Compositions and Methods for Selective Gene Regulation

By designing a non-natural transcription factor expression cassette containing DNA binding domain and transcription activation domain, and using AAV viral vectors to deliver to PV neurons, the immune response and off-target effects of gene therapy in central nervous system diseases were solved, and the specific upregulation of the SCN1A gene and the improvement of the therapeutic effect were achieved.

CN114174520BActive Publication Date: 2025-07-08ENCODED THERAPEUTICS INC
View PDF 19 Cites 0 Cited by

Patent Information

Application Number
CN202080054248.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2020-04-10
Filing Date
2020-05-29
Publication Date
2025-07-08
Estimated Expiration
2040-05-29

AI Technical Summary

Technical Problem

In the treatment of central nervous system diseases such as Dravet syndrome, the existing technology has challenges such as immune responses, off-target effects and short maintenance time of treatment effects caused by gene therapy, and lacks effective gene expression regulation methods.

Method used

An expression cassette containing non-naturally occurring transcription factors, with DNA binding domains and transcription activation domains, was designed to specifically upregulate SCN1A gene expression, delivered to target cells using AAV viral vectors, and bind to selective microRNA binding sites in PV neurons to regulate gene expression.

Benefits of technology

It has achieved specific upregulation of SCN1A gene expression in the central nervous system, reducing immune response and off-target effects, improving treatment effect, significantly reducing epilepsy frequency and improving survival rate.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114174520B_ABST
    Figure CN114174520B_ABST
Patent Text Reader

Abstract

The present disclosure provides engineered transcription factors for selectively upregulating SCN1a and their use in treating diseases and conditions such as Dravet syndrome. MicroRNA binding sites are also provided and their use for selective expression in parvalbumin neurons.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-reference

[0002] This application claims the benefit of U.S. Provisional Patent Application No. 62 / 854,238, filed May 29, 2019, U.S. Provisional Patent Application No. 62 / 857,727, filed Jun. 5, 2019, and U.S. Provisional Patent Application No. 63 / 008,569, filed Apr. 10, 2020, each of which is hereby incorporated by reference in its entirety.

[0003] Sequence Listing

[0004] This application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy, created on May 28, 2020, is named 46482-724_601_SL.txt and is 418,483 bytes in size. BACKGROUND OF THE INVENTION

[0005] Numerous human diseases are associated with abnormal gene expression. In some cases, genetic mutations in a gene can lead to its dysregulation, downregulation, or complete lack of expression, resulting in haploinsufficiency. In some cases, genetic mutations in a gene can lead to its upregulation, resulting in overexpression of the gene. There are many challenges in treating genetic disorders or diseases. One approach is gene therapy, which involves the therapeutic delivery of nucleic acids into patient cells. However, various challenges associated with gene therapy remain unresolved, such as unwanted immune responses, off-target effects, limitations on the cloning capacity of gene therapy vectors (e.g., viruses), and maintaining therapeutic effects over extended periods of time. The central nervous system (CNS) presents many unique challenges for developing therapies to address potential impairments in gene and / or protein expression. While there are some drugs that can help control the symptoms of CNS diseases / conditions, many CNS diseases / conditions, such as Dravet syndrome, lack specific treatments or cures. Accordingly, there is a need for new compositions and methods that can regulate the expression of any endogenous gene to help reverse the effects of a disease or condition, particularly therapies with reduced immunogenicity, reduced off-target effects, increased target gene specificity, and / or increased therapeutic efficacy. SUMMARY OF THE INVENTION

[0006] In one aspect, the present application provides an expression cassette comprising a sequence encoding a non-naturally occurring transcription factor that increases the expression of the SCN1A gene in cells, wherein the non-naturally occurring transcription factor comprises a DNA binding domain (DBD) operably linked to at least two transcription activation domains (TADs) in the following manner: TAD1-TAD2-DBD, DBD-TAD3-TAD4, or TAD1-TAD2-DBD-TAD3-TAD4. In certain embodiments, TAD1, TAD2, TAD3, and TAD4 are independently selected from the following: VP16, VP64, Viper, CITED2, CITED4, CREB3, or functional fragments thereof. In certain embodiments, TAD1 and TAD2 are the same TAD. In certain embodiments, TAD1 and TAD2 are CITED2 or a functional fragment thereof. In certain embodiments, TAD1 and TAD2 are CITED4 or a functional fragment thereof. In certain embodiments, TAD3 and TAD4 are the same TAD. In certain embodiments, TAD3 and TAD4 are CITED2 or a functional fragment thereof. In certain embodiments, TAD3 and TAD4 are CITED4 or a functional fragment thereof. In certain embodiments, TAD1, TAD2, TAD3, and TAD4 are the same TAD. In certain embodiments, TAD1, TAD2, TAD3, and TAD4 are CITED2 or a functional fragment thereof. In certain embodiments, TAD1, TAD2, TAD3, and TAD4 are CITED4 or a functional fragment thereof.

[0007] In certain embodiments, there is no linker between the at least two TAD domains.

[0008] In certain embodiments, there is a linker between the at least two TAD domains. In certain embodiments, the linker comprises GGSGGGSG (SEQ ID NO:177) or GGSGGGSGGGSGGGSG (SEQ ID NO:178) or consists of the same.

[0009] In certain embodiments, the DBD binds to a genomic region having 18-27 nucleotides.

[0010] In certain embodiments, the DBD has at least 80% sequence identity with its closest human counterpart. In certain embodiments, the DBD has at least 90% sequence identity with its closest human counterpart. In certain embodiments, the DBD and the at least two TADs each have at least 80% sequence identity with their closest human counterparts. In certain embodiments, the DBD and the at least two TADs each have at least 90% sequence identity with their closest human counterparts.

[0011] In certain embodiments, the DBD comprises a guide RNA and a nuclease-inactivated Cas protein. In certain embodiments, the nuclease-inactivated Cas protein is nuclease-inactivated Cas9.

[0012] In certain embodiments, the DBD comprises a zinc finger domain. In certain embodiments, the DBD comprises 6 to 9 zinc finger domains. In certain embodiments, the DBD comprises 6 zinc fingers. In certain embodiments, the DBD binds to a genomic region of 18 nucleotides. In certain embodiments, the DBD comprises 9 zinc fingers. In certain embodiments, the DBD binds to a genomic region of 27 nucleotides.

[0013] In certain embodiments, the DBD comprises a sequence having at least 95% sequence identity to any one of SEQ ID NOs: 148 - 151. In certain embodiments, the DBD comprises a sequence of any one of SEQ ID NOs: 148 - 151.

[0014] In certain embodiments, the DBD is derived from human EGR1 or human EGR3.

[0015] In certain embodiments, the DBD comprises a sequence having at least 90% identity to any one of SEQ ID NOs: 77 - 98. In certain embodiments, the DBD comprises SEQ ID NOs: 77 - 98.

[0016] In certain embodiments, the DBD comprises a sequence having at least 90% identity to SEQ ID NO: 92. In certain embodiments, the DBD comprises SEQ ID NO: 92.

[0017] In certain embodiments, the non-naturally occurring transcription factor comprises a sequence having at least 90% identity to SEQ ID NO: 130 or 131. In certain embodiments, the non-naturally occurring transcription factor comprises SEQ ID NO: 130 or 131.

