutions

[0327] Although several embodiments of the present invention have been described and illustrated herein, a person of ordinary skill in the art will readily envision a variety of other ways and / or structures for performing functions and / or obtaining results and / or one or more advantages described herein, and each of such changes and / or modifications is considered to be within the scope of the embodiments of the present invention described herein. More generally, it will be readily understood by those skilled in the art that all parameters, dimensions, materials, and configurations described herein are intended to be examples and that actual parameters, dimensions, materials, and / or configurations will depend on one or more specific applications for which the teachings of the present invention are used. Those skilled in the art will recognize or be able to determine many equivalents of the specific embodiments of the present invention described herein using only routine experiments. Therefore, it should be understood that the aforementioned embodiments are presented only as examples, and within the scope of the attached claims and their equivalents, embodiments of the present invention may be practiced in a manner different from that specifically described and required. The inventive embodiments of the present disclosure relate to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually contradictory, is included in the scope of the invention disclosed herein.

[0328] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0329] All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter cited in each, and in some cases may be incorporated in their entirety.

[0330] The indefinite articles "a" and "an" as used herein, as in the specification and claims, unless explicitly indicated to the contrary, should be understood to mean "at least one".

[0331] The phrase "and / or" as used in the specification and claims herein should be understood to mean "either or both" of the elements so combined, i.e., elements that are combined in some cases and not combined in other cases. Multiple elements listed with "and / or" should be interpreted in the same way, i.e., "one or more" of the elements so combined. In addition to the elements specifically identified by the "and / or" clause, other elements may optionally be present, whether related or unrelated to those specifically identified elements. Therefore, as a non-limiting example, when used in conjunction with open-ended languages ​​such as "comprising", reference to "A and / or B" may refer to only A (optionally including elements other than B) in one embodiment; only B (optionally including elements other than A) in another embodiment; both A and B (optionally including other elements) in yet another embodiment; and so on.

[0332] As used herein in the specification and claims, "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" should be interpreted as inclusive, that is, including at least one of a number or a list of elements and optionally an item that is not listed in addition, but also including more than one. Only terms that clearly indicate the opposite, such as "only one" or "exactly one" or when used in the claims, "consisting of..." will refer to including an exact one of a number or a list of elements. In general, when there is an exclusive term in front, such as "any one", "one of them", "only one of them" or "exactly one", the term "or" as used herein should only be interpreted as indicating an exclusive alternative (that is, "one or the other but not two"). "Substantially consisting of...", when used in the claims, should have the ordinary meaning used in the field of patent law.

[0333] As used herein in the specification and claims, the phrase "at least one" with respect to a list of one or more elements should be understood to mean at least one element selected from any one or more elements in the list of elements, but does not necessarily include at least one of each element specifically listed in the list of elements and does not exclude any combination of elements in the list of elements. This definition also allows that elements other than the elements specifically identified in the list of elements to which the phrase "at least one" refers may optionally be present, whether related or unrelated to those specifically identified elements. Thus, as a non-limiting example, "at least one of A and B" (or equivalently "at least one of A or B", or equivalently "at least one of A and / or B") may refer to at least one, optionally including more than one A, without B (and optionally including elements other than B) in one embodiment; to at least one, optionally including more than one B, without A (and optionally including elements other than A) in another embodiment; to at least one, optionally including more than one A, and at least one, optionally including more than one B (and optionally including other elements) in yet another embodiment; and so on.

