Detection of Colorectal Cancer

Abstract

The present disclosure particularly provides methods for colorectal cancer screening and related compositions. In various embodiments, the present disclosure provides methods for colorectal cancer screening, which include analyzing the methylation status of one or more methylation biomarkers, and related compositions. In various embodiments, the present disclosure provides methods for colorectal cancer screening, which include screening the methylation status of one or more methylation biomarkers in cfDNA, such as ctDNA. In various embodiments, the present disclosure provides methods for colorectal cancer screening, which include using MSRE-qPCR to screen the methylation status of one or more methylation biomarkers in cfDNA, such as ctDNA.

Description

Background Art

[0001] Cancer screening is an important part of cancer prevention, diagnosis, and treatment. According to some reports, colorectal cancer (CRC) has been identified as the third most common type of cancer in the world and the second leading cause of cancer death in terms of frequency. According to some reports, there are more than 1.8 million new cases of colorectal cancer each year, and approximately 881,000 people die from colorectal cancer, accounting for about one-tenth of cancer deaths. Regular colorectal cancer screening is recommended, especially for individuals over 50 years of age. In addition, the incidence of colorectal cancer in individuals under 50 years of age has been increasing over time. Statistical data indicate that current colorectal cancer screening techniques are insufficient. Summary of the Invention

[0002] Although it has improved over time, currently only about 40% to 44% of colorectal cancers are detected through early, local-stage screening. This is at least partially due to the insufficient sensitivity and / or specificity of current screening techniques. Currently recommended techniques include colonoscopy and / or fecal blood testing for people over 50 years of age.

[0003] The present disclosure particularly provides methods for colorectal cancer screening and related compositions. In various embodiments, the present disclosure provides methods for colorectal cancer screening, which include analyzing the methylation status of one or more methylation biomarkers, and related compositions. In various embodiments, the present disclosure provides methods for colorectal cancer screening, which include screening the methylation status of one or more methylation biomarkers in cfDNA, such as ctDNA. In various embodiments, the present disclosure provides methods for colorectal cancer screening, including screening the methylation status of one or more methylation biomarkers in cfDNA, such as ctDNA, using MSRE-qPCR. The various compositions and methods provided herein provide sensitivity and specificity sufficient for clinical applications for colorectal cancer screening. The various compositions and methods provided herein can be used for colorectal cancer screening by analyzing accessible tissue samples of a subject, such as tissue samples as blood or blood components (e.g., cfDNA, e.g., ctDNA) or feces.

[0004] In some aspects, the present disclosure particularly provides a method for screening colorectal cancer, the method comprising determining the methylation status of one or more colorectal cancer methylation loci selected from the following in the DNA of a human subject: (a) one or more genes according to Table 1 (which includes, for example, ALK, LONRF2, ADAMTS2, FGF14, DMRT1, ST6GALNAC5, MCIDAS, PDGFD, GSG1L, ZNF492, ZNF568, ZNF542, ZNF471, ZNF132, JAM2, and CNRIP1); and / or (b) one or more differentially methylated regions (DMRs) according to Table 7 (including, for example, ALK‘434, CNRIP1‘232, CNRIP1‘272, LONRF2‘281, LONRF2‘387, ADAMTS2‘254, ADAMTS2‘284, ADAMTS2‘328, FGF14‘577, DMRT1‘934, ST6GALNAC5‘456, MCIDAS‘855, MCIDAS‘003, PDGFD‘388, PDGFD‘921, GSG1L‘861, ZNF492’499, ZNF492‘069, ZNF568‘252, ZNF568‘405, ZNF542‘525, ZNF542‘502, ZNF471‘527, ZNF471‘558, ZNF471‘662, ZNF132‘268, ZNF132‘415, and JAM2‘320), and diagnosing colorectal cancer in the subject. For example, in some embodiments, one or more members selected from the group consisting of methylation-specific restriction enzyme quantitative polymerase chain reaction (MSRE-qPCR), methylation-specific PCR, methylation-specific nuclease-assisted minor allele enrichment PCR, and next-generation sequencing can be used to determine the methylation status. In various embodiments, after screening or diagnosis, a diagnostic confirmation test is performed on the human subject, such as the diagnostic confirmation test provided in the present disclosure. In certain cases, the diagnostic confirmation test is a colonoscopy. In certain cases, the diagnostic confirmation test is performed within two weeks, one month, two months, three months, or one year after screening or diagnosis.

[0005] In some aspects, the present disclosure particularly provides a method of methylation-specific restriction enzyme quantitative polymerase chain reaction (MSRE-qPCR) for colorectal cancer screening, the method comprising: (a) contacting DNA of a human subject with one or more methylation-specific restriction enzymes; (b) performing qPCR on the enzyme-digested DNA or its amplicons to determine the methylation status of one or more colorectal cancer methylation loci selected from: (i) one or more genes according to Table 1; and / or (ii) one or more differentially methylated regions (DMRs) according to Table 7. In various embodiments, as specifically mentioned above, the DNA of a human subject is contacted with methylation-specific restriction enzymes to, for example, digest unmethylated non-tumor-derived DNA. In various embodiments, the digested DNA and / or the DNA remaining after digestion is pre-amplified (e.g., amplified in an amplification step prior to qPCR) for all or part of one or more selected colorectal cancer methylation loci. In certain embodiments, the pre-amplification comprises amplifying one or more samples of the digested DNA or the DNA remaining after digestion in an amplification reaction comprising one or more or all of the oligonucleotide primer pairs of Table 13, for example, wherein the oligonucleotide primers are provided in a single library. In subsequent qPCR, those skilled in the art will understand that the methylation status will be determined separately, individually, for each individual methylation locus (e.g., each DMR). In various embodiments, for example, as specifically mentioned above, the DNA is an aliquot of a sample such that a separate aliquot of the sample not contacted with the methylation-specific restriction enzyme can provide a DNA reference library for qPCR, which DNA reference library can be subjected to the same or comparable qPCR conditions as the digested DNA (e.g., pre-amplified using the same oligonucleotide primer pairs and quantified using qPCR).

[0006] In some aspects, the present disclosure particularly provides a method for treating colorectal cancer (e.g., colorectal cancer as early colorectal cancer), the method comprising: (a) diagnosing colorectal cancer (e.g., colorectal cancer as early colorectal cancer) based on the methylation status of one or more colorectal cancer methylation loci selected from the following in the DNA of a human subject: (i) one or more genes according to Table 1; and / or (ii) one or more differentially methylated regions (DMRs) according to Table 7; (b) treating colorectal cancer (e.g., colorectal cancer as early colorectal cancer). In various embodiments, for example, as specifically mentioned above, after the diagnosis based on the methylation status, a diagnostic confirmation test is performed on the human subject, such as the diagnostic confirmation test provided in the present disclosure. In some embodiments, for example, as specifically mentioned above, the diagnostic confirmation test is a colonoscopy. In some embodiments, for example, as specifically mentioned above, the diagnostic confirmation test is performed within two weeks, within one month, within two months, within three months, or within one year of the diagnosis based on the methylation status.

[0007] In some aspects, the present disclosure particularly provides a method for treating early colorectal cancer, the method comprising: (a) diagnosing early colorectal cancer based on the methylation status of one or more colorectal cancer methylation loci selected from the following in the DNA of a human subject: (i) one or more genes according to Table 1; and / or (ii) one or more differentially methylated regions (DMRs) according to Table 7; (b) treating early colorectal cancer. In various embodiments, for example, as specifically mentioned above, after the diagnosis based on the methylation status, a diagnostic confirmation test is performed on the human subject, for example, as specifically mentioned above, a diagnostic confirmation test is performed on the human subject, such as the diagnostic confirmation test provided in the present disclosure, and then the diagnosis is based on the methylation status. In some embodiments, for example, as specifically mentioned above, the diagnostic confirmation test is a colonoscopy. In some embodiments, for example, as specifically mentioned above, the diagnostic confirmation test is performed within two weeks, within one month, within two months, within three months, or within one year of the diagnosis based on the methylation status.

[0008] In some aspects, the present disclosure provides methods for analyzing or using methylated-sensitivity restriction enzyme-digested human DNA, such as methylated-sensitivity restriction enzyme-digested human cfDNA, in an in vitro method for screening colorectal cancer, the method comprising determining the methylation status of one or more colorectal cancer methylation loci selected from the group consisting of: (a) one or more genes according to Table 1 (which includes, for example, ALK, LONRF2, ADAMTS2, FGF14, DMRT1, ST6GALNAC5, MCIDAS, PDGFD, GSG1L, ZNF492, ZNF568, ZNF542, ZNF471, ZNF132, JAM2, and CNRIP1); and / or (b) one or more differentially methylated regions (DMRs) according to Table 7 (including, for example, ALK‘434, CNRIP1‘232, CNRIP1‘272, LONRF2‘281, LONRF2‘387, ADAMTS2‘254, ADAMTS2‘284, ADAMTS2‘328, FGF14‘577, DMRT1‘934, ST6GALNAC5‘456, MCIDAS‘855, MCIDAS‘003, PDGFD‘388, PDGFD‘921, GSG1L‘861, ZNF492’499, ZNF492‘069, ZNF568‘252, ZNF568‘405, ZNF542‘525, ZNF542‘502, ZNF471‘527, ZNF471‘558, ZNF471‘662, ZNF132‘268, ZNF132‘415, and JAM2‘320), and diagnosing colorectal cancer in a subject. For example, in some embodiments, one or more selected from the group consisting of methylated-sensitivity restriction enzyme quantitative polymerase chain reaction (MSRE-qPCR), methylation-specific PCR, methylation-specific nuclease-assisted small-allele enrichment PCR, and next-generation sequencing can be used to determine the methylation status. In various embodiments, after screening or diagnosing, a diagnostic confirmation test is performed on a human subject, such as the diagnostic confirmation test provided in the present disclosure. In certain cases, the diagnostic confirmation test is a colonoscopy. In certain cases, the diagnostic confirmation test is performed within two weeks, within one month, within two months, within three months, or within one year after screening or diagnosing.

[0009] In various embodiments, for example, as specifically mentioned above, one aspect of the present disclosure can include determining whether one or more methylation loci are hypermethylated compared to a reference, wherein hypermethylation indicates colorectal cancer.

[0010] In various embodiments, for example, as specifically mentioned above, one aspect of the present disclosure may include determining the methylation status of at least one DMR of each of ZNF471 and FGF14. In various embodiments, for example, as specifically mentioned above, one aspect of the present disclosure may include determining the methylation status of at least one DMR of each of ZNF471, FGF14, and PDGFD. In various embodiments, for example, as specifically mentioned above, one aspect of the present disclosure may include determining the methylation status of at least one DMR of each of ZNF471, FGF14, PDGFD, and ADAMTS2. In various embodiments, for example, as specifically mentioned above, one aspect of the present disclosure may include determining the methylation status of at least one DMR of each of ZNF471, FGF14, PDGFD, ADAMTS2, ZNF492, and ST6GALNAC5. In various embodiments, for example, as specifically mentioned above, one aspect of the present disclosure may include determining the methylation status of at least one DMR of each of ZNF471, FGF14, PDGFD, ADAMTS2, ZNF492, ST6GALNAC5, ZNF542, LONRF2, ZNF132, and CNRIP1, and ALK. In various embodiments, for example, as specifically mentioned above, one aspect of the present disclosure may include determining the methylation status of at least one DMR of each of ALK, LONRF2, ADAMTS2, FGF14, DMRT1, ST6GALNAC5, MCIDAS, PDGFD, GSG1L, ZNF568, ZNF542, ZNF471, ZNF132, JAM2, ZNF492, and CNRIP1.

[0011] In various embodiments, for example, as specifically mentioned above, one aspect of the present disclosure can expressly and / or specifically exclude the use of one or more colorectal cancer methylation loci selected from: (i) one or more genes according to Table 1; and / or (ii) one or more differentially methylated regions (DMRs) according to Table 7. The colorectal cancer methylation loci are selected from FGF14, ZNF471, PDGFD, and ALK and combinations thereof. In some embodiments, for example, as specifically mentioned above, one aspect of the present disclosure can expressly and / or specifically exclude the use of one or more colorectal cancer methylation loci selected from FGF14, ZNF471, PDGFD, and ALK and combinations thereof. In some embodiments, for example, as specifically mentioned above, one aspect of the present disclosure can expressly and / or specifically exclude the use of FGF14 as a methylation locus for screening colorectal cancer, and such exclusion can be exclusion of FGF14 alone or exclusion of multiple methylation sites including FGF14. In some embodiments, for example, as specifically mentioned above, one aspect of the present disclosure can expressly and / or specifically exclude the use of ZNF471 as a methylation locus for screening colorectal cancer, and such exclusion can be exclusion of ZNF471 alone or exclusion of multiple methylation loci including ZNF471. In some embodiments, for example, as specifically mentioned above, one aspect of the present disclosure can expressly and / or specifically exclude the use of PDGFD as a methylation locus for screening colorectal cancer, and such exclusion can be exclusion of PDGFD alone or exclusion of multiple methylation loci including PDGFD. In some embodiments, for example, as specifically mentioned above, one aspect of the present disclosure can expressly and / or specifically exclude the use of ALK as a methylation locus for screening colorectal cancer, and such exclusion can be exclusion of ALK alone or exclusion of multiple methylation loci including ALK.

[0012] In various embodiments, for example, as specifically mentioned above, one aspect of the present disclosure may include determining the methylation status of DMRs ZNF471‘558 and FGF14‘577. In various embodiments, for example, as specifically mentioned above, one aspect of the present disclosure may include determining the methylation status of DMRs ZNF471‘558, FGF14‘577, and PDGFD‘388. In various embodiments, for example, as specifically mentioned above, one aspect of the present disclosure may include determining the methylation status of DMRs ZNF471‘558, FGF14‘577, PDGFD‘388, ZNF471‘527, and ADAMTS2‘284. In various embodiments, for example, as specifically mentioned above, one aspect of the present disclosure may include determining the methylation status of DMRs ZNF471‘558, FGF14‘577, PDGFD‘388, ZNF471‘527, ADAMTS2‘284, ADAMTS2‘254, ZNF492‘069, and ST6GALNAC5‘456. In various embodiments, for example, as specifically mentioned above, one aspect of the present disclosure may include determining the methylation status of DMRs ZNF471‘558, FGF14‘577, PDGFD‘388, ZNF471‘527, ADAMTS2‘284, ADAMTS2‘254, ZNF492‘069, ST6GALNAC5‘456, ZNF542‘502, LONRF2‘281, ZNF132‘415, PDGFD‘921, ZNF132‘268, CNRIP1‘272, and ALK‘434. In various embodiments, for example, as specifically mentioned above, one aspect of the present disclosure may include determining the methylation status of DMRs ALK‘434, CNRIP1‘232, CNRIP1‘272, LONRF2‘281, LONRF2‘387, ADAMTS2‘254, ADAMTS2‘284, ADAMTS2‘328, FGF14‘577, DMRT1‘934, ST6GALNAC5‘456, MCIDAS‘855, MCIDAS‘003, PDGFD‘388, PDGFD‘921, GSG1L‘861, ZNF492‘499, ZNF492‘069, ZNF568‘252, ZNF568‘405, ZNF542‘525, ZNF542‘502, ZNF471‘527, ZNF471‘558, ZNF471‘662, ZNF132‘268, ZNF132‘415, and JAM2‘320.

[0013] In various embodiments, for example, as specifically mentioned above, one aspect of the present disclosure can expressly and / or particularly exclude the use of one or more colorectal cancer DMRs selected from Table 7. In various embodiments, for example, as specifically mentioned above, one aspect of the present disclosure can expressly and / or particularly exclude the use of one or more colorectal cancer DMRs selected from FGF14‘577, ZNF471‘527, ZNF471‘558, ZNF471‘662, PDGFD‘388, PDGFD‘921, and ALK‘434 and combinations thereof. In some embodiments, for example, as specifically mentioned above, one aspect of the present disclosure can expressly and / or particularly exclude the use of FGF14‘577 as a DMR for screening colorectal cancer, and this exclusion can be the exclusion of FGF14‘577 alone or the exclusion of multiple DMRs including FGF14‘577. In some embodiments, for example, as specifically mentioned above, one aspect of the present disclosure can expressly and / or particularly exclude the use of ZNF471‘527, ZNF471‘558, and / or ZNF471‘662 as DMRs for screening colorectal cancer, and this exclusion can be the exclusion of ZNF471‘527, ZNF471‘558, and / or ZNF471‘662 alone or the exclusion of multiple DMRs including ZNF471‘527, ZNF471‘558, and / or ZNF471‘662. In some embodiments, for example, as specifically mentioned above, one aspect of the present disclosure can expressly and / or particularly exclude the use of PDGFD‘388 and / or PDGFD‘921 as DMRs for screening colorectal cancer, and this exclusion can be the exclusion of PDGFD‘388 and / or PDGFD‘921 alone or the exclusion of multiple DMRs including PDGFD‘388 and / or PDGFD‘921. In some embodiments, for example, as specifically mentioned above, one aspect of the present disclosure can expressly and / or particularly exclude the use of ALK‘434 as a DMR for screening colorectal cancer, and this exclusion can be the exclusion of ALK‘434 alone or the exclusion of multiple DMRs including ALK‘434.

[0014] In various embodiments, for example, as specifically mentioned above, one aspect of the present disclosure can include amplifying one or more DMRs by the oligonucleotide primer pairs or groups of oligonucleotide primer pairs provided in Table 13. In various embodiments, for example, as specifically mentioned above, in one or more aspects of the present disclosure, the subject DNA is isolated from the blood, plasma, urine, saliva, or feces of a human subject. In various embodiments, for example, as specifically mentioned above, in one or more aspects of the present disclosure, the DNA is cell-free DNA of a human subject.

[0015] In various embodiments of one or more aspects of the present disclosure, for example, as specifically mentioned above, the screened subject does not have symptoms of colorectal cancer at the time of screening. In various embodiments of one or more aspects of the present disclosure, for example, as specifically mentioned above, the screened subject has previously been screened for colorectal cancer. In various embodiments of one or more aspects of the present disclosure, for example, as specifically mentioned above, the screened subject has been screened for colorectal cancer within the past 10 years, within the past 5 years, within the past 4 years, within the past 3 years, within the past 2 years, or within the past 1 year. In some embodiments, for example, as specifically mentioned above, a previous screening for the subject's colorectal cancer has diagnosed the subject as not having colorectal cancer. For example, where the previous colorectal cancer screening that diagnosed the subject as not having colorectal cancer was within one year, and / or where the previous colorectal cancer screening that diagnosed the subject as not having colorectal cancer was a colonoscopy.

[0016] In various embodiments of one or more aspects of the present disclosure, for example, as specifically mentioned above, the screening method achieves or includes the diagnosis of early colorectal cancer, optionally where the colorectal cancer is stage 0, stage I, stage IIA, stage IIB, or stage IIC colorectal cancer. In various embodiments of one or more aspects of the present disclosure, for example, as specifically mentioned above, the screening method achieves or includes the diagnosis of early colorectal cancer, for example, where the cancer has not metastasized. In various embodiments of one or more aspects of the present disclosure, for example, as specifically mentioned above, the screening method achieves or includes the diagnosis of non-early colorectal cancer, optionally where the colorectal cancer is stage IIIA, stage IIIB, stage IIIC, stage IVA, stage IVB, or stage IVC colorectal cancer. In various embodiments of one or more aspects of the present disclosure, for example, as specifically mentioned above, the screening method achieves or includes the diagnosis of non-early colorectal cancer, for example, where the cancer has metastasized.

[0017] In various embodiments of one or more aspects of the present disclosure, for example, as specifically mentioned above, the screening method achieves or provides a colorectal cancer sensitivity of at least 0.6, for example at least 0.7. In some embodiments, for example, as specifically mentioned above, the screening methods provided herein achieve or provide a colorectal cancer sensitivity equal to or greater than 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or greater than 0.95.

[0018] In various embodiments, for example, as specifically mentioned above, the screening method achieves or provides a specificity for colorectal cancer of at least 0.7, for example at least 0.8. In some embodiments, for example, as specifically mentioned above, the screening method provided herein achieves or provides a specificity for colorectal cancer that is equal to or greater than 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95.

[0019] In various embodiments, for example, as specifically mentioned above, one or more aspects of the present invention can include determining whether a subject includes a cancer-causing mutation. For example, in various embodiments, for example, as specifically mentioned above, the diagnosis can include determining the presence or absence of a cancer-causing mutation in a subject, for example by analyzing cfDNA, cell sample DNA, or tissue sample DNA. In some embodiments, for example, as specifically mentioned above, the cancer-causing mutations are located in Kras, NRAS, PIK3CA, PTEN, TP53, BRAF, and APC. In some embodiments, for example, as specifically mentioned above, a subject can include a cancer-causing mutation in more than two of Kras, NRAS, PIK3CA, PTEN, TP53, BRAF, and APC.

[0020] In some aspects, the present disclosure particularly provides a kit for colorectal cancer screening, the kit comprising: (a) at least one oligonucleotide primer pair of Table 13, and optionally further comprising: (b) at least one methylation-specific restriction enzyme and / or (c) bisulfite reagent. In some aspects, the present disclosure particularly provides a diagnostic qPCR reaction for screening colorectal cancer, the diagnostic qPCR reaction comprising: (a) human DNA; (b) polymerase; (c) at least one oligonucleotide primer pair of Table 13, optionally wherein the human DNA is bisulfite-treated human DNA or human DNA digested with a methylation-specific restriction enzyme. In various embodiments, for example, as described above, the oligonucleotide primer pair comprises an oligonucleotide primer pair for amplifying DMRs ZNF471'558 and FGF14'577. In various embodiments, for example, as specifically mentioned above, the oligonucleotide primer pair comprises an oligonucleotide primer pair for amplifying DMRs ZNF471'558, FGF14'577, and PDGFD'388. In various embodiments, for example, as specifically mentioned above, the oligonucleotide primer pair comprises an oligonucleotide primer pair for amplifying DMR DMRsZNF471'558, FGF14'577, PDGFD'388, ZNF471'527, and ADAMTS2'284. In various embodiments, for example, as specifically mentioned above, the oligonucleotide primer pair comprises an oligonucleotide primer pair for amplifying DMRs ZNF471'558, FGF14'577, PDGFD'388, ZNF471'527, ADAMTS2'284, ADAMTS2'254, ZNF492'069, and ST6GALNAC5'456. In various embodiments, for example, as specifically mentioned above, the oligonucleotide primer pair comprises an oligonucleotide primer pair for amplifying DMRs ZNF471'558, FGF14'577, PDGFD'388, ZNF471'527, ADAMTS2'284, ADAMTS2'254, ZNF492'069, ST6GALNAC5'456, ZNF542'502, LONRF2'281, ZNF132'415, PDGFD'921, ZNF132'268, CNRIP1'272, and ALK'434.In various embodiments, for example, as specifically mentioned above, the oligonucleotide primer pairs include oligonucleotide primer pairs for amplifying DMRs ALK‘434, CNRIP1‘232, CNRIP1‘272, LONRF2‘281, LONRF2‘387, ADAMTS2‘254, ADAMTS2‘284, ADAMTS2‘328, FGF14‘577, DMRT1‘934, ST6GALNAC5‘456, MCIDAS‘855, MCIDAS‘003, PDGFD‘388, PDGFD‘921, GSG1L‘861, ZNF492’499, ZNF492‘069, ZNF568‘252, ZNF568‘405, ZNF542‘525, ZNF542‘502, ZNF471‘527, ZNF471‘558, ZNF471‘662, ZNF132‘268, ZNF132‘415 and JAM2‘320.

[0021] In various embodiments, for example, as specifically mentioned above, one aspect of the present disclosure may expressly and / or particularly exclude the use of oligonucleotide primer pairs to amplify one or more colorectal cancer DMRs selected from Table 7. In some embodiments, for example, as specifically mentioned above, one aspect of the present disclosure may expressly and / or particularly exclude the use of oligonucleotide primer pairs for amplifying one or more colorectal cancer DMRs selected from FGF14‘577, ZNF471‘527, ZNF471‘558, ZNF471‘662, PDGFD‘388, PDGFD‘921, and ALK‘434 and combinations thereof. In some embodiments, for example, as specifically mentioned above, one aspect of the present disclosure may expressly and / or particularly exclude the use of an oligonucleotide primer for amplifying FGF14‘577 as a DMR for screening colorectal cancer, and this exclusion may exclude FGF14‘577 alone or exclude multiple DMRs including FGF14‘577. In some embodiments, for example, as specifically mentioned above, one aspect of the present disclosure may expressly and / or particularly exclude the use of oligonucleotide primers for amplifying ZNF471‘527, ZNF471‘558, and / or ZNF471‘662 as DMRs for screening colorectal cancer, and this exclusion may exclude ZNF471‘527, ZNF471‘558, and / or ZNF471‘662 alone or exclude multiple DMRs including ZNF471‘527, ZNF471‘558, and / or ZNF471‘662. In some embodiments, for example, as specifically mentioned above, one aspect of the present disclosure may expressly and / or particularly exclude the use of oligonucleotide primers for amplifying PDGFD‘388 and / or DGFD‘921 as DMRs for screening colorectal cancer, and this exclusion may exclude PDGFD‘388 and / or PDGFD‘921 alone or exclude multiple DMRs including PDGFD‘388 and / or PDGFD‘921. In some embodiments, for example, as specifically mentioned above, one aspect of the present disclosure may expressly and / or particularly exclude the use of an oligonucleotide primer for amplifying ALK‘434 as a DMR for screening colorectal cancer, and this exclusion may exclude ALK‘434 alone or exclude multiple DMRs including ALK‘434.

[0022] In various embodiments of the various aspects of the present disclosure, for example, as specifically mentioned above, the methods, kits or other compositions of the present disclosure may further comprise or be used to identify at least one of the following (i) to (iv) using the determined methylation status of one or more methylation loci: (i) the presence of colorectal cancer in a human subject; (ii) a predisposition to develop colorectal cancer in a human subject; (iii) an increased risk of colorectal cancer in a human subject, and (iv) the stage of colorectal cancer in a human subject.

[0023] In various aspects and embodiments, including but not limited to all aspects and embodiments provided above or provided otherwise herein, the methods for diagnosing colorectal cancer provided herein are in vitro diagnostic methods, and the compositions for diagnosing colorectal cancer provided herein are compositions for in vitro use.

[0024] In various aspects, the methods and compositions of the present invention may be used in combination with biomarkers known in the art, for example, the biomarkers disclosed in U.S. Patent No. 10,006,925, which is incorporated herein by reference in its entirety.

[0025] Definitions

[0026] A or an: The articles "a" and "an" are used herein to refer to one or more (i.e., at least one) of the grammatical objects of the article. For example, "an element" refers to one element or more than one element.

[0027] About: The term "about", when used herein in reference to a value, refers to a value similar to the referenced value in the context. Generally, those skilled in the art familiar with the context will understand the degree of relevant difference covered by "about" in that context. For example, in some embodiments, the term "about" may cover a range of values of 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or a fraction of a percent of the reference value.

[0028] Administer: As used herein, the term "administer" generally refers to administering a composition to a subject or system, for example to effect the delivery of a reagent included in or otherwise delivered by the composition.

[0029] Reagent: As used herein, the term "reagent" refers to an entity (e.g., a small molecule, peptide, polypeptide, nucleic acid, lipid, polysaccharide, complex, combination, mixture, system or phenomenon, such as heat, electric current, electric field, magnetic force, magnetic field, etc.).