[0018] In certain embodiments, the expression cassette comprises a nucleotide sequence having at least 90% identity to any one of SEQ ID NOs: 72 or 73. In certain embodiments, the expression cassette comprises a nucleotide sequence of any one of SEQ ID NOs: 72 or 73.

[0019] In certain embodiments, the expression cassette further comprises a regulatory element that drives expression of the transcription factor at a higher level in PV neurons than in other cell types. In certain embodiments, the regulatory element comprises any one of SEQ ID NOs: 1-4. In certain embodiments, the regulatory element comprises SEQ ID NO: 2 or 3.

[0020] In certain embodiments, the expression cassette further comprises a PV-selective microRNA binding site. In certain embodiments, the PV-selective microRNA binding site has at least 90% identity with any one of SEQ ID NOs: 7, 14 or 15. In certain embodiments, the PV-selective microRNA binding site comprises any one of SEQ ID NOs: 7, 14 or 15.

[0021] In certain embodiments, the expression cassette is part of a viral vector. In certain embodiments, the viral vector is an AAV virus. In certain embodiments, the AAV virus is an AAV9 virus or an scAAV9 virus. In certain embodiments, the viral vector is a lentivirus.

[0022] In another aspect, the present application provides an expression cassette comprising a sequence encoding a non-naturally occurring transcription factor that increases the expression of the SCN1A gene in a cell, wherein the non-naturally occurring transcription factor comprises a DNA binding domain operably linked to a transcriptional activation domain, wherein the DNA binding domain is a zinc finger protein comprising the sequence LEPGEKP–[YKCPECGKSFS X HQRTHTGEKP]n-YKCPECGKSFS X HQRTH–TGKKTS (SEQ ID NO: 147), and wherein there is no HA tag (SEQ ID NO: 303) between the DNA binding domain and the transcriptional activation domain. In certain embodiments, the transcriptional activation domain comprises a VP16, VPR or VP64 sequence, or a functional fragment thereof. In certain embodiments, the transcriptional activation domain comprises VP64.

[0023] In certain embodiments, the DNA binding domain binds to a genomic region having 18 - 27 nucleotides. In certain embodiments, the DNA binding domain is a zinc finger domain comprising SEQ ID NO:147, wherein n = 6 to 9. In certain embodiments, the DNA binding domain is a zinc finger domain comprising SEQ ID NO:147, wherein n = 6. In certain embodiments, the DNA binding domain binds to a genomic region having 18 nucleotides. In certain embodiments, the DNA binding domain is a zinc finger domain comprising SEQ ID NO:147, wherein n = 9. In certain embodiments, the DNA binding domain binds to a genomic region having 27 nucleotides.

[0024] In certain embodiments, the DNA binding domain comprises a sequence having at least 95% sequence identity to any one of SEQ ID NOs:148 - 151. In certain embodiments, the DNA binding domain comprises a sequence of any one of SEQ ID NOs:148 - 151.

[0025] In certain embodiments, the DNA binding domain comprises a sequence having at least 90% identity to any one of SEQ ID NOs:77 - 91. In certain embodiments, the DNA binding domain comprises any one of SEQ ID NOs:77 - 91.

[0026] In certain embodiments, the expression cassette further comprises a regulatory element that drives expression of the transcription factor at a higher level in PV neurons than in other cell types. In certain embodiments, the regulatory element comprises any one of SEQ ID NOs:1 - 4. In certain embodiments, the regulatory element comprises SEQ ID NO:2 or 3.

[0027] In certain embodiments, the non - naturally occurring transcription factor comprises a sequence having at least 90% identity to SEQ ID NO:127. In certain embodiments, the non - naturally occurring transcription factor comprises SEQ ID NO:127.

[0028] In certain embodiments, the expression cassette comprises a nucleotide sequence having at least 90% identity to any one of SEQ ID NOs:93 or 71. In certain embodiments, the expression cassette comprises a nucleotide sequence of any one of SEQ ID NOs:93 or 71.

[0029] In certain embodiments, the expression cassette further comprises a PV-selective microRNA binding site. In certain embodiments, the PV-selective microRNA binding site has at least 90% identity to any one of SEQ ID NO:7, 14, or 15. In certain embodiments, the PV-selective microRNA binding site comprises any one of SEQ ID NO:7, 14, or 15.

[0030] In certain embodiments, the expression cassette is part of a viral vector. In certain embodiments, the viral vector is an AAV virus. In certain embodiments, the AAV virus is an AAV9 virus or an scAAV9 virus. In certain embodiments, the viral vector is a lentivirus.

[0031] In another aspect, the present application provides a polynucleotide comprising a PV-selective microRNA binding site, the PV-selective microRNA binding site comprising a sequence having at least 80% sequence identity to SEQ ID NO:14 or 15, wherein the microRNA binding site reduces the expression of a transgene in excitatory neurons. In certain embodiments, the PV-selective microRNA binding site comprises SEQ ID NO:14. In certain embodiments, the PV-selective microRNA binding site comprises SEQ ID NO:15. In another aspect, the present application provides an expression cassette comprising a PV-selective microRNA binding site and a promoter and / or enhancer. In certain embodiments, the promoter and / or enhancer is a PV-selective regulatory element that drives the expression of a transgene at a higher level in parvalbumin (PV) neurons than in other cell types. In certain embodiments, the PV-selective regulatory element is operably linked to the transgene.

[0032] In another aspect, the present application provides an expression cassette comprising a regulatory element operably linked to a transgene and at least one microRNA binding site, wherein the regulatory element drives expression of the transgene at a higher level in parvalbumin (PV) neurons than in other cell types, and wherein the microRNA binding site reduces expression of the transgene in excitatory neurons. In certain embodiments, the expression cassette does not comprise SEQ ID NO:67. In certain embodiments, the microRNA binding site comprises at least one binding site for MIR128 (SEQ ID NO:9). In certain embodiments, the microRNA binding site comprises at least one binding site for MIR221 (SEQ ID NO:11). In certain embodiments, the microRNA binding site comprises at least one binding site for MIR222 (SEQ ID NO:13). In certain embodiments, the microRNA binding site comprises at least one binding site for MIR128 (SEQ ID NO:9) and at least one binding site for MIR221 (SEQ ID NO:11). In certain embodiments, the microRNA binding site comprises at least one binding site for MIR128 (SEQ ID NO:9), at least one binding site for MIR221 (SEQ ID NO:11) and at least one binding site for MIR222 (SEQ ID NO:13). In certain embodiments, the microRNA binding site comprises a sequence having at least 90% identity to any one of SEQ ID NO:7, 14 or 15. In certain embodiments, the microRNA binding site comprises SEQ ID NO:7, 14 or 15.

[0033] In certain embodiments, the transgene encodes a polypeptide comprising a non-naturally occurring transcription factor that increases expression of the SCN1A gene in a cell. In certain embodiments, the transcription factor binds to a genomic region having 18 - 27 nucleotides. In certain embodiments, the transcription factor comprises a DNA binding domain. In certain embodiments, the transcription factor comprises a DNA binding domain and a transcriptional activation domain.