[0334] It should also be understood that in any method claimed herein that includes more than one step or action, the order of the method steps or actions is not necessarily limited to the order of the method steps or actions recited unless explicitly indicated to the contrary. Sequence Listing <110> Vertex Pharmaceuticals Incorporated CRISPR Therapeutics AG <120> Gene editing system for modifying SCN9A or SCN10A gene and method of using the same <130> V0138.70071WO00 <140> Not yet assigned <141> Submit with <150> US 62 / 833,523 <151> 2019-04-12 <160> 499 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 1 caauuugggu gguaccugau 20 <210> 2 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 2 gcuucgccuu gcagaaaaca 20 <210> 3 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 3 gccuaugccc uucgacacca 20 <210> 4 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 4 auaggcgagc acaugaaaag 20 <210> 5 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 5 cggcugaaua uacaaguauu 20 <210> 6 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 6 ggaacaccac ccaaugacug 20 <210> 7 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 7 caggccugaa gacaauugua 20 <210> 8 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 8 ggaauguccc cauagaugaa 20 <210> 9 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 9 ccaccaaugc ugccggugaa 20 <210> 10 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 10 cagucaccac ucagcauucg 20 <210> 11 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 11 aagcagaauu augggccucu ca 22 <210> 12 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 12 gccuugcaga aaacaaggag cc 22 <210> 13 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 13 acgacaaaau ccagccaguu cc 22 <210> 14 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 14 cugggaaaac cuuuaccaac ag 22 <210> 15 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 15 ucccaaccuc agacagagag ca 22 <210> 16 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 16 gauguuacug cugcgucgcu cc 22 <210> 17 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 17 caugauccug acuguguucu gu 22 <210> 18 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 18 cucgugugua gucagugucc ag 22 <210> 19 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 19 aaacugauug ccauggaucc au 22 <210> 20 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 20 agaaaacaag gagccacgaa ug 22 <210> twenty one <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> twenty one gcuccccgau caguucugcu 20 <210> twenty two <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> twenty two uguagucacc auggcguaug 20 <210> twenty three <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> twenty three ggaagcuccg cagcacagac 20 <210> twenty four <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> twenty four uccuuacaac cagcgcagga 20 <210> 25 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 25 acuucugacc ccuuacugug 20 <210> 26 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 26 gagcucccag cagaacugau 20 <210> 27 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 27 ccgagacauc gacagcucca 20 <210> 28 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 28 auccguucua cagcacacac 20 <210> 29 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 29 ucacguaccu gagagauccu 20 <210> 30 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 30 cgcaggugcu agcagcacua 20 <210> 31 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 31 cccuggagcu gucgaugucu cg 22 <210> 32 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 32 uagauccguu cuacagcaca ca 22 <210> 33 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 33 agugagagga aagcccaagc aa 22 <210> 34 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 34 accuuuccgg gcccaaaggg ca 22 <210> 35 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 35 cuuugacugc aucaucguca cu 22 <210> 36 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 36 cacuucuucu ggaaauaaua gu 22 <210> 37 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 37 auuuuagcgu cauuacccug gc 22 <210> 38 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 38 aacaacuucc gucgcuuuac uc 22 <210> 39 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 39 gccgagauau cucacucccu ga 22 <210> 40 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 40 ugguguucau cuucuccaug cc 22 <210> 41 <211> 80 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 41 guuuuaguac ucuggaaaca gaaucuacua aaacaaggca aaaugccgug uuuaucucgu 60 caacuuguug gcgagauuuu 80 <210> 42 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 42 gtttaagagc tatgctggaa acagcatagc aagtttaaat aaggctagtc cgttatcaac 60 ttgaaaaagt ggcaccgagt cggtgc 86 <210> 43 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 43 aucuaugggg acauuccucc 20 <210> 44 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 44 cagcaaugcg uuguucaaug 20 <210> 45 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 45 aguagggguc caaguccucc 20 <210> 46 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 46 uggggacauu ccucccggca 20 <210> 47 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 47 guaggggucc aaguccucca 20 <210> 48 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 48 uaggggucca aguccuccag 20 <210> 49 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 49 auggcaaugu ugccuccccc 20 <210> 50 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 50 ggcucugaca ccaugccggg 20 <210> 51 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 51 aacagcugcc cuucaucuau 20 <210> 52 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 52 cggcauggug ucagagcccc 20 <210> 53 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 53 agcaaugcgu uguucaauga 20 <210> 54 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 54 aggaaugucc ccauagauga 20 <210> 55 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 55 aaacagcugc ccuucaucua 20 <210> 56 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 56 ccccuacuau gcagacaaaa 20 <210> 57 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 57 ccaugaauaa cccaccggac 20 <210> 58 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 58 cauuuuuggu ccaguccggu 20 <210> 59 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 59 ccaguccggu ggguuauuca 20 <210> 60 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 60 acauuuuuugg uccaguccgg 20 <210> 61 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 61 ucgacauuuu ugguccaguc 20 <210> 62 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 62 acccacuuac ucgacauuuu 20 <210> 63 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 63 uaugaccaug aauaacccac 20 <210> 64 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 64 uucuucguga cccguggaac 20 <210> 65 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 65 ucgugacccg uggaacuggc 20 <210> 66 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 66 ucacuuuucu ucgugacccg 20 <210> 67 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 67 guguuuaggu acacuuuuac 20 <210> 68 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 68 aagccccuac aauugucuuc 20 <210> 69 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 69 cugagugugu uugcacuaau 20 <210> 70 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 70 auuggacuac agcuguucau 20 <210> 71 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 71 aggccugaag acaauuguag 20 <210> 72 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 72 aagcucgugu agccauaauc 20 <210> 73 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 73 agcucgugua gccauaauca 20 <210> 74 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 74 ggcuaaugac ccaagauuac 20 <210> 75 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 75 uucacacagg uguaccccuc 20 <210> 76 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 76 cguguguagu caguguccag 20 <210> 77 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 77 gcuaaugacc caagauuacu 20 <210> 78 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 78 cgagcuuuga cacuuucagc 20 <210> 79 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 79 ugguacucac cuguugguaa 20 <210> 80 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 80 ggguacaccu gugugaaaau 20 <210> 81 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 81 cugggaaaac cuuuaccaac 20 <210> 82 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 82 uugggucauu agccuaaaca 20 <210> 83 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 83 guguguaguc aguguccaga 20 <210> 84 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 84 gggccuucuu agccuuguuu 20 <210> 85 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 