[0030] Improvement: As used herein, the term "improvement" refers to the prevention, alleviation, mitigation, or amelioration of the state of a subject. Improvement includes, but does not require, complete recovery or complete prevention of a disease, disorder, or condition.

[0031] Amplicon or amplicon molecule: As used herein, the term "amplicon" or "amplicon molecule" refers to a nucleic acid molecule produced by transcription from a template nucleic acid molecule, or a nucleic acid molecule having a sequence complementary thereto, or a double-stranded nucleic acid, including any such nucleic acid molecule. Transcription can start from a primer.

[0032] Amplification: As used herein, the term "amplification" refers to the use of a template nucleic acid molecule in combination with various reagents to produce additional nucleic acid molecules from the template nucleic acid molecule, and these additional nucleic acid molecules can be the same or similar to a fragment of the template nucleic acid molecule (e.g., having at least 70% identity, such as at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) and / or be a sequence complementary thereto.

[0033] Amplification reaction mixture: As used herein, the term "amplification reaction mixture" or "amplification reaction" refers to a template nucleic acid molecule together with reagents sufficient to amplify the template nucleic acid molecule.

[0034] Biological sample: As used herein, the term "biological sample" generally refers to a sample obtained or derived from a biological source of interest (e.g., tissue or organism or cell culture), as described herein. In some embodiments, the biological source is or includes an organism, such as an animal or a human. In some embodiments, the biological sample is or includes biological tissue or fluid. In some embodiments, the biological sample can be or include cells, tissues, or body fluids. In some embodiments, the biological sample can be or include blood, blood cells, cell-free DNA, free-floating nucleic acids, ascites, biopsy samples, surgical specimens, cell-containing body fluids, sputum, saliva, feces, urine, cerebrospinal fluid, peritoneal fluid, pleural effusion, lymph fluid, gynecological fluids, secretions, excretions, skin swabs, vaginal swabs, oral swabs, nasal swabs, flush fluids or lavage fluids, such as catheter lavage fluids or bronchoalveolar lavage fluids, aspirates, scrapings, bone marrow. In some embodiments, the biological sample is or includes cells obtained from a single subject or multiple subjects. The sample can be an "original sample" obtained directly from the biological source or a "processed sample". A biological sample can also be referred to as a "sample".

[0035] Biomarker: As used herein, the term "biomarker" is consistent with its use in the art and refers to an entity whose presence, level, or form is associated with a particular biological event or state of interest and is thus considered to be a "marker" of that event or state. Those skilled in the art will understand that, for example, in the context of a DNA biomarker, a biomarker can be or include a locus (e.g., one or more methylated loci) and / or the state of a locus (e.g., the state of one or more methylated loci). By way of just a few examples of biomarkers, in some embodiments, a biomarker can be or include a marker of a particular disease, disorder, or condition, or can be a qualitative marker of the quantitative probability that a particular disease, disorder, or condition can develop, occur, or recur, for example, in a subject. In some embodiments, a biomarker can be or include a marker of a particular treatment outcome, or the qualitative of its quantitative probability. Thus, in various embodiments, a biomarker can predict, prognose, and / or diagnose a related biological event or state of interest. A biomarker can be an entity of any chemical class. For example, in some embodiments, a biomarker can be or include a nucleic acid, polypeptide, lipid, carbohydrate, small molecule, inorganic reagent (e.g., a metal or ion), or a combination thereof. In some embodiments, a biomarker is a cell surface marker. In some embodiments, a biomarker is intracellular. In some embodiments, a biomarker is found extracellularly (e.g., secreted extracellularly or otherwise produced or present, e.g., in a body fluid such as blood, urine, tears, saliva, cerebrospinal fluid, etc.). In some embodiments, a biomarker is the methylation state of a methylated locus. In certain cases, a biomarker may be referred to as a "marker".

[0036] By way of just one example of a biomarker, in some embodiments, the term refers to the expression of a product encoded by a gene, the expression of which is characteristic of a particular tumor, tumor subtype, tumor stage, etc. As an alternative or in addition, in some embodiments, the presence or level of a particular marker can be associated with the activity (or level of activity) of a particular signaling pathway, e.g., a signaling pathway whose activity is characteristic of a particular class of tumors.

[0037] Those skilled in the art will understand that a biomarker can individually determine a particular biological event or state of interest or can represent or contribute to determining the statistical probability of a particular biological event or state of interest. Those skilled in the art will understand that markers can vary in their specificity and / or sensitivity in relation to a particular biological event or state of interest.

[0038] Blood component: As used herein, the term "blood component" refers to any component of whole blood, including red blood cells, white blood cells, plasma, platelets, endothelial cells, mesothelial cells, epithelial cells, and cell-free DNA. Blood components also include plasma components, including proteins, metabolites, lipids, nucleic acids, and carbohydrates, and any other cells that may be present in blood, such as any other cells present in blood due to pregnancy, organ transplantation, infection, injury, or disease.

[0039] Cancer: As used herein, the terms "cancer," "malignancy," "neoplasm," "tumor," and "carcinoma" are used interchangeably and refer to a disease, disorder, or condition in which cells exhibit or demonstrate relatively abnormal, uncontrolled, and / or autonomous growth such that they exhibit or demonstrate an abnormally elevated proliferation rate and / or abnormal growth phenotype. In some embodiments, cancer may include one or more tumors. In some embodiments, cancer may be or include pre-cancerous (e.g., benign), malignant, pre-metastatic, metastatic, and / or non-metastatic cells. In some embodiments, cancer may be or include solid tumors. In some embodiments, cancer may be or include hematologic malignancies. Generally, examples of different types of cancers known in the art include, for example, colorectal cancer, hematopoietic cancers including leukemia, lymphoma (Hodgkin and non-Hodgkin), myeloma, and myeloproliferative diseases; sarcoma, melanoma, adenoma, solid tissue carcinomas, squamous cell carcinomas of the oral cavity, pharynx, larynx, and lung, liver cancer, genitourinary cancers such as prostate cancer, cervical cancer, bladder cancer, uterine cancer, and endometrial cancer, and renal cell carcinoma, bone cancer, pancreatic cancer, skin cancer, cutaneous or intraocular melanoma, endocrine system cancers, thyroid cancer, parathyroid cancer, head and neck cancer, breast cancer, gastrointestinal cancer, and nervous system cancers, and benign lesions such as papilloma, etc.

[0040] Chemotherapeutic agent: As used herein, the term "chemotherapeutic agent" is consistent with its use in the art and refers to one or more reagents known to be used in the treatment of cancer or to assist in the treatment of cancer or having known characteristics for the treatment of cancer or assisting in the treatment of cancer. In particular, chemotherapeutic agents include apoptosis-inducing agents, cell growth inhibitors, and / or cytotoxic agents. In some embodiments, the chemotherapeutic agent may be or include alkylating agents, anthracyclines, cytoskeleton disruptors (e.g., microtubule-targeting moieties such as taxanes, maytansines, and their analogs), epothilones, histone deacetylase inhibitors (HDACs), topoisomerase inhibitors (e.g., inhibitors of topoisomerase I and / or topoisomerase II), kinase inhibitors, nucleotide analogs or nucleotide precursor analogs, peptide antibiotics, platinum drugs, retinoids, vinca alkaloids, and / or analogs having related antiproliferative activity. In some particular embodiments, the chemotherapeutic agent may be or include actinomycin, all-trans retinoic acid, auristatin, azacitidine, azathioprine, bleomycin, bortezomib, carboplatin, capecitabine, cisplatin, chloramphenicol, cyclophosphamide, curcumin, cytarabine, daunorubicin, docetaxel, doxifluridine, doxorubicin, epirubicin, epothilone, etoposide, fluorouracil, gemcitabine, hydroxyurea, idarubicin, imatinib, irinotecan, maytansine and / or its analogs (such as DM1), mechlorethamine, mercaptopurine, methotrexate, mitoxantrone, maytansine, oxaliplatin, paclitaxel, pemetrexed, teniposide, thioguanine, topotecan, valrubicin, vinblastine, vincristine, vindesine, vinorelbine, or a combination thereof. In some embodiments, chemotherapeutic agents may be used in the context of antibody-drug conjugates.In some embodiments, the chemotherapeutic agent is one found in an antibody-drug conjugate and is selected from the group consisting of: hLL1-doxorubicin, hRS7-SN-38, hMN-14-SN-38, hLL2-SN-38, hA20-SN-38, hPAM4-SN-38, hLL1-SN-38, hRS7-Pro-2-P-Dox, hMN-14-Pro-2-P-Dox, hLL2-Pro-2-P-Dox, hA20-Pro-2-P-Dox, hPAM4-Pro-2-P-Dox, hLL1-Pro-2-P-Dox, P4 / D10-doxorubicin, gemtuzumab ozogamicin, brentuximab vedotin, trastuzumab, inotuzumab ozogamicin, glembatumomab vedotin, SAR3419, SAR566658, BIIB015, BT062, SGN-75, SGN-CD19A, AMG-172, AMG-595, BAY-94-9343, ASG-5ME, ASG-22ME, ASG-16M8F, MDX-1203, MLN-0264, anti-PSMA ADC, RG-7450, RG-7458, RG-7593, RG-7596, RG-7598, RG-7599, RG-7600, RG-7636, ABT-414, IMGN-853, IMGN-529, vorsetuzumab mafodotin, and lorvotuzumab mertansine. In some embodiments, the chemotherapeutic agent can be or include farnesyl-thiosalicylic acid (FTS), 4-(4-chloro-2-methylphenoxy)-N-hydroxybutanamide (CMH), estradiol (E2), tetramethoxystilbene (TMS), delta-tocotrienol, salinomycin, or curcumin.

[0041] Combination therapy: As used herein, the term "combination therapy" refers to administering two or more agents or regimens to a subject such that the two or more agents or regimens together treat the subject's disease, disorder, or condition. In some embodiments, the two or more therapeutic agents or regimens can be administered simultaneously, sequentially, or in an overlapping dosing regimen. One of ordinary skill in the art will understand that combination therapy includes, but does not require, administering the two agents or regimens together in a single composition or simultaneously.

[0042] Comparable: As used herein, the term "comparable" refers to a group of two or more conditions, environments, reagents, entities, populations, etc., which may not be identical to each other, but are similar enough to allow comparison between them, such that one of ordinary skill in the art will understand that conclusions can be reasonably drawn based on the observed differences or similarities. In some embodiments, a comparable group of conditions, environments, reagents, entities, populations, etc. is typically characterized by a plurality of substantially identical features and zero, one, or more different features. One of ordinary skill in the art will understand, in context, what degree of identity is required for the members of the group to be comparable. For example, one of ordinary skill in the art will understand that when characterized by a sufficient number and type of substantially identical features to warrant a reasonable conclusion that the observed differences can be attributed, in whole or in part, to their non-identical features.

[0043] Detectable moiety: As used herein, the term "detectable moiety" refers to any element, molecule, functional group, compound, fragment, or other moiety that is detectable. In some embodiments, the detectable moiety is provided or used alone. In some embodiments, a detectable moiety is provided and / or utilized that is associated with (e.g., linked to) another reagent. Examples of detectable moieties include, but are not limited to, various ligands, radioisotopes (e.g., 3 H, 14 C, 18 F, 19 F, 32 P, 35 S, 135 I, 125 I, 123 I, 64 Cu, 187 Re, 111 In, 90 Y, 99m Tc, 177 Lu, 89 Zr, etc.), fluorescent dyes, chemiluminescent agents, bioluminescent agents, spectrally resolvable inorganic fluorescent semiconductor nanocrystals (i.e., quantum dots), metal nanoparticles, nanoclusters, paramagnetic metal ions, enzymes, colorimetric labels, biotin, dioxigenin, haptens, and proteins for which antisera or monoclonal antibodies are available.

[0044] Diagnosis: As used herein, the term "diagnosis" refers to determining whether a subject has or will develop a disease, disorder, condition, or state, and / or the qualitative quantification of probability. For example, in the diagnosis of cancer, the diagnosis may include determination of the risk, type, stage, malignancy, or other classification of the cancer. In some cases, the diagnosis may be or include determination related to prognosis and / or the likely response to one or more general or specific therapeutic agents or regimens.

[0045] Diagnostic information: As used herein, the term "diagnostic information" refers to information that can be used to provide a diagnosis. Diagnostic information can include, but is not limited to, biomarker status information.

[0046] Differential methylation: As used herein, the term "differential methylation" describes a methylation site where the methylation status differs between a first condition and a second condition. A methylation site that is differentially methylated can be referred to as a differentially methylated site. In some cases, a DMR is defined by an amplicon generated by amplification using oligonucleotide primers, for example, a pair of oligonucleotide primers selected to amplify a DMR or a DNA region of interest present in the amplicon. In some cases, a DMR is defined as a DNA region amplified by a pair of oligonucleotide primers, including a region having the sequence of the oligonucleotide primers or a sequence complementary to the oligonucleotide primers. In some cases, a DMR is defined as a DNA region amplified by a pair of oligonucleotide primers, excluding a region having the sequence of the oligonucleotide primers or a sequence complementary to the oligonucleotide primers. As used herein, a specifically provided DMR can be unambiguously identified by the name of the relevant gene followed by three digits of the starting position, such that, for example, a DMR starting at position 29921434 of ALK can be identified as ALK'434.

[0047] Differentially methylated region: As used herein, the term "differentially methylated region" (DMR) refers to a DNA region that contains one or more differentially methylated sites. Under selected conditions of interest, such as a cancer state, a DMR that includes a greater number or frequency of methylation sites can be referred to as a hypermethylated DMR. Under selected conditions of interest, such as a cancer state, a DMR that includes a lesser number or frequency of methylation sites can be referred to as a hypomethylated DMR. A DMR that serves as a colorectal cancer methylation biomarker can be referred to as a colorectal cancer DMR. In some cases, a DMR can be a single nucleotide, which is a methylation site.

[0048] DNA region: As used herein, a "DNA region" refers to any continuous portion of a larger DNA molecule. Those skilled in the art will be familiar with techniques for determining whether a first DNA region and a second DNA region correspond, such as based on sequence similarity (e.g., sequence identity or homology) of the first DNA region and the second DNA region and / or context (e.g., sequence identity or homology of nucleic acids upstream and / or downstream of the first DNA region and the second DNA region).

[0049] Unless otherwise specified herein, sequences found in or related to humans (e.g., sequences that hybridize to human DNA) are found in, based on, and / or derived from the representative human genomic sequence of the examples, which is commonly referred to as and known to those skilled in the art as the Homo sapiens (human) genome assembly GRCh38, hg38, and / or the Genome Reference Consortium Human Build 38. Those skilled in the art will further understand that DNA regions of hg38 can be referred to by known systems that include identifying specific nucleotide positions or ranges thereof according to a specified numbering.

[0050] Dosing regimen: As used herein, the term "dosing regimen" can refer to a set of one or more identical or different unit doses administered to a subject, typically comprising multiple unit dose administrations, where each unit dose administration is spaced apart from other unit dose administrations by a period of time. In various embodiments, one or more or all of the unit doses of the dosing regimen can be the same or can vary (e.g., increase over time, decrease over time, or be adjusted according to the decision of the subject and / or the physician). In various embodiments, one or more or all of the time periods between each dose can be the same or can vary (e.g., increase over time, decrease over time, or be adjusted according to the decision of the subject and / or the physician). In some embodiments, a given therapeutic agent has a recommended dosing regimen, which can involve one or more doses. Typically, at least one recommended dosing regimen for a commercially available drug is known to those skilled in the art. In some embodiments, when administered across a relevant population, the dosing regimen is associated with a desired or beneficial outcome (i.e., is a therapeutic dosing regimen).

[0051] Downstream: As used herein, the term "downstream" refers to a first DNA region being closer to the C-terminus of a nucleic acid comprising the first DNA region and a second DNA region relative to the second DNA region.

[0052] Gene: As used herein, the term "gene" refers to, for example, a single DNA region in a chromosome that includes a coding sequence encoding a product (e.g., an RNA product and / or a polypeptide product), along with all, some, or none of the DNA sequences that contribute to regulating the expression of the coding sequence. In some embodiments, a gene includes one or more non-coding sequences. In some particular embodiments, a gene includes exon and intron sequences. In some embodiments, a gene includes one or more regulatory elements that can, for example, control or affect one or more aspects of gene expression (e.g., cell type-specific expression, inducible expression, etc.). In some embodiments, a gene includes a promoter. In some embodiments, a gene includes one or both of (i) DNA nucleotides extending a predetermined number of nucleotides upstream of the coding sequence and (ii) DNA nucleotides extending a predetermined number of nucleotides downstream of the coding sequence. In various embodiments, the predetermined number of nucleotides can be 500 bp, 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 10 kb, 20 kb, 30 kb, 40 kb, 50 kb, 75 kb, or 100 kb.

[0053] Homology: As used herein, the term "homology" refers to the overall relatedness between polymeric molecules, such as between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Those skilled in the art will understand that homology can be defined, for example, as percent identity or percent homology (sequence similarity). In some embodiments, polymeric molecules are considered to have "homology" if their sequences have at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity. In some embodiments, polymeric molecules are considered to have "homology" if their sequences have at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% similarity.

[0054] Hybridization: As used herein, "hybridization" refers to the binding of a first nucleic acid to a second nucleic acid to form a double-stranded structure, which occurs through the complementary pairing of nucleotides. Those skilled in the art will recognize that complementary sequences can hybridize in particular. In various embodiments, hybridization can occur, for example, between nucleotide sequences having at least 70% complementarity, such as at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity. Those skilled in the art will further understand that whether hybridization of the first nucleic acid and the second nucleic acid occurs can depend on various reaction conditions. Conditions under which hybridization can occur are known in the art.

[0055] Hypomethylation: As used herein, the term "hypomethylation" refers to the state of a methylated locus having at least one fewer methylated nucleotide in a state of interest compared to a reference state (e.g., having at least one fewer methylated nucleotide in colorectal cancer compared to a healthy control).

[0056] Hypermethylation: As used herein, the term "hypermethylation" refers to the state of a methylated locus having at least one more methylated nucleotide in a state of interest compared to a reference state (e.g., having at least one more methylated nucleotide in colorectal cancer compared to a healthy control).

[0057] Identity: As used herein, the term "identity" refers to the overall relatedness between polymeric molecules, such as between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Methods for calculating the percent identity between two provided sequences are known in the art. The calculation of the percent identity between two nucleic acid or polypeptide sequences, for example, can be accomplished by aligning the two sequences (or the complementary sequences of one or both of the sequences) for optimal comparison purposes (e.g., gaps may be introduced in one or both of the first and second sequences for optimal alignment, and non-identical sequences may be ignored for comparison purposes). The nucleotides or amino acids at corresponding positions are then compared. When a position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between two sequences is a function of the number of positions shared by the sequences, optionally taking into account the number of gaps and the length of each gap, which may be introduced to achieve optimal alignment of the two sequences. The comparison of sequences and the determination of the percent identity between two sequences can be accomplished using computational algorithms, such as BLAST (Basic Local Alignment Search Tool).

[0058] "Improve", "increase", or "decrease": As used herein, these terms or grammatically comparable comparative terms represent a value relative to a comparable reference measurement. For example, in some embodiments, the evaluated value achieved using a reagent of interest can "improve" relative to the evaluated value obtained using a comparable reference reagent or no reagent. Alternatively or additionally, in some embodiments, the evaluated value in a subject or system of interest can "improve" relative to the evaluated value obtained in the same subject or system under different conditions or at different time points (e.g., before or after an event such as the administration of a reagent of interest), or in a different subject being compared (e.g., in a comparable subject or system that differs from the subject or system of interest in the presence of one or more specific diseases, disorders or conditions of interest, or prior exposure to a condition or reagent, etc.). In some embodiments, the comparative term refers to a statistically relevant difference (e.g., a difference in prevalence and / or magnitude sufficient to achieve statistical relevance). Those skilled in the art will recognize or will be able to readily determine the degree and / or prevalence of the difference needed or sufficient to achieve such statistical significance in a given context.

[0059] Methylation: As used herein, the term "methylation" includes methylation at any position in (i) the C5 position of cytosine; (ii) the N4 position of cytosine; (iii) the N6 position of adenine. Methylation also includes (iv) other types of nucleotide methylation. A methylated nucleotide may be referred to as a "methylated nucleotide" or a "methylated nucleobase". In certain embodiments, methylation specifically refers to the methylation of cytosine residues. In certain cases, methylation specifically refers to the methylation of cytosine residues present in CpG sites.

[0060] Methylation test: As used herein, the term "methylation test" refers to any technique that can be used to determine the methylation status of a methylated locus.

[0061] Methylation biomarker: As used herein, the term "methylation biomarker" refers to a biomarker that is or includes at least one methylated locus and / or the methylation status of at least one methylated locus, such as a hypermethylated locus. In particular, a methylation biomarker is a biomarker characterized by a change in the methylation status of one or more nucleic acid loci between a first state and a second state (e.g., between a cancerous state and a non-cancerous state).

[0062] Methylated locus: As used herein, the term "methylated locus" refers to a DNA region that contains at least one differentially methylated region. Under selected conditions of interest, such as a cancer state, a methylated locus that includes a greater number or frequency of methylated sites may be referred to as a hypermethylated locus. Under selected conditions of interest, such as a cancer state, a methylated locus that includes a lesser number or frequency of methylated sites may be referred to as a hypomethylated locus.

[0063] Methylated site: As used herein, a methylated site refers to a nucleotide or nucleotide position that is methylated under at least one condition. In its methylated state, a methylated site may be referred to as a site that is methylated.

[0064] Methylation state: As used herein, the "methylation state", "methylation status" or "methylation profile" refers to the number, frequency or pattern of methylation at methylated sites within a methylated locus. Thus, a change in methylation state between a first state and a second state can be or include an increase in the number, frequency or pattern of methylated sites, or can be or include a decrease in the number, frequency or pattern of methylated sites. In various cases, a change in methylation state is a change in methylation value.

[0065] Methylation value: As used herein, the term "methylation value" refers to a numerical representation of a methylation state, e.g., in a numerical form representative of the methylation frequency or ratio of a methylated locus. In some cases, a methylation value can be generated by a method that includes quantifying the amount of intact nucleic acid present in a sample after restriction digestion of the sample with a methylation-dependent restriction enzyme. In some cases, a methylation value can be generated by a method that includes comparing amplification profiles after a bisulfite reaction of the sample. In some cases, a methylation value can be generated by comparing the sequences of bisulfite-treated and untreated nucleic acids. In some cases, a methylation value is or includes or is based on quantitative PCR results.

[0066] Nucleic Acid: As used herein, in its broadest sense, the term "nucleic acid" refers to any compound and / or substance that is introduced or can be introduced into an oligonucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is introduced or can be introduced into an oligonucleotide chain via a phosphodiester bond. As will be clear from the context, in some embodiments, the term nucleic acid refers to monomeric nucleic acid residues (e.g., nucleotides and / or nucleosides), and in some embodiments refers to a polynucleotide chain comprising multiple monomeric nucleic acid residues. A nucleic acid can be or include DNA, RNA, or a combination thereof. Nucleic acids can include natural nucleic acid residues, nucleic acid analogs, and / or synthetic residues. In some embodiments, nucleic acids include natural nucleotides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine). In some embodiments, a nucleic acid is or includes one or more nucleotide analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrole-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5-propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, 2-thiocytidine, methylated bases, intercalating bases, and combinations thereof).

[0067] In some embodiments, a nucleic acid has a nucleotide sequence encoding a functional gene product such as RNA or protein. In some embodiments, a nucleic acid includes one or more introns. In some embodiments, a nucleic acid includes one or more genes. In some embodiments, a nucleic acid is prepared by one or more of isolation from a natural source, polymerase-mediated synthesis based on a complementary template (in vivo or in vitro), propagation in a recombinant cell or system, and chemical synthesis.

[0068] In some embodiments, a nucleic acid analog differs from a nucleic acid in that it does not utilize a phosphodiester backbone. For example, in some embodiments, a nucleic acid can include one or more peptide nucleic acids, which are known in the art and have peptide bonds rather than phosphodiester bonds in the backbone. As an alternative or in addition, in some embodiments, a nucleic acid has one or more phosphorothioate and / or 5'-N-phosphoramidite bonds rather than phosphodiester bonds. In some embodiments, a nucleic acid contains one or more modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) compared to those in natural nucleic acids.

[0069] In some embodiments, the nucleic acid is or comprises at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues. In some embodiments, the nucleic acid is partially or completely single-stranded, or partially or completely double-stranded.

[0070] Nucleic acid detection assay: As used herein, the term "nucleic acid detection assay" refers to any method for determining the nucleotide composition of a nucleic acid of interest. Nucleic acid detection assays include, but are not limited to, DNA sequencing methods, polymerase chain reaction-based methods, probe hybridization methods, ligase chain reaction, and the like.

[0071] Nucleotide: As used herein, the term "nucleotide" refers to a structural component or building block of a polynucleotide, such as a DNA and / or RNA polymer. Nucleotides include a base (e.g., adenine, thymine, uracil, guanine, or cytosine), a sugar molecule, and at least one phosphate group. As used herein, a nucleotide can be a methylated nucleotide or an unmethylated nucleotide. Those skilled in the art will understand that nucleic acid terms, such as "locus" or "nucleotide", can refer to a locus or nucleotide of a single nucleic acid molecule and / or to a cumulative population of loci or nucleotides and / or to nucleotides in a plurality of nucleic acids representative of a locus or nucleotide (e.g., in a sample and / or a representative of a subject) (e.g., having the same identical nucleic acid sequence and / or nucleic acid sequence context, or having substantially the same nucleic acid sequence and / or nucleic acid context).

[0072] Oligonucleotide primer: As used herein, the term oligonucleotide primer or primer refers to a nucleic acid molecule that is used, capable of being used, or used to generate an amplicon from a template nucleic acid molecule. Under conditions that permit transcription (e.g., in the presence of nucleotides and a DNA polymerase, and at a suitable temperature and pH), an oligonucleotide primer can provide a transcription start point from a template that hybridizes to the oligonucleotide primer. Generally, an oligonucleotide primer is a single-stranded nucleic acid having a length of from 5 to 200 nucleotides. Those skilled in the art will understand that the optimal primer length for generating an amplicon from a template nucleic acid molecule can vary with conditions including temperature parameters, primer composition, and transcription or amplification methods. As used herein, a pair of oligonucleotide primers refers to a set of two oligonucleotide primers that are complementary to the first and second strands, respectively, of a template double-stranded nucleic acid molecule. With respect to the template nucleic acid strands, the first and second members of a pair of oligonucleotide primers may be referred to as the "forward" oligonucleotide primer and the "reverse" oligonucleotide primer, respectively, because the forward oligonucleotide primer is capable of hybridizing to a nucleic acid strand that is complementary to the template nucleic acid strand, the reverse oligonucleotide primer is capable of hybridizing to the template nucleic acid strand, and the position of the forward oligonucleotide primer relative to the template nucleic acid strand is 5' of the position of the reverse oligonucleotide primer sequence relative to the template nucleic acid strand. Those skilled in the art will understand that the identification of the first oligonucleotide primer and the second oligonucleotide primer as the forward oligonucleotide primer and the reverse oligonucleotide primer, respectively, is arbitrary because these identifiers depend on whether a given nucleic acid strand or its complement is used as the template nucleic acid molecule.

