Universal chimeric antigen receptor-expressing immune cells and methods of making and therapeutic uses thereof

Abstract

The present invention relates to universal chimeric antigen receptor-expressing immune cells targeting a variety of diverse antigens and methods of making the same and their use in the treatment of cancer, infection and autoimmune disease. In particular, the present invention relates to immune cell-based anti-cancer therapeutics and methods of using the same in the treatment of cancer.

Description

[0001] This application is a divisional application of the application with international application number PCT / EP2015 / 069527, entered into the Chinese national phase on February 13, 2017, application number 201580043322.7, entitled "Universal chimeric antigen receptor-expressing immune cells targeting a multitude of antigens and methods of making the same and their use in the treatment of cancer, infections and autoimmune diseases". TECHNICAL FIELD

[0002] The present invention relates to immune cell-based therapeutics and methods of using the same in the treatment of cancer, infections and autoimmune diseases. BACKGROUND

[0003] Chimeric antigen receptors (CARs) are artificial receptors composed of a binding moiety providing antigen specificity and one or several signaling chains derived from immune receptors (Cartellieri et al. J. Biomed. Biotechnol. doi: 10.1155 / 2010 / 956304 (2010)). These two major CAR domains are connected by a linker peptide chain comprising a transmembrane domain, which anchors the CAR in the cytoplasmic membrane. Immune cells, in particular T and NK lymphocytes, can be genetically modified to express a CAR inserted in their plasma membrane. If such CAR-modified immune cells encounter other cells or tissue structures expressing or decorated with the appropriate target for the CAR binding moiety, the CAR-modified immune cells crosslink with the target upon binding of the CAR binding moiety to the target antigen. Crosslinking induces a signaling pathway via the CAR signaling chain, which will change the biological properties of the CAR-implanted immune cell. For example, CAR triggering in effector CD4+ and CD8+ T cells will activate typical effector cell functions like secretion of lytic compounds and cytokines, which will eventually lead to killing of the respective target cell. Adoptive transfer of immune cells engineered with chimeric antigen receptors (CARs) is currently considered as a highly promising therapeutic option to treat otherwise incurable malignant, infectious or autoimmune diseases. The first clinical trials proved that this therapeutic strategy is both safe and feasible (Lamers et al. J. Clin. Oncol. 24 e20-e22 (2006), Kershaw et al. Clin. Cancer Res. 12 6106-6115 (2006)). In recently ongoing trials, a majority of patients with advanced B-cell derived tumors showed complete or at least partial response to treatment with autologous T cells equipped with a CD19-specific CAR, which lasted for several months (Brentjens et al. Blood. 118 4817-4828 (2011), Sci. Transl. Med. 20(5) doi: 10.1126 / scitranslmed.3005930 (2013.), Kalos et al. 2011 Sci. Transl. Med. 3(95) doi: 10.1126 / scitranslmed.3002842, Grupp et al. N. Engl. J. Med. 368: 1509-1518 (2013)).

[0004] However, conventional CAR technology is accompanied by a number of major issues which need to be solved before this therapeutic approach can be widely applied in clinical therapy. First, several safety issues have to be addressed. So far, the immune response after infusion of T cells engineered with conventional CARs is difficult to control. Especially, the unexpected expression of the target gene on healthy tissues can provoke a rapid and intense immune reaction of the engineered T cells against healthy cells, which can lead to severe side effects (Lamers et al. J. Clin. Oncol. 24 e20-e22 (2006), Morgan et al. Mol. Ther. 18:843-851 (2010). Another disadvantage of conventional CAR technology is the limitation of the engineered T cells to retarget a single antigen. Such a mono-therapeutic approach implies the risk of generating tumor escape variants which lose the target antigen during therapy. Tumor escape variants have been observed after several months under conventional CAR T cell therapy in clinical trials (Grupp et al. N. Engl. J. Med. 368: 1509-1518 (2013)).

[0005] WO 2012082841 A2 discloses universal anti-tag chimeric antigen receptor expressing T cells and methods of treating cell-associated disorders, e.g. cancer.

[0006] Further, WO 2013044225 A1 discloses universal immune receptors expressed by T cells targeting a variety of antigens.

[0007] Both approaches describe the use of modified T cells expressing universal anti-tag immune receptors. By applying modules binding to these surface antigens and carrying the respective tag, these T cells can be redirected to disease-associated cell surface antigens. The problem arising with the above described methods is that the redirection of the genetically modified T cells using exogenous tags can be immunogenic, which puts the patient at risk and negatively influences the efficacy of the therapy.

[0008] It is therefore an object of the present application to provide genetically modified immune cells which utilize endogenous tags based on nucleoproteins allowing a redirection against a variety of disorders in a safe and efficient manner. It is a further object of the present application to provide methods of treatment of a variety of cell-associated disorders, wherein the length and intensity of the treatment can be adjusted in a simple manner. SUMMARY

[0009] The present application provides a universal, modular, anti-tag chimeric antigen receptor (UniCAR) system which allows the redirection of UniCAR engrafted immune cells to a variety of antigens. The system utilizes a gene therapy platform to generate immune cells capable of recognizing a variety of antigens and which are of broad and valuable clinical significance for use in immune cell-based therapies, in particular T and NK cell-based therapies.

[0010] In a first aspect, the present application provides an isolated nucleic acid sequence encoding a universal chimeric antigen receptor, wherein the receptor comprises three domains, wherein the first domain is a tag binding domain, the second domain is a linker peptide chain comprising an extracellular hinge and a transmembrane domain and the third domain is a signal transduction domain, and wherein the tag binding domain binds to a tag derived from any human nuclear protein. In particular, a suitable tag is a peptide sequence from a nuclear antigen which cannot be accessed and bound by the corresponding tag binding domain in the environment of the natural protein under physiological conditions. In addition, the peptide sequence should not be a target of autoantibodies in autoimmune patients, thus making it less likely that the tag is immunogenic in the environment of the universal chimeric receptor. An optional fourth domain is a short peptide linker in the extracellular part of the UniCAR which forms a linear epitope to which a monoclonal antibody (mab) specifically binds. This additional domain is not required for functionality of the UniCAR system, but can add additional clinical benefit to the present application. Preferably the present application provides an isolated nucleic acid sequence encoding a universal chimeric antigen receptor of the present application, wherein the nucleic acid sequence encodes an artificial chimeric fusion protein and wherein the nucleic acid sequence is provided as a cDNA.

[0011] In another aspect, the present application provides a target module consisting of a binding moiety specific for a certain human cell surface protein or protein complex, and a tag, wherein the tag is derived from any human nuclear protein.

[0012] In another aspect, the present application provides a nucleic acid encoding a target module of the present application. Preferably the present application provides an isolated nucleic acid sequence encoding a target module of the present application, wherein the isolated nucleic acid is provided as a cDNA.

[0013] In another aspect, the present application provides a cell comprising a nucleic acid encoding a universal chimeric antigen receptor of the present application, the receptor comprising three domains, wherein the first domain is a tag binding domain, the second domain is a linker peptide chain comprising an extracellular hinge and a transmembrane domain and the third domain is a signal transduction domain, and wherein the tag binding domain binds to a tag derived from any human nuclear protein.

[0014] In another aspect, the present application provides a vector comprising a nucleic acid encoding a universal chimeric antigen receptor of the present application, wherein the universal chimeric antigen receptor comprises three domains, wherein the first domain is a tag binding domain, the second domain is a linker peptide chain comprising an extracellular hinge and a transmembrane domain and the third domain is a signal transduction domain, and wherein the tag binding domain binds to a tag derived from any human nuclear protein.

[0015] In another aspect, the present application provides a kit comprising a vector of the present application comprising a nucleic acid sequence encoding a universal chimeric antigen receptor of the present application and a target module of the present application and / or a vector of the present application encoding an isolated nucleic acid sequence of a target module of the present application.

[0016] The present application also includes pharmaceutical compositions comprising the cells and target modules of the present application in combination with a pharmaceutically acceptable diluent or carrier. Preferably, the pharmaceutical compositions are in a form suitable for intravenous administration.

[0017] Preferably, the compositions comprise cells comprising a nucleic acid encoding a universal chimeric antigen receptor of the present application and a target module of the present application.

[0018] The pharmaceutical compositions of the present application comprise various administration forms. The pharmaceutical compositions are preferably administered parenterally, particularly intravenously. In one embodiment of the present application, the parenteral pharmaceutical compositions are in a form suitable for injection. Particularly preferred compositions are thus solutions, emulsions or suspensions of the cells and target modules in a pharmaceutically acceptable diluent or carrier.

[0019] As a carrier, water, buffered water, 0.4% saline solution, 0.3% glycine and similar solvents are preferably used. The solutions are sterile. The pharmaceutical compositions are sterilized by conventional, well-known techniques. The compositions preferably contain pharmaceutically acceptable excipients, for example, those necessary to provide a condition close to physiological and / or to increase the stability of the target modules, for example, agents and buffers for pH adjustment, agents for toxicity adjustment and the like, preferably selected from sodium acetate, sodium chloride, potassium chloride, calcium chloride and sodium lactate. The concentration of the target modules of the present application in these formulations is variable depending on the application; they are preferably less than 0.01% by weight, preferably at least 0.1% by weight, more preferably between 1 and 5% by weight, and they are mainly selected based on the volume, viscosity and the like or in accordance with the corresponding administration mode.

[0020] The pharmaceutical compositions must be sterile and stable under the conditions of manufacture and storage. The compositions can be formulated as solutions, microemulsions, dispersions, in liposomes or in other ordered structures suitable for such purposes and known to the skilled person.

[0021] The cells and target modules of the present application are preferably introduced into a composition suitable for parenteral administration. Preferably, the pharmaceutical composition is a buffered injectable solution containing between 0.001 and 500 mg / ml of the antibody, especially preferred between 0.001 and 250 mg / ml of the target module, in particular together with 1 to 500 mmol / l (mM) of a buffer. The injectable solution can exist in a liquid state. The buffer can preferably be histidine (preferably 1 to 50 mM, especially preferred 5 to 10 mM) at a pH value of 5.0 to 7.0 (especially preferred pH 6.0).

[0022] Other suitable buffers include, but are explicitly not limited to, sodium succinate, sodium citrate, sodium phosphate or potassium phosphate. Preferably, the liquid administration form uses 0 to 300 mM, especially preferred 150 mM sodium chloride. In the liquid administration form, a stabilizer is preferably used, especially preferred between 1 and 50 mM L-methionine (preferably between 5 and 10 mM).

[0023] The typical dose rate per m2 per day is between 1 μg and 1000 mg, preferably 10 μg to 1 mg, the dose being administered one or more times per day or continuously over a period of several weeks.

[0024] In another aspect, the present application provides the use of the cells of the present application comprising a nucleic acid encoding the universal chimeric antigen receptor of the present application and the target module of the present application for stimulating a universal chimeric antigen receptor-mediated immune response in a mammal. Preferably, the present application provides the use of the cells of the present application comprising a nucleic acid encoding the universal chimeric antigen receptor of the present application and the target module of the present application as a medicament, more preferably as a medicament for the treatment of cancer or an autoimmune disease. Autoimmune diseases result from an abnormal immune response (autoimmunity) of the body to substances and tissues that normally exist in the body.

[0025] The present application also includes the use of the cells of the present application and the target module of the present application for the manufacture of a medicament for therapeutic and / or diagnostic use in the case of cancer or an autoimmune disease.

[0026] The present application also includes a method for treating a human suffering from cancer or an autoimmune disease by administering the cells of the present application and the target module of the present application.

[0027] For therapeutic use, a sterile pharmaceutical composition containing a pharmacologically effective amount of the cells of the present application and the target module of the present application is administered to a patient in order to treat the aforementioned maladies.

[0028] The present application will be explained in more detail by means of the following figures and embodiments, but the present application is not restricted to them. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1schematic drawing of the universal chimeric antigen receptor (UniCAR),

[0030] Figure 2 schematic drawing of the universal chimeric antigen receptor (UniCAR) platform for antigen-specific immune cell retargeting,

[0031] Figure 3 schematic map of the lentiviral vector pLVX-EFla-IRES-ZsGreenl,

[0032] Figure 4 schematic map of the lentiviral packaging plasmid psPAX2,

[0033] Figure 5 schematic map of the envelope plasmid pMD2.G,

[0034] Figure 6 a graph depicting UniCAR surface expression shown by detection with a monoclonal antibody against the optional fourth domain,

[0035] Figure 7 a graph showing effector function of UniCAR engineered T cells against tumor cells expressing prostate stem cell antigen and prostate membrane antigen.

[0036] Figure 8 a graph showing concentration-response curves for different target modules,

[0037] Figure 9 a graph showing effector function of UniCAR engineered T cells against acute myeloid leukemia,

[0038] Figure 10 a graph depicting T cell reorientation of UniCARs implanted simultaneously against two antigens, and

[0039] Figure 11 a graph depicting in vivo pharmacokinetics of bispecific aCD123-CD33 target modules. DETAILED DESCRIPTION

[0040] Effector cells

[0041] The effector cells used in the methods of the present application can be autologous, syngeneic or allogeneic, the choice depending on the disease to be treated and the means available to do so. Suitable effector cell populations that can be used in the methods include any immune cell, such as T cells, including regulatory T cells, NK cells and macrophages, that have cytolytic, cytotoxic or immunosuppressive activity. In one aspect, the effector cells are from a certain HLA background and are utilized in autologous or allogeneic systems. The effector cells can be isolated from any source, including from a tumor graft of the treated subject or from cells within a tumor of the treated subject. In the following, the term "effector cell" refers to any of the aforementioned immune cells of any kind that are genetically altered to express a UniCAR on the cell surface.

[0042] Universal chimeric antigen receptor (UniCAR)

[0043] The UniCAR expressed by the effector cells used in the methods of the present application allows for modular, highly flexible and tightly controllable retargeting of the UniCAR-expressing immune cells in an antigen-specific manner. The only requirement for the UniCAR used in the methods is (i) that the UniCAR has a binding specificity for a special tag that can be engaged with a target module that in turn binds to a cell surface protein or an extracellular structure, and (ii) that the immune cell can be engineered to express the UniCAR.