[0034] In certain embodiments, the DNA binding domain has at least 80% sequence identity to its closest human counterpart. In certain embodiments, the DNA binding domain has at least 90% sequence identity to its closest human counterpart. In certain embodiments, both the DNA binding domain and the transcriptional activation domain have at least 80% sequence identity to their closest human counterparts. In certain embodiments, both the DNA binding domain and the transcriptional activation domain have at least 90% sequence identity to their closest human counterparts.

[0035] In certain embodiments, the DNA binding domain comprises a guide RNA and a nuclease-inactivated Cas protein. In certain embodiments, the nuclease-inactivated Cas protein is nuclease-inactivated Cas9.

[0036] In certain embodiments, the DNA binding domain comprises a zinc finger domain. In certain embodiments, the DNA binding domain comprises 6 to 9 zinc finger domains. In certain embodiments, the DNA binding domain comprises 6 zinc fingers. In certain embodiments, the DNA binding domain binds to a genomic region having 18 nucleotides. In certain embodiments, the DNA binding domain comprises 9 zinc fingers. In certain embodiments, the DNA binding domain binds to a genomic region having 27 nucleotides.

[0037] In certain embodiments, the DNA binding domain comprises a sequence having at least 95% sequence identity to any one of SEQ ID NOs: 148-151. In certain embodiments, the DNA binding domain comprises a sequence of any one of SEQ ID NOs: 148-151. In certain embodiments, the DNA binding domain comprises a sequence having at least 90% identity to any one of SEQ ID NOs: 92-98. In certain embodiments, the DNA binding domain comprises any one of SEQ ID NOs: 92-98.

[0038] In certain embodiments, the DNA binding domain is a zinc finger protein comprising the sequence LEPGEKP–[YKCPECGKSFS X HQRTHTGEKP]n-YKCPECGKSFS X HQRTH–TGKKTS (SEQ ID NO: 147).

[0039] In certain embodiments, the DNA binding domain comprises a sequence having at least 90% identity to any one of SEQ ID NOs: 77-91. In certain embodiments, the DNA binding domain comprises any one of SEQ ID NOs: 77-91.

[0040] In certain embodiments, the DNA binding domain is derived from human EGR1 or human EGR3.

[0041] In certain embodiments, the transcriptional activation domain comprises a VP16, VPR, VP64, CITED2, CITED4, or CREB3 sequence, or a functional fragment thereof. In certain embodiments, the transcriptional activation domain comprises a human CITED2, CITED4, or CREB3 sequence, or a functional fragment thereof.

[0042] In certain embodiments, the regulatory element comprises a sequence having any one of SEQ ID NOs: 1-4. In certain embodiments, the regulatory element comprises a sequence having SEQ ID NO: 2 or 3.

[0043] In certain embodiments, the non-naturally occurring transcription factor comprises a sequence having at least 90% identity to any one of SEQ ID NOs: 105, 106, and 127-129. In certain embodiments, the non-naturally occurring transcription factor comprises any one of SEQ ID NOs: 105, 106, and 127-129.

[0044] In certain embodiments, the transgene comprises a nucleotide sequence having at least 90% identity to any one of SEQ ID NOs: 71, 74, 75, 76, or 184. In certain embodiments, the transgene comprises any one of SEQ ID NOs: 71, 74, 75, 76, or 184.

[0045] In certain embodiments, the expression cassette is part of a viral vector. In certain embodiments, the viral vector is an AAV virus. In certain embodiments, the AAV virus is an AAV9 virus or an scAAV9 virus. In certain embodiments, the viral vector is a lentivirus.

[0046] In another aspect, the present application provides a method for selectively expressing a transgene in parvalbumin (PV) neurons of a primate, comprising administering to the primate a viral vector comprising the transgene and at least one microRNA binding site, wherein the microRNA binding site reduces the expression of the transgene in excitatory neurons.

[0047] In certain embodiments, the viral vector further comprises a regulatory element operably linked to the transgene, wherein the regulatory element drives the expression of the transgene at a higher level in parvalbumin (PV) neurons than in other cell types.

[0048] In certain embodiments, the microRNA binding site comprises at least one binding site for MIR128 (SEQ ID NO:9). In certain embodiments, the microRNA binding site comprises at least one binding site for MIR221 (SEQ ID NO:11). In certain embodiments, the microRNA binding site comprises at least one binding site for MIR222 (SEQ ID NO:13). In certain embodiments, the microRNA binding site comprises at least one binding site for MIR128 (SEQ ID NO:9) and at least one binding site for MIR221 (SEQ ID NO:11). In certain embodiments, the microRNA binding site comprises at least one binding site for MIR128 (SEQ ID NO:9), at least one binding site for MIR221 (SEQ ID NO:11) and at least one binding site for MIR222 (SEQ ID NO:13). In certain embodiments, the microRNA binding site comprises a sequence having at least 90% identity to any one of SEQ ID NO:7, 14 or 15. In certain embodiments, the microRNA binding site comprises SEQ ID NO:7, 14 or 15.

[0049] In certain embodiments, the transgene comprises a sequence encoding a non-naturally occurring transcription factor that increases the expression of the SCN1A gene in a cell.

[0050] In certain embodiments, the transcription factor binds to a genomic region having 18 - 27 nucleotides.

[0051] In certain embodiments, the transcription factor comprises a DNA binding domain.

[0052] In certain embodiments, the transcription factor comprises a DNA binding domain and a transcriptional activation domain.

[0053] In certain embodiments, the DNA binding domain has at least 80% sequence identity to its closest human counterpart. In certain embodiments, the DNA binding domain has at least 90% sequence identity to its closest human counterpart. In certain embodiments, both the DNA binding domain and the transcriptional activation domain have at least 80% sequence identity to their closest human counterparts. In certain embodiments, both the DNA binding domain and the transcriptional activation domain have at least 90% sequence identity to their closest human counterparts.

[0054] In certain embodiments, the DNA binding domain comprises a guide RNA and a nuclease-inactivated Cas protein. In certain embodiments, the nuclease-inactivated Cas protein is nuclease-inactivated Cas9.

[0055] In certain embodiments, the DNA binding domain comprises a zinc finger domain. In certain embodiments, the DNA binding domain comprises 6 to 9 zinc finger domains. In certain embodiments, the DNA binding domain comprises 6 zinc fingers. In certain embodiments, the DNA binding domain binds to a genomic region of 18 nucleotides. In certain embodiments, the DNA binding domain comprises 9 zinc fingers. In certain embodiments, the DNA binding domain binds to a genomic region of 27 nucleotides.

[0056] In certain embodiments, the DNA binding domain comprises a sequence having at least 95% sequence identity to any one of SEQ ID NOs: 148-151. In certain embodiments, the DNA binding domain comprises a sequence of any one of SEQ ID NOs: 148-151.

[0057] In certain embodiments, the DNA binding domain is derived from human EGR1 or human EGR3.

[0058] In certain embodiments, the DNA binding domain comprises a sequence having at least 90% identity to any one of SEQ ID NOs: 92-98. In certain embodiments, the DNA binding domain comprises any one of SEQ ID NOs: 92-98.

[0059] In certain embodiments, the DNA binding domain is a zinc finger protein comprising the sequence LEPGEKP–[YKCPECGKSFS X HQRTHTGEKP]n-YKCPECGKSFS X HQRTH–TGKKTS (SEQ ID NO: 147).