[0073] Pharmaceutical composition: As used herein, the term "pharmaceutical composition" refers to a composition in which an active agent is formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dosage amount suitable for administration to a subject, e.g., in a treatment regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to the relevant population. In some embodiments, the pharmaceutical composition can be formulated for administration in a particular form (e.g., in solid form or liquid form), and / or can be particularly suitable for, e.g.: oral administration (e.g., as a liquid preparation) (aqueous solution or non-aqueous solution or suspension), tablets, capsules, bolus, powders, granules, pastes, etc., which can be specifically formulated for, e.g., oral, sublingual, or systemic absorption); parenteral administration (e.g., by subcutaneous, intramuscular, intravenous, or epidural injection, e.g., as a sterile solution or suspension, or a sustained release formulation, etc.); topical application (e.g., applied as a cream, ointment, patch, or spray to, e.g., the skin, lung, or oral cavity); intravaginal or rectal administration (e.g., as a pessary, suppository, cream, or foam); ophthalmic administration; nasal or pulmonary administration, etc.

[0074] Pharmaceutically acceptable: As used herein, the term "pharmaceutically acceptable" applies to one or more or all of the components used to formulate the compositions disclosed herein and means that each component must be compatible with the other ingredients of the composition and harmless to its recipient.

[0075] Pharmaceutically acceptable carrier: As used herein, the term "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition, or vehicle that facilitates the formulation and / or modifies the bioavailability of a reagent such as a pharmaceutical reagent, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material. Some examples of materials that can be used as pharmaceutically acceptable carriers include: saccharides such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; tragacanth powder; malt; gelatin; talc; excipients such as cocoa butter and suppository wax; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; diols such as propylene glycol; polyols such as glycerol, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethanol; pH buffer solutions; polyesters, polycarbonates, and / or polyanhydrides; and other non-toxic compatible substances for pharmaceutical formulations.

[0076] Prevent or prevent: As used herein, the terms "prevent" and "prevent" in relation to the occurrence of a disease, disorder, or condition mean reducing the risk of the occurrence of the disease, disorder, or condition; delaying the onset of the disease, disorder, or condition; delaying the onset of one or more features or symptoms of the disease, disorder, or condition; and / or reducing the frequency and / or severity of one or more features or symptoms of the disease, disorder, or condition. Prevention can refer to prevention in a specific subject or a statistical impact on a group of subjects. Prevention can be considered complete when the onset of the disease, disorder, or condition is delayed for a predetermined period of time.

[0077] Probe: As used herein, the term "probe" refers to a single-stranded or double-stranded nucleic acid molecule that is capable of hybridizing to a complementary target and includes a detectable moiety. In certain embodiments, the probe is a restriction digest or synthetically produced nucleic acid, such as a nucleic acid produced by recombination or amplification. In some cases, the probe is a capture probe that can be used to detect, identify, and / or isolate a target sequence such as a gene sequence. In various cases, the detectable moiety of the probe can be, for example, an enzyme (e.g., ELISA, and enzyme-based histochemical assays), a fluorescent moiety, a radioactive moiety, or a moiety associated with a luminescent signal.

[0078] Prognosis: As used herein, the term "prognosis" refers to the determination of the quantitative probability of at least one possible future outcome or event. As used herein, a prognosis can be the determination of the likely course of a disease, disorder, or condition such as cancer in a subject, the determination of a subject's life expectancy, or the determination of a response to a treatment (e.g., a particular therapy).

[0079] Prognostic information: As used herein, the term "prognostic information" refers to information that can be used to provide a prognosis. Prognostic information can include, but is not limited to, biomarker status information.

[0080] Promoter: As used herein, a "promoter" can refer to a DNA regulatory region that directly or indirectly (e.g., through a promoter-binding protein or substance) binds to RNA polymerase and is involved in the initiation of transcription of a coding sequence.

[0081] Reference: As used herein, a standard or control is described with respect to which a comparison is made. For example, in some embodiments, a reagent, subject, animal, individual, population, sample, sequence, or value of interest is compared to a reference or control reagent, subject, animal, individual, population, sample, sequence, or value. In some embodiments, a reference or its characteristics are tested and / or determined substantially contemporaneously with the testing or determination of a characteristic in a sample of interest. In some embodiments, the reference is a historical reference, optionally embodied in a tangible medium. Generally, as will be understood by those of skill in the art, a reference is determined or characterized under conditions or circumstances comparable to those being evaluated, e.g., with respect to a sample. Those of skill in the art will understand when there is sufficient similarity to justify reliance on and / or comparison to a particular possible reference or control.

[0082] Risk: As used herein, with respect to a disease, disorder, or condition, the term "risk" refers to the determination of the quantitative probability (expressed as a percentage or otherwise) that a particular individual will develop the disease, disorder, or condition. In some embodiments, the risk is expressed as a percentage. In some embodiments, the risk is the determination of a quantitative probability that is equal to or greater than 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100%. In some embodiments, the risk is expressed as a determination of the quantitative level of risk relative to a reference risk or level or the risk of the same outcome attributable to a reference. In some embodiments, the relative risk is increased or decreased by a factor of 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more compared to a reference sample.

[0083] Sample: As used herein, the term "sample" generally refers to an aliquot of material obtained or derived from a source of interest. In some embodiments, the source of interest is a biological or environmental source. In some embodiments, the sample is an "original sample" obtained directly from the source of interest. In some embodiments, it will be clear from the context that the term "sample" refers to a preparation obtained by processing the original sample (e.g., by removing one or more components and / or by adding one or more reagents to the original sample). Such a "processed sample" can include, for example, cells, nucleic acids, or proteins extracted from the sample or obtained by subjecting the original sample to techniques such as amplification or reverse transcription of nucleic acids, separation and / or purification of certain components, and the like.

[0084] In certain cases, the processed sample can be a DNA sample that has been amplified (e.g., pre-amplified). Thus, in various cases, the identified sample can refer to the original form of the sample or the processed form of the sample. In some cases, an enzymatically digested DNA sample can refer to the primary enzymatically digested DNA (the direct product of the enzymatic digestion) or a further processed sample, such as an enzymatically digested DNA that has undergone an amplification step (e.g., an intermediate amplification step, such as pre-amplification) and / or a filtration step, a purification step, or a step to modify the sample to facilitate further steps, such as in determining the methylation status (e.g., the methylation status of the original DNA sample and / or the methylation status of the original DNA sample present in its original source context).

[0085] Screening: As used herein, the term "screening" refers to any method, technique, process, or task that is intended to generate diagnostic information and / or prognostic information. Thus, those skilled in the art will understand that the term screening encompasses methods, techniques, processes, or tasks for determining whether an individual has, may have, or will develop, or is at risk of having or developing a disease, disorder, or condition, e.g., colorectal cancer.

[0086] Specificity: As used herein, the "specificity" of a biomarker refers to the percentage of samples characterized by the absence of the event or state of interest for which the measurement of the biomarker accurately indicates the absence of the event or state of interest (true negative rate). In various embodiments, the characterization of the negative sample does not depend on the biomarker and can be achieved by any relevant measurement, such as any relevant measurement known to those skilled in the art. Thus, specificity reflects the probability that the biomarker detects the absence of the event or state of interest when measured in samples not characterized by the event or state of interest. In a particular embodiment where the event or state of interest is colorectal cancer, specificity refers to the probability that the biomarker detects the absence of colorectal cancer in subjects without colorectal cancer. For example, the absence of colorectal cancer can be determined by histology.

[0087] Sensitivity: As used herein, the "sensitivity" of a biomarker is the percentage of samples characterized by the presence of an event or condition of interest for which the measurement of the biomarker accurately indicates the presence of the event or condition of interest (true positive rate). In various embodiments, the characterization of a positive sample is independent of the biomarker and can be achieved by any relevant measurement, such as any relevant measurement known to those of skill in the art. Thus, sensitivity reflects the probability that the biomarker will detect the presence of the event or condition of interest when measured in a sample characterized by the presence of the event or condition of interest. In a particular embodiment where the event or condition of interest is colorectal cancer, the sensitivity is the probability that the biomarker will detect the presence of colorectal cancer in a subject with colorectal cancer. The presence of colorectal cancer can be determined, for example, by histology.

[0088] Solid tumor: As used herein, the term "solid tumor" refers to a mass of abnormal tissue that includes cancer cells. In various embodiments, a solid tumor is or includes a mass of abnormal tissue that does not contain cysts or fluid regions. In some embodiments, a solid tumor can be benign; in some embodiments, a solid tumor can be malignant. Examples of solid tumors include carcinomas, lymphomas, and sarcomas. In some embodiments, a solid tumor can be or include adrenal, bile duct, bladder, bone, brain, breast, cervical, colon, endometrial, esophageal, eye, gallbladder, gastrointestinal, kidney, laryngeal, liver, lung, nasal, nasopharyngeal, oral, ovarian, penile, pituitary, prostate, retinal, salivary gland, skin, small intestine, stomach, testicular, thymic, thyroid, uterine, vaginal, and / or vulvar tumors.

[0089] Cancer staging: As used herein, the term "cancer staging" refers to a qualitative or quantitative assessment of the level of cancer progression. In some embodiments, the criteria used to determine cancer staging can include, but are not limited to, the location of the cancer in the body, the size of the tumor, whether the cancer has spread to the lymph nodes, whether the cancer has spread to one or more different parts of the body, etc. In some embodiments, the so-called TNM system can be used to stage cancer, according to which T refers to the size and extent of the primary tumor, commonly referred to as the primary tumor; N refers to the number of lymph nodes with cancer nearby; and M refers to whether the cancer has metastasized. In some embodiments, cancer can be referred to as stage 0 (there are abnormal cells but they have not spread to nearby tissues, also known as carcinoma in situ or CIS; CIS is not cancer, but it can become cancer), stage I - III (there is cancer; the larger the number, the larger the tumor and the more it has spread to nearby tissues), or stage IV (the cancer has spread to distant parts of the body). In some embodiments, cancer can be designated as a stage selected from the group consisting of: in situ (there are abnormal cells but they have not spread to nearby tissues); local (the cancer is limited to where it started and there are no signs of spread); regional (the cancer has spread to nearby lymph nodes, tissues, or organs); distant (the cancer has spread to distant parts of the body); and unknown (there is not enough information to identify the cancer stage).

[0090] Susceptible to: An individual who is "susceptible" to a disease, disorder, or condition is at risk of developing that disease, disorder, or condition. In some embodiments, an individual who is susceptible to a disease, disorder, or condition does not exhibit any symptoms of that disease, disorder, or condition. In some embodiments, an individual who is susceptible to a disease, disorder, or condition has not been diagnosed with that disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, or condition is an individual who has been exposed to conditions related to the development of the disease, disorder, or condition or exhibits a biomarker status (e.g., methylation status) related to the development of the disease, disorder, or condition. In some embodiments, the risk of developing a disease, disorder, and / or condition is based on population risk (e.g., a family member of an individual with the disease, disorder, or condition).

[0091] Subject: As used herein, the term "subject" refers to an organism, typically a mammal (e.g., a human). In some embodiments, the subject has a disease, disorder, or condition. In some embodiments, the subject is susceptible to a disease, disorder, or condition. In some embodiments, the subject exhibits one or more symptoms or features of a disease, disorder, or condition. In some embodiments, the subject does not have a disease, disorder, or condition. In some embodiments, the subject does not exhibit any symptoms or features of a disease, disorder, or condition. In some embodiments, the subject is a human having one or more characteristics that are characteristic of susceptibility or risk for a disease, disorder, or condition. In some embodiments, the subject is a patient. In some embodiments, the subject is an individual who has been diagnosed and / or treated. In certain cases, a human subject may be interchangeably referred to as an "individual".

[0092] Therapeutic agent: As used herein, the term "therapeutic agent" refers to any agent that elicits a desired pharmacological effect when administered to a subject. In some embodiments, an agent is considered a therapeutic agent if it demonstrates a statistically significant effect in a suitable population. In some embodiments, the suitable population can be a population of model organisms or a human population. In some embodiments, the suitable population can be defined by various criteria, such as a specific age group, gender, genetic background, pre-existing clinical condition, etc. In some embodiments, a therapeutic agent is a substance that can be used to treat a disease, disorder, or condition. In some embodiments, a therapeutic agent is an agent that has been or needs to be approved by a government agency before it can be marketed for administration to humans. In some embodiments, a therapeutic agent is an agent that requires a medical prescription for administration to humans.

[0093] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" refers to the amount that produces the desired effect upon administration. In some embodiments, the term refers to an amount sufficient to treat a disease, disorder, or condition when administered to a population having or susceptible to the disease, disorder, or condition according to a therapeutic dosing regimen. One of ordinary skill in the art will understand that the term therapeutically effective amount does not actually require successful treatment in a particular individual. Instead, a therapeutically effective amount can be an amount that provides a particular desired pharmacological response in a large number of subjects when administered to individuals in need of such treatment. In some embodiments, reference to a therapeutically effective amount can be reference to an amount measured in one or more specific tissues (e.g., tissues affected by a disease, disorder, or condition) or fluids (e.g., blood, saliva, serum, sweat, tears, urine, etc.). One of ordinary skill in the art will understand that in some embodiments, a particular agent of a therapeutically effective amount can be formulated and / or administered in a single dose. In some embodiments, a therapeutically effective agent can be formulated and / or administered in multiple doses, e.g., as part of a multi-dose dosing regimen.

[0094] Treatment: As used herein, the term "treatment" (also referred to as "treating" or "treat") refers to the administration to partially or completely alleviate, ameliorate, relieve, inhibit, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms, features, and / or causes of a particular disease, disorder, or condition, or the administration for the purpose of achieving any such result. In some embodiments, such treatment can be directed to a subject who does not exhibit signs of the relevant disease, disorder, or condition and / or a subject who exhibits only early signs of the disease, disorder, or condition. Alternatively or additionally, such treatment can be directed to a subject who exhibits one or more established signs of the relevant disease, disorder, and / or condition. In some embodiments, treatment can be directed to a subject who has been diagnosed with the relevant disease, disorder, and / or condition. In some embodiments, treatment can be directed to a subject known to have one or more risk factors that are statistically associated with an increased risk of development of the relevant disease, disorder, or condition. In various instances, the treatment is directed to cancer.

[0095] Upstream: As used herein, the term "upstream" means that a first DNA region is closer to the N-terminus of a nucleic acid comprising the first DNA region and a second DNA region relative to the second DNA region.

[0096] Unit dose: As used herein, the term "unit dose" refers to an amount administered as a single dose and / or as a physically discrete unit of a pharmaceutical composition. In many embodiments, a unit dose contains a predetermined amount of an active agent. In some embodiments, a unit dose contains a complete single dose of a reagent. In some embodiments, more than one unit dose is administered to achieve a total single dose. In some embodiments, multiple unit doses are required or expected to be administered to achieve a specified effect. A unit dose can be, for example, a volume of a liquid (e.g., an acceptable carrier) containing a predetermined amount of one or more therapeutic moieties, a predetermined amount of one or more solid forms of a therapeutic moiety, a sustained-release formulation, or a delivery device containing a predetermined amount of one or more therapeutic moieties, and so forth. It should be understood that a unit dose can be present in a formulation that includes any one of a variety of components in addition to the therapeutic agent. For example, it can include an acceptable carrier (e.g., a pharmaceutically acceptable carrier), a diluent, a stabilizer, a buffer, a preservative, and the like. Those skilled in the art will understand that in many embodiments, the total appropriate daily dose of a particular therapeutic agent can include a fraction or multiple unit doses and can be determined, for example, by a practicing physician within the scope of reasonable medical judgment. In some embodiments, the specific effective dose level for any particular subject or organism can depend on a variety of factors, including the disorder being treated and the severity of the disorder; the activity of the particular active compound being used; the particular ingredients employed; the age, weight, general health, sex, and diet of the subject; the time of administration, the excretion rate of the particular active compound being used; the duration of the treatment; drugs and / or other therapies used in combination with or concurrently with the particular compound being used, and similar factors well known in the medical arts.

[0097] Unmethylated: As used herein, the terms "unmethylated" and "non-methylated" are used interchangeably and refer to an identified DNA region that does not include methylated nucleotides.

[0098] Variant: As used herein, the term "variant" refers to an entity that exhibits significant structural identity with a reference entity but is structurally different from the reference entity in the presence, absence, or level of one or more chemical moieties. In some embodiments, the variant is also functionally different from its reference entity. Generally, whether a particular entity is properly regarded as a "variant" of a reference entity depends on the degree of structural identity between the entity and the reference entity. A variant can be a molecule that is comparable but not identical to the reference. For example, a variant nucleic acid can differ from a reference nucleic acid at one or more nucleotide sequence differences. In some embodiments, the variant nucleic acid exhibits an overall sequence identity with the reference nucleic acid of at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%. In many embodiments, a nucleic acid of interest is considered a "variant" of a reference nucleic acid if the nucleic acid of interest has a sequence identical to that of the reference but with minor sequence alterations at specific positions. In some embodiments, the variant has 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 substituted residues compared to the reference. In some embodiments, the variant has no more than 5, 4, 3, 2, or 1 residue added, substituted, or deleted compared to the reference. In various embodiments, the number of added, substituted, or deleted residues is less than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, about 6, and generally less than about 5, about 4, about 3, or about 2 residues. BRIEF DESCRIPTION OF THE DRAWINGS

[0099] Figure 1 is a schematic diagram showing an exemplary MSRE-qPCR method.

[0100] Figure 2 is a table showing the characteristics of a first group of 70 human subjects. Figure 2 The percentage of females, percentage of males, age range, and BMI of the subjects are provided. Figure 2 Further distinguished are the types of colorectal cancer identified as local or advanced based on histological evaluation and the types of colorectal cancer identified as proximal or distal based on colonoscopic evaluation of the colon in the first group of subjects.

[0101] Figure 3 is a table showing the characteristics of a second group of 63 human subjects. Figure 3 The percentage of females, percentage of males, age range, and BMI of the subjects are provided. Figure 3 Further distinguished are the types of colorectal cancer identified as local or advanced based on histological evaluation and the types of colorectal cancer determined as proximal or distal based on colonoscopic evaluation of the colon in the second group of subjects.

[0102] Figure 4 It includes Figure A and Figure B. Figure 4 Figure A shows the performance of a representative proof-of-concept cohort using DMR for colorectal cancer screening in a second subject cohort. The ROC curves and AUCs for all subjects in the second subject cohort are shown. Figure 4 Figure B is a chart showing accuracy values, including, from left to right, the overall sensitivity of colorectal cancer screening for colorectal cancer, the sensitivity of colorectal cancer screening for local colorectal cancer, the sensitivity of colorectal cancer screening for advanced colorectal cancer, the sensitivity of colorectal cancer screening for proximal colorectal cancer, the sensitivity of colorectal cancer screening for distal colorectal cancer, and the specificity of colorectal cancer screening for control subjects (healthy subjects and non-advanced adenoma subjects).

[0103] Figure 5 It is a chart showing the Ct values of MSRE-qPCR of ALK‘434 from subjects with colorectal cancer and control subjects (healthy subjects and subjects with non-advanced adenomas). The data represent the second subject cohort (63 subjects) tested. For display purposes, the Ct value is subtracted from 45 (45-dCt). A higher 45-dCt value corresponds to a higher methylation state, indicating hypermethylation in colorectal cancer subjects.

[0104] Figure 6 It is a chart showing the Ct values of MSRE-qPCR of FGF14‘577DMR from subjects with colorectal cancer and control subjects (healthy subjects and subjects with non-advanced adenomas). The data represent the second subject cohort (63 subjects) tested. For display purposes, the Ct value is subtracted from 45 (45-dCt). A higher 45-dCt value corresponds to a higher methylation state, indicating hypermethylation in colorectal cancer subjects.

[0105] Figure 7 It is a chart showing the Ct values of MSRE-qPCR of PDGFD‘388 from subjects with colorectal cancer and control subjects (healthy subjects and subjects with non-advanced adenomas). The data represent the second subject cohort (63 subjects) tested. For display purposes, the Ct value is subtracted from 45 (45-dCt). A higher 45-dCt value corresponds to a higher methylation state, indicating hypermethylation in colorectal cancer subjects.

[0106] Figure 8It is a graph showing the Ct values of MSRE-qPCR of JAM2‘320 for subjects with colorectal cancer and control subjects (healthy subjects and subjects with non-advanced adenomas). The data represent the second subject group (63 subjects) used for testing. For display purposes, the Ct value is subtracted from 45 (45-dCt). A higher 45-dCt value corresponds to a higher methylation state, indicating hypermethylation in colorectal cancer subjects.

[0107] Figure 9 It is a graph showing the Ct values of MSRE-qPCR of LONRF2‘281 for subjects with colorectal cancer and control subjects (healthy subjects and subjects with non-advanced adenomas). The data represent the second subject group (63 subjects) used for testing. For display purposes, the Ct value is subtracted from 45 (45-dCt). A higher 45-dCt value corresponds to a higher methylation state, indicating hypermethylation in colorectal cancer subjects.

[0108] Figure 10 It is a table showing the characteristics of the third subject group of 82 human subjects. Figure 10 It provides the percentage of females, percentage of males, age range, and BMI of subjects diagnosed by screening using 28 colorectal cancer DMRs of the present disclosure. Figure 10 It further differentiates the types of colorectal cancer identified as local or advanced based on histological evaluation in the third subject group, and the types of colorectal cancer identified as proximal or distal based on colonoscopic evaluation of the colon.

[0109] Figure 11 It is a graph showing the performance of colorectal cancer screening using 28 DMR groups in the third subject group. The ROC curve and AUC of all subjects in the third subject group are shown. ROC curve analysis shows that the 28 DMR groups achieved a general colorectal cancer sensitivity of 79%, a sensitivity of 75% for local (early) cancers, a sensitivity of 84% for advanced cancers, and a specificity of 87% with very stable performance at an AUC of 82% (see also Table 15).

[0110] Figure 12 It is a graph showing the Ct values of MSRE-qPCR of ZNF471‘527 for subjects with colorectal cancer and control subjects (healthy subjects and subjects with non-advanced adenomas). The data represent the third subject group (82 subjects). For display purposes, the Ct value is subtracted from 45 (45-dCt). A higher 45-dCt value corresponds to a higher methylation state, indicating hypermethylation in colorectal cancer subjects.

[0111] Figure 13A graph showing the Ct values of MSRE-qPCR of FGF14‘577 for subjects with colorectal cancer and control subjects (healthy subjects and subjects with non-advanced adenomas). The data represent a third group of subjects (82 subjects). For display purposes, the Ct value was subtracted from 45 (45-dCt). A higher 45-dCt value corresponds to a higher methylation state, indicating hypermethylation in colorectal cancer subjects.

[0112] Figure 14 A graph showing the Ct values of MSRE-qPCR of PDGFD‘388 for subjects with colorectal cancer and control subjects (healthy subjects and subjects with non-advanced adenomas). The data represent a third group of subjects (82 subjects). For display purposes, the Ct value was subtracted from 45 (45-dCt). A higher 45-dCt value corresponds to a higher methylation state, indicating hypermethylation in colorectal cancer subjects.

[0113] Figure 15 A graph showing the Ct values of MSRE-qPCR of ADAMTS2‘254 for subjects with colorectal cancer and control subjects (healthy subjects and subjects with non-advanced adenomas). The data represent a third group of subjects (82 subjects). For display purposes, the Ct value was subtracted from 45 (45-dCt). A higher 45-dCt value corresponds to a higher methylation state, indicating hypermethylation in colorectal cancer subjects.

[0114] Figure 16 A graph showing the Ct values of MSRE-qPCR of ZNF471‘558 (this DMR is also referred to as ZNF471_2 in this article) for subjects with colorectal cancer and control subjects (healthy subjects and subjects with non-advanced adenomas). The data represent a third group of subjects (82 subjects). For display purposes, the Ct value was subtracted from 45 (45-dCt). A higher 45-dCt value corresponds to a higher methylation state, indicating hypermethylation in colorectal cancer subjects.

[0115] Figure 17 A graph showing the Ct values of MSRE-qPCR of ST6GALNAC5‘456 for subjects with colorectal cancer and control subjects (healthy subjects and subjects with non-advanced adenomas). The data represent a third group of subjects (82 subjects). For display purposes, the Ct value was subtracted from 45 (45-dCt). A higher 45-dCt value corresponds to a higher methylation state, indicating hypermethylation in colorectal cancer subjects.

[0116] Figure 18A graph showing the Ct values of MSRE-qPCR of ZNF542 ‘525 for subjects with colorectal cancer and control subjects (healthy subjects and subjects with non-advanced adenomas). The data represent a third group of subjects (82 subjects). For display purposes, the Ct value was subtracted from 45 (45-dCt). Higher 45-dCt values correspond to higher methylation states, indicating hypermethylation in colorectal cancer subjects.

[0117] Figure 19 A graph showing the Ct values of MSRE-qPCR of LONRF2 ‘281 for subjects with colorectal cancer and control subjects (healthy subjects and subjects with non-advanced adenomas). The data represent a third group of subjects (82 subjects). For display purposes, the Ct value was subtracted from 45 (45-dCt). Higher 45-dCt values correspond to higher methylation states, indicating hypermethylation in colorectal cancer subjects.

[0118] Figure 20 A schematic diagram showing exemplary methylation changes in the methylation state between normal cells and cancer cells, and further indicating how changes in the methylation state affect gene expression differences between normal cells and cancer cells. Detailed Description

[0119] Screening for Colorectal Cancer

[0120] There is a need to improve methods for screening colorectal cancer, including screening for early diagnosis of colorectal cancer. Although screening is recommended for individuals (e.g., over 50 years old), colorectal cancer screening programs are often ineffective or unsatisfactory. Improved screening for colorectal cancer can improve diagnosis and reduce colorectal cancer mortality.

[0121] DNA methylation (e.g., hypermethylation or hypomethylation) can activate or inactivate genes, including genes that affect cancer development (see, e.g., Figure 20 ). Thus, for example, hypermethylation can inactivate one or more genes that are normally used to suppress cancer, thereby leading to or promoting cancer development in a sample or subject.

[0122] This disclosure includes the discovery that determination of the methylation state of one or more of the methylation loci provided herein, and / or the methylation state of one or more of the DMRs provided herein, and / or the methylation state of one or more of the methylation sites provided herein can provide, for example, colorectal cancer screening with high sensitivity and / or specificity. This disclosure provides compositions and methods including or relating to colorectal cancer methylation biomarkers that provide screening for colorectal cancer with high specificity and / or sensitivity, either alone or in various groups containing more than two colorectal cancer methylation biomarkers.

[0123] In various embodiments, the colorectal cancer methylation biomarkers of the present disclosure are selected from methylation loci that are or include ALK, LONRF2, ADAMTS2, FGF14, DMRT1, ST6GALNAC5, MCIDAS, PDGFD, GSG1L, ZNF492, ZNF568, ZNF542, ZNF471, ZNF132, JAM2, and CNRIP1 (see, e.g., Table 1). In various embodiments, the colorectal cancer DMRs are selected from ALK‘434, CNRIP1‘232, CNRIP1‘272, LONRF2‘281, LONRF2‘387, ADAMTS2‘254, ADAMTS2‘284, ADAMTS2‘328, FGF14‘577, DMRT1‘934, ST6GALNAC5‘456, MCIDAS‘855, MCIDAS‘003, PDGFD‘388, PDGFD‘921, GSG1L‘861, ZNF492’499, ZNF492‘069, ZNF568‘252, ZNF568‘405, ZNF542‘525, ZNF542‘502, ZNF471‘527, ZNF471‘558, ZNF471‘662, ZNF132‘268, ZNF132‘415, and JAM2‘320 (see, e.g., Table 7).