[0044] The UniCAR comprises three domains Figure 1). The first domain is a tag binding domain. This domain is typically present at the amino terminal end of the polypeptide comprising the UniCAR. The location of the tag binding domain at the amino terminal end allows the tag binding domain to have unobstructed access to the tagged target module bound to a target cell. The tag binding domain is typically, but not limited to, an antibody or an antigen binding fragment thereof. The identity of the antibody or fragment is limited only by the identity of the tag of the tagged target module. The tag can be derived from any human nuclear protein for which an antibody or other binding domain is available. The antibody can be obtained from any animal species, but is preferably obtained from a mammal such as a human, simian, mouse, rat, rabbit, guinea pig, horse, cow, sheep, goat, pig, dog, or cat. Preferably, the antibody is a human or humanized antibody. There is also no limitation on the specific class of antibody that can be used, including IgGl, IgG2, IgG3, IgG4, IgM, IgAl, IgA2, IgD, and IgE antibodies. Antibody fragments include single chain variable fragments (scFv), single chain antibodies, F(ab')2 fragments, fab fragments, and fragments produced by Fab expression libraries, the only limitation being that the antibody fragment retains the ability to bind the selected tag. The antibody can also be a polyclonal, monoclonal, or chimeric antibody, such as a non-human antigen binding region (e.g., F(ab')2 or hypervariable region) transferred into the framework of a human antibody by recombinant DNA techniques to produce a substantially human molecule. From this, antigen binding fragments such as scFv can be prepared. Antibodies against a selected tag can be produced by immunizing various hosts, including, but not limited to, goats, rabbits, rats, mice, humans, by injection with the particular protein or any portion, fragment, or oligopeptide of the protein that retains the immunogenic properties of the protein.

[0045] Depending on the host species, various adjuvants can be used to increase the immunological response. Such adjuvants include, but are not limited to, detoxified heat-labile toxin from E. coli, Freund's adjuvant, mineral gels such as aluminum hydroxide, and surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol. BCG (Bacillus Calmette-Guerin) and Corynebacterium parvum are also potential adjuvants. Antibodies and fragments thereof can be prepared using any technique that provides for the production of antibody molecules, such as monoclonal antibody production by a passaged cell line in culture. Such techniques include, but are not limited to, the hybridoma technique originally described by Koehler and Milstein (Nature 256:495-497 (1975)), the human B cell hybridoma technique (Kosbor et al., Immunol Today 4:72 (1983); Cote et al., Proc Natl. Acad. Sci 80:2026-2030 (1983)), and the EBV hybridoma technique (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss Inc, New York N.Y., pp. 77-96 (1985)). Techniques developed for the production of "chimeric antibodies," i.e., splicing of mouse antibody genes with human antibody genes to create molecules with appropriate antigen specificity and biological activity, can also be used (Morrison et al., Proc Natl. Acad. Sci 81 :6851-6855 (1984); Neuberger et al., Nature 312:604-608 (1984); Takeda et al., Nature 314:452-454 (1985)). Alternatively, techniques described for the production of single chain antibodies can be adapted to produce single chain antibodies specific for the tag.

[0046] In one aspect, the tag binding domain is a single chain variable fragment (scFv). ScFv comprise the variable regions of the heavy (VH) and light (VL) chains of an antibody, which are typically connected via a short peptide of ten to about 25 amino acids. The linker can connect the N-terminus of the VH with the C-terminus of the VL, or vice versa.

[0047] As noted above, the binding specificity of the tag binding domain will depend on the identity of the tag with which the protein engages to bind the target structure.

[0048] In a preferred embodiment, the tag is a short linear epitope from the human nuclear La protein (E5B9), the tag binding domain can constitute an antibody or an antibody-derived antigen binding fragment, such as a single chain variable fragment (scFv) binding to the corresponding La epitope (5B9). The use of the 5B9 anti-La epitope in the UniCAR system is advantageous since the anti-La epitope scFv does not interact with the native La protein bound to the cell surface under normal physiological conditions. Thus, an unwanted interaction of the UniCAR-expressing immune cells, such as T or NK cells, with the 5B9 epitope on the native La is not possible. This leads to a minimization of the risk of uncontrolled on-target off-site toxicities by UniCAR-expressing immune cells, such as the release of toxic levels of cytokines, variously known as cytokine storm or cytokine release syndrome (CRS). The reactivity of the corresponding mab to denatured La protein but not to native La protein in Western blots and in immunoprecipitation experiments was demonstrated Figure 3 ). Furthermore, while Sjogren's syndrome and systemic lupus erythematosus patients produce autoantibodies against various La epitopes, no autoantibodies against E5B9 were identified, which suggests that this epitope is not immunogenic (Yiannaki et al., Clin Exp Immunol., 112(1): 152-8 (1998).

[0049] The second domain of the UniCAR is an extracellular hinge and transmembrane (TM) domain. The hinge domain allows the UniCAR to project from the surface of the effector cell for optimal binding to its specific tag. The TM domain anchors the UniCAR into the cell membrane of the effector cell. Exemplary hinge and TM domains include, but are not limited to, the hinge and transmembrane regions of the human CD28 molecule, the CD8a chain, NK cell receptors such as natural killer group 2D (NKG2D), or portions of antibody constant regions and combinations of various hinge and TM domains.

[0050] The third domain, when present, is a signal transduction domain. This domain transmits a cellular signal into the effector cell upon cross-linking of the UniCAR-bearing effector cell with a cell or extracellular structure. The cross-linking between effector cell and target cell is mediated and depends on the presence of (i) a target module that binds to a specific binding moiety on the target cell or extracellular structure of the target cell and carries a tag, and (ii) a UniCAR expressed on the surface of the effector cell that can recognize and bind the tag comprised in the target module. Effector cell activation includes induction of cytokines or chemokines and activation of cytolytic, phagocytic or suppressive activity of the effector cell. Exemplary effector cell signal transduction domains include, but are not limited to, the cytoplasmic regions of CD28, CD137 (41BB), CD134 (OX40), DAP10 and CD27, which serve to increase T cell survival and proliferation; inhibitory receptors such as Programmed cell death-1 (PD-1) and Cytotoxic T-Lymphocyte Antigen 4 (CTLA-4); and the cytoplasmic regions of CD3 chains (e.g. CD3 zeta), DAP12 and Fc receptors, which induce T and NK cell activation. One or more signal transduction domains can be comprised in the UniCAR, e.g. two, three, four or more immune cell activation or costimulatory domains.

[0051] In another embodiment, the UniCAR comprises a fourth domain, which is a short peptide linker Figure 1 ) in the extracellular part of the UniCAR. Its functionality is required, i.e. this fourth domain forms a linear epitope that allows binding of specific monoclonal antibodies with moderate avidity. One or more linear epitopes can be comprised in the fourth domain and they can be located as a linker within the tag binding domain, between the tag binding domain and the constituent part of the extracellular linker or the extracellular hinge domain. By means of the optional fourth domain, UniCAR engrafted immune cells can be specifically stimulated, such that UniCAR engrafted immune cells preferentially proliferate and persist longer in vitro or in vivo compared to non-engrafted immune cells. The fourth domain can also be used to purify UniCAR engrafted immune cells from mixed cell populations. It can also be used to attenuate UniCAR engrafted immune cell mediated immune responses and to deplete UniCAR engrafted immune cells in vivo.

[0052] To allow expression on the cell surface of the effector cell, a signal peptide (sometimes also called signal sequence, signal leader or leader peptide) is placed in front of the tag binding domain at the N-terminus of the UniCAR nucleic acid sequence. Signal peptides direct proteins to the secretory pathway either co-translationally or post-translationally. For this purpose, signal peptides from proteins of various species can be utilized, however to avoid immunogenic reactions, leader peptides from proteins like CD28, CD8a, IL-2 or the heavy or light chain of antibodies of human origin are preferred.

[0053] Target module

[0054] The target module consists of a binding moiety specific for a certain human cell surface protein or protein complex and a tag. The target module is administered to the subject prior, simultaneously or after administration of the UniCAR-expressing effector cells. Alternatively, the UniCAR-expressing effector cells can be decorated with the target module before infusion into the recipient. The binding moiety of the target module includes, but is not limited to, antibodies or fragments thereof binding to antigens such as surface antigens like CD2, CD3, CD4, CD8, CD10, CD19, CD20, CD22, CD23, CD33, CD38, CD44, CD52, CD99, CD123, CD274 and TIM-3, members of the epidermal growth factor receptor family (erb1, erb2, erb3, erb4 and mutants thereof), members of the ephrin receptor family (EphA1-10, EphB1-6), so-called prostate-specific antigens (e.g. prostate stem cell antigen PSCA, prostate-specific membrane antigen PSMA), embryonic antigens (e.g. carcinoembryonic antigen CEA, fetal acetylcholine receptor), members of the vascular endothelial growth factor family (VEGFR 1-3), epithelial cell adhesion molecule EpCAM, alpha-fetoprotein AFP, members of the mucin family (e.g. MUC1, MUC16), follicle-stimulating hormone receptor (FSHR), human high molecular weight-melanoma-associated antigen (HMW-MAA), folate binding protein FBP, a-folate receptor, ligands of the NKG2D receptor, members of the epithelial glycoprotein family (e.g. EGP-2, EGP-4), disialogangliosides (e.g. GD2, GD3), members of the carbonic anhydrase family (e.g. CAIX), and members of the carbohydrate antigen family (e.g. Ley), including mutants of the named proteins and protein families. In addition, the binding moiety of the target module includes, but is not limited to, antibodies or fragments thereof binding to cytoplasmic or nuclear antigens such as the La / SSB antigen, members of the Rho family of GTPases, members of the high-mobility group proteins, etc. Likewise, the binding moiety of the target module can consist of the alpha and beta or gamma and delta chains of T cell receptors (TCRs) or fragments thereof. Such TCR-derived binding moieties recognize and bind to peptides presented by human leukocyte antigen (HLA) protein complexes of class I and II. Examples are, but are not limited to, TCRs specific for peptides derived from proteins such as the EGFR family, the survivin protein, the sry-like high-mobility group box (SOX) protein family, melanoma-associated antigens (e.g. the autoimmune cancer / testis antigen NY-ESO-1, members of the melanoma antigen family AMAGE, the antigen preferentially expressed in melanoma PRAME), and leukemia-associated antigens (e.g. wilms tumor gene 1, WT1 ). The binding moiety of the target module can also comprise ligands of proteins and protein complexes, also known as receptors.Such ligands can bind, but are not limited to, cytokine receptors (e.g. IL-13 receptor), ligands of the NKG2D receptor, ligands of the EGFR family members, or self-reactive TCRs.

[0055] The binding moiety of the target module can comprise a single antigen specificity (monospecific), two, three or more antigen specificities (bis- and multispecific). Examples of bis- and multispecific antigen specificities include, but are not limited to, target modules that bind to PSCA and PSMA antigens, CD19 and CD20 antigens, CD19, CD20 and CD22 antigens, CD33 and CD123 antigens, CD33 and CD99, CD33 and TIM-3, erb-1 and -2, PSCA and erb-2 and other combinations. The binding moiety of the target module can also comprise monovalent binding as well as bi- and multivalent binding sites. Examples of bi- and multivalent targeting strategies include, but are not limited to, target modules that incorporate two scFv recognizing different epitopes of PSCA, CD19 and CD33, and a ligand-scFv combination recognizing different epitopes of the erb1 receptor.

[0056] The target module can also carry additional ligands that do not participate in the binding to the target antigen, also known as payloads. Such payloads can include, but are not limited to, co-stimulatory ligands or cytokines fused to the N- or C-terminus of the target module, in particular the extracellular domains of CD28, CD137 (41BB), CD134 (OX40) and CD27 and IL-2, IL-7, IL-12, IL-15, IL-17 and Il-21, all of which stimulate different kinds of immune cells. Other payloads can be radionuclides or compounds that induce cell death in the target cell and neighboring cells.

[0057] Method

[0058] A method of stimulating a universal chimeric antigen receptor-mediated immune response in a mammal, the method comprising:

[0059] - administering to the mammal an effective amount of effector cells genetically modified to express a universal chimeric antigen receptor, wherein the universal chimeric antigen receptor comprises three domains, wherein the first domain is a tag-binding domain, the second domain is an extracellular hinge and transmembrane domain and the third domain is a signal transduction domain, wherein the tag-binding domain binds to a tag derived from any human nuclear protein, and

[0060] - administering a target module consisting of a binding moiety specific for a certain human cell surface protein or protein complex and a tag, wherein the tag is derived from any human nuclear protein,

[0061] wherein the target module is administered to the subject prior to, or simultaneously with, or after administration of the universal chimeric antigen receptor expressing effector cell.

[0062] In a preferred embodiment, the effector cell and target module are administered to a human.

[0063] UniCAR effector cell manufacturing

[0064] In embodiments of the application, immune cells can be genetically engineered to express UniCARs by various methods. Generally, a polynucleotide vector encoding the UniCAR and all necessary elements to ensure its expression in the genetically engineered immune cell is transferred into the cell. The transfer of the vector can be, but is not limited to, by electroporation or transfection of nucleic acids or by the help of viral gene transfer systems such as, but not limited to, adenoviral, adeno-associated viral, retroviral, foamy viral or lentiviral vectors.

[0065] In another embodiment, lentiviral gene transfer can be applied for stable expression of UniCARs in immune cells by first constructing a lentiviral vector encoding the selected UniCAR. Exemplary lentiviral vectors include, but are not limited to, the vector pLVX-EF1 a UniCAR 28 / zeta (Clontech, Takara Bio Group) as shown in Figure 3

[0066] For the described application, the MSC / IRES / ZsGreenl part is replaced by the UniCAR construct. Regarding Figure 3 , the following abbreviations are used:

[0067] 5'LTR: 5' long terminal repeat, PBS: primer binding site, Ψ: packaging signal, RRE: Rev-response element, cPPT / CTS: (central polypurine tract / central termination sequence, EF1 a: human elongation factor 1 alpha promoter, MCS: multiple cloning site, IRES: internal ribosome entry site, ZsGreenl : optimized human codons, WPRE: woodchuck hepatitis virus post-transcriptional regulatory element, 3'LTR: 3' long terminal repeat, pUC: origin of replication, Ampr: ampicillin resistance gene; beta-lactamase.