[0060] In certain embodiments, the DNA binding domain comprises a sequence having at least 90% identity to any one of SEQ ID NOs: 77-91. In certain embodiments, the DNA binding domain comprises any one of SEQ ID NOs: 77-91.

[0061] In certain embodiments, the transcriptional activation domain comprises a VP16, VPR, VP64, CITED2, CITED4, or CREB3 sequence, or a functional fragment thereof. In certain embodiments, the transcriptional activation domain comprises a human CITED2, CITED4, or CREB3 sequence, or a functional fragment thereof.

[0062] In certain embodiments, the regulatory element comprises a sequence having any one of SEQ ID NOs: 1-4. In certain embodiments, the regulatory element comprises a sequence having SEQ ID NO: 2 or 3.

[0063] In certain embodiments, the non-naturally occurring transcription factor comprises a sequence having at least 90% identity to any one of SEQ ID NOs: 105, 106, and 127-129. In certain embodiments, the non-naturally occurring transcription factor comprises any one of SEQ ID NOs: 105, 106, and 127-129.

[0064] In certain embodiments, the transgene comprises a nucleotide sequence having at least 90% identity to any one of SEQ ID NOs: 71, 74, 75, 76, or 184. In certain embodiments, the transgene comprises any one of SEQ ID NOs: 71, 74, 75, 76, or 184.

[0065] In certain embodiments, the viral vector is an AAV virus. In certain embodiments, the AAV virus is an AAV9 virus or an scAAV9 virus. In certain embodiments, the viral vector is a lentivirus.

[0066] In certain embodiments, the primate is a human. In certain embodiments, the primate is a non-human primate. In certain embodiments, the non-human primate is an Old World monkey, an orangutan, a gorilla, a chimpanzee, a marmoset, a cynomolgus monkey, a rhesus monkey, or a pig-tailed monkey.

[0067] In another aspect, the present application provides an expression cassette comprising a sequence encoding a non-naturally occurring transcription factor that increases the expression of the SCN1A gene in a cell, wherein the non-naturally occurring transcription factor comprises a sequence having at least 90% identity to SEQ ID NO: 128 or 129. In certain embodiments, the non-naturally occurring transcription factor comprises SEQ ID NO: 128 or 129.

[0068] In another aspect, the present application provides a method of increasing the expression of SCN1A in a cell by administering any of the expression cassettes provided herein. In certain embodiments, the cell is a neuronal cell. In certain embodiments, the neuronal cell is selected from unipolar, bipolar, multipolar, or pseudounipolar neurons. In certain embodiments, the cell is a GABAergic neuron. In certain embodiments, the cell is a PV neuron. In certain embodiments, the cell is a non-neuronal cell. In certain embodiments, the cell is a glial cell. In certain embodiments, the glial cell is selected from astrocytes, oligodendrocytes, ependymal cells, Schwann cells, and satellite cells. In certain embodiments, the cell is within a subject. In certain embodiments, the subject is a mammal. In certain embodiments, the subject is a human. In certain embodiments, increasing the expression of SCN1A treats a disease, disorder, or symptom. In certain embodiments, the disorder is a central nervous system disorder. In certain embodiments, the disorder is epilepsy associated with SCN1A haploinsufficiency. In certain embodiments, the haploinsufficiency is the result of the subject being heterozygous for a loss-of-function mutation in the SCN1A gene. In certain embodiments, the disorder is epilepsy associated with an insertion, deletion, or substitution in the SCN1A gene. In certain embodiments, the disorder is epilepsy associated with a point mutation in the SCN1A gene. In certain embodiments, the disorder is Dravet syndrome. In certain embodiments, the symptom of the central nervous system disorder is excessive neuronal activity. In certain embodiments, treating the central nervous system disorder includes reducing excessive neuronal activity. In certain embodiments, the symptom of the central nervous system disorder is seizure. In certain embodiments, treating the central nervous system disorder includes reducing the frequency of seizures. In certain embodiments, treating the central nervous system disorder includes reducing the severity of seizures.

[0069] In another aspect, the present application provides a method of increasing the expression of SCN1A in the CNS by administering any of the expression cassettes provided herein. In certain embodiments, the expression cassette is administered by unilateral intracerebroventricular (ICV) injection. In certain embodiments, the expression cassette is administered by bilateral intracerebroventricular (ICV) injection. In certain embodiments, the increased SCN1A expression occurs in the brain. In certain embodiments, the increased SCN1A expression occurs in the frontal cortex, parietal cortex, temporal cortex, hippocampus, medulla, and / or occipital cortex. In certain embodiments, the increased SCN1A expression occurs in the spine. In certain embodiments, the increased SCN1A expression occurs in the spinal cord and / or dorsal root ganglion.

[0070] Incorporation by Reference

[0071] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference to the extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0072] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the invention will be obtained from the following detailed description that sets forth illustrative embodiments, together with the drawings in which:

[0073] Figure 1 Upregulation of endogenous SCN1A is shown using engineered transcription factors that bind to various regions on chromosome 2 (referenced to GRCh38.p12). Data are presented as fold change in SCN1A expression relative to the control (EGFP-KASH) condition.

[0074] Figure 2A 、 Figure 2B and Figure 2C Relative expression of endogenous SCN1A in HEK293 cells is shown using an SCN1A-specific transcriptional activator (see Table 1). Data are presented as fold change relative to the control condition and are shown on a Log 10 scale.

[0075] Figure 3A Relative expression of endogenous SCN1A in GABA neurons is shown using an SCN1A-specific transcriptional activator (construct 30). Data are presented as fold change relative to the control condition (CBA-EGFP).

[0076] Figure 3B Relative expression of endogenous SCN1A in GABA neurons is shown using SCN1A-specific transcriptional activators (constructs 25 and 16). Data are presented as fold change relative to the control condition (CBA-EGFP) on a Log 10 scale.

[0077] Figure 4 Relative expression of endogenous SCN1A and 40 nearest neighbor genes driven by an SCN1A-specific transcription factor (construct 30) is shown. Data are presented as fold change relative to the control condition (CBA-EGFP-KASH) on a Log 10 scale.

[0078] Figure 5A and Figure 5B Expression of an SCN1A-specific transcriptional activator in vivo is shown compared to a control expression cassette expressing eGFP. Figure 5AShown is the relative expression of the SCN1A gene in mice injected with control eGFP or construct 4 containing the SCN1A transcriptional activator. Figure 5B Changes in SCN1A expression are shown as mean eGFP percentage. These experiments demonstrate that transcriptional activation by construct 4 results in an upregulation of SCN1A expression of approximately 20-30%.

[0079] Figure 6A , Figure 6B , Figure 6C , Figure 6D , Figure 6E , Figure 6F and Figure 6G The expression of various SCN1A-specific transcription factors in Scn1a in Dravet syndrome compared with controls is shown. tm1Kea Effects on hyperthermic seizures in a knockout mouse model. P1 Scn1a + / - mice (heterozygous; HET) were infused with AAV9-EGFP or an AAV9 vector expressing a SCN1A-specific transcription factor (one of constructs 31-34, 42, and 43). At P26-P28, the infused mice were tested for hyperthermia-induced seizures, and their internal temperature was recorded as they experienced tonic-clonic seizures. Figure 6D A direct comparison between construct 32, which includes an HA tag between the DBD and the TAD, and construct 34, which does not include an HA tag, is shown. Figure 6E A direct comparison between construct 31, which contains the ml microRNA binding site between the coding region and the poly A tail, and construct 32, which does not contain the ml microRNA binding site, is shown. Figure 6H Shown is the expression of Scn1a in Dravet syndrome using construct 31 (compared to PBS-injected controls). RX Effects on febrile seizures in a mutant mouse model.