[0124] To avoid any doubt, any methylation biomarker provided herein may in particular be or be included in the colorectal cancer methylation biomarkers.

[0125] In some embodiments, the colorectal cancer methylation biomarker may be or include a single methylation locus. In some embodiments, the colorectal cancer methylation biomarker may be or include more than two methylation loci. In some embodiments, the colorectal cancer methylation biomarker may be or include a single differentially methylated region (DMR). In some embodiments, the methylation locus may be or include more than two DMRs. In some embodiments, the methylation biomarker may be or include a single methylation site. In other embodiments, the methylation biomarker may be or include more than two methylation sites. In some embodiments, the methylation locus may include more than two DMRs and further include a DNA region adjacent to one or more of the included DMRs.

[0126] In some cases, the methylated locus is or includes a gene, such as the genes provided in Table 1. In some cases, the methylated locus is or includes a portion of a gene, such as a portion of the genes provided in Table 1. In some cases, the methylated locus includes, but is not limited to, the identified nucleic acid boundaries of a gene.

[0127] In some cases, the methylated locus is or includes the coding region of a gene, such as the coding region of the genes provided in Table 1. In some cases, the methylated locus is or includes a portion of the coding region of a gene, such as a portion of the coding region of the genes provided in Table 1. In some cases, the methylated locus includes, but is not limited to, the identified nucleic acid boundaries of the coding region of a gene.

[0128] In some cases, the methylated locus is or includes the promoter and / or other regulatory regions of a gene, such as the promoter and / or other regulatory regions of the genes provided in Table 1. In some cases, the methylated locus is or includes a portion of the promoter and / or regulatory regions of a gene, such as a portion of the promoter and / or regulatory regions of the genes provided in Table 1. In some cases, the methylated locus includes, but is not limited to, the identified nucleic acid boundaries of the promoter and / or other regulatory regions of a gene. In some embodiments, the methylated locus is or includes a high CpG density promoter, or a portion thereof.

[0129] In some embodiments, the methylated locus is or includes a non-coding sequence. In some embodiments, the methylated locus is or includes one or more exons and / or one or more introns.

[0130] In some embodiments, the methylated locus includes a DNA region that extends a predetermined number of nucleotides upstream of the coding sequence, and / or a DNA region that extends a predetermined number of nucleotides downstream of the coding sequence. In various cases, the predetermined number of nucleotides upstream and / or downstream is or includes, for example, 500 bp, 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 10 kb, 20 kb, 30 kb, 40 kb, 50 kb, 75 kb, or 100 kb. Those skilled in the art will understand that methylation biomarkers that can affect the expression of the coding sequence can generally be within any of these distances upstream and / or downstream of the coding sequence.

[0131] Those skilled in the art will understand that the methylated loci identified as methylation biomarkers need not be tested in a single experiment, reaction, or amplicon. A single methylated locus identified as a colorectal cancer methylation biomarker can be tested, for example, by a method that includes separately amplifying one or more independent or overlapping DNA regions within the methylated locus (or providing oligonucleotide primers and conditions sufficient to amplify one or more different or overlapping DNA regions within the methylated locus). Those skilled in the art will further understand that it is not necessary to analyze the methylation status of each nucleotide of the methylated locus identified as a methylation biomarker, nor is it necessary to analyze each CpG present within the methylated locus. Instead, the methylated locus identified as a methylation biomarker can be analyzed, for example, by analyzing a single DNA region within the methylated locus, such as by analyzing a single DMR within the methylated locus.

[0132] The DMRs of the present disclosure can be methylated loci or include a portion of a methylated locus. In some cases, the DMR is a DNA region of a methylated locus having, for example, a length of 1 to 5,000 bp. In various embodiments, the DMR is a DNA region of a methylated locus having a length equal to or less than 5000 bp, 4,000 bp, 3,000 bp, 2,000 bp, 1,000 bp, 950 bp, 900 bp, 850 bp, 800 bp, 750 bp, 700 bp, 650 bp, 600 bp, 550 bp, 500 bp, 450 bp, 400 bp, 350 bp, 300 bp, 250 bp, 200 bp, 150 bp, 100 bp, 50 bp, 40 bp, 30 bp, 20 bp, or 10 bp. In some embodiments, the DMR has a length of 1, 2, 3, 4, 5, 6, 7, 8, or 9 bp.

[0133] Methylation biomarkers, including but not limited to the methylated loci and DMRs provided herein, can include at least one methylation site that is a colorectal cancer methylation biomarker.

[0134] For clarity, those skilled in the art will understand that the term methylation biomarker is used broadly such that a methylated locus can be a methylation biomarker that includes one or more DMRs, where each DRM is itself a methylation biomarker, and each such DMR can include one or more methylation sites, each of which is itself a methylation biomarker. In addition, a methylation biomarker can include more than two methylated loci. Thus, the status as a methylation biomarker does not dictate the continuity of the nucleic acids contained in the biomarker, but rather the presence of a change in the methylation status of the DNA region contained between a first state and a second state (e.g., between colorectal cancer and a control).

[0135] As provided herein, the methylated locus can be any one of one or more of the following methylated loci, each of which is or includes a gene identified in Table 1. In certain specific embodiments, the colorectal cancer methylation biomarker comprises a single methylated locus that is or includes a gene identified in Table 1. For example, in various embodiments, the colorectal cancer methylation biomarker can comprise a single methylated locus that is or includes a gene selected from LONRF2, ADAMTS2, FGF14, ST6GALNAC5, PDGFD, ZNF492, ZNF542, ZNF471, JAM2, GSG1L, DMRT1, and MCIDAS.

[0136] In some specific embodiments, the colorectal cancer methylation biomarker comprises more than two methylated loci, each of which is or includes a gene identified in Table 1. In some embodiments, the colorectal cancer methylation biomarker comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 methylated loci, each of which is or includes a gene identified in Table 1.

[0137] In some specific embodiments, the colorectal cancer methylation biomarker comprises more than two methylation loci, wherein each of the more than two methylation loci is or comprises a gene identified in any one of Tables 1 to 6, including but not limited to combinations of more than two methylation loci, and the methylation loci are respectively or comprise genes identified in one of Tables 2 to 6. In some specific embodiments, the colorectal cancer methylation biomarker comprises two methylation loci, and the two methylation loci comprise a methylation locus that is or comprises a gene identified in Table 2. In some specific embodiments, the colorectal cancer methylation biomarker comprises three methylation loci, and the three methylation loci comprise a methylation locus that is or comprises a gene identified in Table 3. In some specific embodiments, the colorectal cancer methylation biomarker comprises four methylation loci, and the four methylation loci comprise a methylation locus that is or comprises a gene identified in Table 4. In some specific embodiments, the colorectal cancer methylation biomarker comprises six methylation loci, and the six methylation loci comprise a methylation locus that is or comprises a gene identified in Table 5. In some specific embodiments, the colorectal cancer methylation biomarker comprises 11 methylation loci, and the 11 methylation loci comprise a methylation locus that is or comprises a gene identified in Table 6. In various specific embodiments, the colorectal cancer methylation biomarker or the colorectal cancer methylation biomarker group comprises one or more methylation loci of the present disclosure, but does not include the following methylation loci, which are or comprise all or part of one or more of FGF14, ZNF471, PDGFD, and ALK.

[0138] Table 1. Methylation Loci Identified by Gene Name

[0139]

[0140] Table 2. Combinations of 2 Methylation Loci

[0141] ZNF471 FGF14

[0142] Table 3. Combinations of 3 Methylation Loci

[0143] ZNF471 FGF14 PDGFD

[0144] Table 4. Combinations of 4 Methylation Loci

[0145] ZNF471 FGF14 PDGFD ADAMTS2

[0146] Table 5. Combinations of 6 Methylation Loci

[0147] ZNF471 FGF14 PDGFD ADAMTS2 ZNF492 ST6GALNAC5

[0148] Table 6. Combinations of 11 Methylated Loci

[0149] ZNF471 FGF14 PDGFD ADAMTS2 ZNF492 ST6GALNAC5 ZNF542 LONRF2 ZNF132 CNRIP1 ALK

[0150] As provided herein, a DMR can be any one of one or more DMRs, where each DMR exists in or comprises a methylated locus of a gene identified in Table 1. In some particular embodiments, a colorectal cancer methylation biomarker is or comprises a single DMR that comprises all or part of a gene identified in Table 1 or exists in Table 1. For example, in various embodiments, a colorectal cancer methylation biomarker can comprise a single DMR, i.e., that comprises all or part of, or exists in, a gene selected from the group consisting of ALK, LONRF2, ADAMTS2, FGF14, DMRT1, ST6GALNAC5, MCIDAS, PDGFD, GSG1L, ZNF568, ZNF542, ZNF471, ZNF132, JAM2, ZNF492, and CNRIP1.

[0151] In some specific embodiments, a colorectal cancer methylation biomarker comprises more than two DMRs, each of which is or comprises all or part of a gene identified in Table 1 or exists in a gene identified in Table 1. In some embodiments, a colorectal cancer methylation biomarker comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 DMRs, each of which is or comprises all or part of a gene identified in Table 1 or exists in a gene identified in Table 1.

[0152] In some specific embodiments, the colorectal cancer methylation biomarker comprises more than two DMRs, and each of the more than two DMRs is or comprises all or part of the gene identified in any one of Tables 1-6 or is present in the gene identified in any one of Tables 1-6. In some specific embodiments, the colorectal cancer methylation biomarker comprises two DMRs, and the DMRs comprised by the two DMRs are or comprise all or part of the gene identified in Table 2 or are present in the gene identified in Table 2. In some specific embodiments, the colorectal cancer methylation biomarker comprises three DMRs, and the DMRs comprised by the three DMRs are or comprise all or part of the gene identified in Table 3 or are present in the gene identified in Table 3. In some specific embodiments, the colorectal cancer methylation biomarker comprises four DMRs, and the DMRs comprised by the four DMRs are or comprise all or part of the gene identified in Table 4 or are present in the gene identified in Table 4. In some specific embodiments, the colorectal cancer methylation biomarker comprises six DMRs, and the DMRs comprised by the six DMRs are or comprise all or part of the gene identified in Table 5 or are present in the gene identified in Table 5. In some specific embodiments, the colorectal cancer methylation biomarker comprises 11 DMRs, and the DMRs comprised by the 11 DMRs are or comprise all or part of the gene identified in Table 6 or are present in the gene identified in Table 6. In various specific embodiments, the colorectal cancer methylation biomarker or the group of colorectal cancer methylation biomarkers comprises one or more DMRs, provided that the one or more DMRs do not include: DMRs that are or comprise all or part of one or more of FGF14, ZNF471, PDGFD, and ALK, or DMRs that are present in one or more of FGF14, ZNF471, PDGFD, and ALK.

[0153] As provided herein, the DMR can be any one of one or more DMRs, where each DMR is or includes all of the DMRs identified in Table 7 or includes a portion of the DMRs determined in Table 7, including but not limited to specifically the DMRs identified in Table 7. In some particular embodiments, the colorectal cancer methylation biomarker is or includes a single DMR, which is or includes all of the DMRs identified in Table 7 or includes a portion of the DMRs identified in Table 7, including but not limited to specifically the DMRs identified in Table 7. For example, the DMRs of Table Q selected from the following DMR group, the DMR group including but not limited to ALK‘434, CNRIP1‘232, CNRIP1‘272, LONRF2‘281, LONRF2‘387, ADAMTS2‘254, ADAMTS2‘284, ADAMTS2‘328, FGF14‘577, DMRT1‘934, ST6GALNAC5‘456, MCIDAS‘855, MCIDAS‘003, PDGFD‘388, PDGFD‘921, GSG1L‘861, ZNF492’499, ZNF492‘069, ZNF568‘252, ZNF568‘405, ZNF542‘525, ZNF542‘502, ZNF471‘527, ZNF471‘558, ZNF471‘662, ZNF132‘268,, ZNF132‘415 and JAM2‘320. For example, in various embodiments, the colorectal cancer methylation biomarker can include a single DMR, which is or includes all or includes a portion of the following DMRs, the DMRs selected from LONRF2‘281, LONRF2‘387, ADAMTS2‘254, ADAMTS2‘284, ADAMTS2‘328, FGF14‘577, ST6GALNAC5‘456, PDGFD‘388, PDGFD‘921, ZNF492’499, ZNF492‘069, ZNF542‘525, ZNF542‘502, ZNF471‘527, ZNF471‘558 and ZNF471‘662.

[0154] In some specific embodiments, the colorectal cancer methylation biomarker comprises more than two DMRs, and each of the DMRs is or comprises all or a part of the DMRs identified in Table 7, including but not limited to the DMRs specifically identified in Table 7. In some embodiments, the colorectal cancer methylation biomarker comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 DMRs, and each of the DMRs is or comprises all or a part of the DMRs identified in Table 7, including but not limited to the DMRs specifically identified in Table 7.

[0155] In some specific embodiments, the colorectal cancer methylation biomarker comprises more than two DMRs, and each of the more than two DMRs is or comprises all or a part of the DMRs identified in any one of Tables 7 to 12, including but not limited to the DMRs and their combinations specifically identified in Tables 8 to 12. In some specific embodiments, the colorectal cancer methylation biomarker comprises two DMRs, and the two DMRs are the DMRs identified in Table 8. In some specific embodiments, the colorectal cancer methylation biomarker comprises three DMRs, and the three DMRs are the DMRs identified in Table 9. In some specific embodiments, the colorectal cancer methylation biomarker comprises five DMRs, and the five DMRs are the DMRs identified in Table 10. In some specific embodiments, the colorectal cancer methylation biomarker comprises eight DMRs, and the eight DMRs are the DMRs identified in Table 11. In some specific embodiments, the colorectal cancer methylation biomarker comprises fifteen DMRs, and the fifteen DMRs are the DMRs identified in Table 12. In various specific embodiments, the colorectal cancer methylation biomarker or the group of colorectal cancer methylation biomarkers comprises one or more DMRs of Table 7, but the one or more DMRs do not include one or more or all of the DMRs of FGF14, ZNF471, PDGFD and ALK, for example, do not include one or more or all of the DMRs of FGF14, ZNF471, PDGFD and ALK provided in Table 7.

[0156] Table 7: Colorectal cancer DMR

[0157]

[0158] Table 8. Combinations of 2 DMRs

[0159]

[0160] Table 9 Combinations of 3 DMRs

[0161]

[0162] Table 10. Combinations of 5 DMRs

[0163]

[0164] Table 11. Combinations of 8 DMRs

[0165]

[0166] Table 12. Combinations of 15 DMRs

[0167]

[0168] In various embodiments, a methylation biomarker can be or include one or more individual nucleotides (e.g., a single individual cysteine residue in the case of CpG) or multiple individual cysteine residues (e.g., multiple separate cysteine residues of multiple CpGs) present in one or more methylation loci (e.g., one or more DMRs) provided herein. Thus, in certain embodiments, a methylation biomarker is or includes the methylation status of multiple individual methylation sites.

[0169] In various embodiments, a methylation biomarker is or includes or is characterized by a change in methylation status, which change is a change in the methylation of one or more methylation sites within one or more methylation loci (e.g., one or more DMRs). In various embodiments, a methylation biomarker is or includes a change in methylation status, which change is a change in the number of methylation sites within one or more methylation loci (e.g., one or more DMRs). In various embodiments, a methylation biomarker is or includes a change in methylation status, which change is a change in the frequency of methylation sites within one or more methylation loci (e.g., one or more DMRs). In various embodiments, a methylation biomarker is or includes a change in methylation status, which change is a change in the pattern of methylation sites within one or more methylation loci (e.g., one or more DMRs).

[0170] In various embodiments, the methylation status of one or more methylated loci (e.g., one or more DMRs) is expressed as a fraction or percentage of the one or more methylated loci (e.g., one or more DMRs) present in a methylated sample, e.g., as a fraction of the number of individual DNA strands of DNA in a sample that are methylated at one or more specific methylated loci (e.g., one or more specific DMRs). Those skilled in the art will understand that in some cases, the fraction or percentage of methylation can be calculated from, for example, the ratio of methylated DMRs to unmethylated DMRs of one or more analyzed DMRs within a sample.

[0171] In various embodiments, the methylation status of one or more methylated loci (e.g., one or more DMRs) is compared to a reference methylation status value and / or to the methylation status of one or more methylated loci (e.g., one or more DMRs) in a reference sample. In some cases, the reference is a non-concurrent sample from the same source, e.g., a previous sample from the same source, e.g., from the same subject. In some cases, the reference for the methylation status of one or more methylated loci (e.g., one or more DMRs) is a sample (e.g., a sample from a subject) or the methylation status of one or more methylated loci (e.g., one or more DMRs) in multiple samples that is known to represent a particular state (e.g., a cancerous state or a non-cancerous state). Thus, the reference can be or include one or more predetermined thresholds, which can be quantitative (e.g., a methylation value) or qualitative. In some cases, the reference for the DMR methylation status is the methylation status of one nucleotide or more nucleotides (e.g., multiple contiguous oligonucleotides) present in the same sample that does not include the nucleotides of the DMR. Those skilled in the art will understand that reference measurements are typically generated by measuring using the same, similar, or equivalent methods as those used for non-reference measurements.

[0172] Without wishing to be bound by any particular scientific theory, Figure 20 a schematic illustration of one possible mechanism by which hypermethylation or hypomethylation of gene regulatory sequences can affect expression is provided. As Figure 20As shown, hypomethylation can lead to increased expression and / or hypermethylation can lead to expression inhibition. In various cases, compared to a reference, increased methylation in an expression regulatory region such as a promoter region and an enhancer region can reduce or silence the expression of an operably linked gene, such as the expression of an operably linked gene that generally functions to inhibit cancer. In various embodiments, compared to a reference, decreased methylation in an expression regulatory region such as a promoter region and an enhancer region can increase the expression of an operably linked gene, such as the expression of an operably linked gene having activity that contributes to tumorigenesis. Without being bound by any particular scientific theory, DNA methylation can provide an indicator of a cancer state that is more chemically and biologically stable than RNA expression or protein expression itself.

[0173] Methylation is generally considered to be highly tissue-specific, providing a dimension of information not necessarily present in DNA sequence analysis.

[0174] Methylation events that substantially contribute to tumorigenesis can occur, for example, in an expression regulatory region of DNA (such as in a promoter region, enhancer region, transcription factor binding site, CTCF binding site, CpG island, or other sequence) that is operably linked to a cancer-related gene (such as a gene that generally functions to inhibit cancer). Thus, inactivation of a gene that is normally used to inhibit cancer leads to or contributes to tumorigenesis. In addition, hypermethylation commonly occurs in CpG islands.

[0175] Cancer

[0176] The methods and compositions of the present disclosure can be used to screen for cancer, particularly colorectal cancer. Colorectal cancer includes, but is not limited to, colon cancer, rectal cancer, and combinations thereof. Colorectal cancer includes metastatic colorectal cancer and non-metastatic colorectal cancer. Colorectal cancer includes cancers proximal to the colon and cancers distal to the colon.

[0177] Colorectal cancer includes colorectal cancer at any of the various possible stages known in the art, including, for example, stage I, II, III, and IV colorectal cancer (e.g., stages 0, I, IIA, IIB, IIC, IIIA, IIIB, IIIC, IVA, IVB, and IVC). Colorectal cancer includes all stages of the tumor / node / metastasis (TNM) staging system. For colorectal cancer, T can refer to whether the tumor has grown into the wall of the colon or rectum and, if so, how many layers; N can refer to whether the tumor has spread to the lymph nodes, and if so, how many lymph nodes and where they are located; and M can refer to whether the cancer has spread to other parts of the body and, if so, to which parts and to what extent. The specific stages of T, N, and M are known in the art. The T stage can include TX, T0, Tis, T1, T2, T3, T4a, and T4b; the N stage can include NX, N0, N1a, N1b, N1c, N2a, and N2b; and the M stage can include M0, M1a, and M1b. In addition, the grade of colorectal cancer can include GX, G1, G2, G3, and G4. The various means of staging cancer, particularly colorectal cancer, are well known in the art, such as those summarized at cancer.net / cancer-types / colorectal-cancer / stages on the World Wide Web.

[0178] In some cases, the present disclosure includes screening for early-stage colorectal cancer. Early-stage colorectal cancer can include, for example, colorectal cancer located within a subject, e.g., because it has not spread to the lymph nodes of the subject, such as the lymph nodes near the cancer (stage N0), and has not spread to distal sites (stage M0). Early-stage cancer includes colorectal cancer corresponding to, for example, stages 0 to II C.

[0179] Thus, the colorectal cancer of the present disclosure particularly includes pre-malignant colorectal cancer and malignant colorectal cancer. The methods and compositions of the present disclosure can be used to screen for all forms and stages of colorectal cancer, including but not limited to those named herein or known in the art, and all of its subgroups. Thus, those skilled in the art will understand that all references to colorectal cancer provided herein include but are not limited to all forms and stages of colorectal cancer, including but not limited to those named herein or known in the art, and all of its subgroups.

[0180] Subjects and Samples

[0181] Samples analyzed using the methods and compositions provided herein can be any biological sample and / or any sample, including nucleic acids. In various specific embodiments, the sample analyzed using the methods and compositions provided herein can be a sample from a mammal. In various specific embodiments, the sample analyzed using the methods and compositions provided herein can be a sample from a human subject. In various specific embodiments, the sample analyzed using the methods and compositions provided herein can be a sample from a mouse, rat, pig, horse, chicken, or cow.

[0182] In various cases, the human subject is a subject diagnosed or seeking a diagnosis of having cancer (e.g., colorectal cancer), a subject diagnosed as or seeking a diagnosis of being at risk of having cancer (e.g., colorectal cancer), and / or a subject diagnosed as or seeking a diagnosis of being at direct risk of having cancer (e.g., colorectal cancer). In various cases, the human subject is a subject identified as in need of colorectal cancer screening. In some cases, the human subject is a subject identified as in need of colorectal cancer screening by a practicing physician. In various cases, the human subject is identified as in need of colorectal cancer screening due to age, e.g., due to an age equal to or greater than 50 years, e.g., an age equal to or greater than 50, 55, 60, 65, 70, 75, 80, 85, or 90 years. In various cases, the human subject is a subject not diagnosed with cancer (e.g., colorectal cancer), not at risk of having cancer (e.g., colorectal cancer), or not at direct risk of having cancer (e.g., colorectal cancer), a subject not diagnosed with cancer (e.g., colorectal cancer), and / or a subject not attempting to diagnose cancer (e.g., colorectal cancer), or any combination thereof.

[0183] Samples from a subject such as a human or other mammalian subject can be, for example, samples of blood, blood components, cfDNA, ctDNA, feces, or colorectal tissue. In some specific embodiments, the sample is an excretory product or body fluid of the subject (e.g., the subject's feces, blood, lymph fluid, or urine) or a colorectal cancer tissue sample. Samples from a subject can be cell or tissue samples, e.g., cell or tissue samples having cancer or including cancer cells (e.g., having tumor or metastatic tissue). In various embodiments, samples from a subject such as a human or other mammalian subject can be obtained by biopsy (e.g., fine needle aspiration or tissue biopsy) or surgery.

[0184] In various specific embodiments, the sample is a cell-free DNA (cfDNA) sample. CfDNA typically exists in the form of short double-stranded fragments in human biological fluids (such as plasma, serum, or urine). The concentration of cfDNA is usually very low, but it can increase significantly under certain conditions, including but not limited to pregnancy, autoimmune diseases, myocardial infarction, and cancer. Circulating tumor DNA (ctDNA) is a component of circulating DNA that specifically originates from cancer cells. CtDNA can be present in human biological fluids, either bound or unbound to white blood cells and red blood cells. Various tests for detecting tumor-derived cfDNA are based on the detection of genetic or epigenetic modifications characteristic of cancer (such as related cancers). Genetic or epigenetic modifications characteristic of cancer can include but are not limited to oncogenic mutations or cancer-related mutations in tumor suppressor genes, activated oncogenes, hypermethylation, and / or chromosomal disorders. Detecting genetic or epigenetic modifications characteristic of cancer can confirm that the detected cfDNA is ctDNA.

[0185] CfDNA and ctDNA can provide a real-time or near-real-time indicator of the methylation status of the source tissue. The half-life of cfDNA and ctDNA in the blood is approximately 2 hours, so a sample collected at a given time can relatively promptly reflect the status of the source tissue.

[0186] Various methods for isolating nucleic acids from a sample (such as isolating cfDNA from blood or plasma) are known in the art. Nucleic acids can be isolated by, for example but not limited to, standard DNA purification techniques, by direct gene capture (such as by clarifying the sample to remove test inhibitors and capturing the target nucleic acid (if present) from the clarified sample with a capture agent to produce a capture complex, and separating the capture complex to recover the target nucleic acid).

[0187] Methods for measuring methylation status

[0188] The methylation status can be measured by various methods known in the art and / or by the methods provided herein. Those skilled in the art will understand that methods for measuring methylation status are generally applicable to samples from any source and of any type, and will further understand the processing steps that can be used to modify a sample into a form suitable for measurement by the following methods. Methods for measuring methylation status include but are not limited to methods including methylation status-specific polymerase chain reaction (PCR), methods including nucleic acid sequencing, methods including mass spectrometry, methods including methylation-specific nucleases, methods including mass-based separation, methods including target-specific capture, and methods including methylation-specific oligonucleotide primers. Certain specific tests for methylation use bisulfite reagents (such as bisulfite ions).

[0189] Bisulfite reagents may particularly include bisulfite, disulfite, hydrogen sulfite, or combinations thereof, etc. These reagents can be used to distinguish methylated and unmethylated nucleic acids. Bisulfite interacts differently with cytosine and 5-methylcytosine. In a typical bisulfite-based method, contacting DNA with bisulfite causes deamination of unmethylated cytosine to uracil, while methylated cytosine remains unaffected; methylated cytosine is selectively retained rather than unmethylated cytosine. Thus, in a bisulfite-treated sample, uracil residues replace unmethylated cytosine residues and thus provide an identification signal for unmethylated cytosine residues, while the remaining (methylated) cytosine residues thus provide an identification signal for methylated cytosine residues. The bisulfite-treated sample can be analyzed, for example, by PCR.

[0190] Various methylation testing procedures can be used in combination with bisulfite treatment to determine the methylation status of target sequences such as DMRs. Such tests may particularly include methylation-specific restriction enzyme qPCR, sequencing of bisulfite-treated nucleic acids, PCR (e.g., using sequence-specific amplification), methylation-specific nuclease-assisted small allele enrichment PCR, and methylation-sensitive high-resolution melting. In some embodiments, the DMR is amplified from a bisulfite-treated DNA sample, and a DNA sequencing library is prepared for sequencing according to, for example, the Illumina protocol or the transposon-based Nextera XT protocol. In certain embodiments, high-throughput and / or next-generation sequencing technologies are used to achieve base pair-level resolution of the DNA sequence, allowing analysis of the methylation status.