[0068] Lentiviral particles are usually produced by transient transfection of human embryonic kidney (HEK) 293T (ACC 635) cells with UniCAR-encoding lentiviral vector plasmids and use of the Figure 4 ​The depicted group specific antigen (gag) and polymerase (pol) encoding plasmids (e.g., psPAX2, addgene plasmid 12260) plus the envelope encoding plasmid (e.g., pMD2.G, addgene plasmid 12259) as shown were co-transfected to generate. Following transfection, the packaging plasmid expresses the Gag and Pol proteins of HIV-1. Figure 5 The abbreviations used in the middle are as follows: CMV enh: CMV enhancer and promoter, SD: splice donor, SA: splice acceptor, Gag: group specific antigen, Pro: precursor protein encoding the protease protein, Pol: protein encoding the reverse transcriptase and integrase, RRE: rev response element, Amp: ampicillin. Figure 4 The abbreviations used in the middle are as follows: CMV enh: CMV enhancer and promoter, SD: splice donor, SA: splice acceptor, Gag: group specific antigen, Pro: precursor protein encoding the protease protein, Pol: protein encoding the reverse transcriptase and integrase, RRE: rev response element, Amp: ampicillin.

[0069] The plasmid MD2.G( Figure 5 ) encodes the glycoprotein of vesicular stomatitis virus (VSV-G). The VSV-G protein is used in lentiviral vectors to transduce a wide range of mammalian cells. The abbreviations used in the middle are as follows: CMV: CMV enhancer and promoter, beta-globin intror: beta-globin intron, beta-globin pA: beta-globin poly-adenyl tail. Figure 5 The abbreviations used in the middle are as follows: CMV enh: CMV enhancer and promoter, SD: splice donor, SA: splice acceptor, Gag: group specific antigen, Pro: precursor protein encoding the protease protein, Pol: protein encoding the reverse transcriptase and integrase, RRE: rev response element, Amp: ampicillin.

[0070] Various envelopes from different viral species can be used for this purpose. Lentiviral vectors can successfully be, but are not limited to, pseudotyped with the envelope glycoprotein (Env) of the amphotropic murine leukemia virus (MLV) or the G protein of the vesicular stomatitis virus (VSV-G), a modified envelope of the prototypic foamy virus (PFV) or chimeric envelope glycoprotein variants derived from the gibbon ape leukemia virus (GaLV) and the MLV. Supernatants from transfected HEK293T cells can be harvested 24h to 96h after transfection and viral particles can, but do not necessarily have to, be concentrated from the supernatants by ultracentrifugation or other methods. For lentiviral transduction of immune cells various established protocols can be applied. In one aspect, peripheral blood mononuclear cells (PBMCs) or isolated T cells can be activated with mabs specific for the CD3 complex, e.g. clone OKT3 or UCHT, either given in solution or coated onto plastic cell culture dishes or magnetic beads. Activation of PBMCs or isolated T cells can be further enhanced by stimulation of costimulatory pathways with mabs or ligands specific for, but not limited to, CD27, CD28, CD134 or CD137 alone or in various combinations and supply of exogenous recombinant cytokines such as, but not limited to, interleukin (IL)-2, IL-7, IL-12, IL-15 and IL-21. PBMC or T cell cultures are added with concentrated or non-concentrated viral particles 24h to 96h after initial administration of activating CD3 antibodies and / or recombinant cytokines in single or multiple doses. Stable T cell transduction can be determined by flow cytometry after staining of surface expressed UniCAR or mabs directly antagonizing the fourth domain of the UniCAR with tag-containing target modules 3 days after last administration of viral supernatant. UniCAR transduced T cells can be propagated in vitro by culturing them under supply of recombinant cytokines and activating anti-CD3 mabs.

[0071] In case the UniCAR comprises the optional fourth domain, a peptide sequence forming a linear epitope of a mab, immune cells genetically modified to express UniCAR can be specifically propagated in vitro by coating the surface of culture dishes or any kind of beads with a mab or antibody fragment thereof binding to the fourth UniCAR domain added to the cell culture at a defined ratio of 1 bead to 1-4 UniCAR implanting effector cells, but not limited thereto. Binding of the surface-coated mab to the UniCAR peptide domain induces crosslinking of cell surface expressed UniCAR and formation of an immunological synapse, which leads to activation of a signal pathway specifically triggered by the signaling domain of the UniCAR. Depending on the induced signal pathway this can lead to an increased proliferation of the UniCAR carrying immune cells and a sustained resistance against activation-induced cell death and thus enrichment of UniCAR genetically modified immune cells in the mixed population.

[0072] The optional fourth domain, i.e. the peptide sequence forming the linear epitope of the mab, can also be used to enrich and purify UniCAR expressing immune cells from mixed populations. Enrichment and purification can be performed by means of the mab or antibody fragments thereof which bind to the fourth UniCAR domain to label the UniCAR expressing cells for cell sorting or transiently link the UniCAR expressing immune cells to small particles which can be used for cell separation. In one aspect, the UniCAR engrafted immune cells are incubated with a mab recognizing the fourth domain. Next, magnetic beads are added which are conjugated with antibodies or fragments thereof specific for the species and isotype specific heavy and light chains of the mab binding to the optional fourth domain. Thus, the UniCAR expressing immune cells and the magnetic beads are linked and can be captured in a magnetic field and separated from other immune cells.

[0073] In another embodiment of the application, the optional fourth domain can be used to detect UniCAR surface expression, as Figure 6 depicted. Figure 6 It is depicted that UniCAR surface expression can be detected by utilizing a monoclonal antibody directed against the optional fourth domain and subsequent staining with a fluorescent dye conjugated anti-species secondary antibody. The optional fourth domain can additionally be used to purify UniCAR engrafted T cells to high purity, as Figure 6 depicted.

[0074] UniCAR immune cell administration

[0075] Populations of UniCAR expressing immune cells can be formulated for administration to a subject using techniques known to the skilled person.

[0076] Formulations comprising a population of UniCAR expressing immune cells can include pharmaceutically acceptable excipients. The excipients included in the formulation will depend on, for example, the nature of the UniCAR comprising tag binding domain, the population of immune cells used and the mode of administration, and will serve different purposes. Examples of excipients commonly used include, but are not limited to: physiological saline, buffered saline, dextrose, water-for-injection, glycerol, ethanol and combinations thereof, stabilizers, solubilizers and surfactants, buffers and preservatives, tonicity agents, bulking agents, and lubricants. The formulations comprising a population of UniCAR expressing immune cells will generally be prepared and cultured without any non-human components such as animal serum (e.g. bovine serum albumin).

[0077] The preparation can include one population or more than one, e.g., two, three, four, five, six or more, populations of UniCAR-expressing immune cells. Different UniCAR- engrafted immune cell populations can vary based on the identity of the tag binding domain, the identity of the signal transduction domain, the identity of the subpopulation, the way of production and cultivation, or a combination thereof. For example, the preparation can comprise UniCAR-expressing T and NK cell populations that recognize and bind one or more than one, e.g., two, three, four, five, six or more, different tag proteins.

[0078] The preparation comprising the population of UniCAR-expressing immune cells can be administered to the subject using means and techniques known to the skilled person. Exemplary means include, but are not limited to, intravenous injection. Other means include, but are not limited to, intratumoral, intradermal, subcutaneous (s.c, s.q., sub-Q, Hypo), intramuscular (i.m.), intraperitoneal (i.p.), intraarterial, intramedullary, intracardiac, intraarticular, intrasynovial (synovial space), intracranial, intraspinal, and intrathecal (spinal fluid). Any known device useful for parenteral injection or infusion of the preparation can be used to effect such administration. The injection can be made as a bolus or as a continuous drip.

[0079] The preparation comprising the population of UniCAR-expressing immune cells administered to the subject comprises a number of UniCAR-expressing immune cells effective for the treatment and / or prevention of the particular indication or disease. Thus, when practicing the methods of the application, a therapeutically effective population of UniCAR-expressing immune cells is administered to the subject. The number of UniCAR-expressing immune cells administered to the subject will vary between wide limits depending on the location, origin, identity, extent and severity of the disease, the age and condition of the individual to be treated, etc. In general, a preparation comprising between about 1 x 10 4 and about 1 x 10 10 UniCAR-expressing immune cells is administered. In most cases, the preparation will comprise between about 1 x 10 5 and about 1 x 10 9 UniCAR-expressing immune cells, from about 5 x 10 5 to about 5 x 10 8 UniCAR-expressing immune cells, or from about 1 x 10 6 to about 1 x 10 9 UniCAR-expressing immune cells. The physician will ultimately decide on the appropriate dosage for use. In case of adverse events, the UniCAR-engrafted immune cells can be depleted from the individual by administration of mabs directed against the peptide domain (fourth domain) of the UniCAR that forms the linear epitope for the respective antibody.

[0080] Target module production

[0081] The target module comprises two domains, a binding moiety specific for a certain human cell surface protein or protein complex and a tag to which the tag binding domain of the UniCAR is directed. The target module can be manufactured by techniques known to the skilled person. These techniques include, but are not limited to, recombinant expression in prokaryotic or eukaryotic cells or artificial synthesis of the polypeptide chain.

[0082] In one aspect, the target module can be expressed in Chinese hamster ovary (CHO, ACC-110) cells, which are suitable for the synthesis of large amounts of biologically active forms of recombinant proteins. The nucleic acid sequence encoding the target module can be transferred into CHO cells by established genetic engineering techniques such as, but not limited to, naked nucleic acid transfection, electroporation or viral gene transfer. High producing single cell clones can be selected from the lineage using, for example, the dihydrofolate reductase (DHFR) selection system. In this system, CHO cell mutants deficient in DHFR (e.g. CHO subline DXB11 or DG44) are genetically modified by co-transfecting a functional copy of the DHFR gene in addition to the nucleic acid sequence encoding the target module. Clonal selection is then performed by growing in a medium lacking glycine, hypoxanthine and thymidine. High producing clones can be further selected by culturing the cells in high levels of methotrexate (MTX), a folate analogue that blocks DHFR activity. As the genetically modified cells have to cope with reduced DHFR activity, which cannot be rescued by the mere presence of a single DHFR copy, clones with amplified copies of the DHFR gene are at an advantage under these conditions. The genetic linkage between DHFR and the gene of interest ensures that the transgene is co-amplified as well, thus increasing the chances of obtaining a high producing cell clone. The selected cell clone is grown under good manufacturing conditions, preferably in the absence of any animal serum. The target module can be isolated from the cell culture supernatant by established preparative protein purification methods, including preparatory steps such as precipitation or ultracentrifugation and various purification techniques such as, but not limited to, size exclusion or ion exchange chromatography. In one aspect, the nucleic acid sequence of the target module carries a coding sequence for six to eight consecutive histidine amino acids forming a polyhistidine tag. The polyhistidine binds strongly to divalent metal ions such as nickel and cobalt. The cell culture supernatant can be passed over a column containing immobilized nickel ions that bind to the polyhistidine tag, while non-tagged proteins pass through the column. The target module can be eluted with imidazole that competes with the polyhistidine tag for binding to the column, or by lowering the pH to reduce the affinity of the tag for the resin.

[0083] Target module administration

[0084] One target module or more than one, such as two, three, four or more target modules can be formulated for administration to a subject using techniques known to the skilled person.

[0085] The formulation containing one or more target modules can include pharmaceutically acceptable excipients. The excipients included in the formulation will depend on, for example, the nature of the target module and the mode of administration and serve different purposes. Examples of excipients commonly used include, but are not limited to: physiological saline, buffered saline, dextrose, water for injection, glycerol, ethanol, and combinations thereof, stabilizers, solubilizers and surfactants, buffers and preservatives, tonicity agents, bulking agents, and lubricants. The formulation containing the target module will generally be prepared and cultured without any non-human components, such as animal serum (e.g., bovine serum albumin).

[0086] The formulation can include one target module or more than one, for example two, three, four, five, six or more target modules. The target module can vary based on the identity of the binding moiety, the identity of the tag, the mode of production, or a combination thereof. For example, the formulation can contain target modules that recognize and bind one or more than one, for example two, three, four, five, six or more different human cell surface proteins, protein complexes, or extracellular matrix structures.

[0087] The formulation containing the population of UniCAR-expressing immune cells can be incubated ex vivo with a formulation comprising one or more target modules to decorate the UniCAR-expressing immune cells with target modules prior to administration to the subject. Alternatively, the formulation comprising one or more target modules can be administered directly to the subject or a combination of both strategies can be chosen. The route and dosage will vary between wide limits depending on the location, origin, identity, extent and severity of the disease, the age and condition of the individual to be treated, etc. The physician will determine the appropriate route of application and the dosage to be used.

[0088] The formulation containing the target module is administered to the subject in an amount effective to treat and / or prevent the particular indication or disease. Typical dosage rates per m2 per day are between 1 μg and 1000 mg, preferably 10 μg and 1 mg, with the dosage being administered one or more times per day or week over a period of several weeks or continuously. However, the amount of target module in the formulation administered to the subject will vary between wide limits depending on the location, origin, identity, extent and severity of the cancer, the age and condition of the individual to be treated, etc. The physician will determine the appropriate dosage to be used.

[0089] The present application relates to a method of treating a subject having a cancer, an infection, or an autoimmune disease, the method comprising administering to the subject in need of treatment one or more formulations of target modules, wherein the target modules bind to cancer cells, and administering one or more populations of therapeutically effective UniCAR-expressing immune cells, wherein the UniCAR-expressing immune cells bind to the target modules and induce cell death.

[0090] The term "cancer" is intended to be construed broadly and includes all aspects of abnormal cell growth and / or cell division. Examples include: carcinomas, including but not limited to adenocarcinoma, squamous cell carcinoma, adenosquamous carcinoma, anaplastic carcinoma, large cell carcinoma, small cell carcinoma, and cancers of the skin, breast, prostate, bladder, vagina, cervix, uterus, liver, kidney, pancreas, spleen, lung, trachea, bronchus, colon, small intestine, stomach, esophagus, gall bladder; sarcomas, including but not limited to chondrosarcoma, Ewing's sarcoma, hemangiosarcoma, malignant schwannoma, osteosarcoma, soft tissue sarcoma, and cancers of bone, cartilage, fat, muscle, blood vessels, and hematopoietic tissue; lymphomas and leukemias, including but not limited to mature B cell neoplasms, such as chronic lymphocytic leukemia / small lymphocytic lymphoma, B cell prolymphocytic leukemia, lymphoma, and plasma cell neoplasm, mature T cell and natural killer (NK) cell neoplasms, such as T cell prolymphocytic leukemia, T cell large granular lymphocyte leukemia, aggressive NK cell leukemia, and adult T cell leukemia / lymphoma, Hodgkin's lymphoma, and lymphoproliferative disorders associated with immunodeficiency; germ cell tumors, including but not limited to testicular and ovarian cancers; blast cell tumors, including but not limited to hepatoblastoma, medulloblastoma, nephroblastoma, neuroblastoma, pancreatoblastoma, leuropulmonary blastoma, and retinoblastoma. The term also includes benign tumors.

