An InDel molecular marker primer for identifying resistance to cabbage clubroot and its application

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to an InDel molecular marker primer and application for identifying resistance to cabbage clubroot. The molecular marker primers are BOCR-InDel-F: GTTACCATTTTCCTTTGCTTTTGTGT and BOCR-InDel-R: ATCTTGAATGGATAGTTTTCAAGATCA. The molecular marker developed by the present invention is based on 282 cabbage genome resequencing information of different genetic backgrounds, and is obtained after specific InDel identification within the disease resistance linkage interval. When verified in a segregated population, the detection result is completely consistent with the single plant resistance. When tested in 96 different varieties of cabbage vegetables (cabbage, broccoli, cauliflower), it shows good applicability, and can be used for identification of cabbage resistance to clubroot or screening in breeding.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to an InDel molecular marker primer for identifying cabbage clubroot resistance and an application thereof. Background Art

[0002] Clubroot disease, caused by Plasmodiophora brassicae, is one of the most serious soil-borne diseases of cruciferous crops. The disease can cause root deformation and swelling, gradually losing the water and nutrient transport function of the root system, and eventually leading to slow growth and death of the plant. Cabbage is an important vegetable crop in the Cruciferae family. Common vegetables such as cabbage (Brassica oleracea var. capitata), cauliflower (B.oleracea var. botrytis), and broccoli (B.oleracea var. italica) are all cabbage variants. Since clubroot resistance genes are only found in the cabbage subspecies B. rapa ssp. rapa, early cabbage breeding for clubroot resistance required the introduction of disease resistance genes from cabbage through distant hybridization. Compared with cabbage breeding for clubroot resistance, fewer cabbage varieties with clubroot resistance have been reported so far (Zhang Xiaoli et al. 2020).

[0003] The breeding of a few clubroot-resistant cabbage vegetable varieties means that clubroot-resistant genes have been successfully introduced into cabbage vegetable varieties, and cabbage breeders can directly use these varieties as resistance sources in breeding in the future. In the process of transferring clubroot-resistant genes from cabbage to cabbage, the cabbage chromosome fragments closely linked to the genes will also be introduced into the cabbage genome. In theory, the published molecular markers located in this linkage segment can also be used in cabbage. However, the genetic background of the materials used in breeding is very complex, and molecular markers located in the same linkage segment as the disease-resistant gene are not applicable. Some susceptible materials that are closely related to the resistance source have DNA variation characteristics in the linkage interval of the disease-resistant gene that are highly similar to the resistance source. Molecular markers developed based on these DNA variations often detect false positives in such susceptible varieties (Ren et al 2019). Therefore, whether the molecular markers are universal needs to be tested on a large number of varieties with different genetic backgrounds.

[0004] Studies on the evolution of Brassica species have shown that Chinese cabbage and cabbage are the two most closely related basic species within the genus (Li Maoteng et al. 2005). Currently, there are few molecular markers reported for clubroot resistance in cabbage breeding, and the molecular markers for clubroot resistance in cabbage are less applicable in cabbage breeding. For example, Yuan Tiancheng tested 28 published molecular markers for clubroot resistance, and none of these markers showed band differences between resistant and susceptible cabbage materials; Shen Shu selected 43 markers from published articles and patents for testing, and only one marker was screened out that had band differences between the cabbage resistance source he selected and three susceptible cabbages. In the BC1 separation generation, the marker The test results were consistent with the strain resistance; He Haiyan conducted genetic analysis on a commercial cabbage variety "GZ87" resistant to clubroot disease and located its resistance gene at the end of chromosome C07. At the same time, two RAPD molecular markers associated with cabbage clubroot disease resistance were screened and converted into SCAR markers OA and YA, of which OA was located in the linkage interval of the disease resistance gene. In the CP segregation population, the test results of the two SCAR markers were consistent with the single plant resistance. The SCAR markers were tested in 8 susceptible control varieties, mainly cabbage, and no false positives were detected, indicating that it is applicable in cabbage breeding (He Haiyan 2018).

[0005] From the above research progress, the currently screened or developed molecular markers for cabbage resistance to clubroot have high accuracy in the genetic isolation populations used. However, in breeding, molecular markers are often needed to screen disease-resistant materials in different varieties. When backcrossing to breed clubroot resistance genes, the genetic backgrounds of the recurrent parents selected by different breeders are also different. When the above markers are tested for applicability, the number of susceptible varieties used is small and mainly cabbage varieties, which lacks representativeness and cannot prove that they are universal in cabbage vegetable breeding. Therefore, at this stage, there is still a lack of cabbage resistance molecular markers that have been widely verified and have universal applicability. Summary of the invention

[0006] The object of the present invention is to provide an InDel molecular marker primer for identifying cabbage clubroot resistance. The primers of the molecular marker BOCR-InDel are: BOCR-InDel-F: GTTACCATTTTCCTTTGCTTTTGTGT and BOCR-InDel-R: ATCTTGAATGGATAGTTTTCAAGATCA.