85 gagcuuugac acuuucagcu 20 <210> 86 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 86 auuggcagaa acccugauua 20 <210> 87 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 87 cccuagacgc ugcgugcugc 20 <210> 88 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 88 ccagcagcac gcagcgucua 20 <210> 89 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 89 gccagcagca cgcagcgucu 20 <210> 90 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 90 cuuugucgua gugauuuucc 20 <210> 91 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 91 gagguugucu acccccaauc 20 <210> 92 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 92 uaugcccuuc gacaccaagg 20 <210> 93 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 93 accuuggugu cgaagggcau 20 <210> 94 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 94 aguuuccacc uuggugucga 20 <210> 95 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 95 guuuccaccu uggugucgaa 20 <210> 96 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 96 ccgcugccgc ugcaauugcc 20 <210> 97 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 97 gcccaaccag gcaauugcag 20 <210> 98 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 98 aauuugggug guaccugauu 20 <210> 99 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 99 cguucaccgg cagcauuggu 20 <210> 100 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 100 ccguucaccg gcagcauugg 20 <210> 101 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 101 uguuacugcu gcgucgcucc 20 <210> 102 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 102 guuacugcug cgucgcuccu 20 <210> 103 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 103 gggcugagcg uccaucaacc 20 <210> 104 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 104 caccaaugcu gccggugaac 20 <210> 105 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 105 ggcugagcgu ccaucaacca 20 <210> 106 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 106 uuacugcugc gucgcuccug 20 <210> 107 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 107 cugcaacggu guggucuccc 20 <210> 108 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 108 cagcauuggu ggggaccuac 20 <210> 109 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 109 gcgucgcucc uggggucugu 20 <210> 110 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 110 ugcuguggac ugcaacggug 20 <210> 111 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 111 cgucgcuccu ggggucugug 20 <210> 112 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 112 ugcgucgcuc cuggggucug 20 <210> 113 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 113 gguguggucu cccugguuga 20 <210> 114 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 114 guaacaucag ccaagccagu 20 <210> 115 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 115 cugugcauuu ucccguucac 20 <210> 116 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 116 guuugugccc cacagacccc 20 <210> 117 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 117 gcaaaucugu accaccaagg 20 <210> 118 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 118 ugugcaaauc uguaccacca 20 <210> 119 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 119 ccaaggugga cauuuuuguc 20 <210> 120 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 120 ugucuggacu cuucaaguuc 20 <210> 121 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 121 ucuggaauug cucuccauau 20 <210> 122 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 122 aguucugcga ucauucagac 20 <210> 123 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 123 ggagcucuuu cuagcagaug 20 <210> 124 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 124 ccuacuugga aauacucaua 20 <210> 125 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 125 ggggcucuga caccaugccg gg 22 <210> 126 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 126 ccccuacuau gcagacaaaa ag 22 <210> 127 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 127 cucaccuuuu ugucugcaua gu 22 <210> 128 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 128 aucaucaucu uucuuuucuu cu 22 <210> 129 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 129 uuucuccuuu caguccucua ag 22 <210> 130 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 130 ucgacauuuu ugguccaguc cg 22 <210> 131 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 131 ccaccggacu ggaccaaaaa ug 22 <210> 132 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 132 gacaaacugc auauuuauga cc 22 <210> 133 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 133 aauagugcac augaugagca ug 22 <210> 134 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 134 uggucauaaa uaugcaguuu gu 22 <210> 135 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 135 cuccuacaca gaagccucuu gc 22 <210> 136 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 136 ucuucgugac ccguggaacu gg 22 <210> 137 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 137 guuccacggg ucacgaagaa aa 22 <210> 138 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 138 cuugcaagag gcuucugugu ag 22 <210> 139 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 139 uuguguuuag guacacuuuu ac 22 <210> 140 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 140 acuuuuacug gaauauauac uu 22 <210> 141 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 141 uacaaauucu guuaaauacc ug 22 <210> 142 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 142 auuuaauucu acagguauuu aa 22 <210> 143 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 143 uucuaaaguc uucuucacuc uc 22 <210> 144 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 144 gagugaagaa gacuuuagaa gu 22 <210> 145 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 145 agaaagcaua augaauaccc ua 22 <210> 146 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 146 acacacucag acagaacaca gu 22 <210> 147 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 147 uaaugaaaca uuagaaagca ua 22 <210> 148 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 148 ucuaauguuu cauuauuuuc aa 22 <210> 149 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 149 gaaaccacaa aggagagcau cu 22 <210> 150 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 150 cuuugugguu ucagcacaga uu 22 <210> 151 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 151 acagaauauu uuuauuacuu gg 22 <210> 152 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 152 ucaaagcucg uguagccaua au 22 <210> 153 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 153 gguaaagguu uucccaguaa uc 22 <210> 154 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 154 aacauugaag aagcuaaaca ga 22 <210> 155 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 155 cauaugccau ggcaaccaca gc 22 <210> 156 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 156 gaagaagcua aacagaaaga au 22 <210> 157 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 157 gcaauuuggg ugguaccuga uu 22 <210> 158 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 158 caggcaauug cagcggcagc gg 22 <210> 159 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 159 uuuagcacuu uuagagcuca gu 22 <210> 160 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 160 gaugcugaga aauugucgaa au 22 <210> 161 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 161 aauauacaag uauuaggaga ag 22 <210> 162 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 162 ggaagagaua uaggaucuga ga 22 <210> 163 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 163 uucaaaggca gaggaagaga ua 22 <210> 164 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 164 cuaucuccuu ucagaggaua ug 22 <210> 165 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 165 cucauugcuc ucugucugag gu 22 <210> 166 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 166 uuguaguucc uaucuccuuu ca 22 <210> 167 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 167 auggaacacc acccaaugac ug 22 <210> 168 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 168 auauggagag caauuccaga uc 22 <210> 169 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 169 ugaucuggaa uugcucucca ua 22 <210> 170 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 170 augguaauug caagaucuac aa 22 <210> 171 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 171 ugcuuuuuuc ucccagaacu ug 22 <210> 172 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 172 auuuccuaua gcaaguacau uu 22 <210> 173 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 173 acauuuuuga auuccucagu ca 22 <210> 174 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 174 auuugcacac aaauucuuga uc 22 <210> 175 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 175 aaaguguauc uauuuuauug ua 22 <210> 176 