[0091] The term "treatment" as used herein has its ordinary and customary meaning and includes one or more of the following: blocking, alleviating, or reducing the severity and / or frequency of symptoms of cancer in a subject, and / or inhibiting the growth, division, spread, or proliferation of cancer cells, or the progression of cancer (e.g., the appearance of new tumors) in a subject. Treatment refers to blocking, alleviating, reducing, or inhibiting by about 1% to about 100% relative to a subject not practicing the methods of the application. Preferably, the blocking, alleviating, reducing, or inhibiting is about 100%, 99%, 98%, 97%, 96%, 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, or 1% relative to a subject not practicing the methods of the application.

[0092] The frequency of administration of both the preparation comprising the UniCAR-expressing immune cell population and the preparation of the target module will vary depending on factors including the disease being treated, the elements comprising the UniCAR-expressing immune cell and the target module, and the mode of administration. Each preparation can be independently administered 4, 3, 2, or 1 time per day, every other day, every third day, every fourth day, every fifth day, every sixth day, once a week, every eighth day, every ninth day, every tenth day, every two weeks, every month, and every two months.

[0093] The duration of treatment will be based on the disease being treated and will ideally be determined by the attending physician. However, continuous treatment is expected to last for many days, weeks, or months.

[0094] This invention provides flexibility in treatment methods, allowing the formulations of the target module and the UniCAR-expressing immune cell population to be administered to the subject in any order. Therefore, the formulation of the target module can be administered to the subject before, after, or simultaneously with the UniCAR-expressing immune cell population. Alternatively, in cases where more than one target module and / or more than one UniCAR-expressing immune cell population formulation is administered to the subject, they can be interleaved. For example, a first formulation of the target module can be administered, followed by a first population of UniCAR-expressing immune cells, then a second formulation of the tag protein, and then a second population of UniCAR-expressing immune cells.

[0095] The present invention also includes a method of coating a population of UniCAR-expressing immune cells with a target module prior to administering the UniCAR-expressing immune cells to a subject.

[0096] In various embodiments of the present invention, the subjects receiving treatment are humans or non-human animals, such as non-human primates, birds, horses, cattle, goats, sheep, companion animals such as dogs, cats or rodents, or other mammals.

[0097] In one implementation, UniCAR genetically engineered T cells can be specifically redirected to tumor cells expressing PSCA and / or PSMA, which are frequently detected in biopsies, such as those from prostate, bladder, pancreas, and breast tumors. Figure 7 Human T cells were either spuriously transduced (white bars) or transduced using lentiviral vectors of UniCAR encoding dual CD28 / CD3ξ signaling domains (black bars), lacking any signaling domains (shaded bars), or expressing only the EGFP marker protein (banded bars). Specific lysis of genetically engineered prostate tumor cells (PC3) expressing prostate stem cell antigen (PC3-PSCA) or prostate membrane antigen (PC3-PSMA) was analyzed in the presence of engineered human T cells and target modules in a 51Cr release assay. T cells were incubated with PC3 target cells loaded with 51Cr at an effector cell to target ratio (e:t) of 5:1 or 1:1. Target modules (TMs) specific to PSCA (αPSCA™) or PSMA (αPSMA™) were added at a concentration of 15 nMol. Target cell lysis (Cr release) was measured after 20 h of culture. The figure shows the mean and sd ( ) from experiments with three individual T cell donors. Figure 7A). Likewise, the killing capacity of UniCAR engineered T cells against LNCap-4-2B tumor stem cells expressing both antigens PSCA and PSMA was demonstrated in the presence of PSCA- or PSMA TM (1 nMol) by51Cr release assay at the indicated e:t ratios. The mean and s.d. of experiments with three individual T cell donors are shown. Figure 7 B). Figure 7 B. The experiment was repeated at a lower e:t ratio of 1 :2, adding 1 nMol PSCA- or PSMA specific TM or a combination of both TM at a total concentration of 1 nMol. Specific lysis determined by51Cr release was measured after 24h and 48h. The mean and s.d. of experiments with three individual healthy T cell donors are shown. Figure 7 C). This experiment demonstrates that the combination of two different TM improves the killing capacity of UniCAR redirected T cells against tumor cells compared to the single antigen retargeting strategy, even if the total amount of both TM in the dual targeting sample equals the total amount of each TM in the single antigen retargeting control sample Figure 7 C). Furthermore, human T cells armed with the UniCAR secrete inflammatory and proliferative cytokines upon crosslinking with antigen expressing tumor cells in the presence of the respective TM Figure 7 D). Human T cells were incubated with PSCA or PSMA antigen expressing PC3 cells in the presence or absence of TM specific for PSCA or PSMA. After 24h of incubation, cell free supernatants were harvested and subsequently analyzed for the release of T cell specific cytokines using commercially available ELISA kits. The mean and s.d. of experiments with three individual T cell donors are shown. Figure 7 Statistical analysis of C, D was performed using non-parametric one-way ANOVA (Kruskal-Wallis test) and post-hoc Dunn's multiple comparison test (**p<0.01).

[0098] In another embodiment, Figure 8 Concentration response curves of UniCAR genetically modified human T cells in the presence of target modules binding to various antigens on the surface of tumor cells of different origin are shown. Human T cells were transduced with lentiviral vectors encoding UniCAR containing a dual CD28 / CD3 zeta signaling domain. UniCAR engrafted T cells were incubated with51Cr loaded PC3 target cells genetically engineered to express PSCA or PSMA antigen at an e:t ratio of 5:1. Target modules (TM) specific for PSCA (aPSCA TM) or PSMA (aPSMA TM) were added in increasing concentrations Figure 7 A). The half maximal effective dose (EC50) of both TM was determined to be close to 12 pMol. Experiments were performed as Figure 7Additional experiments as in A, but with an e:t ratio of 1 : 1 chosen and the acute myeloid leukemia cell line MOLM-13 used as target tumor cells. TM specific for CD33 antigen (aCD33 TM) or CD123 antigen (aCD123 TM) were added in increasing concentrations and EC50 values of 137 pMol for aCD33 TM and 45 pMol for aCD123 TM were determined. These experiments demonstrate that UniCAR-implanted T cells are effective at very low concentrations of TM, which are 10 to 100-fold lower than the experimentally determined EC50 values of approved monoclonal antibody drugs for cancer treatment (e.g. Herter et al. Mol Cancer Ther 12(10):2031-2042 (2013)).

[0099] In another embodiment, Figure 9 It was demonstrated that UniCAR-engineered T cells can effectively kill acute myeloid leukemia (AML) blasts. Human T cells were either mock transduced (wt, diamonds) or transduced with lentiviral vectors encoding U-CARs containing a dual CD28 / CD3 zeta signaling domain (CAR 28 / z, open and filled circles) or lacking any signaling domain (CAR stop, upward-pointing triangles) or expressing only the EGFP marker protein (vc, downward-pointing triangles). T cells were incubated with 2*10 4 Alexa eFluor 674-labeled target cells at an e:t ratio of 1 : 1 for 24 h Figure 9 A). The number of live, propidium iodide (PI)-negative, but Alexa eFluor 674-positive target cells was determined by flow cytometry using a MACSQuant Analyzer. The number of live leukemia target cells was normalized to control samples with target cells but without any T cells. This experiment demonstrates that UniCAR-implanted T cells effectively lyse AML blasts independent of antigen density upon cross-linking with the respective TM, CD33 being high on MOLM-13, intermediate on MV4-1,1 and low on OCI-AML3, while the CD123 antigen density is in the opposite order on the 3 cell lines. Moreover, UniCAR-implanted T cells can eliminate AML blasts even at low e:t ratios as found in typical patient samples upon TM-mediated cross-linking Figure 9 B). The experimental setup was as in Figure 9A similar, but with a low e:t ratio of 1 :5. The number of viable, PI-negative T cells and target cells was determined at the indicated time points using a MACSQuant Analyzer by flow cytometry. The number of viable leukemia target cells was normalized to control samples with target cells but lacking any T cells Figure 9 B). Upon activation via CAR-mediated signaling, UniCAR-engrafted T cells start to proliferate as shown in Figure 9 C. The experimental setup was as described for Figure 9 B, the number of T cells was determined by flow cytometry using a MACSQuant Analyzer. T cell expansion was calculated as the ratio of T cells present in the sample after 144 h (d6) to the number inoculated at the start of the experiment (dO). Statistical analysis for Figure 8 A and B was performed using a non-parametric one-way ANOVA (Kruskal-Wallis test) and post-hoc Dunn's multiple comparison test. Statistical results for Figure 9 A are indicated, for Figure 9 B, results are given in the table below the graph (ns = not significant, *p<0.05, **p<0.01, ***p<0.001).

[0100] In another embodiment, Figure 10 shows the re-direction of UniCAR-engrafted T cells against two antigens simultaneously. Due to its modular nature, the UniCAR technology allows UniCAR-engrafted immune cells (e.g. T cells) to be re-directed against two antigens simultaneously using two separate TMs (TM 1 + TM 2, Figure 10 A left), or a combination of bispecific TMs arranged as a bispecific single-chain tandem construct (TM1-2, Figure 10 A right) (10A). Using bispecific TMs targeting two antigens can be more efficient than using a combination of two mono-antigen specific TMs as demonstrated by the concentration-response curves of UniCAR-engrafted T cells re-targeted against AML cell lines for combined CD33- and CD123-specificity Figure 10B). Human T cells were transduced using a lentiviral vector encoding a UniCAR containing dual CD28 / CD3ξ signaling domains. UniCAR-implanted T cells were incubated for 24 h at a 1:1 e:t ratio with Cr51-labeled MOLM-13 (mean from trials with 4 different healthy human donors, triangle) and OCI-AML3 (mean from trials with 2 different healthy human donors, hollow circle). Target modules (TMs) specific to CD33 (αCD33TM), CD123 (αCD123 TM), or bispecific CD33-CD123 TM (αCD123-CD33 TM) were added at increasing concentrations. The measured EC50 values ​​were: αCD33+αCD123TM: EC50 MOLM-13 = 70.2 pMol, EC50 OCI-AML3 = 80.2 pMol, αCD33-αCD123TM: EC50 MOLM-13 = 2.9 pMol, EC50 OCI-AML3 = 11.7 pMol. Secondly, it demonstrates that UniCAR-implanted T cells from both healthy human donors and AML patients can successfully target AML cell lines and redirect AML blast cells isolated from patients with blastic crisis. Figure 10 C, D, E, F). Human T cells are pseudotransduced ( Figure 10 Hollow circles in C and D Figure 10 Hollow columns in E and F) or UniCAR encoded with dual CD28 / CD3ξ signal transduction domains ( Figure 10 The triangles in C and D, Figure 10 (black bars in E and F) or lack of any signal conduction domains ( Figure 10 The rhombuses in C and D Figure 10 Lentiviral vector transduction (gray columns in E and F). Highly effective AML cell elimination mediated by UniCAR-implanted T cells was achieved in the presence of the combination of αCD33TM and αCD123TM, or in the presence of the dual-targeting αCD123-CD33TM, but not in the absence of the TM, further demonstrating that cross-linking via TM is indispensable for the antigen-specific reorientation of UniCAR-implanted T cells. Figure 10 C, D, E). T cells were administered at a total dose of 100 pMol™ in the presence (+) or absence (-) of AML cells, along with 2*10-1 cells from three AML cell lines (MOLM-13, MV4-11, OCI-AML3). 4 Alexa eFluor 674-labeled target cells were incubated together at a 1:5 e:t ratio for 144 h. The TM was updated after 48 h. The number of live, PI-negative but Alexa eFluor 674-positive target cells was measured using MACSQuant. The analyzer determines the number of live, Alexa eFluor 674 positive target cells by flow cytometry. Figure 10 In D, T cell expansion is calculated as the ratio of T cells present in the sample after 144 h (d6) to the number inoculated at the beginning of the experiment (dO). Results from experiments with 6 donors are shown, mean values and s.d. are indicated. These results strongly demonstrate that activation via UniCAR signaling after TM-mediated cross-linking not only leads to target cell killing but in addition the UniCAR engrafted T cells receive a proliferative stimulus via the combined CD28 / CD3 zeta UniCAR signaling chain and start to divide. Next, genetically modified T cells from a healthy donor were incubated with 5*10 4 Alexa eFluor 674 labeled leukemia cells were incubated in a 1 : 1 e:t ratio. Figure 10 e) After 24 h (left panel) and 48 h (right panel), the number of live, Alexa eFluor 674 positive target cells was determined by flow cytometry using a MACSQuant® Analyzer. The analyzer determines the number of live, Alexa eFluor 674 positive target cells by flow cytometry. Figure 11 In E, results from 5 paired experiments demonstrate that UniCAR engineered T cells are able to lyse patient's AML blast cells over time. It could also be demonstrated that by adding AML antigen specific TMs, UniCAR genetically modified T cells from AML patients are able to attack and lyse AML cells. Modified T cells were incubated with 2*10 4 Alexa eFluor 674 labeled target cells were incubated in a 1 : 1 e:t ratio. The number of live, PI negative but Alexa eFluor 674 positive target cells was determined by flow cytometry using a MACSQuant® Analyzer. The analyzer determines the number of live, Alexa eFluor 674 positive target cells by flow cytometry.

[0101] In another embodiment, Figure 11 A graph showing the in vivo pharmacokinetics of the bispecific aCD123-CD33 target module is depicted. NSG mice (NOD / SCID IL2Ry- / -) were injected intravenously (i.v., left panel) or intraperitoneally (i.p., right panel) with 5*10 Figure 11 A) or intraperitoneally (i.p., right panel) with 5*10 ​B) 250 pg / g body weight of aCD123-CD33™ was injected and serum samples were taken at the indicated time points. A capture ELISA was used to determine the concentration of TM in the samples. The results show the mean and standard deviation (n=3). The half-life of the i.v. injection was determined using an exponential one-phase decay model (GraphPad Prism software).