[0007] Another object of the present invention is to provide an application of InDel molecular marker primers for identifying clubroot resistance in cabbage, which can be used to breed clubroot-resistant varieties of different cabbage varieties, or to identify clubroot-resistant varieties. In order to achieve the above object, the present invention adopts the following technical measures:

[0008] Acquisition of molecular marker primers for identification of clubroot disease in cruciferous plants:

[0009] 1. Whole genome resequencing was performed on three commercial varieties resistant to clubroot. At the same time, 282 whole genome resequencing data of various cabbage varieties such as cabbage, broccoli, cauliflower, etc. were obtained from the NCBI database.

[0010] 2. Using the GATK algorithm (implemented by sentieon software), the V1 version of the third-generation genome assembly sequence of broccoli HDEM, Brassica oleracea cv. HDEM V1 (NCBI accession number: GCA_900416815.2) was used as the reference genome (Belser et al 2018) to analyze all the sequencing data obtained in 1 to obtain the genotype results of InDel and SNP (VCF file).

[0011] 3. Based on the SNP genotype results obtained in 2, 282 cabbage variants and 3 clubroot-resistant cabbage commercial varieties were clustered one by one in the whole genome with 1Mb as the unit and 0.5Mb as the sliding distance. It was successfully identified that the three disease-resistant varieties were clustered into one group on two consecutive chromosome intervals of chromosome 7, C07:51.5-52.5Mb and C07:52-53Mb ( Figure 2 ), therefore, we developed molecular markers using C07:51.5-53Mb as the linkage interval where the disease resistance gene was located.

[0012] 4. Within the linkage interval determined in 3, the InDel genotype results in 2 were used to search for InDel mutations that only existed in disease-resistant varieties. Finally, a 4bp InDel mutation was identified at C07:52560844 (the reference genome base was ATACT, and the mutant base was A), and a 28bp InDel mutation was identified at C07:52561054 (the reference genome base was ATTCAATTGACACCAGAGGTGTCTGGTGG, and the mutant base was T). Both InDel mutations met the following characteristics: the genotypes of the three clubroot-resistant varieties were all heterozygous mutants; there were no heterozygous or homozygous mutants in the other 282 different cabbage variety materials.

[0013] 5. A molecular marker BOCR-InDel was designed for the InDel mutation identified in 4, as follows: the forward primer of the marker was designed upstream of C07:52560844, and the reverse primer was designed downstream of C07:52561054, so that the difference in primer amplification bands was 32bp, forward primer BOCR-InDel-F: GTTACCATTTTCCTTTGCTTTTGTGT, reverse primer BOCR-InDel-R: ATCTTGAATGGATAGTTTTCAAGATCA, the disease-resistant band was 302bp; the disease-susceptible band was 334bp.

[0014] The invention discloses an application of molecular marker primers for identifying clubroot resistance of cruciferous plants in identifying clubroot resistance of cabbage; the invention comprises using conventional methods in the art to perform PCR on the cabbage variety to be tested, thereby obtaining a determination of the resistance of the cabbage variety to clubroot.

[0015] In the above-mentioned application, the cabbage includes the varieties in Table 1 in the specific implementation manner, 119 varieties in NCBI accession number: PRJNA312457, and 163 varieties in NCBI accession number: PRJNA700684.

[0016] Compared with the prior art, the present invention has the following advantages:

[0017] The cabbage clubroot resistance molecular marker BOCR-InDel developed by the present invention is developed on the basis of fully considering the polymorphic information of 282 resources within the cabbage species and avoiding the interference of kinship to the greatest extent. Compared with the prior art, the molecular marker disclosed by the present invention is the most universal molecular marker for identifying clubroot resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The figure is a flow chart for the development of the anti-clumproot disease molecular markers of the present invention.

[0019] Figure 2 This is the clustering result of 3 clubroot-resistant varieties and 282 cabbage variant resources. The gray fonts ruixue, yacui91 and weibaF1 are the clubroot-resistant varieties Ruixue, Yacui91 and WeibaF1 respectively.

[0020] Among them: A is the clustering result in the interval of C07: 51.5-52.5Mb;

[0021] B is the clustering result in the interval of C07:52-53Mb;

[0022] Figure 3The results of inoculation and identification of disease-resistant and disease-susceptible individual plants in the segregating population obtained by hybridizing the heterozygous clubroot-resistant broccoli variety "Yacui 91" with the susceptible broccoli inbred line BL-83 were presented.

[0023] CP-R represents the disease-resistant individual in the isolated population, CP-S represents the disease-susceptible individual in the isolated population, and BL-83 is the susceptible control.