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 176 uacaauaaaa uagauacacu uu 22 <210> 177 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 177 aaugguauua aaacugauug cc 22 <210> 178 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 178 auaugaguau uuccaaguag gc 22 <210> 179 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 179 accuuaguuu auguuuacca gu 22 <210> 180 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 180 cagccuacuu ggaaauacuc au 22 <210> 181 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 181 gagcucuuuc uagcagaugu gg 22 <210> 182 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 182 uuuuucucac uuaggucuuu ac 22 <210> 183 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 183 gacggaaguu guuaguuucg 20 <210> 184 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 184 caacuuccgu cgcuuuacuc 20 <210> 185 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 185 ucgcuuuacu ccggagucac 20 <210> 186 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 186 gaacggaucu agauccucca 20 <210> 187 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 187 acggaaguug uuaguuucga 20 <210> 188 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 188 aacggaucua gauccuccag 20 <210> 189 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 189 agaacggauc uagauccucc 20 <210> 190 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 190 gugacuccgg aguaaagcga 20 <210> 191 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 191 uuaguuucga gggauccaau 20 <210> 192 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 192 guuaguuucg agggauccaa 20 <210> 193 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 193 ggcuccccga ucaguucugc 20 <210> 194 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 194 uaguuucgag ggauccaaug 20 <210> 195 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 195 gcucccagca gaacugaucg 20 <210> 196 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 196 acccggugug ugcuguagaa 20 <210> 197 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 197 agaacugauc ggggagcccc 20 <210> 198 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 198 uccguucuac agcacacacc 20 <210> 199 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 199 cuuuacuccg gagucacugg 20 <210> 200 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 200 caccauagaa cuugggcagc 20 <210> 201 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 201 ugggagcuca ccauagaacu 20 <210> 202 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 202 acugaucggg gagccccugg 20 <210> 203 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 203 aaccagcugc ccaaguucua 20 <210> 204 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 204 gaacuugggc agcugguugc 20 <210> 205 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 205 gaagcaaauu gcugccaagc 20 <210> 206 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 206 ucuaucucca ccagugacuc 20 <210> 207 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 207 ggggccgagg cuucucuucu 20 <210> 208 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 208 gggcccgagu ggcacuaaac 20 <210> 209 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 209 uucccgguuu agugccacuc 20 <210> 210 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 210 ggcccgagug gcacuaaacc 20 <210> 211 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 211 uuucccgguu uagugccacu 20 <210> 212 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 212 uuagugccac ucgggcccug 20 <210> 213 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 213 ugauggccgu ucuucugauc 20 <210> 214 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 214 gaauagccac agggcccgag 20 <210> 215 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 215 guucuucuga ucagguugaa 20 <210> 216 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 216 aguggcacua aaccgggaaa 20 <210> 217 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 217 acaaagggag gaccauuucc 20 <210> 218 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 218 ggauuuuagc gucauuaccc 20 <210> 219 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 219 cauagagaua uacucacgcc 20 <210> 220 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 220 gccaguucca aggaucucuc 20 <210> 221 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 221 accugagaga uccuuggaac 20 <210> 222 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 222 gcacagcaau agaucuccgu 20 <210> 223 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 223 uaagaacucu gaauguccgc 20 <210> 224 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 224 auagaucucc gugggaucuc 20 <210> 225 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 225 ggcacagcaa uagaucuccg 20 <210> 226 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 226 gggcccccac aaugaccuuc 20 <210> 227 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 227 cgcaggccug aaggucauug 20 <210> 228 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 228 guggggcugc aacucuucaa 20 <210> 229 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 229 gcaggccuga aggucauugu 20 <210> 230 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 230 gguggggcug caacucuuca 20 <210> 231 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 231 ucaucuuccc gcaggccuga 20 <210> 232 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 232 gaagaguugc agccccacca 20 <210> 233 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 233 gaccccuuac uguguggcaa 20 <210> 234 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 234 agauccauug ccacacagua 20 <210> 235 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 235 uguggcaaug gaucugacuc 20 <210> 236 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 236 guggcaaugg aucugacuca 20 <210> 237 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 237 gauccauugc cacacaguaa 20 <210> 238 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 238 auccauugcc acacaguaag 20 <210> 239 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 239 acuguuccgc cucaugacac 20 <210> 240 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 240 cugggaacgc cucuaccagc 20 <210> 241 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 241 ccggguuguc agaaguuuua 20 <210> 242 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 242 gccucaugac acaggauucc 20 <210> 243 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 243 agcucaguac cugcugguag 20 <210> 244 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 244 uuaaggcaga uauaaccauc 20 <210> 245 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 245 aagcuggugu aguuaaaauc 20 <210> 246 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 246 ucaugaggcg gaacagugag 20 <210> 247 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 247 ccuuaaaacu ucugacaacc 20 <210> 248 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 248 gaaugcagcu caguaccugc 20 <210> 249 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 249 ggcccucgag augcuccgga 20 <210> 250 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 250 guucugcucc ucauacgcca 20 <210> 251 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 251 cuccuuccgg agcaucucga 20 <210> 252 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 252 cuaccugguc aacuugaucu 20 <210> 253 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 253 gcuccuuccg gagcaucucg 20 <210> 254 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 254 cgagaugcuc cggaaggagc 20 <210> 255 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 255 aggaggcccu cgagaugcuc 20 <210> 256 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 256 uuugugcucg uaaucuuccu 20 <210> 257 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 257 ggagcaucuc gagggccucc 20 <210> 258 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 258 ggcguaugag gagcagaacc 20 <210> 259 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 259 uuuugugcuc guaaucuucc 20 <210> 260 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 260 ugaccaggua gaaagauccc 20 <210> 261 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 261 gaucuuggcu guagucacca 20 <210> 262 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 262 accauccugc gcugguugua 20 <210> 263 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 263 cugauccuua caaccagcgc 20 <210> 264 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 264 ucgcaggugc uagcagcacu 20 <210> 265 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 265 gguuaaaggu gauccauugu 20 <210> 266 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 266 agccucuuac cauccugcgc 20 <210> 267 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 