[0080] Figure 7A , Figure 7B , Figure 7C and Figure 7D Scn1a expression in Dravet syndrome under various conditions is shown tm1Kea Survival in knockout mouse models. Figure 7A Comparison between wild type (PBS WT) and Scn1a+ / - mice (PBS HET) in a survival assay is shown. P1 Scn1a+ / - (N=53) and Scn1a+ / + (N=54) mice were infused with PBS. Mice were observed daily in their home cages and the date was recorded if there was any death. There was a significant difference in survival between Scn1a+ / - and Scn1a+ / + animals (P<0.0001). Figure 7B-D shows the effect on survival in a mouse model of Dravet syndrome for mice treated with various SCN1A-specific transcription factors compared to controls. PBS or an AAV9 vector expressing an SCN1A-specific transcription factor (construct 31 or 33) was infused into P1 Scn1a+ / - mice. Mice were observed daily in their home cages, and the date of any death was recorded. Figure 7D A direct comparison between construct 31, which contains the m1 microRNA binding site located between the coding region and the polyA tail, and construct 33, which does not contain this m1 microRNA binding site, is shown. Figure 7E Shows survival in the Scn1a RX mutant mouse model of Dravet syndrome using construct 31 (compared to controls injected with PBS).

[0081] Figure 8 Shows relative Scn1A mRNA expression in different brain tissues after intrastrial delivery of an AAV9 vector encoding an SCN1A-specific transcription factor (construct 33), which was administered to two cynomolgus monkeys at 1.2 x 10 12 gc / animal and normalized relative to two untreated control animals. All animals were sacrificed 28 days after injection, and Scn1A mRNA in tissue samples was quantified by Taqman PCR. Data are reported as the normalized expression of the target mRNA in different tissue sections from the brain. Similar results were also recorded using a different set of Scnla gene-derived primers / probes.

[0082] Figure 9 A - F show the expression pattern of EGFP in the dentate gyrus region of the hippocampus of marmosets after treatment with an AAV9 vector that contains an EGFP transgene under the control of the EF1a promoter, an EGFP transgene under the control of the RE 2 promoter (SEQ ID NO:2), or an EGFP transgene under the control of the RE 2 promoter (SEQ ID NO:2) with an m1 microRNA binding site (SEQ ID NO:7) located between the EGFP coding region and the polyA site. For each vector treatment, a representative region of the hippocampal dentate gyrus region is shown. The top row shows nuclei stained with DAPI, while the bottom row shows GFP-positive regions stained with an anti-GFP antibody. In Figure 9 A (EF1a treatment), the hilus region of the hippocampal CA4 gyrus is outlined in yellow, and the arrow points to the granule cell layer of the dentate gyrus (DG). Figure 9 B and Figure 9C is centered on the same area. The CA4 region is highlighted - it is a mixture of excitatory and inhibitory interneurons as it is the only region significantly expressed under the RE 2+m1 condition. Through transgenic expression driven by EF1a and RE 2, GFP expression is more extensive and includes other regions of the hippocampus. It is thought that the DG cell layer mainly contains excitatory neurons. GFP expression driven by EF1a and RE 2 is visible in the DG cell layer ( Figure 9 D and Figure 9 E), but is absent in animals treated with RE 2+m1 ( Figure 9 F) (white arrow).

[0083] Figure 10 A-L show that after treatment with an AAV9 vector (containing an EGFP transgene under the control of the EF1a promoter, an EGFP transgene under the control of the RE 2 promoter (SEQ ID NO:2), or an EGFP transgene under the control of the RE 2 promoter (SEQ ID NO:2) with an m1 microRNA binding site (SEQ ID NO:7) located between the EGFP coding region and the polyA site), the expression pattern of EGFP in the dentate gyrus region of the marmoset hippocampus is mainly in parvalbumin (PV)-positive cells in animals treated with RE 2 and RE 2+m1. For each vector treatment, a representative region of the dentate gyrus region of the hippocampus is shown. The top row shows the GFP-positive region, and the bottom row shows the same region stained with an inhibitory interneuron marker against PV. Figure 10 The regions boxed in A-F are shown at Figure 10 G-L at a higher magnification. GFP expression driven by RE 2 and RE 2+m1 mainly co-localizes with the inhibitory interneuron marker PV ( Figure 10 H and 10K, 10I and 10L, white arrow), while in EG-EF1a, GFP expression is less readily localized to PV-positive cells ( Figure 10 G and 10J, white arrow). Additionally, compared to the less distinct cell body morphology in animals treated with EF1a ( Figure 10 G, yellow arrow), in animals treated with RE 2 and RE 2+m1, GFP-positive cells have an obvious interneuron morphology of highly branched cells with pyramidal cell bodies ( Figure 10 H and 10I, yellow arrow).

[0084] Figure 11 Shown is for AAV9-RE administered by unilateral intracerebroventricular (ICV) injection at 4.8E+13 or 8E+13 vg / animal GABA -eTF SCN1AFor animals treated, VG / diploid genome in tissue samples of the frontal cortex (FC), rostral parietal cortex (Rostral PC), temporal cortex (TC), caudal parietal cortex (Caudal PC), hippocampus (Hip), medulla (Med), and occipital cortex (OC) (Examples 10 and 11). Each data point represents the VG / diploid genome of a tissue sample, and the horizontal bar represents the average VG / diploid genome of all tissue samples for each animal.

[0085] Figure 12 Shows for animals treated by unilateral intracerebroventricular (ICV) administration of AAV9-RE at 4.8E+13 or 8E+13 vg / animal GABA -eTF SCN1A transcripts / μg RNA in tissue samples of the frontal cortex (FC), rostral parietal cortex (Rostral PC), temporal cortex (TC), caudal parietal cortex (Caudal PC), hippocampus (Hip), medulla (Med), and occipital cortex (OC) (Examples 10 and 11). Each data point represents the VG / diploid genome of a tissue sample, and the horizontal bar represents the average VG / diploid genome of all tissue samples for each animal. The average transcript of ARFGAP2 was 1.85E+6 / μg RNA and is represented by the upper border dashed line. The limit of detection is represented by the lower border dashed line.

[0086] Figure 13 Shows vector biodistribution (VG / diploid genome) and transgene expression (transcripts / μg RNA) in peripheral tissue samples outside the brain. The peripheral tissue samples shown are spinal cord C2 / L4 (SC C2 / L4), dorsal root ganglia C2 / L4 (DRGC2 / L4), liver, spleen, heart, kidney, lung, pancreas, and testis / ovary. The average VCN (vector biodistribution) and transcripts (transgene expression) in the primate brain are represented by the dashed line. Detailed Description

[0087] Engineered transcription factors or eTFs are provided herein that are non-naturally occurring and have been designed to bind to genomic target sites and regulate the expression of endogenous genes of interest. Such eTFs can be designed to upregulate or downregulate the expression (RNA and / or protein expression) of the gene of interest. MicroRNA binding sites that can be incorporated into viral vectors are also provided herein, and selective expression of the transgene in parvalbumin (PV) neurons is provided.