[0102] In another embodiment, an isolated nucleic acid sequence encoding a universal chimeric antigen receptor of SEQ. ID 1 is provided. The encoding isolated nucleic acid sequence is as follows: a human IL-2m leader peptide of SEQ. ID 2, a humanized anti-La 5B9 antibody variable region heavy chain of SEQ. ID 3, a humanized anti-La 5B9 antibody variable region light chain of SEQ. ID 4, a La 7B6 epitope of SEQ. ID 5, a human CD28 of SEQ. IDs 6-8, including a human CD28 extracellular portion with a mutated binding motif of SEQ. ID 6, a CD28 transmembrane domain of SEQ. ID 7, and a human CD28 intracellular portion including a mutated internalization motif of SEQ. ID 8, and a human CD3 zeta intracellular domain of SEQ. ID 9.

[0103] The protein expression product of the isolated nucleic acid sequence of SEQ. ID 1 can be found in SEQ. ID 27. The nucleic acid sequence of the humanized anti-La 5B9 antibody variable region heavy chain of SEQ. ID 3 encodes a protein of SEQ. ID 33, while the humanized anti-La 5B9 antibody variable region light chain of SEQ. ID 4 encodes a protein of SEQ. ID 34.

[0104] The nucleic acid sequence of the human La 7B6 epitope of SEQ. ID 5 encodes a protein domain of SEQ. ID 35.

[0105] In another embodiment of the present application, an isolated nucleic acid sequence encoding a target module having a binding portion for prostate specific antigen PSCA is provided in SEQ. ID 10. The encoding isolated nucleic acid sequence is as follows: a leader peptide IgG kappa of SEQ. ID 11, a humanized light chain of an anti-PSCA scFv of SEQ. ID 12, a humanized heavy chain of an anti-PSCA scFv of SEQ. ID 13, a La 5B9 epitope of SEQ. ID 14, a myc tag of SEQ. ID 15, and a his tag of SEQ. ID 16.

[0106] The protein expression product of the nucleic acid of SEQ.ID 10 can be taken from SEQ.ID 28. The nucleic acid sequence of the humanized light chain of the anti-PSCA scFv of SEQ.ID 12 encodes the protein domain of SEQ.ID 36, while the humanized heavy chain of the anti-PSCA scFv of SEQ.ID 13 encodes the protein domain of SEQ.ID 37. The La 5B9 epitope of SEQ.ID 14 encodes the protein of SEQ.ID 44.

[0107] In another embodiment of the application, the isolated nucleic acid sequence encoding a target module having a binding moiety for the prostate specific antigen PSMA is provided in SEQ.ID 17. The isolated nucleic acid sequence is encoded as follows: the leader peptide IgG kappa of SEQ.ID 11, the humanized heavy chain of the anti-PSMA scFv of SEQ.ID 18, the humanized light chain of the anti-PSMA scFv of SEQ.ID 19, the La 5B9 epitope of SEQ.ID 14, the myc tag of SEQ.ID 15, and the his tag of SEQ.ID 16.

[0108] The protein expression product of the nucleic acid of SEQ.ID 17 can be taken from SEQ.ID 29. The nucleic acid sequence of the humanized heavy chain of the anti-PSMA scFv of SEQ.ID 18 encodes the protein domain of SEQ.ID 38, while the humanized light chain of the anti-PSMA scFv of SEQ.ID 19 encodes the protein domain of SEQ.ID 39. The La 5B9 epitope of SEQ.ID 14 encodes the protein of SEQ.ID 44.

[0109] In another embodiment of the application, the isolated nucleic acid sequence encoding a target module having a binding moiety for the anti-CD33 antigen antibody is provided in SEQ.ID 20. The isolated nucleic acid sequence is encoded as follows: the leader peptide IgG kappa of SEQ.ID 11, the humanized light chain of the anti-CD33 scFv of SEQ.ID 21, the humanized heavy chain of the anti-CD33 scFv of SEQ.ID 22, the La 5B9 epitope of SEQ.ID 14, the myc tag of SEQ.ID 15, and the his tag of SEQ.ID 16.

[0110] The protein expression product of the nucleic acid of SEQ.ID 20 can be taken from SEQ.ID 30. The nucleic acid sequence of the humanized light chain of the anti-CD33 scFv of SEQ.ID 21 encodes the protein domain of SEQ.ID 40, while the humanized heavy chain of the anti-CD33 scFv of SEQ.ID 22 encodes the protein domain of SEQ.ID 41. The La 5B9 epitope of SEQ.ID 14 encodes the protein of SEQ.ID 44.

[0111] In another embodiment of the application, the isolated nucleic acid sequence encoding the target module having a binding portion of an anti-CD123 antigen antibody is provided in SEQ. ID 23. The isolated nucleic acid sequence encodes the following: the leader peptide IgGkappa of SEQ. ID 11, the humanized heavy chain of the anti-CD123 scFv of SEQ. ID 24, the humanized light chain of the anti-CD123 scFv of SEQ. ID 25, the La 5B9 epitope of SEQ. ID 14, the myc tag of SEQ. ID 15, and the his tag of SEQ. ID 16.

[0112] The protein expression product of the nucleic acid of SEQ. ID 23 can be obtained from SEQ. ID 31. The nucleic acid sequence of the humanized heavy chain of the anti-CD123 scFv of SEQ. ID 24 encodes the protein domain of SEQ. ID 42, while the humanized light chain of the anti-CD123 scFv of SEQ. ID 25 encodes the protein domain of SEQ. ID 43. The La 5B9 epitope of SEQ. ID 14 encodes the protein of SEQ. ID 44.

[0113] In another embodiment of the application, the isolated nucleic acid sequence encoding the target module having a binding portion of an anti-CD123 anti-CD33 antigen antibody is provided in SEQ. ID 26. The isolated nucleic acid sequence encodes the following: the leader peptide IgGkappa of SEQ. ID 11, the humanized heavy chain of the anti-CD123 scFv of SEQ. ID 24, the humanized light chain of the anti-CD123 scFv of SEQ. ID 25, the La 5B9 epitope of SEQ. ID 14, the humanized heavy chain of the anti-CD33 scFv of SEQ. ID 22, the humanized light chain of the anti-CD33 scFv of SEQ. ID 21, the myc tag of SEQ. ID 15, and the his tag of SEQ. ID 16.