267 agguuaaagg ugauccauug 20 <210> 268 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 268 ugguuguaag gaucagagcg 20 <210> 269 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 269 guggagcccu cugacacucu 20 <210> 270 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 270 gcucacuagu gggcggcggu 20 <210> 271 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 271 ggaaaacgcc gggcuaguca 20 <210> 272 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 272 acuagcccgg cguuuuccag 20 <210> 273 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 273 accgagacau cgacagcucc 20 <210> 274 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 274 cccggcguuu uccagaggcg 20 <210> 275 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 275 gagagccccg auggcuuucg 20 <210> 276 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 276 cgauggcuuu cguggucucc 20 <210> 277 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 277 ccucgccucu ggaaaacgcc 20 <210> 278 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 278 cgagacaucg acagcuccag 20 <210> 279 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 279 gccucgccuc uggaaaacgc 20 <210> 280 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 280 gggagugaga uaucucggcc 20 <210> 281 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 281 ggagaccacg aaagccaucg 20 <210> 282 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 282 cgagauaucu cacucccuga 20 <210> 283 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 283 cccacuagug agcuugcccc 20 <210> 284 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 284 ccaggggcaa gcucacuagu 20 <210> 285 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 285 gagugagaua ucucggccag 20 <210> 286 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 286 ccgagauauc ucacucccug 20 <210> 287 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 287 cucggccagg ggaccggaaa 20 <210> 288 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 288 agauaucucg gccaggggac 20 <210> 289 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 289 guguuccauu uccggucccc 20 <210> 290 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 290 uccaggggca agcucacuag 20 <210> 291 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 291 ggggcaagcu cacuaguggg 20 <210> 292 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 292 ggagugagau aucucggcca 20 <210> 293 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 293 uggagaccac gaaagccauc 20 <210> 294 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 294 ggcgaggccu agaaaagacu 20 <210> 295 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 295 cccuggagcu gucgaugucu 20 <210> 296 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 296 cuggagacca cgaaagccau 20 <210> 297 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 297 ucuuuuuag gccucgccuc 20 <210> 298 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 298 aggcgaggcc uagaaaagac 20 <210> 299 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 299 ccucagggag ugagauaucu 20 <210> 300 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 300 guugaggaag agggcuucua 20 <210> 301 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 301 uucuagggag ggggccuugc 20 <210> 302 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 302 ucucaacagg cauucgaugc 20 <210> 303 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 303 augaaccuuu ccgggcccaa 20 <210> 304 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 304 gcacuuaccc ucaaggacgg 20 <210> 305 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 305 uaucauaacc uccguccuug 20 <210> 306 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 306 ugaaccuuuc cgggcccaaa 20 <210> 307 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 307 aucauaaccu ccguccuuga 20 <210> 308 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 308 auugcccuuu gggcccggaa 20 <210> 309 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 309 gugagcagca cuuacccuca 20 <210> 310 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 310 gcagcacuua cccucaagga 20 <210> 311 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 311 cacucauugc ccuuugggcc 20 <210> 312 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 312 gacaacacuc auugcccuuu 20 <210> 313 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 313 auacuuagau gaaccuuucc 20 <210> 314 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 314 ugacaacacu cauugcccuu 20 <210> 315 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 315 cacucacgau guugccuauc 20 <210> 316 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 316 uucgaagcca ugcuccagau 20 <210> 317 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 317 caccaucacc uugugcaucg 20 <210> 318 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 318 acacuauaau gcagaacucg 20 <210> 319 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 319 caccacgaug cacaagguga 20 <210> 320 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 320 cguggugaac accaucuuca 20 <210> 321 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 321 ggagcauggc uucgaaggua 20 <210> 322 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 322 uaucuggagc auggcuucga 20 <210> 323 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 323 uggagcaugg cuucgaaggu 20 <210> 324 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 324 cgaagguagg gcucaugcca 20 <210> 325 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 325 gguguucacc acgaugcaca 20 <210> 326 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 326 acaagcuggu caagcagggu 20 <210> 327 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 327 gauguugccu aucuggagca 20 <210> 328 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 328 uucauggcca uggagcacca 20 <210> 329 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 329 ucuugagcuu cacccacaug 20 <210> 330 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 330 cugggauugc ugccccaugu 20 <210> 331 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 331 ugucuugagc uucacccaca 20 <210> 332 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 332 gugaugguga gcucugcaaa 20 <210> 333 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 333 ggugauggug agcucugcaa 20 <210> 334 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 334 ugugcugcgg agcuuccgcu 20 <210> 335 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 335 gaaauaauag uaugggucga 20 <210> 336 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 336 acugugaguc ugcuagagcu 20 <210> 337 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 337 cacugugagu cugcuagagc 20 <210> 338 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 338 gcgacggaag uuguuaguuu cg 22 <210> 339 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 339 guuaguuucg agggauccaa ug 22 <210> 340 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 340 cuuacccggu gugugcugua ga 22 <210> 341 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 341 agaacugauc ggggagcccc ug 22 <210> 342 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 342 ucucuaucuc caccagugac uc 22 <210> 343 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 343 aaugagaaga uggaauuccc ca 22 <210> 344 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 344 aaggacugaa uagccacagg gc 22 <210> 345 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 345 ucuucugauc agguugaaag ga 22 <210> 346 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 346 cugaccuucc agagaaaauu ga 22 <210> 347 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 347 caauuuucuc uggaagguca gu 22 <210> 348 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 348 cgaacugacc uuccagagaa aa 22 <210> 349 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 349 cuggcaagag gauuuugucu aa 22 <210> 350 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 350 acgcuaaaau ccagccaguu cc 22 <210> 351 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 351 ccugagagau ccuuggaacu gg 22 <210> 352 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 352 gccuugauaa agauacuggc aa 22 <210> 353 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 353 uuggcacagc aauagaucuc cg 22 <210> 354 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 354 ggaucucagg ccugcggaca uu 22 <210> 355 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 355 uguuuuuaau gcucuaagaa cu 22 <210> 356 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 356 cuccacucac guuuucugug ag 22 <210> 357 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 357 aaacacuuag gcagaagaug gu 22 <210> 358 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 358 