[0088] In one aspect, the present application provides an eTF that can upregulate the expression of the sodium voltage-gated channel alpha subunit 1 (SCN1A) gene and increase the expression of its corresponding protein product Nav1.1, as well as a method for treating diseases or disorders associated with Nav1.1 deficiency such as Dravet syndrome using the same.

[0089] In another aspect, the present application provides a microRNA binding site that reduces the expression of an mRNA containing the microRNA binding site in excitatory neurons, thereby resulting in the selective expression of the gene in GABAergic or parvalbumin (PV) neurons, and a method of using the same for selectively expressing a gene of interest in PV neurons.

[0090] Definitions

[0091] Unless the context clearly dictates otherwise, the singular forms "a", "an", and "the" as used herein are also intended to include the plural forms. Additionally, with respect to the terms "comprising", "including", "having", or variations thereof used in the detailed description and / or claims, these terms are intended to be inclusive in a manner similar to the term "including".

[0092] The term "about" or "approximately" means within an acceptable error range of a particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, in accordance with practice in the art, "about" can mean within 1 or more standard deviations. Alternatively, "about" can mean a range of up to 20%, up to 15%, up to 10%, up to 5%, or up to 1% of a given value.

[0093] The terms "determine", "measure", "evaluate", "assess", "assay", "analyze" and their grammatical equivalents are used interchangeably herein to refer to any form of measurement and include determining whether an element is present (e.g., detecting). These terms can include quantitative and / or qualitative determinations. An assessment can be relative or absolute.

[0094] The term "expression" refers to the process by which a nucleic acid sequence or polynucleotide is transcribed from a DNA template (such as transcribed into mRNA or other RNA transcripts), and / or the subsequent translation of the transcribed mRNA into a peptide, polypeptide, or protein. The transcript and the encoded polypeptide can be collectively referred to as a "gene product". If the polynucleotide is derived from genomic DNA, expression can include splicing of the mRNA in a eukaryotic cell.

[0095] As used herein, "operably linked", "operably connecting", "effectively linked" or their grammatical equivalents refer to the juxtaposition of genetic elements such as promoters, enhancers, polyadenylation sequences, etc., where the relationship between these elements allows them to function in the intended manner. For example, if a regulatory element that may contain a promoter and / or enhancer sequence helps initiate the transcription of a coding sequence, then the regulatory element is operably linked to the coding region. There may be intervening residues between the regulatory element and the coding region, as long as this functional relationship can be maintained.

[0096] As used herein, a "vector" refers to a macromolecule or macromolecular complex that contains or is associated with a polynucleotide and can be used to mediate the delivery of the polynucleotide into a cell. Examples of vectors include plasmids, viral vectors, liposomes, and other gene delivery mediators. Vectors typically contain genetic elements, such as regulatory elements, that are operably linked to a gene to facilitate the expression of the gene in a target.

[0097] As used herein, "expression cassette" and "nucleic acid cassette" are used interchangeably and refer to a combination of nucleic acid sequences or elements that are co-expressed or operably linked for expression. In some cases, an expression cassette refers to a combination of a regulatory element and one or more genes that are operably linked thereto for expression.

[0098] The term "AAV" is an abbreviation for adeno-associated virus and can be used to refer to the virus itself or its derivatives. This term encompasses all serotypes, subtypes, and natural and recombinant forms, unless otherwise required. The abbreviation "rAAV" refers to recombinant adeno-associated virus, also known as a recombinant AAV vector (or "rAAV vector"). The term "AAV" includes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, rh10, and their hybrids, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV. The genomic sequences of the various serotypes of AAV, as well as the sequences of the native terminal repeats (TRs), Rep proteins, and capsid subunits, are known in the art. Such sequences can be found in the literature or in public databases such as GenBank. As used herein, an "rAAV vector" refers to an AAV vector that contains a polynucleotide sequence of non-AAV origin (i.e., a polynucleotide that is heterologous relative to AAV), which polynucleotide sequence is generally the sequence of interest for the purpose of genetic transformation of cells. Typically, the heterologous polynucleotide is flanked by at least one, and usually two, AAV inverted terminal repeats (ITRs). An rAAV vector can be single-stranded (ssAAV) or self-complementary (scAAV). An "AAV virus" or "AAV viral particle" refers to a viral particle composed of at least one AAV capsid protein and a polynucleotide rAAV vector encapsulated therein. If the particle contains a heterologous polynucleotide (i.e., a polynucleotide other than the wild-type AAV genome, such as a transgene to be delivered to a mammalian cell), it is generally referred to as an "rAAV viral particle" or simply an "rAAV particle". Thus, the production of an rAAV particle necessarily includes the production of an rAAV vector, as such a vector is contained within the rAAV particle.

[0099] As used herein, the terms “treatment,” “treating,” “therapy,” etc. refer to reducing, delaying or slowing the progression of a disease or disorder, preventing, attenuating, reducing an effect or symptom, preventing its onset, suppressing or alleviating its onset. The methods of the present disclosure can be used in any mammal. Exemplary mammals include, but are not limited to, rats, cats, dogs, horses, cows, sheep, pigs, and more preferably humans. Therapeutic benefits include eradication or amelioration of the underlying disease being treated. Additionally, therapeutic benefits can also be achieved as follows: one or more physiological symptoms associated with the underlying condition are eradicated or ameliorated such that an improvement is observed in the subject, even though the subject may still be afflicted with the underlying condition. In some cases, for prophylactic benefits, a therapeutic agent can be administered to a subject at risk of developing a particular disease or reporting one or more physiological symptoms of a disease, even if a diagnosis of the disease may not have been made. The methods of the present disclosure can be used in any mammal. In some cases, treatment can result in a reduction or cessation of symptoms (e.g., a decrease in seizure frequency, duration, and / or severity). Prophylactic effects include delaying or eliminating the appearance of a disease or condition, delaying or eliminating the onset of symptoms of a disease or condition, slowing, halting or reversing the progression of a disease or condition, or any combination thereof.

[0100] The term “effective amount” or “therapeutically effective amount” refers to an amount of the compositions described herein sufficient to achieve the intended application, which includes, but is not limited to, the treatment of diseases as defined hereinafter. The therapeutically effective amount can vary depending on the intended therapeutic application (in vivo), or the subject and disease condition being treated, e.g., the weight and age of the subject, the severity of the disease condition, the mode of administration, etc., which can be readily determined by one of ordinary skill in the art. The term also applies to the dose that will induce a specific response in a target cell. The specific dose will vary depending on the particular composition selected, the dosing regimen followed, whether administered in combination with other compounds, the timing of administration, the tissue to which it is administered, the physical delivery system carrying the composition.

[0101] A “fragment” of a nucleotide or peptide sequence refers to a sequence that is shorter than the reference or “full-length” sequence.

[0102] A “variant” of a molecule refers to an allelic variation of such a sequence, i.e., a sequence that is substantially similar in structure and biological activity to the whole molecule or a fragment thereof.

[0103] A “functional fragment” of a DNA or protein sequence refers to a fragment that retains biological activity (functionally or structurally) that is substantially similar to the biological activity of the full-length DNA or protein sequence. The biological activity of a DNA sequence can be its ability to affect expression in a manner known to be attributed to the full-length sequence.