[0114] The protein expression product of the nucleic acid of SEQ. ID 26 can be obtained from SEQ. ID 32. The nucleic acid sequence of the humanized heavy chain of the anti-CD123 scFv of SEQ. ID 24 encodes the protein domain of SEQ. ID 42, while the humanized light chain of the anti-CD123 scFv of SEQ. ID 25 encodes the protein domain of SEQ. ID 43. The La 5B9 epitope of SEQ. ID 14 encodes the protein of SEQ. ID 44. The humanized heavy chain of the anti-CD33 scFv of SEQ. ID 22 encodes the protein domain of SEQ. ID 41, while the nucleic acid sequence of the humanized light chain of the anti-CD33 scFv of SEQ. ID 21 encodes the protein domain of SEQ. ID 40. SEQUENCE LIST <110> AVENIR PHARMA EUROPE LTD <120> Universal chimeric antigen receptor-expressing immune cells and methods of making and therapeutic uses thereof <130> SPI213390-31 <150> EP 14 182 945.7 <151> 29-August-2014 <160> 44 <170> PatentIn 3.5 version <210> 1 <211> 2685 <212> DNA <213> Artificial Sequence <220> <223> Chimeric DNA sequence Mouse / Human <400> 1 atgcgccgca tgcagctgct gcttctgatc gctctgagcc tggctcttgt gaccaactct 60 gaattccagg tgcagctggt gcagagcgga gccgaggtga agaagcctgg agcctctgtg 120 aaggtgagct gcaaggcttc tggctacacc ttcacccact actacatcta ctgggtgaga 180 caggctcccg gacagggcct ggagtggatg ggaggcgtga accccagcaa cggaggcacc 240 cacttcaacg agaagttcaa gtctcgcgtg accatgaccc gcgacaccag catctctacc 300 gcttacatgg agctgagccg cctgcgctct gatgataccg ctgtgtacta ctgcgctcgc 360 agcgagtacg attacggact gggcttcgcc tactggggcc agggaaccct ggtgaccgtg 420 agctctggag gcggaggcag cggaggcggc ggatctggag gcggaggaag cgatatcgtg 480 atgacccagt ctcctgatag cctggctgtg agcctgggcg agagagctac catcaactgc 540 aagagcagcc agagcctgct gaactctcgc acccctaaga actaccttgc ttggtaccag 600 cagaagcctg gacagccccc taagctgctg atctactggg cttctacccg caagagcggc 660 gtgcccgaca gattctctgg cagcggaagc ggcaccgatt tcaccctgac catcagcagc 720 ctgcaggctg aggacgtggc cgtgtactac tgcaagcagt cttacaacct gctgaccttc 780 ggaggcggaa ccaaggtgga gatcaaggct gccgctctgg agaaggaggc cctgaagaag 840 atcatcgagg atcagcagga ggctctgaac aagtgggctg ccgctgggcc cggaggaggc 900 ggcagcaaga tcctggtcaa acagtcccct atgctggtcg cttacgacaa cgccgttaat 960 ctgagttgca aatatagtta caacctgttt agccgggaat ttcgcgcatc tctccacaag 1020 ggactggatt ctgcggttga ggtttgtgtg gtctatggca attatagcca gcaactgcaa 1080 gtgtacagca aaacaggctt taactgcgac gggaaactcg ggaacgaatc agtgaccttc 1140 tatctgcaga acctgtacgt taaccaaaca gatatttact tctgcaagat agaggtgatg 1200 gctccaccgc cagcactgga taacgagaag tccaatggaa ccatcattca cgtcaagggg 1260 aagcatctgt gtccttcccc gttgttccct gggccgagca aacccttttg ggtgcttgtg 1320 gtagttggcg gggtattggc ctgctattcc cttctcgtaa ctgtggcctt catcatcttc 1380 tgggtcagat ctaagaggtc taggggcggg catagcgact acatgaacat gacacccagg 1440 cggcctggcc ccactcgcaa acactaccag ccatacgcac caccaagaga ctttgccgca 1500 tatcggagtg gtggcggcgg gtcaggaggt ggagctagcg gtggaggagg ttccttctct 1560 aggtcagctg atgctcccgc ctatcagcaa ggtcagaacc agctctacaa tgagctgaat 1620 ctgggacgtc gggaggagta cgacgtgctg gataaacgaa gaggacgcga tcccgagatg 1680 ggtgggaagc ctaggcgcaa gaatccccag gaaggcctct acaatgaact gcagaaagac 1740 aagatggccg aagcctacag cgagattggc atgaaagggg agcgacggag aggaaaggga 1800 catgacgggt tgtatcaggg tctttccact gcgacaaagg atacctatgg ggctctgcac 1860 atgcaagcac tgccacctag aggatccggc tcgagcggtg agggcagagg aagtcttcta 1920 ACATGC GGTG ACGTGGAGGAATCCC GGC CCACC GGT CGCCACC ATGGT GAGCAAGGGC 1980 GAGGAGCTGTT CACC GGGGT GGTGCCCATC CTGGTCGAGC TGGACGGCGA C GTAACGGC 2040 CACAAGTTCA GC GTGTCCGGC GAGGGCGAGG GCATGCCACC TACGGCAAGC TGACCCTG 2100 AAGTTCATCT GCACCACC GGC AAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTG 2160 ACCTACGGCG TGCAGTGCTT CAGCCGCTAC CCCGACCACA TGAAGCAGCA CGACTTCTTC 2220 AAGTCCGCCA TGCCC GAAGGCTACGTCCAG GAGCGCACCA TCTTCTTCAAGGACGACGGC 2280 AAGTCCGCCA TGCCC GAAGGCTACGTCCAG GAGCGCACCA TCTTCTTCAAGGACGACGGC 2280 CTGAAGGGCA TCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAAC 2400 TACAACAGCC ACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAAC 2460 TTCAAGATCC GCCACAACAT CGAGGACGGC AGC GTGCAGC TCGCCGACCAC TACCAGCAG 2520 AACACCCCCA TC GGC GACGGCCCCGTGCTGCTGCCCGACAACC ACTACCTGAGCACCCAG 2580 TCCGCCCTGA GCAAAGACCC CAACGAGAAG CGCGATCACA TG GTCCTGCT GGAGTTCGTG 2640 accgccgccg ggatcactct cggcatggac gagctgtaca agtaa 2685 <210> 2 <211> 60 <212> DNA <213> Homo sapiens <400> 2 atgcgccgca tgcagctgct gcttctgatc gctctgagcc tggctcttgt gaccaactct 60 <210> 3 <211> 360 <212> DNA <213> Mouse <400> 3 caggtgcagc tggtgcagag cggagccgag gtgaagaagc ctggagcctc tgtgaaggtg 60 agctgcaagg cttctggcta caccttcacc cactactaca tctactgggt gagacaggct 120 cccggacagg gcctggagtg gatgggaggc gtgaacccca gcaacggagg cacccacttc 180 aacgagaagt tcaagtctcg cgtgaccatg acccgcgaca ccagcatctc taccgcttac 240 atggagctga gccgcctgcg ctctgatgat accgctgtgt actactgcgc tcgcagcgag 300 tacgattacg gactgggctt cgcctactgg ggccagggaa ccctggtgac cgtgagctct 360 <210> 4 <211> 336 <212> DNA <213> Mouse <400> 4 gatatcgtga tgacccagtc tcctgatagc ctggctgtga gcctgggcga gagagctacc 60 atcaactgca agagcagcca gagcctgctg aactctcgca cccctaagaa ctaccttgct 120 tggtaccagc agaagcctgg acagccccct aagctgctga tctactgggc ttctacccgc 180 aagagcggcg tgcccgacag attctctggc agcggaagcg gcaccgattt caccctgacc 240 atcagcagcc tgcaggctga ggacgtggcc gtgtactact gcaagcagtc ttacaacctg 300 ctgaccttcg gaggcggaac caaggtggag atcaag 336 <210> 5 <211> 60 <212> DNA <213> Homo sapiens <400> 5 ctggagaagg aggccctgaa gaagatcatc gaggatcagc aggaggctct gaacaagtgg 60 <210> 6 <211> 399 <212> DNA <213> Homo sapiens <400> 6 aagatcctgg tcaaacagtc ccctatgctg gtcgcttacg acaacgccgt taatctgagt 60 tgcaaatata gttacaacct gtttagccgg gaatttcgcg catctctcca caagggactg 120 atcaactgca agagcagcca gagcctgctg aactctcgca cccctaagaa ctaccttgct 120gattctgcgg ttgaggtttg tgtggtctat ggcaattata gccagcaact gcaagtgtac 180 agcaaaacag gctttaactg cgacgggaaa ctcgggaacg aatcagtgac cttctatctg 240 cagaacctgt acgttaacca aacagatatt tacttctgca agatagaggt gatggctcca 300 ccgccagcac tggataacga gaagtccaat ggaaccatca ttcacgtcaa ggggaagcat 360 ctgtgtcctt ccccgttgtt ccctgggccg agcaaaccc 399 <210> 7 <211> 81 <212> DNA <213> Homo sapiens <400> 7 ttttgggtgc ttgtggtagt tggcggggta ttggcctgct attcccttct cgtaactgtg 60 gccttcatca tcttctgggt c 81 <210> 8 <211> 123 <212> DNA <213> Homo sapiens <400> 8 agatctaaga ggtctagggg cgggcatagc gactacatga acatgacacc caggcggcct 60 ggccccactc gcaaacacta ccagccatac gcaccaccaa gagactttgc cgcatatcgg 120 agt 123 <210> 9 <211> 327 <212> DNA <213> Homo sapiens <400> 9<213> Homo sapiens <400> 9 ttctctaggt cagctgatgc tcccgcctat cagcaaggtc agaaccagct ctacaatgag 60 ctgaatctgg gacgtcggga ggagtacgac gtgctggata aacgaagagg acgcgatccc 120 gagatgggtg ggaagcctag gcgcaagaat ccccaggaag gcctctacaa tgaactgcag 180 aaagacaaga tggccgaagc ctacagcgag attggcatga aaggggagcg acggagagga 240 aagggacatg acgggttgta tcagggtctt tccactgcga caaaggatac ctatggggct 300 ctgcacatgc aagcactgcc acctaga 327 <210> 10 <211> 981 <212> DNA <213> Artificial Sequence <220> <223> Chimeric DNA sequence mouse / human <400> 10 atggagacag acacactcct gctatgggta ctgctgctct gggttccagg ttccactggt 60 gacgcggccc agccggccgg atccgatatc cagatgactc aaagtcctag ttccctgtct 120 gcatcagtgg gagaccgggt gaccattaca tgcggtacat cccaagacat caataattat 180 ctcaactggt atcagcagaa gccaggcaaa gttcctaagt tattaatcta ctacacatcc 240 aggctgcatt ccggggtgcc ctcccgcttt tcgggctccg ggtcgggaac cgactttacc 300 ctaaccatat cttccctgca gcctgaagac gttgcaacgt actattgtca gcagtcaaag 360 acattaccat ggacatttgg tggtgggacg caactcactg tacttggtgg aggtggcagt 420 ggtggaggag ggagcggagc aagtgccgct ggaggcggag gttcaggcgg tggtggaagc 480 caggtgcagc tagtggagtc cggtggcggc ctcgttaagc cgggcggatc gctgcgcctt 540 tcatgtgccg catcaggatt cacattctcc agttactcta tgtcatggat tcggcaggca 600 cctggcaagg gattggaatg ggtctcgtac attaatgatt caggtggaag tacattctat 660 ccggacacgg ttaaaggtag atttaccatc agccgtgata acgcgaagaa tagcttgtac 720 ttacagatga atagcctgcg tgcagaggat actgctgtat attattgcgc tcgacgtatg 780 tattatggca atagtcactg gcactttgac gtctggggcc agggcacgac agttactgtc 840 tcttcgggag gaggaggatc cgcggccgct aaacccctac ctgaagtgac tgatgagtat 900 gctcgaggag ggcccgaaca aaaactcatc tcagaagagg atctgaatag cgccgtcgac 960 catcatcatc atcatcattg a 981 <210> 11 <211> 63 <212> DNA <213> Homo sapiens <400> 11 atggagacag acacactcct gctatgggta ctgctgctct gggttccagg ttccactggt 60 gac 63 <210> 12 <211> 321 <212> DNA <213> Mus musculus <400> 12 gatatccaga tgactcaaag tcctagttcc ctgtctgcat cagtgggaga ccgggtgacc 60 attacatgcg gtacatccca agacatcaat aattatctca actggtatca gcagaagcca 120 ggcaaagttc ctaagttatt aatctactac acatccaggc tgcattccgg ggtgccctcc 180 cgcttttcgg gctccgggtc gggaaccgac tttaccctaa ccatatcttc cctgcagcct 240 gaagacgttg caacgtacta ttgtcagcag tcaaagacat taccatggac atttggtggt 300 gggacgcaac tcactgtact t 321 <210> 13 <211> 366 <212> DNA <213> Mus musculus <400> 13 caggtgcagc tagtggagtc cggtggcggc ctcgttaagc cgggcggatc gctgcgcctt 60 tcatgtgccg catcaggatt cacattctcc agttactcta tgtcatggat tcggcaggca 120 cctggcaagg gattggaatg ggtctcgtac attaatgatt caggtggaag tacattctat 180 ccggacacgg ttaaaggtag atttaccatc agccgtgata acgcgaagaa tagcttgtac 240 ttacagatga atagcctgcg tgcagaggat actgctgtat attattgcgc tcgacgtatg 300 tattatggca atagtcactg gcactttgac gtctggggcc agggcacgac agttactgtc 360 tcttcg 366 <210> 14 <211> 30 <212> DNA <213> Homo sapiens <400> 14 aaacccctac ctgaagtgac tgatgagtat 30 <210> 15 <211> 30 <212> DNA <213> Homo sapiens <400> 15 gaacaaaaac tcatctcaga agaggatctg 30 <210> 16 <211> 18 <212> DNA <213> Homo sapiens <400> 16 catcatcatc atcatcat 18 <210> 17 <211> 909 <212> DNA <213> Artificial sequences <220> <223> Chimeric DNA construct human / mouse <400> 17 atggagacag acacactcct gctatgggta ctgctgctct gggttccagg ttccactggt 60 gacgcggccc agccggccga ggtgcagctg cagcagtcag gacctgaact ggtgaagcct 120 gggacttcag tgaggatatc ctgcaagact tctggataca cattcactga atataccata 180 cactgggtga agcagagcca tggaaagagc cttgagtgga ttggaaacat caatcctaac 240 aatggtggta ccacctacaa tcagaagttc gaggacaagg ccacattgac tgtagacaag 300 tcctccagta cagcctacat ggagctccgc agcctaacat ctgaggattc tgcagtctat 360 tattgtgcag ctggttggaa ctttgactac tggggccaag ggaccacggt caccgtctcc 420 tcaggtggag gtggatcagg tggaggtgga tctggtggag gtggatctga cattgtgatg 480 acccagtctc acaaattcat gtccacatca gtaggagaca gggtcagcat catctgtaag 540 gccagtcaag atgtgggtac tgctgtagac tggtatcaac agaaaccagg acaatctcct 600 aaactactga tttattgggc atccactcgg cacactggag tccctgatcg cttcacaggc 660 agtggatctg ggacagactt cactctcacc attactaatg ttcagtctga agacttggca 720 gattatttct gtcagcaata taacagctat cccctcacgt tcggtgctgg gaccatgctg 780 gacctgaaag cggccgctaa acccctacct gaagtgactg atgagtatgc tcgaggaggg 840 cccgaacaaa aactcatctc agaagaggat ctgaatagcg ccgtcgacca tcatcatcat 900 [[ID=⑧]]catcattga 909 <210> 18 <211> 345 <212> DNA <213> Mouse <400> 18 gaggtgcagc tgcagcagtc aggacctgaa ctggtgaagc ctgggacttc agtgaggata 60 tcctgcaaga cttctggata cacattcact gaatatacca tacactgggt gaagcagagc 120 catggaaaga gccttgagtg gattggaaac atcaatccta acaatggtgg taccacctac 180 aatcagaagt tcgaggacaa ggccacattg actgtagaca agtcctccag tacagcctac 240 atggagctcc gcagcctaac atctgaggat tctgcagtct attattgtgc agctggttgg 300 aactttgact actggggcca agggaccacg gtcaccgtct cctca 345 <210> 19 <211> 321 <212> DNA It should be noted that there seems to be an incorrect "⑧" in the original text which is maintained as is during translation. If this is an error, it might need to be corrected in the original source for a more accurate translation.<213> Mouse <400> 19 gacattgtga tgacccagtc tcacaaattc atgtccacat cagtaggaga cagggtcagc 60 atcatctgta aggccagtca agatgtgggt actgctgtag actggtatca acagaaacca 120 ggacaatctc ctaaactact gatttattgg gcatccactc ggcacactgg agtccctgat 180 cgcttcacag gcagtggatc tgggacagac ttcactctca ccattactaa tgttcagtct 240 gaagacttgg cagattattt ctgtcagcaa tataacagct atcccctcac gttcggtgct 300 gggaccatgc tggacctgaa a 321 <210> 20 <211> 972 <212> DNA <213> Artificial Sequence <220> <223> Chimeric DNA sequence Mouse / Human <400> 20 atggagacag acacactcct gctatgggta ctgctgctct gggttccagg ttccactggt 60 gacgcggccc agccggccgg atccgatata gttttaaccc aatcccctgc tagtctggcc 120 gtatccccag gccagagggc tactataacc tgcactgcaa gctcatctgt caactacatc 180 cattggtacc agcagaaacc tggacaaccg ccgaaacttc tgatatacga caccagcaag 240 GTCGCCTCCGGGGGTGCCTGCTCGATTCAAGCGGCAGCGGATCAGGTACTGACTTCACCTTG 300 ACTATCAATCCAGTGGAAAGAATGATACTGCGAATTACTACTGCCAGCAATGGAGGTCG 360 TACCCCTTGACATTTGGCCAAAGTACTAAACTAGAGATAAAAGGTGGAGGTGGCAGTGGT 420 GGAGGAGGGAGCGGAGCAAGTGGCGCCGGAGGCAGGAGGTTCAAGCGGTGGTGGAAGCCA 480 GTACAACGGGTCCAATCTGGAGCCGAAGTCAAGAAACCAAGAGCTTCTGTGAAAGTCAGT 540 TGCAAGGCCTCTGGGTATACATTCACAGATTACGTAATACACTGGGTAGGCAAGCTCCT 600 GGTCAAGGGCTTGAATGGATGGGATATATTAATCCGTACAACGACGGAACAAAATATAA 660 GAGAAGTTTAAGGGTAGAGTAAC TATGACCAGGGACACAA GCATCAGTACAGC GTATATG 720 GAAC TGA GTCGTCTCCGGTC TGATGACACCGCTGTCTATTATTGTGCAAGAGATTACC GT 780 TACGAGGTTTACGGCATGGACTATTGGGGCCAAGGCAC TCTCGTTACCGTGTCAAGCGGA 840 GGAGGAGGATCCGC GGC GC TAAACCCCTACCTGAAGT GACTGATGAGTATGCTCGAGGA 900 GGGCCC GAAAC AAAACTCATCTCAGAAGAGGATCTG AATAGCGCCGTCGACCATCATCAT 960 CATCATCATTGA 972 <210> 21 <211> 318 <212> DNA <213> Mouse <400> 21 gatatagttt taacccaatc ccctgctagt ctggccgtat ccccaggcca gagggctact 60 ataacctgca ctgcaagctc atctgtcaac tacatccatt ggtaccagca gaaacctgga 120 caaccgccga aacttctgat atacgacacc agcaaggtcg cgtccggggt gcctgctcga 180 ttcagcggca gcggatcagg tactgacttc actttgacta tcaatccagt ggaagcgaac 240 gatactgcga actactactg ccagcaatgg aggtcgtacc ccttgacatt tggccaaggt 300 actaaactag agataaaa 318 <210> 22 <211> 360 <212> DNA <213> Mouse <400> 22 caggtacaac tggtccaatc tggagccgaa gtcaagaaac caggagcttc tgtgaaagtc 60 agttgcaagg cgtctgggta tacattcaca gattacgtag tacactgggt taggcaagct 120 cctggtcaag ggcttgaatg gatgggatat attaatccgt acaacgacgg aacaaaatat 180 aacgagaagt ttaagggtag agtaactatg accagggaca caagcatcag tacagcgtat 240 atggaactga gtcgtctccg gtctgatgac accgctgtct attattgtgc aagagattac 300 cgttacgagg tttacggcat ggactattgg ggccaaggca ctctcgttac cgtgtcaagc 360 <210> 23 <211> 963 <212> DNA <213> Artificial Sequence <220> <223> Chimeric DNA sequence Mouse / Human <400> 23 atggagacag acacactcct gctatgggta ctgctgctct gggttccagg ttccactggt 60 gacgcggccc agccggccga agtgcagctg cagcagtctg gccccgagct ggtcaaacca 120 ggcgccagcg tgaagatgag ctgcaaggcc agcggctaca ccttcaccga ctactacatg 180 aagtgggtca agcagagcca cggcaagagc ctggaatgga tcggcgacat catccccagc 240 aacggcgcca ccttctacaa ccagaagttc aagggcaagg ccaccctgac cgtggacaga 300 agcagcagca ccgcctacat gcacctgaac agcctgacca gcgaggacag cgccgtgtac 360 tactgcacca gaagccatct gctgcgggcc agttggttcg cttattgggg ccagggcacc 420 ctggtcacag tgtctgccgc ctctggagga ggaggtagtg gcggaggtgg gtccggtggc 480 ggtggctctg acttcgtgat gacccagagc cctagcagcc tgaccgtgac agccggcgag 540 aaagtgacca tgagctgcaa gagcagccag agcctgctga actccggcaa ccagaagaac 600 tacctgacct ggtatctgca gaagcccgga cagcccccca agctgctgat ctactgggcc 660 agcaccagag aaagcggcgt gcccgataga ttcacaggca gcggcagcgg caccgacttc 720 accctgacaa tcagcagcgt gcaggccgag gacctggccg tgtactattg ccagaacgac 780 tacagctacc cctacacctt cggaggcggg accaagctgg aaatcaaggg aggaggagga 840 tccgcggccg ctaaacccct acctgaagtg actgatgagt atgctcgagg agggcccgaa 900 caaaaactca tctcagaaga ggatctgaat agcgccgtcg accatcatca tcatcatcat 960 tga 963 <210> 24 <211> 357 <212> DNA <213> Mouse <400> 24 gaagtgcagc tgcagcagtc tggccccgag ctggtcaaac caggcgccag cgtgaagatg 60 agctgcaagg ccagcggcta caccttcacc gactactaca tgaagtgggt caagcagagc 120 CAGAAGTGAA CGGCTCTATG GCTGCCTATG ATTAACAGCC GGGAGGAGTA 60 AACCAGAAGT TCAAGGGCAA GGCCACCCTG ACCGTGGACA GAAGCAGCAG CACC GCCTAC 240 ATGCACCTGA ACAGCCTGAC CAGCGAGGAC AGCGCCGTGT ACTACTGCAC CAGAAGCCAT 300 CTGCTGCGGG CCAGTTGGTT CGCTTATTGG GGCCAGGGC ACCCTGGTCA CAGTGTC 357 <210> 25 <211> 339 <212> DNA <213> Mouse <400> 25 GACTTCGTGA TGACCCAGAG CCCTAGCAGC CTGACCGTGA CAGCCGGCGA GAAAGTGACC 60 ATGAGCTGCA AGAGCAGCCA GAGCCTGCTG AACTCCGGCA ACCAGAAGAA CTACCTGACC 120 TGGTATCTGC AGAAGCCCgg ACAGCCCCCA AGCTGCTGAT CTACTGGGCC AGCACCAGA 180 GAAAGCGGCG TGCCCGATAG ATTACAGGCA GCggCAGCGG CACCgACTT CACCCTGACA 240 ATCAGCAGCG TGCAGGCCGA GGACCTGGCC GTGTACTATT GCCAGAAGAC TACAGCTAC 300 CCCTACACCT TCGGAGGCGG ACCAAGCTG GAAATCAAG 339 <210> 26 <211> 1671 <212> DNA <213> Artificial Sequence <220> <223> Chimeric DNA sequence mouse / human <400> 26 atggagacag acacactcct gctatgggta ctgctgctct gggttccagg ttccactggt 60 gacgcggccc agccggccga agtgcagctg cagcagtctg gccccgagct ggtcaaacca 120 ggcgccagcg tgaagatgag ctgcaaggcc agcggctaca ccttcaccga ctactacatg 180 aagtgggtca agcagagcca cggcaagagc ctggaatgga tcggcgacat catccccagc 240 aacggcgcca ccttctacaa ccagaagttc aagggcaagg ccaccctgac cgtggacaga 300 agcagcagca ccgcctacat gcacctgaac agcctgacca gcgaggacag cgccgtgtac 360 tactgcacca gaagccatct gctgcgggcc agttggttcg cttattgggg ccagggcacc 420 ctggtcacag tgtctgccgc ctctggagga ggaggtagtg gcggaggtgg gtccggtggc 480 ggtggctctg acttcgtgat gacccagagc cctagcagcc tgaccgtgac agccggcgag 540 aaagtgacca tgagctgcaa gagcagccag agcctgctga actccggcaa ccagaagaac 600 tacctgacct ggtatctgca gaagcccgga cagcccccca agctgctgat ctactgggcc 660 agcaccagag aaagcggcgt gcccgataga ttcacaggca gcggcagcgg caccgacttc 720 accctgacaa tcagcagcgt gcaggccgag gacctggccg tgtactattg ccagaacgac 780 tacagctacc cctacacctt cggaggcggg accaagctgg aaatcaaggc ggccgctaaa 840 cccctacctg aagtgactga tgagtatgct cgaggacagg tacaactggt ccaatctgga 900 gccgaagtca agaaaccagg agcttctgtg aaagtcagtt gcaaggcgtc tgggtataca 960 ttcacagatt acgtagtaca ctgggttagg caagctcctg gtcaagggct tgaatggatg 1020 ggatatatta atccgtacaa cgacggaaca aaatataacg agaagtttaa gggtagagta 1080 actatgacca gggacacaag catcagtaca gcgtatatgg aactgagtcg tctccggtct 1140 gatgacaccg ctgtctatta ttgtgcaaga gattaccgtt acgaggttta cggcatggac 1200 tattggggcc aaggcactct cgttaccgtg tcaagcggcg gcggcggatc cggcggtggc 1260 ggttccggag gaggcggatc cgatatagtt ttaacccaat cccctgctag tctggccgta 1320 tccccaggcc agagggctac tataacctgc actgcaagct catctgtcaa ctacatccat 1380 TGGTACCAGC AGAAACCTGG ACAACC GCCGAAACTTCTGATATCGACACCAGCAAGGTC 1440 GCGTCCGGGG TGCCTGCTCG ATTCA GC GGCA GC GGA TC AG GTAC TG ACTT C ACTTTGACT 1500 ATCAATCCAG TGGAAGCGAA CGATACTGCG AACTACTACT GCCAGCAATG GAGGTCGTAC 1560 CCCTTGACAT TTGGCCAAGG TACTAAACTA GAGATAAAAG GGCCC GAACA AAAACTCATC 1620 TCAGAAGAGG ATCTGAA TAGC GCCGTCGAC CATCATCAT CATCATCATTG A 1671 <210> 27 <211> 894 <212> PRT <213> Artificial Sequence <220> <223> Chimeric Fusion Protein Mouse / Human <400> 27 Met Arg Arg Met Gin Leu Leu Leu Leu lie Ala Leu Ser Leu Ala Leu 1 5 10 15 Val Thr Asn Ser Glu Phe Gin Val Gin Leu Val Gin Ser Gly Ala Glu 20 25 30 Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly 35 40 45 