caucagccag uuucuucacu ga 22 <210> 359 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 359 aacuacucau cucacagaaa ac 22 <210> 360 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 360 gucacaucag ccaguuucuu ca 22 <210> 361 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 361 caaccucaaa aauaaaugug uc 22 <210> 362 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 362 uuuauuuuug agguugcccu ug 22 <210> 363 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 363 ucagauccau ugccacacag ua 22 <210> 364 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 364 cuguguggca auggaucuga cu 22 <210> 365 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 365 guggcaaugg aucugacuca gg 22 <210> 366 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 366 ucugaccccu uacugugugg ca 22 <210> 367 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 367 accugcuggu agaggcguuc cc 22 <210> 368 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 368 cucacuguuc cgccucauga ca 22 <210> 369 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 369 cugccuuaaa acuucugaca ac 22 <210> 370 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 370 ucaaagcugg uguaguuaaa au 22 <210> 371 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 371 uuuuuugugc ucguaaucuu cc 22 <210> 372 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 372 uauagauuuu cccagaaguc cu 22 <210> 373 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 373 gcucugaucc uuacaaccag cg 22 <210> 374 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 374 cuucgcaggu gcuagcagca cu 22 <210> 375 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 375 cuuaccaucc ugcgcugguu gu 22 <210> 376 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 376 gcgcugguug uaaggaucag ag 22 <210> 377 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 377 acaaccucuc uccacuccca ca 22 <210> 378 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 378 gagguuaaag gugauccauu gu 22 <210> 379 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 379 agagaaggca uagaauaaag cc 22 <210> 380 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 380 aaaaugccag ugagagaagg ca 22 <210> 381 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 381 aagccaucgg ggcucucugc ug 22 <210> 382 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 382 uccaucaucu gugacucccu ca 22 <210> 383 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 383 ucggggcucu cugcugcugg gu 22 <210> 384 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 384 uccaugccug gagucagggu ug 22 <210> 385 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 385 ucccugaggg agucacagau ga 22 <210> 386 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 386 ucaucuucuc caugccugga gu 22 <210> 387 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 387 caguaucaua accuccgucc uu 22 <210> 388 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 388 gaaagucuuc uuuuguccug ca 22 <210> 389 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 389 caaaagaaga cuuucuuguc ag 22 <210> 390 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 390 ccacacuaua augcagaacu cg 22 <210> 391 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 391 caugcuccag auaggcaaca uc 22 <210> 392 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 392 agggauccgu cacaagccca aa 22 <210> 393 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 393 ugaucuggga uugcugcccc au 22 <210> 394 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 394 cuugucucag aaguaucuga uc 22 <210> 395 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 395 gacaauucuc uuugggcuug ug 22 <210> 396 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 396 cuucugagac aagcugguca ag 22 <210> 397 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 397 aaggugaugg ugagcucugc aa 22 <210> 398 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 398 ugggcacuuc uguucagacu cc 22 <210> 399 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 399 guaaaaaaua ugguaaagac cu 22 <210> 400 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 400 auacuauuau uuccagaaga ag 22 <210> 401 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 401 tcgtcggcag cgtcagatgt gtataagaga cagcatccag gcctcttatg tgaggag 57 <210> 402 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 402 gtctcgtggg ctcggagatg tgtataagag acagatagat gaagggcagc tgtttgc 57 <210> 403 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 403 tcgtcggcag cgtcagatgt gtataagaga cagtgaacaa cgcattgctg aaaga 55 <210> 404 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 404 gtctcgtggg ctcggagatg tgtataagag acagttttat acagaaggaa gccaacag 58 <210> 405 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 405 tcgtcggcag cgtcagatgt gtataagaga cagaactgct gatattgatg tgaaaaa 57 <210> 406 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 406 gtctcgtggg ctcggagatg tgtataagag acagaaaata gcaaaaatta caccataaag 60 t 61 <210> 407 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 407 tcgtcggcag cgtcagatgt gtataagaga cagtcctcaa atatttcaaa ttcccactgt 60 <210> 408 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 408 gtctcgtggg ctcggagatg tgtataagag acagtcccca tcttcataaa tgcagtaac 59 <210> 409 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 409 tcgtcggcag cgtcagatgt gtataagaga cagaaagatt tacatggtgg ttgtattctt 60 <210> 410 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 410 gtctcgtggg ctcggagatg tgtataagag acagctgtgc tgcctgagat tttcat 56 <210> 411 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 411 tcgtcggcag cgtcagatgt gtataagaga cagagcccca aacgtagaaa atacct 56 <210> 412 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 412 gtctcgtggg ctcggagatg tgtataagag acagctccca aatagttgga gttatgagt 59 <210> 413 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 413 tcgtcggcag cgtcagatgt gtataagaga caggtttcga ttcagaggct ttatgtc 57 <210> 414 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 414 gtctcgtggg ctcggagatg tgtataagag acagctctct agggtattca ttatgctttc 60 t 61 <210> 415 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 415 tcgtcggcag cgtcagatgt gtataagaga caggaagctt tctgatgtca tgatcc 56 <210> 416 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 416 gtctcgtggg ctcggagatg tgtataagag acaggcaaca tttcattatt aaaagagagc 60 a 61 <210> 417 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 417 tcgtcggcag cgtcagatgt gtataagaga cagggaccag gcctgaattt gtag 54 <210> 418 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 418 gtctcgtggg ctcggagatg tgtataagag acagtttgca aactgactga acattct 57 <210> 419 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 419 tcgtcggcag cgtcagatgt gtataagaga caggtcctga agacactctc acct 54 <210> 420 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 420 gtctcgtggg ctcggagatg tgtataagag acagcaggct cttaacatac accagg 56 <210> 421 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 421 tcgtcggcag cgtcagatgt gtataagaga cagtgctcat gcctgtcaaa ttgaaata 58 <210> 422 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 422 gtctcgtggg ctcggagatg tgtataagag acagacatct gttgaaattc taattctttc 60 tgt 63 <210> 423 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 423 tcgtcggcag cgtcagatgt gtataagaga cagctagacg ctgcgtgctg ct 52 <210> 424 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 424 gtctcgtggg ctcggagatg tgtataagag acagaaggcc aagcatatac cgcaga 56 <210> 425 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 425 tcgtcggcag cgtcagatgt gtataagaga cagatgtcct gtcctagggt ttcct 55 <210> 426 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 426 gtctcgtggg ctcggagatg tgtataagag acagtcagca tctccctttt cctctc 56 <210> 427 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 427 tcgtcggcag cgtcagatgt gtataagaga cagggcagcg gctgaatata caagt 55 <210> 428 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 428 gtctcgtggg ctcggagatg tgtataagag acagctcgcc tatgcccttc gac 53 <210> 429 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 429 tcgtcggcag cgtcagatgt gtataagaga cagagaatca aaagaagctc tccagtg 57 <210> 430 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 430 gtctcgtggg ctcggagatg tgtataagag acagtcactc actatcctct cccga 55 <210> 431 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 431 tcgtcggcag cgtcagatgt gtataagaga cagagtgtac ttctatcagt aggtgctt 58 <210> 432 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 432 gtctcgtggg ctcggagatg tgtataagag acaggaccta ctggcttggc tgat 54 <210> 433 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 433 tcgtcggcag cgtcagatgt gtataagaga cagaagcagc agaacaagtc tttttagtt 59 <210> 434 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 