[0104] The terms "subject" and "individual" are used interchangeably herein and refer to a vertebrate, preferably a mammal, more preferably a human. The methods described herein can be used for human therapy, veterinary applications, and / or preclinical studies in animal models of diseases or conditions.

[0105] The term "in vivo" refers to an event that occurs within the body of a subject.

[0106] The term "in vitro" refers to an event that occurs outside the body of a subject. For example, in vitro assays include any assay performed outside the body of a subject. In vitro assays include cell-based assays in which live or dead cells are employed. In vitro assays also include cell-free assays in which intact cells are not employed.

[0107] Generally, the terms "sequence identity" or "sequence homology", which can be used interchangeably, refer to the exact nucleotide-nucleotide or amino acid-amino acid correspondence between two polynucleotide or polypeptide sequences, respectively. In general, techniques for determining sequence identity include comparing two nucleotide or amino acid sequences and determining the percentage of identity between them. For example, to assess identity, sequence comparisons can be performed by any suitable alignment algorithm, including but not limited to the Needleman-Wunsch algorithm (see, e.g., the EMBOSS Needle aligner available at www.ebi.ac.uk / Tools / psa / emboss_needle / , optionally using default settings), the BLAST algorithm (see, e.g., the BLAST alignment tool available at blast.ncbi.nlm.nih.gov / Blast.cgi, optionally using default settings), and the Smith-Waterman algorithm (see, e.g., the EMBOSS Water aligner available at www.ebi.ac.uk / Tools / psa / emboss_water / , optionally using default settings). Any suitable parameters of the selected algorithm (including default parameters) can be used to evaluate the optimal alignment. The "percentage identity" between two sequences, also referred to as the "percentage homology", can be calculated as the number of exact matches between the two optimally aligned sequences divided by the length of the reference sequence and multiplied by 100. For example, the percentage identity can also be determined by comparing sequence information using the BLAST computer program, including version 2.2.9, available from the National Institutes of Health. The BLAST program is based on the alignment method of Karlin and Altschul, Proc. Natl. Acad. Sci. USA 87:2264-2268 (1990), and is discussed in the following references: Altschul et al., J. Mol. Biol. 215:403-410 (1990); Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90:5873-5877 (1993); and Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997). Briefly, the BLAST program defines identity as the number of identical alignment symbols (i.e., nucleotides or amino acids) divided by the total number of symbols in the shorter of the two sequences. This program can be used to determine the percentage of identity over the total length of the sequences being compared. Default parameters are provided to optimize searches with short query sequences, such as with the blastp program.The program also allows the use of SEG filters to mask query sequence segments determined by the SEG program of Wootton and Federhen, Computers and Chemistry 17:149-163 (1993). High sequence identity generally includes a range of about 80% to 100% sequence identity, and integer values therebetween.

[0108] As used herein, "engineered" with respect to a protein refers to a non-naturally occurring protein, including but not limited to a protein derived from a naturally occurring protein, or a protein in which a naturally occurring protein has been modified or reprogrammed to have a certain property.

[0109] As used herein, "synthetic" and "artificial" are used interchangeably and refer to a protein or domain thereof that has low sequence identity (e.g., less than 50% sequence identity) with a naturally occurring human protein. For example, the VPR and VP64 domains are synthetic transactivation domains.

[0110] As used herein, "engineered transcription factor" or "eTF" refers to a non-naturally occurring DNA-binding protein or non-naturally occurring transcriptional regulator that has been modified or reprogrammed to bind to a specific target binding site and / or includes a modified or replaced transcriptional effector domain.

[0111] As used herein, "DNA-binding domain" can be used to refer to one or more DNA-binding motifs, such as zinc fingers or basic helix-loop-helix (bHLH) motifs, which alone or together are part of a DNA-binding protein.

[0112] The terms "transcription activation domain", "transcription activation structure domain", "transactivation domain", "transactivation structure domain", and "TAD" are used interchangeably herein and refer to a protein domain that, together with a DNA-binding domain, can activate transcription from a promoter by directly or through other proteins called coactivators contacting the transcriptional machinery (e.g., general transcription factors and / or RNA polymerase).

[0113] The terms "transcription repression domain", "transcription repression structure domain", and "TRD" are used interchangeably herein and refer to a protein domain that, together with a DNA-binding domain, can repress transcription from a promoter by directly or through other proteins called corepressors contacting the transcriptional machinery (e.g., general transcription factors and / or RNA polymerase).

[0114] The term "GRCh38.p12" refers to Genome Reference Consortium Human Build 38 patch release 12 (GRCh38.p12), which has a GenBank Assembly accession number of GCA_000001405.27 and a date of 2017 / 12 / 21.

[0115] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art, and the practice of the present invention will employ conventional techniques of molecular biology, microbiology, and recombinant DNA technology, which are within the knowledge of one of ordinary skill in the art.

[0116] Engineered transcription factors (eTFs) that upregulate SCN1A

[0117] In one aspect, the present application provides eTFs that are capable of upregulating the expression of the sodium voltage-gated channel alpha subunit 1 (SCN1A) gene and increasing the expression of its corresponding protein product, Nav1.1. The SCN1A gene belongs to a family of genes that encode subunits for assembling sodium channels. These channels transport positively charged sodium ions into the cell and play a key role in the ability of the cell to generate and transmit electrical signals. The SCN1A gene encodes a part (alpha subunit) of the sodium channel known as Nav1.1. These channels are mainly present in the brain, where they control the flow of sodium ions into the cell. The Nav1.1 channels are involved in transmitting signals from one nerve cell (or neuron) to another nerve cell (or neuron). Several mutations in the SCN1A gene have been found to cause genetic epilepsy with febrile seizures plus (GEFS+), which is a spectrum of seizure disorders of varying severity. These conditions include simple febrile (fever-related) seizures, which begin in infancy and usually stop by age 5, and febrile seizures plus (FS+). FS+ involves febrile and other types of seizures, including seizures that are not related to fever (afebrile seizures), which persist beyond childhood. The GEFS+ spectrum also includes other conditions such as Dravet syndrome (also known as severe myoclonic epilepsy of infancy or SMEI), which causes more severe seizures that last longer and may be difficult to control. These recurrent seizures (epilepsy) worsen over time and are often accompanied by a decline in brain function. Many other mutations are associated with familial hemiplegic migraine, a form of migraine that is common in families, and at least one mutation is associated with the effectiveness of certain anti-epileptic drugs. Thus, the eTFs provided herein that increase SCN1A expression can be used to treat a variety of diseases or conditions associated with mutations in the Nav1.1 channels.