Tyr Thr Phe Thr His Tyr Tyr lie Tyr Trp Val Arg Gin Ala Pro Gly 50 55 60 Gln Gly Leu Glu Trp Met Gly Gly Val Asn Pro Ser Asn Gly Gly Thr 65 70 75 80 His Phe Asn Glu Lys Phe Lys Ser Arg Val Thr Met Thr Arg Asp Thr 85 90 95 Ser Ile Ser Thr Ala Tyr Met Glu Leu Ser Arg Leu Arg Ser Asp Asp 100 105 110 Thr Ala Val Tyr Tyr Cys Ala Arg Ser Glu Tyr Asp Tyr Gly Leu Gly 115 120 125 Phe Ala Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly 130 135 140 Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val 145 150 155 160 Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala 165 170 175 Thr Ile Asn Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser Arg Thr Pro 180 185 190 Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys 195 200 205 Leu Leu Ile Tyr Trp Ala Ser Thr Arg Lys Ser Gly Val Pro Asp Arg 210 215 220 Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr lie Ser Ser 225 230 235 240 Leu Gin Ala Glu Asp Val Ala Val Tyr Tyr Cys Lys Gin Ser Tyr Asn 245 250 255 Leu Leu Thr Phe Gly Gly Gly Thr Lys Val Glu lie Lys Ala Ala Ala 260 265 270 Leu Glu Lys Glu Ala Leu Lys Lys lie lie Glu Asp Gin Gin Glu Ala 275 280 285 Leu Asn Lys Trp Ala Ala Ala Gly Pro Gly Gly Gly Gly Ser Lys lie 290 295 300 Leu Val Lys Gin Ser Pro Met Leu Val Ala Tyr Asp Asn Ala Val Asn 305 310 315 320 Leu Ser Cys Lys Tyr Ser Tyr Asn Leu Phe Ser Arg Glu Phe Arg Ala 325 330 335 Ser Leu His Lys Gly Leu Asp Ser Ala Val Glu Val Cys Val Val Tyr 340 345 350 Gly Asn Tyr Ser Gin Gin Leu Gin Val Tyr Ser Lys Thr Gly Phe Asn 355 360 365 Cys Asp Gly Lys Leu Gly Asn Glu Ser Val Thr Phe Tyr Leu Gin Asn 370 375 380 Leu Tyr Val Asn Gln Thr Asp Ile Tyr Phe Cys Lys Ile Glu Val Met 385 390 395 400 Ala Pro Pro Pro Ala Leu Asp Asn Glu Lys Ser Asn Gly Thr Ile Ile 405 410 415 His Val Lys Gly Lys His Leu Cys Pro Ser Pro Leu Phe Pro Gly Pro 420 425 430 Ser Lys Pro Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys 435 440 445 Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val Arg Ser 450 455 460 Lys Arg Ser Arg Gly Gly His Ser Asp Tyr Met Asn Met Thr Pro Arg 465 470 475 480 Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg 485 490 495 Asp Phe Ala Ala Tyr Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly Ala 500 505 510 Ser Gly Gly Gly Gly Ser Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr 515 520 525 Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg 530 535 540 Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met 545 550 555 560 Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu 565 570 575 Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys 580 585 590 Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu 595 600 605 Ser Thr Ala Thr Lys Asp Thr Tyr Gly Ala Leu His Met Gln Ala Leu 610 615 620 Pro Pro Arg Gly Ser Gly Ser Ser Gly Glu Gly Arg Gly Ser Leu Leu 625 630 635 640 Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Pro Val Ala Thr Met 645 650 655 Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val 660 665 670 Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu 675 680 685 Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys 690 695 700 Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu 705 710 715 720 Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln 725 730 735 His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg 740 745 750 Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val 755 760 765 Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile 770 775 780 Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn 785 790 795 800 Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly 805 810 815 Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val 820 825 830 Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro 835 840 845 Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gin Ser Ala Leu Ser 850 855 860 Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val 865 870 875 880 Thr Ala Ala Gly He Thr Leu Gly Met Asp Glu Leu Tyr Lys 885 890 <210> 28 <211> 326 <212> PRT <213> Artificial Sequence <220> <223> Chimeric Fusion Protein Mouse / Human <400> 28 Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro 1 5 10 15 Gly Ser Thr Gly Asp Ala Ala Gin Pro Ala Gly Ser Asp He Gin Met 20 25 30 Thr Gin Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr 35 40 45 He Thr Cys Gly Thr Ser Gin Asp He Asn Asn Tyr Leu Asn Trp Tyr 50 55 60 Gln Gin Lys Pro Gly Lys Val Pro Lys Leu Leu He Tyr Tyr Thr Ser 65 70 75 80 Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly 85 90 95 Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Val Ala 100 105 110 Thr Tyr Tyr Cys Gln Gln Ser Lys Thr Leu Pro Trp Thr Phe Gly Gly 115 120 125 Gly Thr Gln Leu Thr Val Leu Gly Gly Gly Gly Ser Gly Gly Gly Gly 130 135 140 Ser Gly Ala Ser Ala Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 145 150 155 160 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly 165 170 175 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 180 185 190 Ser Met Ser Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 195 200 205 Ser Tyr Ile Asn Asp Ser Gly Gly Ser Thr Phe Tyr Pro Asp Thr Val 210 215 220 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 225 230 235 240 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 245 250 255 Ala Arg Arg Met Tyr Tyr Gly Asn Ser His Trp His Phe Asp Val Trp 260 265 270 Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Ala 275 280 285 Ala Ala Lys Pro Leu Pro Glu Val Thr Asp Glu Tyr Ala Arg Gly Gly 290 295 300 Pro Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Ser Ala Val Asp 305 310 315 320 His His His His His His 325 <210> 29 <211> 302 <212> PRT <213> Artificial Sequence <220> <223> Chimeric Fusion Protein Mouse / Human <400> 29 Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro 1 5 10 15 Gly Ser Thr Gly Asp Ala Ala Gln Pro Ala Glu Val Gin Leu Gin Gin 20 25 30 Ser Gly Pro Glu Leu Val Lys Pro Gly Thr Ser Val Arg Ile Ser Cys 35 40 45 Lys Thr Ser Gly Tyr Thr Phe Thr Glu Tyr Thr Ile His Trp Val Lys 50 55 60 Gln Ser His Gly Lys Ser Leu Glu Trp Ile Gly Asn Ile Asn Pro Asn 65 70 75 80 Asn Gly Gly Thr Thr Tyr Asn Gln Lys Phe Glu Asp Lys Ala Thr Leu 85 90 95 Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Glu Leu Arg Ser Leu 100 105 110 Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Ala Gly Trp Asn Phe 115 120 125 Asp Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly 130 135 140 Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val Met 145 150 155 160 Thr Gln Ser His Lys Phe Met Ser Thr Ser Val Gly Asp Arg Val Ser 165 170 175 Ile Ile Cys Lys Ala Ser Gln Asp Val Gly Thr Ala Val Asp Trp Tyr 180 185 190 Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr Trp Ala Ser 195 200 205 Thr Arg His Thr Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly 210 215 220 Thr Asp Phe Thr Leu Thr Ile Thr Asn Val Gln Ser Glu Asp Leu Ala 225 230 235 240 Asp Tyr Phe Cys Gln Gln Tyr Asn Ser Tyr Pro Leu Thr Phe Gly Ala 245 250 255 Gly Thr Met Leu Asp Leu Lys Ala Ala Ala Lys Pro Leu Pro Glu Val 260 265 270 Thr Asp Glu Tyr Ala Arg Gly Gly Pro Glu Gln Lys Leu Ile Ser Glu 275 280 285 Glu Asp Leu Asn Ser Ala Val Asp His His His His His His 290 295 300 <210> 30 <211> 323 <212> PRT <213> Artificial Sequence <220> <223> Chimeric Construct <400> 30 Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro 1 5 10 15 Gly Ser Thr Gly Asp Ala Ala Gln Pro Ala Gly Ser Asp Ile Val Leu 20 25 30 Thr Gin Ser Pro Ala Ser Leu Ala Val Ser Pro Gly Gin Arg Ala Thr 35 40 45 Ile Thr Cys Thr Ala Ser Ser Ser Val Asn Tyr Ile His Trp Tyr Gin 50 55 60 Gln Lys Pro Gly Gin Pro Pro Lys Leu Leu Ile Tyr Asp Thr Ser Lys 65 70 75 80 Val Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr 85 90 95 Asp Phe Thr Leu Thr Ile Asn Pro Val Glu Ala Asn Asp Thr Ala Asn 100 105 110 Tyr Tyr Cys Gin Gin Trp Arg Ser Tyr Pro Leu Thr Phe Gly Gin Gly 115 120 125 Thr Lys Leu Glu Ile Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 130 135 140 Gly Ala Ser Gly Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gin 145 150 155 160 Val Gin Leu Val Gin Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser 165 170 175 Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr Val 180 185 190 Val His Trp Val Arg Gin Ala Pro Gly Gin Gly Leu Glu Trp Met Gly 195 200 205 Tyr He Asn Pro Tyr Asn Asp Gly Thr Lys Tyr Asn Glu Lys Phe Lys 210 215 220 Gly Arg Val Thr Met Thr Arg Asp Thr Ser He Ser Thr Ala Tyr Met 225 230 235 240 Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys Ala 245 250 255 Arg Asp Tyr Arg Tyr Glu Val Tyr Gly Met Asp Tyr Trp Gly Gin Gly 260 265 270 Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Ala Ala Ala Lys 275 280 285 Pro Leu Pro Glu Val Thr Asp Glu Tyr Ala Arg Gly Gly Pro Glu Gin 290 295 300 Lys Leu He Ser Glu Glu Asp Leu Asn Ser Ala Val Asp His His His 305 310 315 320 His His His <210> 31 <211> 320 <212> PRT <213> Artificial Sequence <220> <223> Chimeric Fusion Protein Mouse / Human <400> 31 Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro 1 5 10 15 Gly Ser Thr Gly Asp Ala Ala Gln Pro Ala Glu Val Gln Leu Gln Gln 20 25 30 Ser Gly Pro Glu Leu Val Lys Pro Gly Ala Ser Val Lys Met Ser Cys 35 40 45 Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr Tyr Met Lys Trp Val Lys 50 55 60 Gln Ser His Gly Lys Ser Leu Glu Trp Ile Gly Asp Ile Ile Pro Ser 65 70 75 80 Asn Gly Ala Thr Phe Tyr Asn Gln Lys Phe Lys Gly Lys Ala Thr Leu 85 90 95 Thr Val Asp Arg Ser Ser Ser Thr Ala Tyr Met His Leu Asn Ser Leu 100 105 110 Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Thr Arg Ser His Leu Leu 115 120 125 Arg Ala Ser Trp Phe Ala Tyr Trp Gly Gln Gly Thr Leu Val Thr Val 130 135 140 Ser Ala Ala Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 145 150 155 160 Gly Gly Ser Asp Phe Val Met Thr Gin Ser Pro Ser Ser Leu Thr Val 165 170 175 Thr Ala Gly Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gin Ser Leu 180 185 190 Leu Asn Ser Gly Asn Gin Lys Asn Tyr Leu Thr Trp Tyr Leu Gin Lys 195 200 205 Pro Gly Gin Pro Pro Lys Leu Leu lie Tyr Trp Ala Ser Thr Arg Glu 210 215 220 Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe 225 230 235 240 Thr Leu Thr lie Ser Ser Val Gin Ala Glu Asp Leu Ala Val Tyr Tyr 245 250 255 Cys Gin Asn Asp Tyr Ser Tyr Pro Tyr Thr Phe Gly Gly Gly Thr Lys 260 265 270 Leu Glu lie Lys Gly Gly Gly Gly Ser Ala Ala Ala Lys Pro Leu Pro 275 280 285 Glu Val Thr Asp Glu Tyr Ala Arg Gly Gly Pro Glu Gin Lys Leu lie 290 295 300 Ser Glu Glu Asp Leu Asn Ser Ala Val Asp His His His His His His 305 310 315 320 <210> 32 <211> 556 <212> PRT <213> Artificial Sequence <220> <223> Chimeric fusion protein mouse / human <400> 32 Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro 1 5 10 15 Gly Ser Thr Gly Asp Ala Ala Gln Pro Ala Glu Val Gln Leu Gln Gln 20 25 30 Ser Gly Pro Glu Leu Val Lys Pro Gly Ala Ser Val Lys Met Ser Cys 35 40 45 Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr Tyr Met Lys Trp Val Lys 50 55 60 Gln Ser His Gly Lys Ser Leu Glu Trp Ile Gly Asp Ile Ile Pro Ser 65 70 75 80 Asn Gly Ala Thr Phe Tyr Asn Gln Lys Phe Lys Gly Lys Ala Thr Leu 85 90 95 Thr Val Asp Arg Ser Ser Ser Thr Ala Tyr Met His Leu Asn Ser Leu 100 105 110 Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Thr Arg Ser His Leu Leu 115 120 125 Arg Ala Ser Trp Phe Ala Tyr Trp Gly Gin Gly Thr Leu Val Thr Val 130 135 140 Ser Ala Ala Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 145 150 155 160 Gly Gly Ser Asp Phe Val Met Thr Gin Ser Pro Ser Ser Leu Thr Val 165 170 175 Thr Ala Gly Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gin Ser Leu 180 185 190 Leu Asn Ser Gly Asn Gin Lys Asn Tyr Leu Thr Trp Tyr Leu Gin Lys 195 200 205 Pro Gly Gin Pro Pro Lys Leu Leu lie Tyr Trp Ala Ser Thr Arg Glu 210 215 220 Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe 225 230 235 240 Thr Leu Thr lie Ser Ser Val Gin Ala Glu Asp Leu Ala Val Tyr Tyr 245 250 255 Cys Gin Asn Asp Tyr Ser Tyr Pro Tyr Thr Phe Gly Gly Gly Thr Lys 260 265 270 Leu Glu lie Lys Ala Ala Ala Lys Pro Leu Pro Glu Val Thr Asp Glu 275 280 285 Tyr Ala Arg Gly Gin Val Gin Leu Val Gin Ser Gly Ala Glu Val Lys 290 295 300 Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr 305 310 315 320 Phe Thr Asp Tyr Val Val His Trp Val Arg Gin Ala Pro Gly Gin Gly 325 330 335 Leu Glu Trp Met Gly Tyr He Asn Pro Tyr Asn Asp Gly Thr Lys Tyr 340 345 350 Asn Glu Lys Phe Lys Gly Arg Val Thr Met Thr Arg Asp Thr Ser He 355 360 365 Ser Thr Ala Tyr Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala 370 375 380 Val Tyr Tyr Cys Ala Arg Asp Tyr Arg Tyr Glu Val Tyr Gly Met Asp 385 390 395 400 Tyr Trp Gly Gin Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly 405 410 415 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp He Val Leu Thr 420 425 430 Gln Ser Pro Ala Ser Leu Ala Val Ser Pro Gly Gin Arg Ala Thr He 435 440 445 Thr Cys Thr Ala Ser Ser Ser Val Asn Tyr Ile His Trp Tyr Gln Gln 450 455 460 Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Asp Thr Ser Lys Val 465 470 475 480 Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 485 490 495 Phe Thr Leu Thr Ile Asn Pro Val Glu Ala Asn Asp Thr Ala Asn Tyr 500 505 510 Tyr Cys Gln Gln Trp Arg Ser Tyr Pro Leu Thr Phe Gly Gln Gly Thr 515 520 525 Lys Leu Glu Ile Lys Gly Pro Glu Gln Lys Leu Ile Ser Glu Glu Asp 530 535 540 Leu Asn Ser Ala Val Asp His His His His His His 545 550 555 <210> 33 <211> 120 <212> PRT <213> Mouse <400> 33 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr His Tyr 20 25 30 Tyr Ile Tyr Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Gly Val Asn Pro Ser Asn Gly Gly Thr His Phe Asn Glu Lys Phe 50 55 60 Lys Ser Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ser Glu Tyr Asp Tyr Gly Leu Gly Phe Ala Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 34 <211> 112 <212> PRT <213> Mouse <400> 34 Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser 20 25 30 Arg Thr Pro Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Pro Pro Lys Leu Leu lie Tyr Trp Ala Ser Thr Arg Lys Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 lie Ser Ser Leu Gin Ala Glu Asp Val Ala Val Tyr Tyr Cys Lys Gin 85 90 95 Ser Tyr Asn Leu Leu Thr Phe Gly Gly Gly Thr Lys Val Glu lie Lys 100 105 110 <210> 35 <211> 20 <212> PRT <213> Homo sapiens <400> 35 Leu Glu Lys Glu Ala Leu Lys Lys lie lie Glu Asp Gin Gin Glu Ala 1 5 10 15 Leu Asn Lys Trp 20 <210> 36 <211> 107 <212> PRT <213> Mus musculus <400> 36 Asp lie Gin Met Thr Gin Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr lie Thr Cys Gly Thr Ser Gin Asp lie Asn Asn Tyr 20 25 30 Leu Asn Trp Tyr Gin Gin Lys Pro Gly Lys Val Pro Lys Leu Leu lie 35 40 45 Tyr Tyr Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr lie Ser Ser Leu Gin Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Gin Gin Ser Lys Thr Leu Pro Trp 85 90 95 Thr Phe Gly Gly Gly Thr Gin Leu Thr Val Leu 100 105 <210> 37 <211> 122 <212> PRT <213> Mus musculus <400> 37 Gin Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ser Met Ser Trp lie Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Tyr lie Asn Asp Ser Gly Gly Ser Thr Phe Tyr Pro Asp Thr Val 50 55 60 ​​​​​​​​​​​​​​​​​​​​​​Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Arg Met Tyr Tyr Gly Asn Ser His Trp His Phe Asp Val Trp 100 105 110 Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 38 <211> 115 <212> PRT <213> Mouse <400> 38 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Thr 1 5 10 15 Ser Val Arg Ile Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Glu Tyr 20 25 30 Thr Ile His Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile 35 40 45 Gly Asn Ile Asn Pro Asn Asn Gly Gly Thr Thr Tyr Asn Gln Lys Phe 50 55 60 Glu Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Gly Trp Asn Phe Asp Tyr Trp Gly Gln Gly Thr Thr Val Thr 100 105 110 Val Ser Ser 115 <210> 39 <211> 107 <212> PRT <213> Mouse <400> 39 Asp Ile Val Met Thr Gln Ser His Lys Phe Met Ser Thr Ser Val Gly 1 5 10 15 Asp Arg Val Ser Ile Ile Cys Lys Ala Ser Gln Asp Val Gly Thr Ala 20 25 30 Val Asp Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile 35 40 45 Tyr Trp Ala Ser Thr Arg His Thr Gly Val Pro Asp Arg Phe Thr Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Thr Asn Val Gln Ser 65 70 75 80 Glu Asp Leu Ala Asp Tyr Phe Cys Gln Gln Tyr Asn Ser Tyr Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Met Leu Asp Leu Lys [[ID= <210> 40 <211> 106 <212> PRT <213> Mouse <400> 40 Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Pro Gly 1 5 10 15 Gln Arg Ala Thr Ile Thr Cys Thr Ala Ser Ser Ser Val Asn Tyr Ile 20 25 30 His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr 35 40 45 Asp Thr Ser Lys Val Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Ser 50 55 60 Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Asn Pro Val Glu Ala Asn 65 70 75 80 Asp Thr Ala Asn Tyr Tyr Cys Gln Gln Trp Arg Ser Tyr Pro Leu Thr 85 90 95 Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 <210> 41 <211> 120 <212> PRT <213> Mouse <400> 41 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Val Val His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Tyr Ile Asn Pro Tyr Asn Asp Gly Thr Lys Tyr Asn Glu Lys Phe 50 55 60 Lys Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Asp Tyr Arg Tyr Glu Val Tyr Gly Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 42 <211> 119 <212> PRT <213> Mouse <400> 42 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Tyr Met Lys Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile 35 40 45 Gly Asp Ile Ile Pro Ser Asn Gly Ala Thr Phe Tyr Asn Gln Lys Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Val Asp Arg Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met His Leu Asn Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Thr Arg Ser His Leu Leu Arg Ala Ser Trp Phe Ala Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser 115 <210> The 43rd <211> 113 <212> PRT <213> Mouse <400> This sequence is the 43rd Asp Phe Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly 1 5 10 15 Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser 20 25 30 Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Leu Gln Lys Pro Gly Gln 35 40 45 Pro Pro Lys Leu Leu lie Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 lie Ser Ser Val Gin Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gin Asn 85 90 95 Asp Tyr Ser Tyr Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu lie 100 105 110 Lys <210> 44 <211> 10 <212> PRT <213> Homo sapiens <400> 44 Lys Pro Leu Pro Glu Val Thr Asp Glu Tyr 1 5 10