[0191] In various embodiments, the methylation status is detected by a method including PCR amplification using methylation-specific oligonucleotide primers (MSP method), for example, applied to bisulfite-treated samples (see, e.g., Herman 1992 Proc. Natl. Acad. Sci. USA 93:9821-9826, the method for determining methylation status of which is incorporated herein by reference). Amplifying bisulfite-treated DNA using methylation status-specific oligonucleotide primers can distinguish methylated and unmethylated nucleic acids. The oligonucleotide primer pairs for the MSP method include at least one oligonucleotide primer capable of hybridizing with a sequence including a methylation site (e.g., CpG). An oligonucleotide primer containing a T residue at a position complementary to a cytosine residue will selectively hybridize with a template in which cytosine was not methylated before bisulfite treatment, while an oligonucleotide primer containing a G residue at a position complementary to a cytosine residue will selectively hybridize with a template in which cytosine was methylated cytosine before bisulfite treatment. MSP results can be obtained with or without sequencing the amplicons, for example, using gel electrophoresis. MSP (methylation-specific PCR) allows for highly sensitive detection of locus-specific DNA methylation using PCR amplification of bisulfite-converted DNA (detection level of 0.1% alleles, with complete specificity).

[0192] Another method that can be used to determine the methylation status of a sample after bisulfite treatment is methylation-sensitive high-resolution melting (MS-HRM) PCR (see, e.g., Hussmann 2018 Methods Mol Biol.

[0193] 1708:551-571, the method for determining methylation status of which is incorporated herein by reference). MS-HRM is a PCR-based in-tube method that can detect the methylation level of a specific locus of interest based on hybridization melting. Bisulfite treatment of DNA before performing MS-HRM ensures different base compositions between methylated and unmethylated DNA, which is used to separate the resulting amplicons by high-resolution melting. Unique primer design promotes the high sensitivity of the test, capable of detecting as low as 0.1-1% methylated alleles in an unmethylated background. The oligonucleotide primers for the MS-HRM test are designed to be complementary to methylated alleles, and specific annealing temperatures enable these primers to anneal to both methylated and unmethylated alleles, thus enhancing the sensitivity of the test.

[0194] Another method that can be used to determine the methylation status after bisulfite treatment of a sample is quantitative multiplex methylation-specific PCR (QM-MSP). QM-MSP uses methylation-specific primer pairs to sensitively quantify DNA methylation (see, e.g., Fackler 2018 Methods Mol Biol. 1708:473-496, the methods for determining methylation status of which are incorporated herein by reference). QM-MSP is a two-step PCR method. In the first step, a pair of gene-specific primers (forward and reverse) simultaneously and multiplex amplify methylated and unmethylated copies of the same gene in one PCR reaction. After 36 PCR cycles, this methylation-independent amplification step can generate up to 10 9 copies per μL of amplicons. In the second step, real-time PCR and two independent fluorophores are used to detect methylated / unmethylated DNA of each gene in the same well (e.g., 6FAM and VIC), and the amplicons from the first reaction are quantified using a standard curve. One methylated copy can be detected in 100,000 reference gene copies.

[0195] Another method that can be used to determine the methylation status after bisulfite treatment of a sample is methylation-specific nuclease-assisted minor allele enrichment (MS-NaME) (see, e.g., Liu 2017 Nucleic Acids Res. 45(6):e39, the methods for determining methylation status of which are incorporated herein by reference). Ms-NaME is based on the selective hybridization of a probe to a target sequence in the presence of a DNA nuclease specific for double-stranded (ds) DNA (DSN), such that the hybridization generates regions of double-stranded DNA that are subsequently digested by DSN. Thus, oligonucleotide probes targeting unmethylated sequences generate local double-stranded regions, resulting in digestion of the unmethylated targets; oligonucleotide probes capable of hybridizing to methylated sequences generate local double-stranded regions, which result in digestion of the methylated targets, leaving the methylated targets intact. In addition, oligonucleotide probes can simultaneously direct DSN activity to multiple targets in bisulfite-treated DNA. Subsequent amplification can enrich the undigested sequences. Ms-NaME can be used alone or in combination with other techniques provided herein.

[0196] Another method that can be used to determine the methylation status after bisulfite treatment of a sample is methylation-sensitive single nucleotide primer extension (Ms-SNuPE TM)(See, e.g., Gonzalgo 2007 Nat Protoc. 2(8):1931-6, the method for determining methylation status of which is incorporated herein by reference). In Ms-SNuPE, strand-specific PCR is performed to generate a DNA template for quantitative methylation analysis using Ms-SNuPE. Then, SNuPE is performed with an oligonucleotide designed to hybridize immediately upstream of the interrogated CpG site. The reaction products can be electrophoresed on a polyacrylamide gel for visualization and quantification by phosphorimage analysis. The amplicons can also carry a directly or indirectly detectable label, such as a fluorescent label, a radioisotope, or a cleavable molecular fragment or other entity having a mass distinguishable by mass spectrometry. Detection can be performed and / or visualized by, for example, matrix-assisted laser desorption / ionization mass spectrometry (MALDI) or using electrospray ionization mass spectrometry (ESI).

[0197] Certain methods useful for determining methylation status after bisulfite treatment of a sample utilize a first oligonucleotide primer, a second oligonucleotide primer, and an oligonucleotide probe in an amplification-based method. For example, the oligonucleotide primers and probes can be used in methods of real-time polymerase chain reaction (PCR) or droplet digital PCR (ddPCR). In various cases, the first oligonucleotide primer, the second oligonucleotide primer, and / or the oligonucleotide probe selectively hybridize to methylated DNA and / or unmethylated DNA such that amplification or probe signal indicates the methylation status of the sample.

[0198] Other bisulfite-based methods for detecting methylation status (e.g., the presence of 5-methylcytosine levels) are disclosed, e.g., in Frommer (1992 Proc Natl Acad Sci U S A. 1; 89(5):1827-31, the method for determining methylation status of which is incorporated herein by reference).

[0199] Certain methods for determining methylation status do not include bisulfite treatment of the sample. For example, changes in methylation status can be detected by PCR-based methods in which DNA is digested with one or more methylation-sensitive restriction enzymes (MSREs) prior to PCR amplification (e.g., by MSRE-qPCR). Generally, MSREs have recognition sites that contain at least one CpG motif, and thus if the site contains 5-methylcytosine, the activity of the MSRE is blocked from cleaving the potential recognition site. (See, e.g., Beikircher 2018 Methods Mol Biol. 1708:407-424, which is incorporated herein by reference regarding methods for determining methylation status). Thus, MSREs selectively digest nucleic acids according to the methylation status of the MSRE recognition site; they can digest DNA at unmethylated MSRE recognition sites but not at methylated MSRE recognition sites. In certain embodiments, an aliquot of the sample can be digested with MSREs, producing a processed sample in which unmethylated DNA has been cleaved by the MSREs, such that the proportion of uncleaved and / or amplifiable DNA having at least one methylated site within the MSRE site recognition (e.g., at least one methylated site within each MSRE recognition site of a DNA molecule) is increased relative to uncleaved and / or amplifiable DNA that does not include at least one methylated site within the MSRE recognition site (e.g., does not include at least one methylated site within each MSRE recognition site of a DNA molecule). The uncleaved sequences of the restriction enzyme-digested sample can then be pre-amplified (e.g., by PCR) and quantified, e.g., by qPCR, real-time PCR, or digital PCR. Oligonucleotide primers for MSRE-qPCR amplify regions that include one or more MSRE cleavage sites and / or multiple MSRE cleavage sites. Amplicons that contain multiple MSRE cleavage sites are generally more likely to produce reliable results. The number of DMR amplicon cleavage sites, and in some cases the robustness of the determination of the DMR methylation status, can be increased by designing DMRs that contain multiple MSRE recognition sites (rather than a single recognition site) within the DMR amplicon. In various cases, multiple MSREs can be applied to the same sample, including, for example, more than two of AciI, Hin6I, HpyCH4IV, and HpaII (e.g., including AciI, Hin6I, and HpyCH4IV). Multiple MSREs (e.g., a combination of AciI, Hin6I, HpyCH4IV, and HpaII, or a combination of AciI, Hin6I, and HpyCH4IV) can provide an improved MSRE recognition site frequency within the DMR amplicon.

[0200] Given the low prevalence of cfDNA in blood, MSRE-qPCR can also include a pre-amplification step after digestion of the sample by MSRE but before qPCR to increase the amount of sample available.

[0201] In certain MSRE-qPCR embodiments, the amount of total DNA is measured in aliquots of the sample in its native (e.g., undigested) form using, for example, real-time PCR or digital PCR.

[0202] A variety of amplification techniques can be used alone or in combination with other techniques described herein to detect methylation status. Those skilled in the art will understand, upon reading this specification, how to combine the various amplification techniques known in the art and / or described herein with the various other techniques known in the art and / or provided herein for methylation status determination. Amplification techniques include, but are not limited to, PCR, such as quantitative PCR (qPCR), real-time PCR, and / or digital PCR. Those skilled in the art will understand that polymerase amplification can multiplex amplify multiple targets in a single reaction. The length of PCR amplicons is typically from 100 to 2000 base pairs. In various cases, the amplification techniques are sufficient to determine methylation status.

[0203] Digital PCR (dPCR)-based methods involve partitioning and distributing the sample into the wells of a plate having 96, 384, or more wells, or into individual emulsion droplets (ddPCR), e.g., using a microfluidic device, such that some wells contain one or more template copies and others do not. Thus, the average number of template molecules per well prior to amplification is less than 1. The number of wells in which template amplification occurs provides a measure of the template concentration. If the sample has been contacted with MSRE, the number of wells in which template amplification occurs provides a measure of the methylated template concentration.

[0204] In various embodiments, fluorescence-based real-time PCR assays, such as MethyLight TM , can be used to measure methylation status (see, e.g., Campan 2018 Methods Mol Biol. 1708:497-513, the test methods for methylation status of which are incorporated herein by reference). MethyLight is a fluorescence-based quantitative real-time PCR method that can sensitively detect and quantify DNA methylation in genomic candidate regions. MethyLight is particularly suitable for detecting low-frequency methylated DNA regions in the high background of unmethylated DNA because it combines methylation-specific priming and methylation-specific fluorescence detection. In addition, MethyLight can be used in combination with digital PCR for highly sensitive detection of individual methylated molecules for disease detection and screening.

[0205] A real-time PCR-based method for determining methylation status typically includes the step of generating a standard curve of unmethylated DNA based on the analysis of an external standard. The standard curve can be constructed from at least two points, and the real-time Ct value of the digested DNA and / or the real-time Ct value of the undigested DNA can be compared with a known quantitative standard. In certain cases, the sample Ct value of the MSRE-digested and / or undigested sample or sample aliquot can be determined, and the genomic equivalent of the DNA can be calculated from the standard curve. The Ct values of the MSRE-digested and undigested DNA can be evaluated to identify the digested amplicons (e.g., efficient digestion; e.g., resulting in a Ct value of 45). Amplicons that are not amplified under digested or undigested conditions can also be identified. The corrected Ct values of the amplicons of interest can then be directly compared across conditions to determine the relative differences in methylation status between the conditions. Alternatively or in addition, the delta difference between the Ct values of the digested and undigested DNA can be used to determine the relative differences in methylation status between the conditions.

[0206] Methods for measuring methylation status can include, but are not limited to, massively parallel sequencing (e.g., next-generation sequencing) to determine methylation status, such as synthesis sequencing, real-time (e.g., single molecule) sequencing, bead emulsion sequencing, nanopore sequencing, or other sequencing techniques known in the art. In some embodiments, methods for measuring methylation status can include whole-genome sequencing, e.g., with base pair resolution.

[0207] In certain specific embodiments, MSRE-qPCR, as well as other techniques, can be used to determine the methylation status of colorectal cancer methylation biomarkers that are or include a single methylated locus. In certain specific embodiments, MSRE-qPCR, as well as other techniques, can be used to determine the methylation status of colorectal cancer methylation biomarkers that are or include more than two methylated loci. In certain specific embodiments, MSRE-qPCR, as well as other techniques, can be used to determine the methylation status of colorectal cancer methylation biomarkers that are or include a single differentially methylated region (DMR). In certain specific embodiments, MSRE-qPCR, as well as other techniques, can be used to determine the methylation status of colorectal cancer methylation biomarkers that are or include more than two DMRs. In certain specific embodiments, MSRE-qPCR, as well as other techniques, can be used to determine the methylation status of colorectal cancer methylation biomarkers that are or include a single methylation site. In certain specific embodiments, MSRE-qPCR, as well as other techniques, can be used to determine the methylation status of colorectal cancer methylation biomarkers that are or include more than two methylation sites. In various embodiments, the colorectal cancer methylation biomarker can be any colorectal cancer methylation biomarker provided herein. The present disclosure particularly includes oligonucleotide primer pairs for amplifying DMRs, e.g., for amplifying the DMRs identified in Table 7.

[0208] In certain specific embodiments, the cfDNA sample is derived from a subject's plasma and contacted with an MSRE, which is or includes one or more of AciI, Hin6I, HpyCH4IV, and HpaII (e.g., AciI, Hin6I, and HpyCH4IV). The digested sample can be pre-amplified with oligonucleotide primer pairs for one or more DMRs, such as one or more of the oligonucleotide primer pairs provided in Table 13. The digested DNA, e.g., the pre-amplified digested DNA, can be quantified with oligonucleotide primer pairs for one or more DMRs using qPCR, e.g., using one or more of the oligonucleotide primer pairs provided in Table 13. The qPCR ct value can then be determined and used to determine the methylation status of each DMR amplicon.

[0209] Those skilled in the art will understand that the oligonucleotide primer pairs provided in Table 13 can be used in any combination of colorectal cancer methylation biomarkers identified herein. Those skilled in the art will realize that the oligonucleotide primer pairs of Table 2 can be included or not included individually in a given assay to analyze a particularly desired DRM combination.

[0210] Those skilled in the art will further understand that while other oligonucleotide primer pairs can be used, it is important to select and pair oligonucleotide primers to produce useful DMR amplicons and represents a substantial contribution.

[0211] Those skilled in the art will further understand that the methods, reagents, and protocols of qPCR are well known in the art. Different from traditional PCR, qPCR is capable of detecting amplicons generated over time during the amplification process (e.g., at the end of each amplification cycle), typically by using an amplification-responsive fluorescence system, e.g., in combination with a thermal cycler having fluorescence detection capabilities. Two common types of fluorescent reporters used in qPCR include (i) double-stranded DNA-binding dyes, which fluoresce more brightly when bound than when unbound; (ii) labeled oligonucleotides (e.g., labeled oligonucleotide primers or labeled oligonucleotide probes).

[0212] Those skilled in the art will understand that in embodiments where the methylation status of multiple methylation loci (e.g., multiple DMRs) is analyzed by the colorectal cancer screening method provided herein, the methylation status of each methylation locus can be measured or represented in any of a variety of forms, and the methylation status of multiple methylation loci (preferably each measured and / or represented in the same, similar, or comparable manner) can be analyzed or represented together or cumulatively in any of a variety of forms. In various embodiments, the methylation status of each methylation locus can be measured as a ct value. In various embodiments, the methylation status of each methylation locus can be represented as the difference in ct values between the measured sample and a reference. In various embodiments, the methylation status of each methylation locus can be represented as a qualitative comparison to a reference, e.g., by identifying each methylation locus as hypermethylated or not hypermethylated.

[0213] In some embodiments in which a single methylated locus is analyzed, hypermethylation of the single methylated locus constitutes a diagnosis that the subject has or may have colorectal cancer, while the absence of hypermethylation of the single methylated locus constitutes a diagnosis that the subject likely does not have colorectal cancer. In some embodiments, hypermethylation of a single methylated locus (e.g., a single DMR) among multiple analyzed methylated loci constitutes a diagnosis that the subject has or may have colorectal cancer, while the absence of hypermethylation at any of the methylated loci among the multiple analyzed methylated loci constitutes a diagnosis that the subject likely does not have colorectal cancer. In some embodiments, a determined percentage (e.g., a predetermined percentage) (e.g., at least 10% (e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100%)) of the methylated loci among the multiple analyzed methylated loci constitutes a diagnosis that the subject has or may have colorectal cancer, while the absence of a determined percentage (e.g., a predetermined percentage) (e.g., at least 10% (e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100%)) of the methylated loci among the multiple analyzed methylated loci constitutes a diagnosis that the subject is unlikely to have colorectal cancer. In some embodiments, hypermethylation of a determined number (e.g., a predetermined number) of methylated loci (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 DMRs) among multiple analyzed methylated loci (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 DMRs) constitutes a diagnosis that the subject has or may have colorectal cancer, while the absence of hypermethylation of a determined number (e.g., a predetermined number) of methylated loci (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 DMRs) among multiple analyzed methylated loci (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 DMRs) constitutes a diagnosis that the subject is unlikely to have colorectal cancer.

[0214] In some embodiments, the methylation status of multiple methylation loci (e.g., multiple DMRs) is qualitatively or quantitatively measured, and the measurements of each of the multiple methylation loci are combined to provide a diagnosis. In some embodiments, the qualitative methylation status of the quantitative measurement of each of the multiple methylation loci is individually weighted, and the weighted values are combined to provide a single value that can be compared to a reference to provide a diagnosis. To provide just one example of such a method, a support vector machine (SVM) algorithm can be used to analyze the methylation status of the multiple methylation loci of the present disclosure to generate a diagnosis. At least one goal of the support vector machine algorithm is to identify a hyperplane in an N-dimensional space (N - the number of features) that clearly classifies the data points, with the goal of finding a plane with the maximum margin, i.e., the maximum distance between two classes of data points. As discussed in this example, the SVM model is built on labeled values (e.g., ct values) derived from a set of training samples (e.g., a first group of subjects and / or a second group of subjects), which are transformed into support vector values when making predictions. When applying the SVM model to a new sample, the sample will be mapped into the vector space of the model and classified as having a probability of belonging to a first condition or a second condition, e.g., based on the position of each new sample relative to the gap between the two conditions. Those skilled in the art will understand that once the relevant compositions and methods are determined, the vector values can be used in conjunction with the SVM algorithm defined by the predict() function of the R-package (see Hypertext Transfer Protocol Secure (HTTPS): / / cran.r-project.org / web / packages / e1071 / index.html, the SVM of which is hereby incorporated by reference) to easily generate predictions for new samples. Thus, using the compositions and methods for colorectal cancer diagnosis disclosed herein (and only then), it will be straightforward to generate a prediction model of the predict() function of the R-package (see Hypertext Transfer Protocol Secure (HTTPS): / / cran.r-project.org / web / packages / e1071 / index.html, the SVM of which is hereby incorporated by reference) using algorithm input information combinations to provide a colorectal cancer diagnosis. For example, a non-limiting example of SVM vectors for diagnosing colorectal cancer by analyzing the methylation status of the multiple DMRs provided herein is provided in Table 17. Those skilled in the art will understand that, using the present disclosure at hand, the generation of SVM vectors can be accomplished according to the methods provided herein as well as other methods known in the art.

[0215] Table 13: Colorectal cancer DMR oligonucleotide primer pairs, e.g., for MSRE-qPCR

[0216]

[0217]

[0218] Application

[0219] The methods and compositions of the present disclosure can be used in any of a variety of applications. For example, the methods and compositions of the present disclosure can be used to screen for or assist in screening for colorectal cancer. In various circumstances, screening using the methods and compositions of the present disclosure can detect colorectal cancer at any stage, including but not limited to early-stage colorectal cancer. In some embodiments, colorectal cancer screening using the methods and compositions of the present disclosure is applicable to individuals over 50 years of age, such as 50, 55, 60, 65, 70, 75, 80, 85, or 90 years of age or older. In some embodiments, colorectal cancer screening using the methods and compositions of the present disclosure is applicable to individuals over 20 years of age, such as 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or 90 years of age or older. In some embodiments, colorectal cancer screening using the methods and compositions of the present disclosure is applicable to individuals between 20 and 50 years of age, such as between 20 and 30 years of age, between 20 and 40 years of age, between 20 and 50 years of age, between 30 and 40 years of age, between 30 and 50 years of age, or between 40 and 50 years of age. In various embodiments, colorectal cancer screening using the methods and compositions of the present disclosure is applicable to individuals experiencing abdominal pain or discomfort, such as individuals experiencing undiagnosed or incompletely diagnosed abdominal pain or discomfort. In various embodiments, colorectal cancer screening using the methods and compositions of the present disclosure is applicable to individuals without symptoms that may be associated with colorectal cancer. Thus, in certain embodiments, colorectal cancer screening using the methods and compositions of the present disclosure is fully or partially preventive or prophylactic, at least with respect to advanced or non-early-stage colorectal cancer.

[0220] In various embodiments, colorectal cancer screening using the methods and compositions of the present disclosure can be applied to asymptomatic human subjects. As used herein, a subject can be referred to as "asymptomatic" if the subject does not report and / or demonstrate sufficient characteristics of colorectal cancer to support a medically reasonable suspicion that the subject may have colorectal cancer and / or cancer through non-invasive observable markers (e.g., without any, several, or all device-based detections, tissue sample analyses, body fluid analyses, surgeries, or colorectal cancer screenings). Early-stage colorectal cancer is particularly likely to be detected in asymptomatic individuals screened according to the methods and compositions of the present disclosure.

[0221] In various embodiments, colorectal cancer screening using the methods and compositions of the present disclosure can be applied to symptomatic human subjects. As used herein, a subject can be termed "symptomatic" if the subject reports and / or demonstrates sufficient characteristics of colorectal cancer to support a medically reasonable suspicion that the subject may have colorectal cancer and / or cancer through non-invasive observable markers (e.g., without device-based detection, tissue sample analysis, body fluid analysis, surgery, or colorectal cancer screening). Symptoms of colorectal cancer can include, but are not limited to, persistent (e.g., lasting more than 3 days) changes in bowel habits (diarrhea, constipation, or narrowing of the stool), the feeling of needing to have a bowel movement (which is not relieved after having a bowel movement), rectal bleeding (e.g., bright red blood), blood in the stool (which can cause the stool to appear black), abdominal cramps, abdominal pain, weakness, fatigue, unexpected weight loss, anemia, and combinations thereof. Those skilled in the art will understand that individual symptoms that do not alone indicate or raise suspicion of colorectal cancer may indicate or raise such suspicion when present in combination (e.g., for purposes of providing, but not limiting, an example, the combination of abdominal cramps and blood in the stool).

[0222] Those skilled in the art will understand that regular, preventive, and / or prophylactic screening for colorectal cancer improves the diagnosis of colorectal cancer, including and / or especially early-stage cancer. As noted above, according to at least one cancer staging system, early-stage cancer includes stages 0 to IIC of colorectal cancer. Accordingly, the present disclosure particularly provides methods and compositions suitable for the diagnosis and treatment of early-stage colorectal cancer. Generally, especially in embodiments where colorectal cancer screening is performed annually according to the present disclosure and / or where the subject is asymptomatic at the time of screening, the methods and compositions of the present invention are particularly likely to detect early-stage colorectal cancer.

[0223] In various embodiments, colorectal cancer screening according to the present disclosure is performed one or more times on a given subject. In various embodiments, colorectal cancer screening is performed regularly according to the present disclosure, such as every six months, annually, biennially, triennially, quadrennially, quinquennially, or decennially.

[0224] In various embodiments, colorectal cancer screening using the methods and compositions disclosed herein will provide a diagnosis of colorectal cancer. In other instances, colorectal cancer screening using the methods and compositions disclosed herein will indicate a diagnosis of colorectal cancer but will not establish a diagnosis of colorectal cancer. In various instances of screening for colorectal cancer using the methods and compositions of the present disclosure, a further diagnostic confirmation test can be performed after screening using the methods and compositions of the present disclosure, and the further diagnostic confirmation test can confirm, support, undermine, or refute the diagnosis generated by a previous screening (e.g., a screening according to the present disclosure). As used herein, a diagnostic confirmation test can be a colorectal cancer test that provides a diagnosis that is recognized by a practicing physician as definitive, such as a diagnosis based on a colonoscopy, or a colorectal cancer test that significantly increases or decreases the likelihood that a previous diagnosis is correct, e.g., a diagnosis generated by a screening according to the present disclosure. Diagnostic confirmation tests can include existing screening techniques that generally require improvement in one or more of sensitivity, specificity, and non-invasiveness, particularly in detecting early colorectal cancer.

[0225] In some cases, the diagnostic confirmation test is a test that is or includes a visual or structural examination of a subject's tissue, such as by colonoscopy. In some embodiments, the colonoscopy includes or is followed by a histological analysis. The visual and / or structural test for colorectal cancer can include examining the structure of the colon and / or rectum for any abnormal tissue and / or structure. For example, a visual and / or structural examination can be performed using an endoscope through the rectum or by CT scan. In some cases, the diagnostic confirmation test is a colonoscopy, e.g., including or followed by a histological analysis. According to some reports, colonoscopy is currently the primary and / or most relied-upon diagnostic confirmation test.

[0226] Another visual and / or structural diagnostic confirmation test based on computed tomography (CT) is CT colonography, sometimes also referred to as virtual colonoscopy. The CT scan utilizes a large number of X-ray images of the colon and / or rectum to generate a dimensional representation of the colon. Although available as a diagnostic confirmation test, some reports suggest that CT colonography is not sufficient to replace colonoscopy, at least in part because the physician does not have actual access to the subject's colon to obtain tissue for histological analysis.

[0227] Another diagnostic confirmation test can be sigmoidoscopy. In sigmoidoscopy, a sigmoidoscope is used to image a portion of the colon and / or rectum through the rectum. According to some reports, sigmoidoscopy has not been widely used.

[0228] In some cases, diagnostic confirmation tests are fecal-based tests. Generally, when fecal-based tests are used in place of visual or structural examinations, they are recommended to be used at a higher frequency than that required for visual or structural examinations. In some cases, diagnostic confirmation tests are guaiac-based fecal occult blood tests or fecal immunochemical tests (gFOBTs / FITs) (see, e.g., Navarro 2017 World J Gastroenterol. 23(20):3632-3642, which is incorporated herein by reference regarding colorectal cancer testing). FOBTs and FITs are sometimes used to diagnose colorectal cancer (see, e.g., Nakamura 2010 J Diabetes Investig. Oct 19;1(5):208-11, which is incorporated herein by reference regarding colorectal cancer testing). FIT is based on the detection of occult blood in feces, and the presence of occult blood generally indicates colorectal cancer, but usually in amounts insufficient to be identified by the naked eye. For example, in a typical FIT, the test utilizes a hemoglobin-specific reagent to test for occult blood in a fecal sample. In various cases, FIT kits are suitable for personal use at home. When used without other diagnostic confirmation tests, it is recommended to use FIT once a year. Generally, FIT is not relied upon to provide sufficient diagnostic information for a conclusive diagnosis of colorectal cancer.

[0229] Diagnostic confirmation tests also include gFOBT, which is designed to detect occult blood in feces through a chemical reaction. Like FIT, when used without other diagnostic confirmation tests, it may be recommended to use gFOBT once a year. Generally, gFOBT is not relied upon to provide sufficient diagnostic information for a conclusive diagnosis of colorectal cancer.

[0230] Diagnostic confirmation tests can also include fecal DNA testing. Fecal DNA testing for colorectal cancer can be designed to identify DNA sequence characteristics of cancer in a fecal sample. If used without other diagnostic confirmation tests, it is recommended to use fecal DNA testing once every three years. Generally, fecal DNA testing is not relied upon to provide sufficient diagnostic information for a conclusive diagnosis of colorectal cancer.