[0024] Figure 4 The detection results of BOCR-InDel in the isolated population.

[0025] Among them: the information of each lane in A is: M, DNA ruler; 1, Yacui 91 (positive control); 2, BL-83 (negative control); 3-20 are the individual plants in the isolated population that showed disease resistance after inoculation.

[0026] The information of each lane in B is as follows: M, DNA ruler; 1, Yacui 91 (positive control); 2, BL-83 (negative control); 3-19 is the individual plant that showed susceptible disease after inoculation in the isolated population.

[0027] Figure 5 This is a diagram showing the detection effect of BOCR-InDel in cabbage, broccoli and cauliflower varieties;

[0028] The first two lanes in each row are DNA marker and positive control, respectively. The positive control in the first row is Yacui 91, the positive control in the second row is Ruixue, and the positive control in the third row is Weiba F1. Lanes 35 and 36 are clubroot-resistant cabbage varieties 210717 and 20205 provided by the Vegetable Research Center of Beijing Academy of Agricultural and Forestry Sciences, respectively. The other lanes are 94 susceptible varieties provided by the 2021 Wuhan Seed Expo. For specific information, see Appendix 1. DETAILED DESCRIPTION

[0029] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or materials, unless otherwise specified, are all from commercial channels.

[0030] Embodiment 1:

[0031] Acquisition of an InDel molecular marker for identifying resistance to cabbage clubroot:

[0032] 1. The whole genome resequencing data of three clubroot-resistant commercial varieties: cabbage "Weiba F1" (from Shouguang Gedun Agricultural Technology Co., Ltd.), cauliflower "Ruixue" (from Shouguang Gedun Agricultural Technology Co., Ltd.) and broccoli "Yacui 91" (from Shouguang Syngenta Seed Co., Ltd.) were obtained using the second-generation sequencing technology. 119 (NCBI accession number: PRJNA312457) and 163 (NCBI accession number: PRJNA700684) whole genome resequencing data of 282 materials including various cabbage varieties such as cabbage, broccoli, cauliflower, etc. were obtained from the NCBI database.

[0033] 2. Using the GATK algorithm (implemented by sentieon software), the V1 version of the third-generation genome assembly sequence of broccoli HDEM, Brassica oleracea cv. HDEM V1 (NCBI accession number: GCA_900416815.2) was used as the reference genome (Belser et al 2018) to analyze all the sequencing data obtained in 1 to obtain the genotype results of InDel and SNP (VCF file).

[0034] 3. Based on the SNP genotype results obtained in 2, 282 cabbage variants and 3 clubroot-resistant cabbage commercial varieties were clustered one by one in the whole genome with 1Mb as the unit and 0.5Mb as the sliding distance. It was successfully identified that the three disease-resistant varieties were clustered into one group on two consecutive chromosome intervals of chromosome 7, C07:51.5-52.5Mb and C07:52-53Mb ( Figure 2 ), therefore, we developed molecular markers using C07:51.5-53Mb as the linkage interval where the disease resistance gene was located.

[0035] 4. Within the linkage interval determined in 3, the InDel genotype results in 2 were used to search for InDel mutations that only existed in disease-resistant varieties. Finally, a 4bp InDel mutation was identified at C07:52560844 (the reference genome base was ATACT, and the mutant base was A), and a 28bp InDel mutation was identified at C07:52561054 (the reference genome base was ATTCAATTGACACCAGAGGTGTCTGGTGG, and the mutant base was T). Both InDel mutations met the following characteristics: the genotypes of the three clubroot-resistant varieties were all heterozygous mutants; there were no heterozygous or homozygous mutants in the other 282 different cabbage variety materials.

[0036] 5. A molecular marker BOCR-InDel was designed for the InDel mutation identified in 4, as follows: the forward primer of the marker was designed upstream of C07:52560844, and the reverse primer was designed downstream of C07:52561054, so that the difference in primer amplification bands was 32bp, forward primer BOCR-InDel-F: GTTACCATTTTCCTTTGCTTTTGTGT, reverse primer BOCR-InDel-R: ATCTTGAATGGATAGTTTTCAAGATCA, the disease-resistant band was 302bp; the disease-susceptible band was 334bp.

[0037] Embodiment 2:

[0038] Correlation between BOCR-InDel molecular markers and clubroot resistance:

[0039] The clubroot-resistant varieties collected are all commercial F1 varieties with cytoplasmic male sterility. The heterozygous clubroot-resistant commercial F1 was used as the female parent ("Yacui 91") and hybridized with the susceptible material (susceptible broccoli inbred line BL-83). Since the female parent is heterozygous resistant, the hybrid offspring with the susceptible material will show resistance segregation. The dominant physiological subspecies 4 of the popular clubroot pathogen of cruciferous vegetables was used to identify the segregated population obtained from the hybridization:

[0040] The root nodules of the root knot fungus stored at -20℃ were taken out, thawed and crushed, and mixed with dry peat substrate at a ratio of 1:20. After being placed in a dark environment at 25℃ for 48 hours, they were sown. The seedlings were grown in a green room with an ambient temperature of 25℃ / 20℃ (day / night) and a photoperiod of 14 / 10 hours (light / darkness). The substrate was kept moist during this period. After 4 weeks, the roots of the seedlings were cleaned and the disease was observed.