Claims

1. A nucleic acid encoding a universal chimeric antigen receptor, wherein the receptor comprises three domains, wherein - The first structural domain is the label-based structural domain. - The second domain is the extracellular hinge and transmembrane domain, and - The third structural domain is the signal transduction structural domain. The tag-binding domain is an antibody or its antigen-binding fragment, and binds to a tag derived from a human nuclear protein, wherein the tag is a short linear epitope from the human nuclear La protein (E5B9) encoded by the nucleic acid sequence of SEQ ID No.

14. The tag-binding domain constitutes an anti-La epitope scFv, which has a humanized anti-La 5B9 antibody variable region heavy chain encoded by the nucleic acid sequence of SEQ ID No. 3, and a humanized anti-La 5B9 antibody variable region light chain encoded by the nucleic acid sequence of SEQ ID No.

4.

2. The nucleic acid according to claim 1, wherein the hinge and transmembrane domain are selected from the hinge and transmembrane regions of the constant region of the human CD28 molecule, the CD8α chain, the NK cell receptor, or an antibody, and combinations thereof of different hinge and transmembrane domains.

3. The nucleic acid according to claim 1, wherein the hinge and transmembrane domain are selected from the hinge and transmembrane regions of the natural killer class NKG2D.

4. The nucleic acid according to claim 1, wherein the signal transduction domain is selected from the signal transduction domains of CD28, CD137 (4-1BB), CD134 (OX40), DAP10, CD27, programmed cell death-1 (PD-1), cytotoxic T-lymphocyte antigen 4 (CTLA-4), CD3 chain, DAP12 and T cell activation-inducible Fc receptor.

5. The nucleic acid according to any one of claims 1 to 4, wherein the receptor comprises a fourth domain, the fourth domain being a short peptide linker between the tag-binding domain and the extracellular hinge and transmembrane domain.

6. A cell or vector comprising the nucleic acid according to any one of claims 1 to 5.

7. The cell or carrier according to claim 6, wherein the cell is an immune cell.

8. The cell or vector according to claim 6, wherein the cell is selected from T cells, natural killer cells, and macrophages.

9. The cell or vector according to claim 6, wherein the cell is a cytotoxic T lymphocyte or a regulatory T cell.

10. A reagent kit comprising: - The cell or carrier according to any one of claims 6 to 9, and - A target module consisting of an amino acid sequence of SEQ ID No. 28, 29, 30, 31 or 32, or a vector containing nucleic acids having sequences selected from SEQ ID No. 10, 17, 20, 23 and 26.

11. A formulation comprising: - The cell or carrier according to any one of claims 6 to 9, and - A target module consisting of an amino acid sequence of SEQ ID No. 28, 29, 30, 31 or 32, or a vector containing nucleic acids having sequences selected from SEQ ID No. 10, 17, 20, 23 and 26.

Images