[0231] A particular screening technique is a fecal-based screening test ( (Exact Sciences Corporation, Madison, WI, United States), which combines FIT analysis with analysis of abnormal modifications of DNA (such as mutations and methylation). Testing has shown improved sensitivity compared to FIT testing alone, but may be clinically impractical or ineffective due to low compliance rates, which are at least in part due to subject dislike of fecal-based testing (see, e.g., doi:10.1056 / NEJMc1405215 (e.g., 2014 N Engl J Med. 371(2):184-188)). Testing appears to exclude almost half of the eligible population from the screening program (see, e.g., van der Vlugt 2017 Br J Cancer. 116(1):44-49). Use of screening as provided herein (e.g., by blood-based assays) will increase the number of individuals selecting to screen for colorectal cancer (see, e.g., Adler 2014 BMC Gastroenterol. 14:183; Liles 2017 Cancer Treatment and Research Communications 10:27-31). As is currently known, only one existing colorectal cancer screening technology, Epiprocolon, has received FDA approval and CE-IVD clearance, and is blood-based. Epiprocolon is based on hypermethylation of the SEPT9 gene. The Epiprocolon test has low accuracy for colorectal cancer detection, with a sensitivity of 68% and a sensitivity for advanced adenomas of only 22% (see, e.g., Potter 2014 Clin Chem. 60(9):1183-91). There is a particular need in the art for a non-invasive colorectal cancer screening that can achieve high subject compliance and has high and / or improved specificity and / or sensitivity.

[0232] In various embodiments, screening according to the methods and compositions of the present disclosure reduces colorectal cancer mortality, e.g., by early colorectal cancer diagnosis. Data support that colorectal cancer screening reduces colorectal cancer mortality, and this effect has persisted for over 30 years (see, e.g., Shaukat 2013 N Engl J Med. 369(12):1106-14). In addition, colorectal cancer is particularly difficult to treat, at least in part because colorectal cancer that is not screened in a timely manner may not be detected until the cancer has passed the early stage. At least for this reason, treatment of colorectal cancer is often unsuccessful. To maximize the improvement in colorectal cancer outcomes for the entire population, utilization of screening according to the present disclosure can be paired with, e.g., recruitment of eligible subjects to ensure widespread screening.

[0233] In various embodiments, colorectal cancer screening that includes one or more of the methods and / or compositions disclosed herein is followed by treatment of colorectal cancer, such as treatment of early-stage colorectal cancer. In various embodiments, treatment of colorectal cancer, such as early-stage colorectal cancer, includes administering a treatment regimen that includes one or more of surgery, radiation therapy, and chemotherapy. In various embodiments, treatment of colorectal cancer, such as early-stage colorectal cancer, includes administering a treatment regimen that includes one or more of the treatments provided herein for treating stage 0 colorectal cancer, stage I colorectal cancer, and / or stage II colorectal cancer.

[0234] In various embodiments, treatment of colorectal cancer includes treating early-stage colorectal cancer, such as stage 0 colorectal cancer or stage I colorectal cancer, by one or more of: surgical removal of the cancerous tissue (e.g., by local excision (e.g., by colonoscopy), partial colectomy, or total colectomy).

[0235] In various embodiments, treatment of colorectal cancer includes treating early-stage colorectal cancer, such as stage II colorectal cancer, by one or more of: surgical removal of the cancerous tissue (e.g., by local excision (e.g., by colonoscopy), partial colectomy, or total colectomy), surgical removal of lymph nodes near the identified colorectal cancer tissue, and chemotherapy (e.g., administering 5-FU and leucovorin, oxaliplatin, or capecitabine).

[0236] In various embodiments, treatment of stage III colorectal cancer includes treating by one or more of: surgical removal of the cancerous tissue (e.g., by local excision (e.g., by colonoscopy-based resection), partial colectomy, or total colectomy), surgical removal of lymph nodes near the identified colorectal cancer tissue, and chemotherapy (e.g., administering one or more of 5-FU and leucovorin, oxaliplatin, or capecitabine, such as in the following combinations: (i) 5-FU and leucovorin, (ii) 5-FU, leucovorin, and oxaliplatin (e.g., FOLFOX), or (iii) capecitabine and oxaliplatin (e.g., CAPEOX)) and radiation therapy.

[0237] In various embodiments, the treatment of colorectal cancer includes treating stage IV colorectal cancer by one or more of the following: surgical resection of cancerous tissue (e.g., by local excision (e.g., by colonoscopy-based resection), partial colectomy, or total colectomy), surgical resection of lymph nodes near the identified colorectal cancer tissue, surgical resection of metastases, chemotherapy (e.g., administration of one or more of 5-FU, leucovorin, oxaliplatin, capecitabine, irinotecan, VEGF-targeted therapeutic agents (e.g., bevacizumab, aflibercept, or ramucirumab), EGFR-targeted therapeutic agents (e.g., cetuximab or panitumumab), regorafenib, trifluridine and tipiracil, such as in the following combinations: (i) 5-FU and leucovorin, (ii) 5-FU, leucovorin, and oxaliplatin (e.g., FOLFOX), (iii) capecitabine and oxaliplatin (e.g., CAPEOX), and (v) fluorouracil and tipiracil (Lonsurf)), radiotherapy, hepatic artery infusion (e.g., if the cancer has metastasized to the liver), tumor ablation, tumor embolization, colonic stent, colectomy, colostomy (e.g., diversion colostomy), and immunotherapy (e.g., pembrolizumab).

[0238] The treatment of colorectal cancer provided herein can be used by a person skilled in the art, alone or in any combination, in any order, regimen, and / or treatment procedure, for example, as determined by a practicing physician. A person skilled in the art will further understand that advanced treatment options may be applicable to early-stage cancers in subjects previously affected by cancer or colorectal cancer, e.g., subjects diagnosed with recurrent colorectal cancer.

[0239] In some embodiments, the methods and compositions for colorectal cancer screening provided herein can inform treatment and / or payment (e.g., reimbursement or reduction of the cost of healthcare, e.g., screening or treatment) decisions and / or actions made, for example, by an individual, a healthcare institution, a healthcare practitioner, a health insurance provider, a government agency, or other parties interested in healthcare costs.

[0240] In some embodiments, the methods and compositions for colorectal cancer screening provided herein can inform decisions related to whether a health insurance provider will reimburse (or not) a healthcare payer or recipient for healthcare costs, e.g., for (1) the screening itself (e.g., reimbursement for screening, unless unavailable, only for regular / periodic screening, or only for screening motivated by a temporary and / or incidental reason); and / or for (2) treatment, including, e.g., initiating, maintaining, and / or changing treatment based on the screening results. For example, in some embodiments, the methods and compositions for colorectal cancer screening provided herein serve as a basis for, contribute to, or support the determination of whether reimbursement or cost reduction will be provided to a healthcare payer or recipient. In some cases, the party seeking reimbursement or cost reduction can provide the results of a screening conducted in accordance with this specification and a request for such reimbursement or cost reduction of healthcare costs. In certain cases, the party making the decision on whether to provide reimbursement or cost reduction for medical expenses will make the decision based, in whole or in part, on receiving and / or reviewing the results of a screening conducted in accordance with this specification.

[0241] To avoid any doubt, those skilled in the art will understand from this disclosure that the methods and compositions of this specification for colorectal cancer diagnosis are for in vitro use at least. Accordingly, all aspects and embodiments of this disclosure can be carried out and / or used at least in vitro.

[0242] Kit

[0243] The present disclosure particularly includes kits that include one or more of the compositions for colorectal cancer screening provided herein, optionally in combination with instructions for their use in colorectal cancer screening. In various embodiments, a kit for colorectal cancer screening can include one or more of the following: one or more oligonucleotide primers (e.g., one or more oligonucleotide primer pairs, e.g., as shown in Table 13), one or more MSREs, one or more reagents for qPCR (e.g., reagents sufficient to complete a qPCR reaction mixture, including but not limited to dNTPs and polymerase), and instructions for use of one or more components of the kit for colorectal cancer screening. In various embodiments, a kit for colorectal cancer screening can include one or more of the following: one or more oligonucleotide primers (e.g., one or more oligonucleotide primer pairs, e.g., as shown in Table 13), one or more bisulfite reagents, one or more reagents for qPCR (e.g., reagents sufficient to complete a qPCR reaction mixture, including but not limited to dNTPs and polymerase), and instructions for use of one or more components of the kit for colorectal cancer screening.

[0244] In some embodiments, the kits of the present disclosure include at least one oligonucleotide primer pair for amplifying a methylated locus and / or DMR as disclosed herein.

[0245] In some cases, the kits of the present disclosure include one or more oligonucleotide primer pairs for amplifying one or more methylated loci of the present disclosure. In some cases, the kits of the present disclosure include one or more oligonucleotide primer pairs for amplifying one or more methylated loci, where the one or more methylated loci are or include all or part of one or more of the genes provided in Table 1. In some specific cases, the kits of the present disclosure include oligonucleotide primer pairs for multiple methylated loci, each methylated locus being or including all or part of the genes identified in Table 1, and the multiple methylated loci including, for example, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 methylated loci, such as provided in any one of Tables 1 to 6.

[0246] In some cases, the kits of the present disclosure include one or more oligonucleotide primer pairs for amplifying one or more DMRs of the present disclosure. In some cases, the kits of the present disclosure include one or more oligonucleotide primer pairs for amplifying one or more DMRs, where the DMRs are or include all or part of the genes identified in Table 1 or within the genes identified in Table 1. In some specific embodiments, the kits of the present disclosure include oligonucleotide primer pairs for multiple DMRs, each DMR being or including all or part of the genes identified in Table 1 or within the genes identified in Table 1, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 DMRs, for example, according to any one of Tables 1 to 6.

[0247] In some cases, the kits of the present disclosure include one or more oligonucleotide primer pairs for amplifying one or more DMRs of Table 7. In some specific cases, the kits of the present disclosure include oligonucleotide primer pairs for multiple DMRs of Table 7, the multiple DMRs including, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 DMRs of Table 7, such as provided in any one of Tables 8 to 12.

[0248] In various embodiments, the kits of the present disclosure include one or more oligonucleotide primer pairs provided in Table 13. Those skilled in the art will understand that the oligonucleotide primer pairs provided in Table 13 can be provided in any combination of one or more oligonucleotide primer pairs, such as in the combinations provided in any one of Tables 1 - 12.

[0249] In various specific embodiments, the kits of the present disclosure do not include oligonucleotide primer pairs that amplify all or part of one or more of FGF14, ZNF471, PDGFD, and ALK.

[0250] The kits of the present disclosure may further include one or more MSREs, either alone or in a single solution. In various embodiments, one or more MSREs are selected from the group of MSREs including AciI, Hin6I, HpyCH4IV, and HpaII (e.g., such that the kit includes AciI, Hin6I, and HpyCH4IV, either alone or in a single solution). In certain embodiments, the kits of the present disclosure include one or more reagents for qPCR (e.g., reagents sufficient to complete a qPCR reaction mixture, including but not limited to dNTPs and polymerase).

[0251] Examples

[0252] The examples herein confirm that the present disclosure particularly provides methods and compositions for screening and treating colorectal cancer and the like. This example further demonstrates that the compositions and methods provided herein provide a significantly high degree of sensitivity and specificity in the screening and / or treatment of colorectal cancer. A clinical study comparing the methylation of biomarkers in samples from subjects diagnosed with colorectal cancer and the methylation of biomarkers in samples from control subjects is also provided, further demonstrating the screening of colorectal cancer including the methods and / or compositions of the present disclosure. Unless otherwise specifically stated, the samples in this example are human or human-derived. Except for Example 1, all experiments were performed using plasma samples.

[0253] Example 1. Identification of Methylation Biomarkers Associated with Colorectal Cancer

[0254] This example includes identifying CpG loci that are hypermethylated in one or more of colon cancer and rectal cancer compared to healthy controls. Specifically, the experiments in this example examined CpG methylation in samples from: (i) colon cancers of 341 subjects previously diagnosed with colon cancer who had not previously received chemotherapy or radiotherapy; (ii) rectal cancers of 118 subjects previously diagnosed with rectal cancer who had not previously received chemotherapy or radiotherapy; (iii) colons of 40 healthy control subjects not diagnosed with colorectal cancer; (iv) white blood cells of 10 healthy control subjects not diagnosed with colorectal cancer. The tissue samples were fresh frozen tissues.

[0255] The DNA methylation of samples was analyzed by a global methylomics analysis platform (Infinium HumanMethylation450 (HM450) bead assay). The Infinium HumanMethylation450 array assesses the methylation status of >450,000 CpGs located throughout the genome. DNA methylation profiles were obtained from all tissue samples.

[0256] CpG methylation sites with no significant difference in methylation status between colorectal cancer and healthy controls were identified and excluded from consideration (average β-value < 0.25 and β-value > 0.3 in no more than five samples across the entire set). This filtering yielded a list of CpG methylation sites with significant differences in methylation status between colorectal cancer and healthy controls. The resulting set of CpG methylation sites was then further filtered by excluding CpG methylation sites with an average β-value difference equal to or less than 0.1, resulting in 253 CpG methylation sites. Each of the 253 CpG methylation sites was associated with a hypermethylated state in the colorectal cancer status compared to the control.

[0257] Thus, this example yielded a set of 253 individual CpG methylation sites as methylation biomarkers for colorectal cancer. The 253 methylation biomarkers represent multiple DMRs found in common within 36 genes, i.e., within 36 methylated loci. Each of the 36 DMRs in colorectal cancer was hypermethylated compared to healthy controls.

[0258] Example 2: Development of a cell-free DNA assay for methylation biomarkers by MSRE-qPCR

[0259] This example developed a test for determining the methylation status of colorectal cancer methylation biomarkers based on circulating cell-free DNA (cfDNA). CfDNA is incomplete and fragmented, and the mechanism by which cfDNA is transported from cancer cells to the blood (as part of what is called circulating tumor DNA) is unknown. At least because the 253 methylation biomarkers of Example 1 were identified from tissue samples, it was not known prior to the experiments of this example whether the identified colorectal cancer methylation biomarkers could be adequately analyzed from cfDNA to successfully capture the ctDNA fraction that would permit the identification of a subject or sample with colorectal cancer.

[0260] As a key step in determining whether the colorectal cancer methylation biomarkers identified in Example 1 can be sufficiently analyzed from cfDNA to successfully capture the ctDNA fraction that permits the identification of colorectal cancer subjects or samples, a sensitive assay was developed to screen for these biomarkers. In particular, a methylation-sensitive restriction enzyme (MSRE)-qPCR method was developed. The MSRE-qPCR method was developed to measure the methylation of DMRs that cover the identified CpG sites in blood samples, particularly in the cell-free DNA (cfDNA) of tumors present in the blood.

[0261] The development of the MSRE-qPCR method is significant, at least in part because analyzing CpG methylation biomarkers derived from tumor tissue by analyzing cfDNA is challenging due to the low concentration (0.1 - 1%) of tumor-derived DNA circulating in the blood compared to the non-tumor DNA background of the sample. Thus, while it is generally preferred to develop biomarker assays that rely on readily available samples such as blood, urine, or feces, using blood to analyze tumor-derived methylation biomarkers is challenging. Therefore, even after methylation biomarkers characteristic of colorectal cancer have been identified in tissue, as described above, it is not possible to predict whether the fragmentation and poorly understood nature of ctDNA will permit successful screening using the methylation biomarkers identified in tissue.

[0262] MSRE-qPCR requires the design of oligonucleotide primers (MSRE-qPCR oligonucleotide primer pairs) that amplify loci, each of which includes at least one colorectal cancer MSRE cleavage site (i.e., an MSRE cleavage site that covers at least one colorectal cancer methylation biomarker site such that cleavage of the MSRE cleavage site in a nucleic acid molecule is permitted where all of the at least one colorectal cancer methylation biomarker sites are unmethylated and blocked in a nucleic acid molecule where at least one colorectal cancer methylation biomarker site is methylated). The MSRE-qPCR assay can utilize multiple restriction enzymes to expand the range of colorectal cancer methylation biomarker sites that can be tested by a single MSRE-qPCR reaction because it is unlikely that a single MSRE will cleave a site that includes all of the methylation biomarker sites of interest. The MSRE-qPCR assay of the present example utilizes MSREs AciI, Hin6I, and HpyCH4IV, which were found to provide sufficient coverage together.

[0263] Figure 1An exemplary workflow diagram of MSRE-qPCR is provided. As performed in this example, circulating cell-free tumor DNA was extracted from the blood of a subject (usually about 4 mL of plasma sample) using the QIAamp MinElute ccfDNA Kit according to the manufacturer's protocol (QIAamp MinElute ccfDNA Handbook 08 / 2018, Qiagene). As Figure 1 shown, the isolated cfDNA was divided into two aliquots, one aliquot for qPCR quality control analysis and the second aliquot for MSRE-qPCR.

[0264] For MSRE-qPCR, 2 / 3 volume of the eluted cfDNA was digested with MSRE. Since unmethylated DNA is selectively cleaved, contacting cfDNA with MSRE enriches the methylation-derived signal of the sample; methylated DNA remains intact and quantifiable. The remaining 1 / 3 volume of the eluted cfDNA was used for qPCR using MSRE-qPCR oligonucleotide primers to confirm successful amplification of the amplicon from the cfDNA, which confirmed the presence of the template, thus providing technical quality control.

[0265] As applied herein, MSRE-qPCR oligonucleotide primer pairs for co-amplifying DMRs were successfully developed, including 180 out of the 253 CpG methylation biomarker sites identified in Example 1. DMRs typically contain 1 to 15 MSRE cleavage sites, which together cover each of the 180 methylation biomarker sites. As used herein, the methylation status of six genes (JUB, H19, TBP, TCEB2, SNRPN, IRF4) provides a methylation control that allows monitoring of the robustness and reproducibility of the test.

[0266] Example 3: MSRE-qPCR of cfDNA successfully distinguished subjects by colorectal cancer status

[0267] To explore the clinical diagnostic and prognostic capabilities of the identified methylation biomarkers, the DMRs amplified by MSRE-qPCR oligonucleotide primer pairs covering 180 methylation biomarker sites, and appropriate controls, were tested in cfDNA extracted from human subject plasma. The subjects were undiagnosed individuals seeking or in the process of obtaining a diagnosis of possible colorectal cancer, such that methylation biomarker analysis could be performed prior to traditional colorectal cancer diagnostic tests and then compared to subsequent traditional diagnoses. In particular, cfDNA was obtained from samples of undiagnosed individuals seeking or in the process of obtaining a diagnosis of possible colorectal cancer at screening centers and oncology clinics in Spain and the United States between 2017 and 2018. The first subject group consisted of 70 such individuals (see Figure 2 for the description of the first subject group), and the second subject group consisted of 63 such individuals (see Figure 3 for the description of the second subject group). Preliminary results from MSRE-qPCR analysis of a small panel of tested DMRs of the genes shown in Table 14 in the second subject group provided proof of principle for colorectal cancer diagnosis: the results showed that for colorectal cancer, the overall diagnostic sensitivity was 80%, the diagnostic sensitivity for early local colorectal cancer was as high as 75%, and the specificity was 90% ( Figure 4 ). The representative DMR proof-of-principle groups performed similarly and / or were statistically comparable with respect to proximal and distal cancers ( Figure 4 ). The DMR proof-of-principle groups also performed similarly and / or were statistically equally good with respect to local and advanced cancers ( Figure 4 ). In addition, MSRE-qPCR analysis of methylation of the MSRE-qPCR control genes and undigested DNA controls indicated that the developed MSRE-qPCR test had high technical reliability in measuring the methylation status of colorectal cancer biomarkers in plasma cfDNA.

[0268] Figures 5 - 9 The association between the methylation status of colorectal cancer DMRs and colorectal cancer is shown. The results are presented as 45 minus the MSRE-qPCR Ct value (i.e., 45–Ct value) for display purposes. The results demonstrated a surprisingly high predictive ability of the individual colorectal cancer methylation biomarkers of the present disclosure or as few as three individual colorectal cancer methylation biomarkers for colorectal cancer (e.g., for determining screening for colorectal cancer in a subject).

[0269] Table 14: Proof-of-Principle DMR Group

[0270]

[0271] Example 4. Further Validation of Methylation Biomarkers by MSRE-qPCR

[0272] To verify the predictive ability of the methylation biomarker DMR for colorectal cancer, data from MSRE-qPCR analysis of samples from 133 subjects in the first and second subject groups identified in Example 3 were further analyzed (see Figure 2 and Figure 3 ). Using Monte-Carlo cross-validation for more than 50 runs, feature ranking was performed using the random forest algorithm, and a classification model based on the support vector machine (SVM) algorithm was constructed with markers having VIP>2. This analysis identified several marker subgroups (2, 3, 5, 8, 15, 28, as described in Tables 7-12) that gave good predictions in the SVM model.

[0273] All models (2, 3, 5, 8, 15, and 28 colorectal cancer DMR groups) were applied to cfDNA extracted from the plasma of the third subject group. The third subject group included 82 subjects who had previously received a confirmed diagnosis of colorectal cancer based on colonoscopy, or were control subjects known not to be considered to have colorectal cancer (the control group included subjects with hyperplastic polyps and / or non-advanced adenomas, but no colorectal cancer). The 82 subjects were subjects participating in colorectal cancer screening and oncology in Spain and the United States. Further description of the third subject group is as Figure 10 shown.

[0274] The oligonucleotide primer pairs (Table 13) used to amplify 28 DRM in MSRE-qPCR covered at least one MSRE cleavage site, typically 3 to 15 MSRE cleavage sites. MSRE-qPCR was performed according to the method described in Example 2.

[0275] Despite the adequacy and utility of all test groups for screening colorectal cancer, those skilled in the art will understand that the 28-DMR group provides increased sensitivity and comparable specificity compared to all other DMR groups shown in Table 15. For the avoidance of doubt, all groups tested (the groups described in Tables 7-14) are individually sufficient (e.g., in terms of sensitivity and specificity) and useful for clinical screening of colorectal cancer. Analysis of the third subject group using the 28 colorectal cancer DMR group showed a general sensitivity of 79% for diagnosing colorectal cancer, a sensitivity of 75% for local (early) cancer, and a sensitivity of 84% for advanced cancer. The data also showed a specificity of 87% with an AUC of 82% ( Figure 11 ). Figure 11 ROC curve analysis of the second validation group data for the 28 marker group identified by the SVM model was provided.

[0276] Therefore, the evaluation of the performance of the 28 colorectal cancer DMR groups and their subgroups showed that the entire group of the 28 colorectal cancer DMRs and each of the individual subgroups of 2, 3, 5, 8, and 15 were sufficient for clinical screening of colorectal cancer alone (see Tables 7 - 14). For example, just to give one example, the 3 - DMR subgroup (Table 9) achieved good separation of colorectal cancer subjects from control subjects, demonstrating sufficient performance for clinical screening of colorectal cancer, which was demonstrated at least in part by a determined sensitivity of 60% and a specificity of 87% (Table 15).

[0277] The SVM - model features are described in Table 16. The input support SVM vectors and their coefficient (weight) values are given in Table 17 (due to the size of Table 17, Table 17 is shown in several parts, and the coefficients and gene names are repeated in each part for reference). For prediction purposes, the information provided is used in combination with the predict() function in the R - package (see Hypertext Transfer Protocol Secure (HTTPS): / / cran.r - project.org / web / packages / e1071 / index.html).