434 gtctcgtggg ctcggagatg tgtataagag acagaccagg gagaccacac cgt 53 <210> 435 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 435 tcgtcggcag cgtcagatgt gtataagaga cagacagcat ttttggagac aatgaga 57 <210> 436 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 436 gtctcgtggg ctcggagatg tgtataagag acagatgcct gagctatgta aaacgtc 57 <210> 437 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 437 tcgtcggcag cgtcagatgt gtataagaga cagcccagca atctaggctc tact 54 <210> 438 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 438 gtctcgtggg ctcggagatg tgtataagag acagccttcc acagtgtttg ttaatatgc 59 <210> 439 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 439 tcgtcggcag cgtcagatgt gtataagaga cagtcaaata cacaagaaaa ggcgttg 57 <210> 440 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 440 gtctcgtggg ctcggagatg tgtataagag acagacaatt ccatcagtat ccattggt 58 <210> 441 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 441 tcgtcggcag cgtcagatgt gtataagaga cagggttagg agtgaaacag acaaatgg 58 <210> 442 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 442 gtctcgtggg ctcggagatg tgtataagag acagtggtgt tccatagcca taaataatgt 60 g 61 <210> 443 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 443 tcgtcggcag cgtcagatgt gtataagaga cagtcttgat ctggaattgc tctccat 57 <210> 444 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 444 gtctcgtggg ctcggagatg tgtataagag acagacaatg atgacaacta aaaagagaaa 60 ct 62 <210> 445 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 445 tcgtcggcag cgtcagatgt gtataagaga cagatcattg tgttgatttc ctgttttct 59 <210> 446 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 446 gtctcgtggg ctcggagatg tgtataagag acagccagtc tgaatgatcg cagaac 56 <210> 447 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 447 tcgtcggcag cgtcagatgt gtataagaga cagtgcagct gaaatggtat taaaactga 59 <210> 448 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 448 gtctcgtggg ctcggagatg tgtataagag acagtgcaaa accaaagaaa tacccctt 58 <210> 449 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 449 tcgtcggcag cgtcagatgt gtataagaga caggctgtca cctctctgtg gtt 53 <210> 450 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 450 gtctcgtggg ctcggagatg tgtataagag acagtagaac ttgggcagct ggtt 54 <210> 451 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 451 tcgtcggcag cgtcagatgt gtataagaga cagccaagca gggaacaaag aaa 53 <210> 452 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 452 gtctcgtggg ctcggagatg tgtataagag acagccgaga cttcctctcc aaga 54 <210> 453 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 453 tcgtcggcag cgtcagatgt gtataagaga caggcctgag ataatgcctc tcatgt 56 <210> 454 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 454 gtctcgtggg ctcggagatg tgtataagag acagactgga cacagtaggc aagg 54 <210> 455 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 455 tcgtcggcag cgtcagatgt gtataagaga cagtgtaatc attcagcatc aaggtg 56 <210> 456 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 456 gtctcgtggg ctcggagatg tgtataagag acagacaaag actgccaagt gaagga 56 <210> 457 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 457 tcgtcggcag cgtcagatgt gtataagaga cagcatccct ccctcctgga aga 53 <210> 458 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 458 gtctcgtggg ctcggagatg tgtataagag acagcccctc tcctatcaca catgc 55 <210> 459 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 459 tcgtcggcag cgtcagatgt gtataagaga cagaggctaa tgatacccca ggt 53 <210> 460 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 460 gtctcgtggg ctcggagatg tgtataagag acagagtctt tgccctggaa cctt 54 <210> 461 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 461 tcgtcggcag cgtcagatgt gtataagaga caggtgtgct ccgtgtgtgc tac 53 <210> 462 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 462 gtctcgtggg ctcggagatg tgtataagag acagaaccag accttggtcc ctatg 55 <210> 463 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 463 tcgtcggcag cgtcagatgt gtataagaga cagcttcaag ggcaacctca aaa 53 <210> 464 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 464 gtctcgtggg ctcggagatg tgtataagag acagatttcc ttgcaagagg gatg 54 <210> 465 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 465 tcgtcggcag cgtcagatgt gtataagaga cagattgcat tcaccacaca agg 53 <210> 466 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 466 gtctcgtggg ctcggagatg tgtataagag acagatgcca aggacaagat ggag 54 <210> 467 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 467 tcgtcggcag cgtcagatgt gtataagaga cagtgggcta ccttgtctgc aat 53 <210> 468 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 468 gtctcgtggg ctcggagatg tgtataagag acagagcctc caaccaagtc tgc 53 <210> 469 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 469 tcgtcggcag cgtcagatgt gtataagaga cagcctggag gaggctgact taaa 54 <210> 470 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 470 gtctcgtggg ctcggagatg tgtataagag acagagggcc tcctggaact tctt 54 <210> 471 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 471 tcgtcggcag cgtcagatgt gtataagaga cagtgcagac cctgaggact tct 53 <210> 472 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 472 gtctcgtggg ctcggagatg tgtataagag acagtggaca gtctgcaacc ttct 54 <210> 473 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 473 tcgtcggcag cgtcagatgt gtataagaga cagtcatgct aagtccaagc aaatact 57 <210> 474 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 474 gtctcgtggg ctcggagatg tgtataagag acaggcagct gcaatggtgg gtaa 54 <210> 475 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 475 tcgtcggcag cgtcagatgt gtataagaga cagttccagc cttcttgctc cttt 54 <210> 476 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 476 gtctcgtggg ctcggagatg tgtataagag acagagtcag ggttgctggg ttga 54 <210> 477 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 477 tcgtcggcag cgtcagatgt gtataagaga cagccctgag ggagtcacag atg 53 <210> 478 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 478 gtctcgtggg ctcggagatg tgtataagag acaggctcaa ggcttctagg tgga 54 <210> 479 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 479 tcgtcggcag cgtcagatgt gtataagaga cagtttgcca tgaagatgtc agg 53 <210> 480 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 480 gtctcgtggg ctcggagatg tgtataagag acagtgctca catgggaatt catc 54 <210> 481 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 481 tcgtcggcag cgtcagatgt gtataagaga cagagaggat gaccgcagaa ttg 53 <210> 482 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 482 gtctcgtggg ctcggagatg tgtataagag acagatgcac aaggtgatgg tgag 54 <210> 483 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 483 tcgtcggcag cgtcagatgt gtataagaga cagcttgacc agcttgtctc agaag 55 <210> 484 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 484 gtctcgtggg ctcggagatg tgtataagag acagactgca ccctgccatc at 52 <210> 485 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 485 tcgtcggcag cgtcagatgt gtataagaga cagaccccac agatcccact gt 52 <210> 486 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 486 gtctcgtggg ctcggagatg tgtataagag acagcacaga caggcttccc ttctt 55 <210> 487 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 487 tcgtcggcag cgtcagatgt gtataagaga cagtgctgaa atggtcttca aaatc 55 <210> 488 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 488 gtctcgtggg ctcggagatg tgtataagag acagtgaatc tgggtgggag tttc 54 <210> 489 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <220> <221> misc_feature <222> (1)..(21) <223> n is a, c, g, or t <220> <221> misc_feature <222> (22)..(22) <223> r is a or g <400> 489 nnnnnnnnnn nnnnnnnnnn nrg 23 <210> 490 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <220> <221> misc_feature <222> (1)..(24) <223> n is a, c, g, or t <220> <221> misc_feature <222> (26)..(27) <223> r is a or g <400> 490 nnnnnnnnnn nnnnnnnnnn nnnngrrt 28 <210> 491 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 491 uucccguuca ccggcagcau 20 <210> 492 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 492 guucaccggc agcauuggug 20 <210> 493 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 493 uuggugggga ccuacuggcu 20 <210> 494 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 494 uaggucccca ccaaugcugc 20 <210> 495 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 495 gcuguccauu ggggagcaug 20 <210> 496 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 496 ucuggcagaa gcuguccauu 20 <210> 497 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 497 gcaagcucac uagugggcgg 20 <210> 498 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 498 agagcaacag tgctgtggcc 20 <210> 499 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotides <400> 499 agagcaacag ugcuguggcc 20