[0041] The results showed that typical resistant and susceptible plants were isolated in the progeny ( Figure 3 ), CP-R represents the disease-resistant individual in the isolated population, CP-S represents the disease-susceptible individual in the isolated population, and BL-83 is the susceptible control.

[0042] The progeny were detected using the molecular marker primers in Example 1. The PCR reaction system: total volume 10 μL, including: 10X Easy Taq buffer 1.0 μL, dNTP (10 mM) 0.2 μL, forward and reverse primers (10 μM) 0.2 μL each, DNA template (50-200 ng / μL) 1 μL, Easy Taq enzyme (5 U / μL) 0.1 μL, ddH2O 7.3 μL;

[0043] BOCR-InDel-F:GTTACCATTTTCCTTTTGCTTTTGTGT,

[0044] BOCR-InDel-R:ATCTTGAATGGATAGTTTTCAAGATCA;

[0045] PCR reaction program: 94°C pre-denaturation for 3 min, 94°C denaturation for 30 s, 52°C annealing for 30 s, 72°C extension for 30 s, 35 cycles, 72°C extension for 5 min, 4°C storage for 10 min;

[0046] Gel electrophoresis detection: PCR products were electrophoresed on 3% agarose gel at 130 V for 50 min, and the results were displayed on a gel imaging system.

[0047] The results are as follows Figure 4 As shown, in the disease-resistant progeny, all detected were heterozygous with bands of 302bp and 334bp; in the disease-susceptible progeny, all detected were homozygous with a band of 334bp.

[0048] The above results indicate that the marker developed in the present invention is linked to clubroot resistance in the segregating population.

[0049] Embodiment 3:

[0050] Universality of BOCR-InDel molecular markers:

[0051] The tested varieties are shown in Table 1. The cabbage vegetable varieties consist of 96 commercial varieties of cabbage, broccoli and cauliflower, including 2 disease-resistant varieties and 94 disease-susceptible varieties.

[0052] The results are as follows Figure 5 As shown, the molecular marker primers designed by the present invention were used to detect 96 varieties of cabbage vegetables (cabbage, broccoli, cauliflower), and the cabbage variety 210717 with high resistance to clubroot was detected as pure resistance ( Figure 5 Middle lane 35, 302 bp), the moderately resistant cabbage variety 20205 was detected as heterozygous ( Figure 5 No disease-resistant bands were detected in 94 susceptible varieties.

[0053] The validation results showed that the newly developed molecular markers for clubroot resistance have wide applicability in cabbage vegetable breeding.

[0054] Table 1

[0055]

[0056]

[0057] Sequence Listing <110> Institute of Economic Crops, Hubei Academy of Agricultural Sciences <120> An InDel molecular marker primer for identifying resistance to cabbage clubroot and its application <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 26 <212> DNA <213> Artificial Sequence <400> 1 gttaccattttcctttgcttttgtgt 26 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence <400> 2 atcttgaatggatagttttc aagatca 27

Claims

1. Application of primers in identification of clubroot resistance of cabbage vegetables, the primers are: BOCR-InDel-F: GTTACCATTTTCCTTTGCTTTTGTGT and BOCR-InDel-R: ATCTTGAATGGATAGTTTTCAAGATCA, cabbage vegetables are tested, high-resistant varieties are homozygous with a band of 302bp, medium-resistant varieties are heterozygous with bands of 302bp and 334bp, and susceptible varieties are homozygous with a band of 334bp. The cabbage vegetables are cabbage, kale or cauliflower.

2. Application of primers in breeding of cabbage vegetables with resistance to clubroot disease, the primers are: BOCR-InDel-F: GTTACCATTTTCCTTTGCTTTTGTGT and BOCR-InDel-R: ATCTTGAATGGATAGTTTTCAAGATCA, the primers are used to screen disease-resistant materials, and cabbage vegetables are tested. High-resistant varieties are homozygous with a band of 302bp, medium-resistant varieties are heterozygous with bands of 302bp and 334bp, and susceptible varieties are homozygous with a band of 334bp. The cabbage vegetables are cabbage, kale or cauliflower.

3. The use according to claim 1 or 2, wherein the cabbage vegetables are: the varieties in NCBI accession number: PRJNA312457, the varieties in NCBI accession number: PRJNA700684 and the following varieties: 。

Images