[0278] Table 15. Accuracy measures for applying the 28 colorectal cancer DMR groups and their subgroups to a third group of subjects

[0279]

[0280] Table 16 SVM model input characteristics

[0281] Variable Value type 0 kernel 2 cost 1 degree 3 gamma 0.035714 coef0 0 nu 0.5 epsilon 0.1 nclasses 2 rho -0.73551 probA -2.14936 probB -0.10114 sigma 0

[0282] Table 17: SVM vectors

[0283] coefs GSG1L ZNF492_2 ZNF568_2 ZNF568_1 ZNF542_2 GSG1L'861 ZNF492'499 ZNF568'252 ZNF568'405 ZNF542'525 1 0.166333806 0.423405118 -0.939531248 0.275236404 -0.052862411 1 0.183718034 -2.19255911 -0.092363545 -0.327541264 0.309450278 0.160992568 -0.094429617 -2.19255911 -0.939531248 -0.413652359 0.137466406 1 0.475386751 0.318930431 -0.147777884 0.019978514 0.164983826 1 -0.152377044 0.473593938 1.146062978 0.429006217 0.574305439 1 0.315065536 0.442866089 0.835406834 0.041506288 0.55940017 0.539110203 -0.428593114 0.344536972 0.864793226 -0.0507556 0.174156299 1 0.143154835 -2.19255911 0.848840613 -0.373672208 0.025103611 0.228841426 -0.16396653 0.392677269 -0.939531248 -0.0507556 0.161544148 1 0.691723813 0.288202582 -0.939531248 0.232180856 0.641952428 1 0.152812739 0.548365038 0.897538063 0.321367348 0.6259006 0.086502196 0.152812739 0.413162502 -0.939531248 -0.318315075 0.260148235 1 0.058165275 0.455157229 -0.939531248 -0.035378619 0.421813073 0.022981588 -0.055797999 -2.19255911 -0.939531248 -0.469009492 0.310596837 0.199753156 0.029191561 0.425453641 -0.939531248 -0.192223828 0.392002536 0.640672506 0.401986676 0.512515881 0.731295044 -0.352144434 -2.050168434 0.488436741 0.11224954 -2.19255911 -0.939531248 -0.327541264 -2.050168434 0.290813367 0.038849466 0.455157229 0.842963334 0.038430892 0.370217912 0.93438076 -0.165898111 0.292299628 0.996612184 -0.293711905 0.182182213 1 0.34597083 0.531976852 -0.939531248 0.622756182 0.534175869 0.177133374 0.291886565 0.201140342 0.931122511 0.312141159 0.439011461 0.363673626 -0.252819252 0.199091819 -0.939531248 -0.232203979 0.408054364 0.372869951 -0.022961123 -2.19255911 -0.939531248 -0.438255529 -2.050168434 0.180416799 -0.0152348 0.246207854 -0.939531248 -0.247580961 0.130587052 1 1.837151292 1.131169911 -0.939531248 1.084065621 1.180835225 0.236974727 -4.54286045 0.032137172 -0.240135117 -0.619703909 -2.050168434 0.433173404 -4.54286045 -2.19255911 -0.939531248 -0.40442617 0.427545869 0.037394649 0.15474432 -2.19255911 -0.939531248 -0.204525413 0.471115116 1 0.245528623 0.455157229 -0.939531248 -0.207600809 0.380536944 0.263636311 -4.54286045 -2.19255911 -0.939531248 -1.72992196 -2.050168434 1 0.682065908 0.557583393 1.034394689 0.828807731 0.838014042 1 -0.042276933 0.55553487 0.775794438 0.158371346 0.349579848 1 0.025328399 0.467448369 0.848001002 -0.524366624 0.018224256 0.26169536 -4.54286045 -2.19255911 -0.939531248 -7.963750185 -2.050168434

[0284] Table 17 continued: SVM vectors

[0285] coefs GSG1L ZNF492_2 ZNF568_2 ZNF568_1 ZNF542_2 GSG1L'861 ZNF492'499 ZNF568'252 ZNF568'405 ZNF542'525 0.1799778 0.295749727 0.267717349 -0.939531248 0.226030064 0.467675439 0.898868481 -0.18521392 0.324051739 -0.939531248 -0.023077034 0.29339845 0.042908076 0.019533657 0.191921987 -0.939531248 -0.622779305 0.275053503 0.140898434 -4.54286045 0.204213127 -0.939531248 -0.567422172 0.123707697 0.140415448 0.293818146 -2.19255911 -0.939531248 -0.699664211 0.061793503 1 0.166333806 0.135587597 -0.939531248 -0.044604807 0.459649525 0.108835219 -0.378372011 0.333270094 -0.939531248 -0.604326927 -2.050168434 1 0.608665834 0.370143513 0.901736119 0.641208559 0.750875547 -1 0.322791859 -2.19255911 1.066299914 0.186049912 0.550227697 -1 0.025328399 -2.19255911 -0.497895756 0.026129307 0.433278665 -1 0.311202374 0.387555961 -0.939531248 -0.182997639 0.5192706 -1 -0.059661161 0.322003216 1.020121298 0.422855425 0.403468127 -1 0.403918257 0.612893521 0.959669292 0.468986368 0.589210708 -1 0.172128548 0.145830214 0.701908652 0.182974516 0.491753181 -1 -0.16396653 0.411113978 -0.939531248 -0.336767452 0.473408235 -1 0.336312926 0.694834453 -0.939531248 0.819581542 0.740556515 -0.27309104 1.360050807 0.923244798 1.68509337 2.378807448 1.22669759 -1 2.101777876 1.346264856 1.939495565 3.255295383 1.550027268 -1 0.712971203 0.404968409 0.776634049 0.475137161 -2.050168434 -0.675668601 0.382670867 0.677422005 1.048668079 0.579700634 0.674056084 -1 0.245528623 0.403944147 -0.939531248 -0.545894398 -2.050168434 -0.228886868 1.516508861 0.993918852 1.713640151 2.252716201 1.264534042 -1 0.523676274 0.505346049 0.922726399 0.272161008 0.602969418 -0.253709663 0.53719734 0.671276435 -0.939531248 0.186049912 0.764634257 -1 -0.007508476 -2.19255911 -0.939531248 -0.284485716 0.336967697 -1 0.465728846 0.297420936 -0.939531248 0.075335647 0.648831783 -1 0.206897005 0.52480702 0.981499183 0.066109458 0.583477912 -1 0.626050062 0.583189934 -0.939531248 0.804204561 0.654564579 -1 0.094865312 0.356828111 0.968065404 0.112240402 0.397735331 -1 0.04850737 -2.19255911 -0.939531248 -1.041033197 0.29339845 -1 -0.241229766 -2.19255911 0.913490675 -0.14916828 0.136319847 -1 0.419370905 -2.19255911 -0.939531248 0.099938817 0.659150816 -1 0.228144395 0.438769043 0.834567222 0.413629236 0.549081138 -1 0.45220778 0.585238457 0.886623117 -0.103037336 0.838014042 -1 0.237802299 0.444914613 -0.939531248 0.078411043 0.295691568

[0286] Table 17 continued: SVM vectors

[0287] coefs ZNF542_1 ZNF471_2 ZNF471_1 ZNF471_3 ZNF132_2 ZNF542'502 ZNF471'527 ZNF471'558 ZNF471'662 ZNF132'268 1 0.210023302 0.448781467 0.381358009 0.276869984 -0.079808848 1 0.096511033 -1.701659498 0.111027436 0.245615084 0.220719423 0.160992568 0.011755205 0.491015986 0.192253523 0.011882788 0.004011962 1 0.075322076 0.362552655 0.179561947 0.342097602 0.355650484 1 0.438561338 0.531490735 0.353436542 0.351609963 0.275918493 1 0.322022075 0.502454502 0.314092655 0.193976554 0.091921593 0.539110203 0.007214715 0.395108431 0.091990071 0.143696932 -0.206562268 1 0.010241709 0.604521258 0.298862764 0.238820541 0.200275323 0.228841426 0.010241709 -1.701659498 -0.009542539 -3.291624259 0.120543333 1 0.477912258 0.220891037 0.146563849 0.172234015 0.333161974 1 0.228185265 0.381030258 0.097066702 0.160003836 0.380183404 0.086502196 0.116186493 -1.701659498 -0.38775151 -0.122649173 -0.237228418 1 0.194888333 0.592202857 0.357244014 0.299971432 0.053077803 0.022981588 -0.13808099 -1.701659498 -0.060308843 -3.291624259 -0.186118168 0.199753156 0.15705091 0.495415416 0.260788035 0.227949271 -0.034831828 0.640672506 0.120726984 -1.701659498 0.215098361 0.210283458 0.183920043 0.488436741 0.05867361 -1.701659498 0.02853219 0.007806062 -0.341493329 0.290813367 0.063214101 0.449661352 0.10848912 0.248332902 0.433338064 0.93438076 0.043538641 0.359912998 0.034877978 -0.051985921 0.051033393 1 0.211536799 -1.701659498 -0.187224606 -0.012577568 0.482403904 0.177133374 0.264509192 0.375750943 0.046300397 -3.291624259 -7.69E-05 0.363673626 0.073808579 0.258726128 0.171947002 -0.049268103 -0.204517858 0.372869951 -3.407234345 0.527971191 0.279825399 0.138261297 -0.406914449 0.180416799 -3.407234345 -1.701659498 -0.136458301 -3.291624259 -0.406914449 1 1.345145995 1.182606248 1.282459921 1.285180239 1.347189337 0.236974727 -3.407234345 -1.701659498 -2.980640533 -0.383559643 -0.085942078 0.433173404 0.001160727 0.382790029 0.060261131 -0.069651734 -0.110474998 0.037394649 -0.468023319 0.373111285 0.013302299 -0.008500842 -0.257672518 1 0.455209804 0.5957224 0.409279477 0.446733572 0.001967552 0.263636311 -3.407234345 -1.701659498 -2.980640533 0.049932232 -5.066124854 1 0.721585263 0.52181199 0.325515074 0.344815419 0.791109815 1 0.060187107 0.342315281 0.10848912 -0.046550286 0.071477493 1 -0.038190193 0.419745234 0.317900128 0.173592923 -0.413047679 0.26169536 -3.407234345 0.529730963 0.213829203 -0.096829908 -0.366026249

[0288] Table 17 continued: SVM vectors

[0289] coefs ZNF542_1 ZNF471_2 ZNF471_1 ZNF471_3 ZNF132_2 ZNF542'502 ZNF471'527 ZNF471'558 ZNF471'662 ZNF132'268 0.1799778 0.155537413 -1.701659498 -0.034925691 0.191258736 -5.066124854 0.898868481 0.278130664 0.655554636 0.5463485 0.405966311 -0.192251398 0.042908076 0.079862567 0.491895872 0.225251622 0.179028558 0.020367243 0.140898434 0.051106125 -1.701659498 -0.243067541 -3.291624259 -5.066124854 0.140415448 -0.074514119 -1.701659498 -2.980640533 0.154568201 -0.304693949 1 0.128294469 0.220011151 -0.135189143 0.202130006 0.106232463 0.108835219 -3.407234345 -1.701659498 -2.980640533 -3.291624259 0.026500473 1 0.526344159 -1.701659498 -0.140265774 0.233384906 0.603024094 -1 0.368940479 0.572845368 0.377550536 0.036343145 0.177786813 -1 0.31445459 0.503334388 0.298862764 0.181746375 0.132809793 -1 0.240293241 0.61683966 0.287440345 0.473911746 0.378138994 -1 0.134348456 0.407426833 0.248096459 0.279587802 -0.165674068 -1 0.424939866 0.570205711 0.39151127 0.305407067 0.523292104 -1 0.347751522 0.558767195 0.404202846 0.324431789 0.210497373 -1 0.325049069 0.280723273 0.102143332 0.295894706 -0.286294258 -1 0.577803055 0.540289593 0.434662629 0.505166646 0.881063855 -0.27309104 1.379956424 0.847369747 0.820486547 0.710361859 1.046661066 -1 1.806762557 1.486166858 1.711435198 1.720031023 2.25286297 -1 0.343211032 0.614200002 0.400395374 0.426349941 0.654134345 -0.675668601 0.455209804 0.547328679 0.424509368 0.408684128 0.776798945 -1 -0.012460745 0.328237108 -0.031118218 -0.007141934 0.077610723 -0.228886868 1.384496915 1.151810244 1.269768345 1.328665317 1.330834057 -1 0.391642933 0.754981735 0.631382061 -3.291624259 0.118498923 -0.253709663 0.741260723 1.184366019 1.220271198 1.031064312 0.367916944 -1 -0.147161972 -1.701659498 -0.187224606 -0.133520443 0.065344263 -1 0.536938638 0.610680459 0.408010319 0.446733572 0.425160424 -1 0.188834345 -1.701659498 0.259518877 0.237461632 0.480359494 -1 0.421912872 0.484856786 0.344552438 0.318996154 0.692978135 -1 0.190347842 0.604521258 0.31663097 0.270075441 -0.024609778 -1 0.060187107 0.410946376 0.26332635 0.282305619 0.108276873 -1 0.043538641 0.546448794 0.279825399 0.100211854 -0.063453568 -1 0.443101829 0.402147518 0.429585999 0.274152167 0.055122213 -1 0.446128822 0.451421124 0.211290888 0.308124884 0.220719423 -1 0.774557655 0.410946376 0.221444149 0.145055841 0.717511055 -1 0.110132505 0.549968337 0.243019828 -0.111777904 0.273874083

[0290] Table 17 continued: SVM vectors

[0291] coefs ZNF132_1 JAM2 MCIDAS_1 MCIDAS_2 PDGFD_1 ZNF132'415 JAM2'320 MCIDAS'855 MCIDAS'003 PDGFD'388 1 0.238896666 0.406419198 0.492859834 0.416450063 0.046762915 1 -0.397730773 -2.423671354 0.320276073 0.121123394 -0.124572283 0.160992568 -0.170552517 -2.423671354 -2.052243039 0.091026409 -0.261640442 1 0.347202579 0.464995238 0.485753444 0.245273459 0.426555938 1 0.120024323 0.545266109 0.761887461 0.544362251 -0.027482338 1 0.006435195 0.297945048 0.524330991 0.190722673 0.235231633 0.539110203 -0.693590827 0.228521593 0.262409754 0.038356684 -0.53577676 1 -0.550944015 0.287097633 0.044142056 -0.183608583 0.20382018 0.228841426 -0.352823443 0.214419954 0.199467441 0.028951376 0.121008168 1 0.299653641 0.447639374 0.58219731 0.501097835 0.423700352 1 0.26795435 0.317470395 0.572045325 0.252797705 0.266643087 0.086502196 -0.487545432 0.333741518 0.359868819 0.213295412 -0.16169491 1 0.088325031 0.395571783 0.40961355 0.333683353 0.126719341 0.022981588 -1.155872162 -2.423671354 -2.052243039 0.019546069 -0.669989332 0.199753156 -0.231309492 -2.423671354 0.225862604 0.043999869 -0.17882843 0.640672506 0.407959554 0.378215919 0.320276073 0.141815072 0.152419621 0.488436741 -0.410938811 -0.105578787 0.311139286 -4.590935879 -0.375863908 0.290813367 -0.049038566 0.15367443 -2.052243039 0.168149934 0.358021859 0.93438076 -0.614342598 0.187301416 -0.001541881 -0.078269134 -0.624299946 1 0.415884377 0.216589437 0.588288502 0.241511336 0.469389738 0.177133374 0.135873968 0.230691076 0.443115103 0.15122038 0.132430514 0.363673626 -0.025264097 0.130894859 0.318245676 0.072215793 -0.247362509 0.372869951 -0.281500037 0.267572287 0.200482639 -0.042528964 -0.190250776 0.180416799 -6.542110115 0.37930066 0.199467441 -0.245683615 -0.435831227 1 1.855560534 1.410889819 1.44105532 1.953277379 1.120463492 0.236974727 -0.71208208 -2.423671354 -2.052243039 -4.590935879 -0.344452455 0.433173404 0.104174677 -0.128358358 0.297941704 -0.078269134 0.292343366 0.037394649 -0.226026277 0.150420206 -2.052243039 0.049643054 -0.104583177 1 -0.424146849 0.275165477 -2.052243039 0.072215793 0.063896435 0.263636311 -6.542110115 -0.08605344 -2.052243039 -0.591798947 -7.103626036 1 0.69061157 0.407503939 0.605546878 0.314872738 1.134741426 1 -0.038472135 0.309877205 0.161905093 -0.241921492 0.295198953 1 -0.014697667 0.199233573 0.256318562 -0.24004043 -0.407275361 0.26169536 -0.878503361 0.122216927 0.038050865 -4.590935879 -0.415842121

[0292] Table 17 continued: SVM vectors

[0293] coefs ZNF132_1 JAM2 MCIDAS_1 MCIDAS_2 PDGFD_1 ZNF132'415 JAM2'320 MCIDAS'855 MCIDAS'003 PDGFD'388 0.1799778 -0.125645187 0.492113775 0.581182112 0.352493969 -7.103626036 0.898868481 0.101533069 -2.423671354 0.41671994 0.02142713 -0.470098267 0.042908076 -0.281500037 -2.423671354 0.402507159 -0.345379879 -0.235940162 0.140898434 -0.532452762 0.177538743 -2.052243039 -0.040647902 -0.707111958 0.140415448 -0.136211617 -2.423671354 0.160889894 0.143696133 -0.147416977 1 0.006435195 0.180792967 0.542604565 0.326159107 -0.304474242 0.108835219 -0.292066467 -2.423671354 0.051248446 -0.388644296 -0.632866706 1 0.574380834 0.446554633 0.667473992 0.598913037 0.812060135 -1 0.196630944 0.384724368 0.345656038 0.218938597 0.363733032 -1 0.180781298 0.228521593 0.117236355 -0.119652489 0.546490577 -1 0.471358137 0.249131681 0.483723047 -0.149749474 0.483667671 -1 -0.022622489 0.469334204 0.406567954 0.145577195 -0.007493231 -1 0.574380834 0.309877205 0.617729261 0.132409764 0.466534151 -1 0.030209663 0.205742022 0.451236692 -0.003026671 -0.010348818 -1 0.02228484 0.213335212 0.123327546 0.237749213 0.078174368 -1 0.970621979 0.511639122 0.606562077 0.311110614 0.689269909 -0.27309104 0.981188409 1.000857535 1.309079503 1.5507302 1.465989476 -1 2.840880179 1.538889315 1.185225275 1.65795071 2.031395631 -1 0.574380834 0.560452489 0.650215616 0.561291805 0.777793095 -0.675668601 1.139684867 0.64072336 0.720264319 0.572578175 0.892016561 -1 -0.178477339 0.079912009 0.120281951 0.008259699 0.123863754 -0.228886868 1.945375193 1.1646535 1.014671911 1.069178434 1.683014061 -1 0.064550562 0.462825755 0.547680558 0.290418937 0.395144485 -0.253709663 0.79099266 0.783909237 0.578136516 0.538719066 0.709259016 -1 -0.276216822 -2.423671354 0.205558632 -0.010550917 -0.298763069 -1 0.36833544 0.443300408 0.530422182 0.094788532 0.400855659 -1 0.36833544 0.212250471 0.372051202 0.143696133 0.226664874 -1 0.761934976 0.514893347 0.615698864 0.350612908 0.717825776 -1 0.283803995 0.427029286 0.48169265 0.243392397 0.149564034 -1 -0.659249928 0.18296245 0.281698527 -0.371714741 0.118152581 -1 -0.241875922 0.190555641 0.327382464 -0.001145609 -0.116005524 -1 0.149082006 0.290351858 0.572045325 0.388234139 0.452256218 -1 0.347202579 0.420520837 0.494890231 0.164387811 0.466534151 -1 1.055153423 0.579977836 0.862392122 0.811472996 0.186686661 -1 -0.123003579 -2.423671354 0.184239462 0.29418106 0.443689458

[0294] Continued Table 17: SVM Vectors

[0295] coefs PDGFD_2 ST6GALNAC5 ZNF492_1 CNRIP1_1 LONRF2_1 PDGFD'921 ST6GALNAC5'456 ZNF492'069 CNRIP1'272 LONRF2'281 1 1.302789852 0.466406944 -0.240707793 -0.064165795 0.182108844 1 -0.682617737 0.569041467 -0.17761095 -0.307307386 -0.063816882 0.160992568 -0.682617737 0.705281983 -0.150569446 0.093547669 -0.189987472 1 -0.682617737 0.569041467 0.176933218 0.189928119 0.325387311 1 1.475318586 0.828806718 -0.132541776 0.498783653 0.197078236 1 -0.682617737 -1.277471664 0.08679487 0.38268902 0.201355206 0.539110203 -0.682617737 -1.277471664 -0.210661677 0.019071866 0.100846431 1 -0.682617737 0.367405503 0.056748754 -0.149593922 0.090154008 0.228841426 -0.682617737 0.246605578 0.194960887 0.161452077 -0.098032635 1 1.096640133 0.76522781 0.480398989 0.178975795 0.534958799 1 -0.682617737 0.792475913 0.065762589 0.119833246 0.338218218 0.086502196 1.281555546 -1.277471664 -0.327841529 -0.079499049 -0.207095348 1 -0.682617737 0.638978265 0.149891714 0.369546231 0.333941249 0.022981588 -0.682617737 -1.277471664 -0.360892257 -3.744146627 -0.585607118 0.199753156 -0.682617737 -1.277471664 -0.162587892 -0.042261148 -5.029378066 0.640672506 -0.682617737 0.586298599 0.23702545 -0.07073719 -0.22634171 0.488436741 1.209005001 -1.277471664 0.017688804 -0.348926217 -0.160048688 0.290813367 -0.682617737 0.638069995 0.110831763 -0.007213711 0.165000968 0.93438076 1.368262294 0.469131755 -0.57421968 -0.379592724 -0.014631737 1 -0.682617737 -1.277471664 0.423311368 0.316975076 0.498604562 0.177133374 -0.682617737 0.554509145 0.243034673 0.222785091 0.154308545 0.363673626 -0.682617737 0.566316656 -0.369906092 -0.186831823 -0.068093851 0.372869951 -0.682617737 -1.277471664 -0.231693959 -0.06635626 -0.435913198 0.180416799 -0.682617737 -1.277471664 -1.154109717 -2.41672497 -0.136525357 1 -0.682617737 1.508192759 1.468916202 2.071537366 0.917747538 0.236974727 -0.682617737 -1.277471664 -0.330846141 -4.848140877 -5.029378066 0.433173404 -0.682617737 0.542701634 0.056748754 -0.243783907 0.263371258 0.037394649 -0.682617737 -1.277471664 0.149891714 -0.362069006 -0.068093851 1 -0.682617737 0.620812863 0.336177632 0.045357444 -0.311881093 0.263636311 -0.682617737 -1.277471664 -7.154319065 -0.734448018 -5.029378066 1 1.438158551 -1.277471664 1.072307472 0.660878047 0.791576948 1 1.220506917 0.624445943 0.131864044 -0.048832542 -0.016770221 1 -0.682617737 0.609913622 -0.204652454 -0.160546246 -0.269111401 0.26169536 -0.682617737 -1.277471664 -7.154319065 0.207451837 -5.029378066

[0296] Continued Table 17: SVM Vectors

[0297] coefs PDGFD_2 ST6GALNAC5 ZNF492_1 CNRIP1_1 LONRF2_1 PDGFD'921 ST6GALNAC5'456 ZNF492'069 CNRIP1'272 LONRF2'281 0.1799778 -0.682617737 -1.277471664 0.534481997 0.062881162 0.607667275 0.898868481 -0.682617737 0.698015822 -0.021371147 0.268784851 -0.040293551 0.042908076 -0.682617737 -1.277471664 -0.339859976 -0.567972695 -0.326850485 0.140898434 -0.682617737 -1.277471664 -0.571215068 -0.537306188 -0.442328652 0.140415448 -0.682617737 -1.277471664 -0.144560222 -3.146149742 0.111538853 1 -0.682617737 -1.277471664 -0.021371147 0.178975795 0.505020015 0.108835219 -0.682617737 -1.277471664 -0.318827695 -4.848140877 -0.463713497 1 -0.682617737 -1.277471664 0.429320592 0.560116667 0.757361195 -1 1.29571175 -1.277471664 0.092804093 -0.136451133 0.107261884 -1 -0.682617737 0.76613608 0.393265253 -0.094832302 0.220601567 -1 -0.682617737 -1.277471664 0.324159186 0.260022992 0.415203663 -1 1.442582365 0.811549586 -0.108504883 0.424307851 0.248401866 -1 -0.682617737 0.770677431 0.579551171 0.380498555 0.637606059 -1 1.147071609 -1.277471664 -0.084467991 -0.241593443 0.094430977 -1 -0.682617737 0.633528644 0.342186855 0.216213697 0.081600069 -1 -0.682617737 0.821540557 0.792878594 0.619259216 0.872839362 -0.27309104 2.042451502 1.427356719 1.264602614 1.732015325 1.51224625 -1 -0.682617737 1.5981115 2.0127509 2.529344505 2.128129808 -1 1.308983191 0.435525761 0.480398989 0.316975076 0.733837865 -0.675668601 -0.682617737 0.837889419 0.726777139 0.551354808 0.63332909 -1 -0.682617737 -1.277471664 0.083790259 -0.06635626 -0.040293551 -0.228886868 1.923893295 1.317456036 1.381782466 1.839348099 1.349721423 -1 -0.682617737 0.856963091 0.315145351 0.343260654 0.259094289 -0.253709663 1.235547883 1.01500209 0.964141455 1.026685666 0.729560896 -1 1.354106091 -1.277471664 -0.048412651 -0.099213232 -0.076647789 -1 -0.682617737 0.617179782 0.393265253 0.303832288 0.505020015 -1 1.269168867 0.629895564 0.342186855 0.481259935 0.421619117 -1 1.248819324 0.831531528 0.315145351 0.308213217 0.673960297 -1 1.336410836 0.788842833 -0.168597115 0.371736696 0.188524298 -1 1.133800168 0.567224926 -0.126532553 -0.134260668 -0.001800829 -1 -0.682617737 -1.277471664 -0.105500272 -0.090451373 0.216324598 -1 -0.682617737 0.717997765 0.390260641 0.411165062 0.513573954 -1 -0.682617737 0.735254897 0.231016227 0.384879485 0.541374253 -1 -0.682617737 1.01681863 0.231016227 1.147161228 0.703899081 -1 1.284209834 -1.277471664 0.158905548 -0.103594161 -0.574914695

[0298] Continued Table 17: SVM Vectors

[0299] coefs LONRF2_2 ADAMTS2_2 ADAMTS2_1 ADAMTS2_3 ALK LONRF2'387 ADAMTS2'254 ADAMTS2'284 ADAMTS2'328 ALK'434 1 0.816278101 -1.226540092 0.479237716 0.308464228 1.224961864 1 0.707526931 0.608032885 0.377972809 0.108720604 -0.67135809 0.160992568 -1.17952336 -1.226540092 -1.402761026 -3.569757964 -0.67135809 1 0.644016248 0.715511247 0.413319994 0.342021157 -0.67135809 1 1.028560383 0.889956898 0.805960341 0.757487893 -0.67135809 1 0.704916903 0.774210969 0.512674242 0.359598595 -0.67135809 0.539110203 -1.17952336 0.74444773 0.34931293 -0.159734825 -0.67135809 1 -1.17952336 -1.226540092 -1.344485938 -0.001537876 1.290071562 0.228841426 -1.17952336 0.651850986 0.265243951 0.155061125 -0.67135809 1 0.849338456 0.647717203 0.611073161 0.319649871 1.311232214 1 0.788437801 0.675826929 0.455354484 0.27330935 -0.67135809 0.086502196 0.548315219 -1.226540092 0.357910894 0.155061125 1.30146576 1 0.564845397 0.690708548 -1.172526662 0.340423208 1.271352524 0.022981588 -1.17952336 -1.226540092 -1.818329276 -0.437777949 -0.67135809 0.199753156 0.650976323 0.717164761 0.579547294 0.310062177 -0.67135809 0.640672506 -1.17952336 0.763463132 0.44580119 0.290886789 -0.67135809 0.488436741 -1.17952336 0.617127208 0.287216525 -0.153343029 -0.67135809 0.290813367 0.570935463 0.735353407 0.491656997 0.316453973 -0.67135809 0.93438076 -1.17952336 0.666732606 0.444845861 0.169442666 -0.67135809 1 -0.840219712 0.793226371 0.47350574 0.389959626 -0.67135809 0.177133374 -1.17952336 -1.226540092 0.355044906 0.129493941 -0.67135809 0.363673626 0.538745116 -1.226540092 0.304412453 -0.142157387 -0.67135809 0.372869951 -1.17952336 -1.226540092 0.354089577 0.111916502 -0.67135809 0.180416799 0.499594695 -1.226540092 -1.818329276 -3.569757964 -0.67135809 1 0.880658793 1.437269791 1.395398525 1.705071643 1.21519541 0.236974727 -1.17952336 -1.226540092 -1.818329276 -3.569757964 -0.67135809 0.433173404 -1.17952336 -1.226540092 0.347402271 0.057586237 -0.67135809 0.037394649 -1.17952336 -1.226540092 -1.818329276 -3.569757964 -0.67135809 1 -1.17952336 0.671693146 0.532736158 -0.081435325 -0.67135809 0.263636311 -1.17952336 -1.226540092 -1.818329276 -3.569757964 -0.67135809 1 0.846728428 0.660118553 0.491656997 0.417124759 1.282746721 1 0.650106314 -1.226540092 0.401856042 -0.322725622 -0.67135809 1 0.640536211 -1.226540092 0.567128013 0.254133962 -0.67135809 0.26169536 0.519604911 -1.226540092 0.536557475 0.284494993 -0.67135809