Claims

1. A gene editing system for modifying the sodium voltage-gated channel alpha subunit 9 (SCN9A) gene, the gene editing system comprising: (a) Staphylococcus aureus Cas9 (SaCas9) or a first polynucleotide portion comprising a first nucleotide sequence encoding SaCas9; and (b) a guide RNA (gRNA) or a second polynucleotide portion comprising a second nucleic acid sequence encoding a gRNA, wherein the gRNA comprises the nucleotide sequence of any one of SEQ ID NOs: 11-20.

2. The gene editing system of claim 1, wherein the gRNA of (b) comprises the nucleotide sequence of any one of SEQ ID NOs: 11-16 and 18-20.

3. A gene editing system as described in claim 1 or 2, wherein the gRNA of (b) further comprises a scaffold sequence.

4. A gene editing system as described in claim 3, wherein the scaffold sequence comprises the nucleotide sequence of SEQ ID NO:

41.

5. The gene editing system of any one of claims 1-4, wherein SaCas9 further comprises a nuclear localization signal (NLS).

6. The gene editing system of claim 5, wherein the NLS is SV40 NLS.

7. The gene editing system of any one of claims 1-6, wherein the first polynucleotide portion of (a) and the second polynucleotide portion of (b) are different polynucleotides.

8. The gene editing system of claim 7, wherein at least one of the different polynucleotides is a viral vector.

9. The gene editing system of claim 8, wherein the one or more viral vectors are one or more adeno-associated virus (AAV) vectors.

10. The gene editing system of any one of claims 1-6, wherein a single polynucleotide comprises the first polynucleotide portion of (a) and the second polynucleotide portion of (b).

11. The gene editing system of claim 10, wherein the single polynucleotide is a viral vector.

12. The gene editing system of claim 11, wherein the viral vector is an adeno-associated virus (AAV) vector.

13. A nucleic acid comprising the single polynucleotide of claim 11.

14. A virus particle or a group of virus particles, which collectively contain the gene editing system described in any one of claims 1-12.

15. The viral particle or set of viral particles according to claim 14, wherein the viral particle or set of viral particles is one or more adeno-associated virus (AAV) particles.

16. The use of the following in the preparation of a medicament for editing the sodium voltage-gated channel alpha subunit 9 (SCN9A) gene in a subject in need thereof: (a) The gene editing system according to any one of claims 1 to 12; (b) the nucleic acid of claim 13; or (c) The viral particle or viral particle group according to claim 14 or claim 15.

17. The use according to claim 16, wherein the subject is a human patient suffering from pain.

18. The use of claim 17, wherein the drug contacts neurons of the peripheral nervous system of the subject.

19. The use of claim 16, wherein the drug comprises cells of a subject contacted with the gene editing system of (a), the nucleic acid of (b), or the viral particles of (c).

20. The use according to claim 19, wherein the cells are autologous cells.

21. The use of claim 19, wherein the cell is a heterologous cell.

22. The use of claim 20 or claim 21, wherein the cells are stem cells.

23. The use according to claim 22, wherein the stem cells are iPSC cells or mesenchymal stem cells.

24. The use of any one of claims 19-23, wherein the cell is contacted in vitro with the gene editing system of (a), the nucleic acid of (b) or the viral particle of (c) and then administered to the subject.

25. The use of any one of claims 19-23, wherein the subject is a human patient suffering from pain.

Images