[0300] Continued Table 17: SVM Vectors

[0301] coefs LONRF2_2 ADAMTS2_2 ADAMTS2_1 ADAMTS2_3 ALK LONRF2'387 ADAMTS2'254 ADAMTS2'284 ADAMTS2'328 ALK'434 0.1799778 0.525694976 0.613820181 0.533691487 0.266917554 -0.67135809 0.898868481 -1.17952336 0.719645031 0.407588018 -0.172518417 1.353553518 0.042908076 0.605735837 0.541065597 0.508852925 0.28928884 -0.67135809 0.140898434 -1.17952336 -1.226540092 -1.818329276 -3.569757964 -0.67135809 0.140415448 -1.17952336 -1.226540092 -1.818329276 -0.332313316 -0.67135809 1 0.771037614 -1.226540092 0.249958682 -0.099012764 -0.67135809 0.108835219 0.456094228 0.611339911 -1.818329276 -0.242828173 -0.67135809 1 0.865868634 -1.226540092 0.373196163 0.410732963 -0.67135809 -1 -1.17952336 0.717991517 0.575725977 0.27330935 1.293327047 -1 -0.466985698 0.596458292 0.295814489 0.17903036 -0.67135809 -1 0.741457296 0.675000172 0.399945384 0.287690891 -0.67135809 -1 0.838898344 0.763463132 0.587189928 0.35160885 -0.67135809 -1 0.764077539 0.795706641 0.609162503 0.4315063 -0.67135809 -1 0.920679223 -1.226540092 0.530825499 0.139081635 1.257516713 -1 -1.17952336 0.608859641 0.236584071 0.044802645 -0.67135809 -1 0.706656922 0.8155488 0.656928968 0.760683791 1.349484162 -0.27309104 1.371344069 1.329791428 1.262607751 1.433420315 1.942796285 -1 1.875079486 1.591046526 1.560670496 2.013475797 2.200793463 -1 0.539615126 0.697322601 0.524138194 0.247742166 -0.67135809 -0.675668601 0.845858419 0.760982862 0.572859989 0.501816055 1.410524504 -1 -1.17952336 0.765943402 0.286261196 -0.031898906 1.241239289 -0.228886868 1.433114734 1.358727911 1.26451841 1.481358784 1.862223034 -1 0.513514845 0.884996358 0.706606092 0.567331964 1.322626411 -0.253709663 1.074670879 0.993301477 0.790675072 0.69996173 1.619689409 -1 -1.17952336 0.583230186 0.338804308 0.166246768 -0.67135809 -1 0.977229831 0.713030978 0.603430527 0.370784238 -0.67135809 -1 0.684036679 0.742794216 0.471595082 0.263721656 -0.67135809 -1 0.950259541 0.777517995 0.650241663 0.568929913 1.333206737 -1 0.843248391 0.738660433 0.582413282 0.319649871 -0.67135809 -1 -1.17952336 -1.226540092 0.244226706 -0.234838428 -0.67135809 -1 0.717097034 -1.226540092 0.458220472 0.107122655 -0.67135809 -1 0.689256735 -1.226540092 0.342625625 0.242948319 -0.67135809 -1 0.864128615 0.785785562 0.597698551 0.452279637 -0.67135809 -1 1.023340327 -1.226540092 0.275752573 0.006451869 1.64085006 -1 -1.17952336 0.702283141 0.516495559 0.334031412 -0.67135809

[0302] Continued Table 17: SVM Vectors

[0303] coefs FGF14 DMRT1 CNRIP1_2 FGF14'577 DMRT1'934 CNRIP1'232 1 0.955300844 1.131612847 0.296394201 1 -0.93950462 -0.701307401 0.101966839 0.160992568 0.846924723 -0.701307401 -2.336804129 1 -0.93950462 -0.701307401 0.230086604 1 1.296419127 1.516680127 0.443619546 1 0.974844079 -0.701307401 0.407656103 0.539110203 -0.93950462 1.17300758 0.203114022 1 -0.93950462 -0.701307401 0.261554616 0.228841426 -0.93950462 1.199962289 0.268297762 1 -0.93950462 -0.701307401 0.368321087 1 0.734106957 -0.701307401 0.228962746 0.086502196 0.761645152 -0.701307401 0.236829749 1 -0.93950462 -0.701307401 0.536899725 0.022981588 -0.93950462 -0.701307401 -2.336804129 0.199753156 0.771416769 -0.701307401 0.216600313 0.640672506 0.814944884 -0.701307401 0.384055093 0.488436741 -0.93950462 -0.701307401 0.073870399 0.290813367 -0.93950462 -0.701307401 0.268297762 0.93438076 -0.93950462 -0.701307401 0.027792238 1 0.960630817 -0.701307401 0.3997891 0.177133374 -0.93950462 -0.701307401 0.092975978 0.363673626 0.769640112 -0.701307401 0.317747496 0.372869951 -0.93950462 -0.701307401 0.225591173 0.180416799 -0.93950462 1.108508811 -2.336804129 1 1.728146955 1.533045486 1.467453809 0.236974727 -0.93950462 -0.701307401 -2.336804129 0.433173404 -0.93950462 -0.701307401 0.284031768 0.037394649 -0.93950462 -0.701307401 -2.336804129 1 0.834488119 -0.701307401 0.25031604 0.263636311 -0.93950462 -0.701307401 -2.336804129 1 0.798066635 -0.701307401 0.540271298 1 -0.93950462 -0.701307401 -0.045258506 1 0.853143025 1.17300758 -2.336804129 0.26169536 -0.93950462 -0.701307401 0.450362691

[0304] Continued Table 17: SVM Vectors

[0305] coefs FGF14 DMRT1 CNRIP1_2 FGF14'577 DMRT1'934 CNRIP1'232 0.1799778 -0.93950462 1.108508811 0.412151533 0.898868481 -0.93950462 -0.701307401 0.412151533 0.042908076 -0.93950462 -0.701307401 0.205361737 0.140898434 -0.93950462 -0.701307401 -2.336804129 0.140415448 0.748320219 -0.701307401 -2.336804129 1 0.726111997 -0.701307401 0.384055093 0.108835219 -0.93950462 -0.701307401 -2.336804129 1 -0.93950462 1.12487417 0.598711893 -1 0.830046474 -0.701307401 0.314375923 -1 -0.93950462 -0.701307401 0.078365829 -1 -0.93950462 -0.701307401 0.552633732 -1 0.867356287 1.072890087 0.532404295 -1 1.115200039 -0.701307401 0.452610406 -1 0.632837467 1.202850294 0.307632777 -1 0.974844079 -0.701307401 0.05476482 -1 0.946417555 -0.701307401 0.585225602 -0.27309104 1.777893371 2.092355709 1.213461994 -1 1.891599465 2.29451603 1.66750046 -1 0.822939843 -0.701307401 -2.336804129 -0.675668601 0.790071676 -0.701307401 0.593092605 -1 -0.93950462 -0.701307401 0.252563755 -0.228886868 1.602004256 1.983574202 1.266283301 -1 1.124971657 1.209588971 0.542519013 -0.253709663 1.057458663 -0.701307401 0.829102699 -1 1.010377234 -0.701307401 0.017677519 -1 0.846924723 1.254834377 0.354834796 -1 1.049463703 1.121023497 0.557129162 -1 -0.93950462 -0.701307401 0.488573849 -1 0.948194213 0.985287281 0.479582988 -1 -0.93950462 -0.701307401 -2.336804129 -1 -0.93950462 -0.701307401 0.325614499 -1 0.225094519 -0.701307401 0.389674381 -1 0.870909602 1.213439644 0.285155626 -1 -0.93950462 1.568664209 0.829102699 -1 -0.93950462 -0.701307401 0.224467316

[0306] Example 5. Various individual methylation biomarkers are highly informative

[0307] Evaluation of the performance of individual colorectal cancer DMRs from 28 colorectal cancer DMR sets revealed that various individual colorectal cancer DMRs are sufficient to screen for colorectal cancer (see Figure 12 - 19 ). For the selected colorectal cancer DMRs, Figure 12 - 19 shows the methylation status of the designated DMRs in colorectal cancer samples and control samples. The results are shown as subtracting the MSRE-qPCR Ct value from 45 (i.e., 45 - Ct value) for display purposes. The data provided in this example and the cumulative data provided in this example (including, for example, Figure 5 - 9 ) demonstrate that for each individual colorectal cancer DMR, the methylation status signal is stable enough between subject groups to allow clinical screening. Therefore, Figure 12 - 19 the results presented in

[0308] Sequence confirm that the methylation biomarkers for colorectal cancer provided herein can provide a reliable signal for the screening of colorectal cancer. In addition, those skilled in the art will understand that the present disclosure provides methylation biomarkers that can be used independently alone for the screening of colorectal cancer. Specifically, the methylation biomarkers provided herein can be used alone or in combination.

[0309] SEQ ID NO:1 (ZNF132) (see Table 1)

[0310] ZNF132 chr19, bp 58439728 to 58440994, from hg38

[0311] SEQ ID NO:2 (DMRT1) (see Table 1)

[0312] DMRT1 chr9, bp 841340 to 968090, from hg38

[0313] SEQ ID NO:3 (ALK) (see Table 1)

[0314] ALK chr2, bp 29193215 to 29922286, from hg38

[0315] SEQ ID NO:4 (JAM2) (see Table 1)

[0316] JAM2 chr21, bp 25637848 to 25714704, from hg38

[0317] SEQ ID NO:5 (FGF14) (see Table 1)

[0318] FGF14 chr13, bp 101919879 to 102403137, from hg38

[0319] SEQ ID NO:6 (MCIDAS) (see Table 1)

[0320] MCIDAS chr5, bp 55220951 to 55221051, from hg38

[0321] SEQ ID NO:7 (ST6GALNAC5) (see Table 1)

[0322] ST6GALNAC5 chr1, bp 76866255 to 77063388, from hg38

[0323] SEQ ID NO:8 (LONRF2) (see Table 1)

[0324] LONRF2 chr2, bp 100285667 to 100323015, from hg38

[0325] SEQ ID NO:9 (PDGFD) (see Table 1)

[0326] PDGFD, chromosome 11, bp 104163499 to 104164026, from hg38

[0327] SEQ ID NO:10 (GSG1L) (see Table 1)

[0328] GSG1L, chromosome 16, bp 27920615 to 28064275, from hg38

[0329] SEQ ID NO:11 (ZNF492) (see Table 1)

[0330] ZNF492, chromosome 19, bp 22633051 to 22666433, from hg38

[0331] SEQ ID NO:12 (ZNF568) (see Table 1)

[0332] ZNF568, chromosome 19, bp 36916312 to 36943940, from hg38

[0333] SEQ ID NO:13 (ADAMTS2) (see Table 1)

[0334] ADAMTS2, chromosome 5, bp 179118114 to 179344392, from hg38

[0335] SEQ ID NO:14 (ZNF542) (see Table 1)

[0336] ZNF542, chromosome 19, bp 56367838 to 56370986, from hg38

[0337] SEQ ID NO:15 (ZNF471) (see Table 1)

[0338] ZNF471, chromosome 19, bp 56507245 to 56508589, from hg38

[0339] SEQ ID NO:16 (CNRIP1) (see Table 1)

[0340] CNRIP1, chromosome 2, bp 68293114 to 68320928, from hg38

[0341] SEQ ID NO:17 (see Table 7)

[0342] CCTCCTCACCCATCATCAGCGCCCGCGGCTTTGGGTGGCCGACCAGAGGGCGGCCGGAAAGCACCTCGGTGCCCCGCGACCCTCCGAACAGAGGCGGCGGGAGGTACC

[0343] SEQ ID NO:18 (See Table 7)

[0344] GCGTGCTGGGTTTAATCTTCACCTCAACCTTGTAGGAGGAGCCGGTGAGCAGCTTGATGGTGCGGTTCTGGCCGAAGCGCTGCCCGTCCACCTTGTAAAAGACCGGGCCGT

[0345] SEQ ID NO:19 (See Table 7)

[0346] AGGAAGCAAAGTGACCCCTAAGCCTAGACAAAGCTCTCGAAAGCCCAAAGCCTCGGGCCCACCGGCCAGCTCCCCACCCCGCTGCTGGGCCGGACAGGTGTAGGGGAGGCGGACC

[0347] SEQ ID NO:20 (See Table 7)

[0348] CTCTCAGTCCCGCCGGCTTAGGTAACCCAGGTCGCTGCGGTAACGCAGTGACCGCGCTCCAGGTCCGCGTCTCTTGC

[0349] SEQ ID NO:21 (See Table 7)

[0350] CCACTGCGAAGGGAAGGGGCATTCCGCCAGGCGACCCCAGAAGCCAGCCTGCACCTCCCCGGCTTTCCTGCAACCGGGAAGGGGCGTTAACAGGG

[0351] SEQ ID NO:22 (See Table 7)

[0352] GCGACCCCAGAAGCCAGCCTGCACCTCCCCGGCTTTCCTGCAACCGGGAAGGGGCGTTAACAGGGCCACCACTCCGGGGCTCCGCCACTCCCCAGCCGTT

[0353] SEQ ID NO:23 (See Table 7)

[0354] CAACGGAAACTTCCCGCGCTACGGCGGCTCCAACGGGCCGCTTCCGCCGCATTGCGTAGCGAAGCCCCCGGCGAG

[0355] SEQ ID NO:24 (See Table 7)

[0356] CAAAGCGTCTGGGGCGCTAGTGGGGGCGGCCAGCGGCTCGAGCGCCGGGGGCAGCAGCAGAGGAGGCGGCTCCGGCTCCGGGGCGTCGGACCTGGGTGCCGGGAGCAAGAAGT

[0357] SEQ ID NO:25 (See Table 7)

[0358] CGCTCAGCCGCTCTCCTCTTCTCTCTCCCGCCCGCCCGCAGCGCCATGGTCTGGCAGTGTGTTTAGCGCT

[0359] SEQ ID NO:26 (See Table 7)

[0360] GGGTTCGGAGCGTGCAAAAGGTGACCTAGGCGCGCTACGCACCACGCACTCAGCGGTACTCTCCTCTCCCGGGCCCCCACGGGTCCCGATGCTGGGCGGGGATGCACTGAACTGTTC

[0361] SEQ ID NO:27 (See Table 7)

[0362] GCGCCCCACTTACATCCAGCACCGAGGCCAGGTGCCGGGTTCGGCTGGCGAGTTCCTTCAGCTGCACGTTCCGCTCCTTGAGCGAGGCGATCTCCTCCTGTTTCTGGGTCAATGTCACGT

[0363] SEQ ID NO:28 (See Table 7)

[0364] AACGTCTATCACCCAGGGAAAGCTACTCTTGACTCCTTCCACCTATCAAAATTGCCTAAGAAAGGTTGAGTCTGACCAAGGGGCGGCGCAGCTTGCAACTTTCGCCAACTCCGGGA

[0365] SEQ ID NO:29 (See Table 7)

[0366] GGTGCATTTGGGATCAGCGACTAGAGACAGCGTCGCTCCAAGAAAAAGCCGGGTTCTGCTCCCGGGACCGACGCCGCGCCGCCCTGCGCTCTCGCCGCCTGCGCTCGCCCTGCGCTGGCCCGGGTCGCTGTGCTAATC

[0367] SEQ ID NO:30 (See Table 7)

[0368] CCGAAAGAAATCCGAGCCAGGGTGAGGGTCTGAGACGCAAGGAGAATCCCAGGCAAGGCGCTCCTGAGAAAAGATCCCCACGGCGGACGTGGGGCAACAAAACC

[0369] SEQ ID NO:31 (See Table 7)

[0370] CGAGAGAGGGGAAGGGGCTGGTTGGAACCGGTGGCAAGAGGCTGTGGCGGGACTCAGGCCTCCCCGCAGTCGGCTCCACAATCTGCGCCCCAAGTTCG

[0371] SEQ ID NO:32 (See Table 7)

[0372] GCCCAAGCCTCACCCTCACACAGGAAAGCAGATGTGTTCTGGCCGGAAGTTGAGTGGGGCCGCGGGGCCTGCTGGGAGGTGTTGTCCTCGGAAACGTCGCTGGCGCGGAGGGATGGTTCG

[0373] SEQ ID NO:33 (See Table 7)

[0374] GGTCGCCTTCACCCAGCATCTCAGAAACTGCGCGCGGGATGAACATTCGGGTGTTTCCGGCAGGTGACGCTG

[0375] SEQ ID NO:34 (See Table 7)

[0376] CCAGAGGCCCAGGGATCCGTTCAGGTCAGCGCTGGCGTCCGGGCCTGAGTTTGGAGGTGGCGGGTGCCTTACAAGAATGCTCGCGT

[0377] SEQ ID NO:35 (See Table 7)

[0378] GGGAGGAGTGGGCGGCTGAATGGCCAGAGGCCCAGGGATCCGTTCAGGTCAGCGCTGGCGTCCGGGCCTGAGTTTGGAGGTGGCGGGTGC

[0379] SEQ ID NO:36 (See Table 7)

[0380] CCCCACGCGTACTCACACCGAAGGCTCAGCCGTCGCGCGTTTCCCTCCCAGGCCCCAGGAACTAGTAACTAGGGACGCTTCTGGTCTCTAGGCGAGGAGAGGGGGAGAGCGCAATCTTTGCGCCTGCGCACACTCCTGCTCTTACCCGC

[0381] SEQ ID NO:37 (See Table 7)

[0382] GTCGCGCGTTTCCCTCCCAGGCCCCAGGAACTAGTAACTAGGGACGCTTCTGGTCTCTAGGCGAGGAGAGGGGGAGAGCGCAATCTTTGCGCCTGCGCACACTCCTGCTCTTACCCGC

[0383] SEQ ID NO:38 (See Table 7)

[0384] CTGCTCTTACCCGCCGGAACCCTGGGCCACGCCCGGCTCGCGTAATCACGCACTGCGCAGGCACCGCCCGCTCTGCTCTAAGGTCCCTC

[0385] SEQ ID NO:39 (See Table 7)

[0386] CTACTGCTAGGTCGTTGCCAAGGTGATTGAGGAATGGCGTTTATTGCGTCGCTGCTCAGGCAACGCAAACTACATTATCCAGAAGGACCCTCGCGGTGCCTCAGGGCTGGCCATTGGCAGCCGAGGAGACAGGCACTTCCGGGCGGAGTGTAAGACGCTGGCCAATCA

[0387] SEQ ID NO:40 (See Table 7)

[0388] GTGTAAGACGCTGGCCAATCACAGCCTGGCAGCGGGACTTCCGTCGTCGTCCTCGGACCATCACTTTGGCATTTCTCGATTTTGTCTGCTTCTGAAGGGACCGCGTTGT

[0389] SEQ ID NO:41 (See Table 7)

[0390] CCGCGTGGTCTGGGCTCTGTAGCGTCCCAGCTGAGCCGGCGATATGCAGCGCACTTGTGGGGCGGAGGTGGAGGGAATTC

[0391] SEQ ID NO:42 (See Table 7)

[0392] CAACGTTAAAGGCAAACACCTTCTGCGGTGTGCTTGGCTCAGCTCAGGCAGGAAGCCCTGCCTGAAAAGGCTGCACCTTCGGCTGTCACTCTGTCCTCATTCGGCC

[0393] SEQ ID NO:43 (See Table 7)

[0394] GCCGGTGAGCAGCTTGATGGTGCGGTTCTGGCCGAAGCGCTGCCCGTCCACCTTGTAAAAGACCGGGCCGT

[0395] SEQ ID NO:44 (See Table 7)

[0396] CGGGAAGGGGCGTTAACAGGGCCACCACTCCGGGGCTCCGCCACTCCCCAGCCGTTCCCTCCTCCGGAGACCTTGCCTGCCAAGA

[0397] SEQ ID NO:45 (See Table 13)

[0398] CCTCCTCACCCATCATCAGCGCCC

[0399] SEQ ID NO:46 (See Table 13)

[0400] GGTACCTCCCGCCGCCTCTGTTC

[0401] SEQ ID NO:47 (See Table 13)

[0402] GCGTGCTGGGTTTAATCTTCACCTCAA

[0403] SEQ ID NO:48 (See Table 13)

[0404] ACGGCCCGGTCTTTTACAAGGTGG

[0405] SEQ ID NO:49 (See Table 13)

[0406] AGGAAGCAAAGTGACCCCTAAGCCT

[0407] SEQ ID NO:50 (See Table 13)

[0408] GGTCCGCCTCCCCTACACCT

[0409] SEQ ID NO:51 (See Table 13)

[0410] CTCTCAGTCCCGCCGGCTTAGGTA

[0411] SEQ ID NO:52 (See Table 13)

[0412] GCAAGAGACGCGGACCTGGAGC

[0413] SEQ ID NO:53 (See Table 13)

[0414] CCACTGCGAAGGGAAGGGGCA

[0415] SEQ ID NO:54 (See Table 13)

[0416] CCCTGTTAACGCCCCTTCCCGGTT

[0417] SEQ ID NO:55 (See Table 13)

[0418] GCGACCCCAGAAGCCAGCCT

[0419] SEQ ID NO:56 (See Table 13)

[0420] AACGGCTGGGGAGTGGCGGA

[0421] SEQ ID NO:57 (See Table 13)

[0422] CAACGGAAACTTCCCGCGCTAC

[0423] SEQ ID NO:58 (See Table 13)

[0424] CTCGCCGGGGGCTTCGCTAC

[0425] SEQ ID NO:59 (See Table 13)

[0426] CAAAGCGTCTGGGGCGCTAGT

[0427] SEQ ID NO:60 (See Table 13)

[0428] ACTTCTTGCTCCCGGCACCCAGGTC

[0429] SEQ ID NO:61 (See Table 13)

[0430] CGCTCAGCCGCTCTCCTCTTCTCT

[0431] SEQ ID NO:62 (See Table 13)

[0432] AGCGCTAAACACACTGCCAGACCA

[0433] SEQ ID NO:63 (See Table 13)

[0434] GGGTTCGGAGCGTGCAAAAGGTGA

[0435] SEQ ID NO:64 (See Table 13)

[0436] GAACAGTTCAGTGCATCCCCGCCC

[0437] SEQ ID NO:65 (See Table 13)

[0438] GCGCCCCACTTACATCCAGCACC

[0439] SEQ ID NO:66 (See Table 13)

[0440] ACGTGACATTGACCCAGAAACAGGAGGA

[0441] SEQ ID NO:67 (See Table 13)

[0442] AACGTCTATCACCCAGGGAAAGCT

[0443] SEQ ID NO:68 (See Table 13)

[0444] TCCCGGAGTTGGCGAAAGTTGCAA

[0445] SEQ ID NO:69 (See Table 13)

[0446] GGTGCATTTGGGATCAGCGACTAGAGAC

[0447] SEQ ID NO:70 (See Table 13)

[0448] GATTAGCACAGCGACCCGGGCCAG

[0449] SEQ ID NO:71 (See Table 13)

[0450] CCGAAAGAAATCCGAGCCAGGGTGA

[0451] SEQ ID NO:72 (See Table 13)

[0452] GGTTTTGTTGCCCCACGTCC

[0453] SEQ ID NO:73 (See Table 13)

[0454] CGAGAGAGGGGAAGGGGCTGGTTG

[0455] SEQ ID NO:74 (See Table 13)

[0456] CGAACTTGGGGCGCAGATTGTGG

[0457] SEQ ID NO:75 (See Table 13)

[0458] GCCCAAGCCTCACCCTCACACAG

[0459] SEQ ID NO:76 (See Table 13)

[0460] CGAACCATCCCTCCGCGCCA

[0461] SEQ ID NO:77 (See Table 13)

[0462] GGTCGCCTTCACCCAGCATCTCAG

[0463] SEQ ID NO:78 (See Table 13)

[0464] CAGCGTCACCTGCCGGAAACACC

[0465] SEQ ID NO:79 (See Table 13)

[0466] CCAGAGGCCCAGGGATCCGTTCAG

[0467] SEQ ID NO:80 (See Table 13)

[0468] ACGCGAGCATTCTTGTAAGGCACCC

[0469] SEQ ID NO:81 (See Table 13)

[0470] GGGAGGAGTGGGCGGCTGAATGG

[0471] SEQ ID NO:82 (See Table 13)

[0472] GCACCCGCCACCTCCAAACTCAG

[0473] SEQ ID NO:83 (See Table 13)

[0474] CCCCACGCGTACTCACACCGAAG

[0475] SEQ ID NO:84 (See Table 13)

[0476] GCGGGTAAGAGCAGGAGTGTG

[0477] SEQ ID NO:85 (See Table 13)

[0478] GTCGCGCGTTTCCCTCCCAG

[0479] SEQ ID NO:86 (See Table 13)

[0480] GCGGGTAAGAGCAGGAGTGTG

[0481] SEQ ID NO:87 (See Table 13)

[0482] CTGCTCTTACCCGCCGGAACCCTG

[0483] SEQ ID NO:88 (See Table 13)

[0484] GAGGGACCTTAGAGCAGAGCGGGC

[0485] SEQ ID NO:89 (See Table 13)

[0486] CTACTGCTAGGTCGTTGCCAAGG

[0487] SEQ ID NO:90 (See Table 13)

[0488] TGATTGGCCAGCGTCTTACACTCCG

[0489] SEQ ID NO:91 (See Table 13)

[0490] GTGTAAGACGCTGGCCAATCACA

[0491] SEQ ID NO:92 (See Table 13)

[0492] ACAACGCGGTCCCTTCAGAAGCAG

[0493] SEQ ID NO:93 (See Table 13)

[0494] CCGCGTGGTCTGGGCTCTGTAG

[0495] SEQ ID NO:94 (See Table 13)

[0496] GAATTCCCTCCACCTCCGCCCCAC

[0497] SEQ ID NO:95 (See Table 13)

[0498] CAACGTTAAAGGCAAACACCTTCTGC

[0499] SEQ ID NO:96 (See Table 13)

[0500] GGCCGAATGAGGACAGAGTGACAG

[0501] SEQ ID NO:97 (See Table 13)

[0502] GCCGGTGAGCAGCTTGATGGT

[0503] SEQ ID NO:98 (See Table 13)

[0504] ACGGCCCGGTCTTTTACAAGG

[0505] SEQ ID NO:99 (See Table 13)

[0506] CGGGAAGGGGCGTTAACAGGGC

[0507] SEQ ID NO:100 (See Table 13)

[0508] TCTTGGCAGGCAAGGTCTCCGGAG

Claims

1. Use of a reagent for determining methylation status in the preparation of a kit for screening colorectal cancer, the reagent comprising: Reagents for determining the methylation status of the DMR shown by SEQ ID NO:23 in FGF14 in the DNA of a human subject, and reagents for determining the methylation status of the DMR shown by SEQ ID NO:37 in ZNF471 The kit is used for performing a detection comprising the following steps: a) Determining the methylation status of the DMR shown by SEQ ID NO:23 in FGF14 and the DMR shown by SEQ ID NO:37 in ZNF471 in the DNA of a human subject b) Comparing the obtained data with a reference value obtained from a healthy individual, and c) If hypermethylation is detected in the DMR shown by SEQ ID NO:23 in FGF14 and the DMR shown by SEQ ID NO:37 in ZNF471 compared with the reference sample, diagnosing the subject with colorectal cancer 2. The application according to claim 1, wherein, The reagents further include: reagents for determining the methylation status of at least one DMR of LONRF2 and at least one DMR of PDGFD 3. The application according to claim 1, wherein, The reagents further include: reagents for determining the methylation status of at least one DMR of PDGFD 4. The application according to claim 1, wherein The reagents further include: reagents for determining the methylation status of at least one DMR of PDGFD and at least one DMR of ADAMTS2 5. The application according to claim 1, wherein The reagents further include: reagents for determining the methylation status of at least one DMR of PDGFD, at least one DMR of ADAMTS2, at least one DMR of ZNF492, and at least one DMR of ST6GALNAC5 6. The application according to claim 1, wherein, The reagents further include: reagents for determining the methylation status of at least one DMR of PDGFD, at least one DMR of ADAMTS2, at least one DMR of ZNF492, at least one DMR of ST6GALNAC5, at least one DMR of ZNF542, at least one DMR of LONRF2, at least one DMR of ZNF132, at least one DMR of CNRIP1, and at least one DMR of ALK 7. The application according to claim 1, wherein, The DNA is isolated from the blood, plasma, urine, saliva, or feces of a human subject 8. The application according to claim 1, wherein, The DNA is cell-free DNA of the human subject 9. The application according to claim 1, wherein The sensitivity of the kit for colorectal cancer is at least 0.6 10. The application according to claim 1, wherein, The specificity of the kit for colorectal cancer is at least 0.7 11. The application according to claim 1, wherein, Determining the methylation status using one or more selected from the group consisting of methylation-sensitive restriction enzyme quantitative polymerase chain reaction (MSRE-qPCR), methylation-specific PCR, methylation-specific nuclease-assisted small-allele enrichment PCR, and next-generation sequencing

Images