[0118] Transcription factors (TFs) are proteins that bind to specific sequences in the genome and control gene expression. The engineered transcription factors or eTFs that upregulate SCN1A provided herein are non-naturally occurring proteins that include a DNA binding domain (DBD) and at least one domain that acts as a transcriptional regulator, such as a transcriptional activation domain (TAD) or a transcriptional repression domain (TRD). In one embodiment, the eTF that upregulates SCN1A may include a DBD and a TAD (e.g., TAD-DBD or DBD-TAD), wherein the DBD and TAD may be derived from the same protein or different proteins. In another embodiment, an eTF that upregulates SCN1A may comprise a DBD and two TADs, wherein the DBD and TADs are derived from the same protein, the DBD is derived from a first protein and both TADs are derived from a second protein, the DBD and one TAD are derived from a first protein and the second TAD is derived from the second protein, or the DBD is derived from a first protein, one TAD is derived from a second protein and the second TAD is derived from a third protein (e.g., TAD1-DBD-TAD1, TAD1-DBD-TAD2, TAD1-TAD1-DBD, TAD1-TAD2-DBD, DBD-TAD1-TAD1, or DBD-TAD1-TAD2). In another embodiment, an eTF that upregulates SCN1A may comprise a DBD and three TADs, wherein the DBD and TADs are derived from the same protein, the DBD is derived from a first protein and the TADs are derived from one or more different proteins, or wherein the DBD and all TADs are derived from different proteins, e.g., TAD X -TAD X -TAD X -DBD, TAD X -TAD X -DBD-TAD X 、TAD X -DBD-TAD X -TAD X DBD-TAD X -TAD X -TAD X, wherein each X is independently selected and may be the same as or different from one or all of the other TADs. Examples include, for example, TAD1-TAD1-DBD-TAD1, TAD1-TAD1-DBD-TAD2, TAD1-TAD2-DBD-TAD1, TAD1-TAD2-DBD-TAD2, TAD1-TAD2-DBD-TAD3, TAD1-DBD-TAD1-TAD1, TAD1-DBD-TAD2-TAD2, TAD1-DBD-TAD1-TAD2, TAD2-DBD-TAD1-TAD3 AD2, TAD1-DBD-TAD2-TAD3, TAD1-TAD1-TAD1-DBD, TAD1-TAD2-TAD2-DBD, TAD1-TAD2-TAD2-DBD, TAD1-TAD2-TAD3-DBD, DBD-TAD1-TAD1-TAD1, DBD-TAD1-TAD1-TAD2, DBD-TAD1-TAD2-TAD2, or DBD-TAD1-TAD2-TAD3, etc. In another embodiment, the eTF that upregulates SCN1A may comprise a DBD and four TADs, wherein the DBD and TADs are derived from the same protein, the DBD is derived from a first protein and the TADs are derived from one or more different proteins, or wherein the DBD and all TADs are derived from different proteins, e.g., TADs. X -TAD X -TAD X -TAD X -DBD, TAD X -TAD X -TAD X -DBD-TAD X 、TAD X -TAD X -DBD-TAD X -TAD X 、TAD X -DBD-TAD X -TAD X -TAD X DBD-TAD X -TAD X -TAD X -TAD X, where each X is independently selected and can be the same as or different from one or all of the other TADs. Examples include, for example, TAD1-TAD1-DBD-TAD1-TAD1, TAD1-TAD1-DBD-TAD2-TAD2, TAD1-TAD2-DBD-TAD1-TAD2, TAD1-TAD2-DBD-TAD2-TAD1, TAD1-TAD2-DBD-TAD1-TAD3, TAD1-TAD3-DBD-TAD1-TAD2, TAD1-TAD2-DBD-TAD3-TAD4, TAD1-TAD1-TAD1-DBD-TAD2, TAD1-TAD2-TAD3-DBD-TAD4, TAD1-DBD-TAD1-TAD1-TAD2, TAD1-DBD-TAD2-TAD3-TAD4, TAD1-DBD-TAD1-TAD2-TAD3, TAD2-DBD-TAD1-TAD2-TAD3, TAD1-DBD-TAD2-TAD3-TAD4, TAD1-TAD1-TAD1-TAD1-DBD, TAD1-TAD2-TAD2-TAD3-DBD, TAD1-TAD2-TAD3-TAD4-DBD, DBD-TAD1-TAD1-TAD1-TAD1, DBD-TAD1-TAD1-TAD2-TAD2, DBD-TAD1-TAD2-TAD3-TAD4, or DBD-TAD1-TAD2-TAD3-TAD3, etc. In one embodiment, the eTF that upregulates SCN1A comprises a DBD and two TADs located at the same end (e.g., the N-terminus or C-terminus) of the DBD, where the DBD is derived from a first protein and both TADs are derived from a second protein, or the DBD is derived from a first protein, one TAD is derived from a second protein, and the second TAD is derived from a third protein (e.g., TAD1-TAD1-DBD, TAD1-TAD2-DBD, DBD-TAD1-TAD1, or DBD-TAD1-TAD2). In certain embodiments, the DBD can be a synthetic construct comprising domains from multiple proteins.

[0119] In certain embodiments, the DBD and the TAD and / or two TADs can be directly conjugated, e.g., without an intervening amino acid sequence, the DBD and the TAD and / or two TADs can be conjugated using a peptide linker, or a combination thereof. In certain embodiments, the DBD is conjugated to the TAD, and / or one TAD is conjugated to a second TAD via a linker having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 60, 70, 75, 80, 90, or 100 amino acids or 1-5, 1-10, 1-20, 1-30, 1-40, 1-50, 1-75, 1-100, 5-10, 5-20, 5-30, 5-40, 5-50, 5-75, 5-100, 10-20, 10-30, 10-40, 10-50, 10-75, 10-100, 20-30, 20-40, 20-50, 20-75, or 20-100 amino acids. In some cases, the DBD and the TAD and / or two TADs are conjugated via naturally occurring intervening residues found in the naturally occurring proteins from which the domains are derived. In other embodiments, the DBD and the TAD and / or two TADs are conjugated via synthetic or exogenous linker sequences. Suitable linkers can be flexible, cleavable, non-cleavable, hydrophilic, and / or hydrophobic. In certain embodiments, the DBD and the TAD and / or two TADs can be fused together via a linker comprising multiple glycine and / or serine residues. Examples of glycine / serine peptide linkers include [GS]n, [GGGS]n (SEQ ID NO:179), [GGGGS]n (SEQ ID NO:180), [GGSG]n (SEQ ID NO:181), where n is an integer equal to or greater than 1. In certain embodiments, the linker that can be used to conjugate the DBD and the TAD and / or two TADs is GGSGGGSG (SEQ ID NO:177). In certain embodiments, the linker that can be used to conjugate the DBD and the TAD and / or two TADs is GGSGGGSGGGSGGGSG (SEQ ID NO:178). In certain embodiments, when the DBD is conjugated to two TADs, the first TAD and the second TAD can be conjugated to the DBD by the same or different linkers, or one TAD can be conjugated to the DBD by a linker while the other TAD is directly conjugated to the DBD (e.g., without an intervening linker sequence), or two TADs can be directly conjugated to the DBD (e.g., without an intervening linker sequence).In certain embodiments, when the DBD is conjugated to two TADs at the same end (e.g., the N-terminus or C-terminus), the linker connecting the two TADs can be the same as or different from the linker connecting the TAD to the DBD, or the TADs can be conjugated to each other through a linker, but the TADs are directly conjugated to the DBD (e.g., without an intervening linker sequence), or the TADs can be directly conjugated to each other (e.g., without an intervening linker sequence), but the TADs are conjugated to the DBD through a linker. In certain embodiments, the eTFs that upregulate SCN1A provided herein do not contain one or more HA tags (e.g., SEQ ID NO:171) located between the DBD and one or more TADs.

[0120] The eTFs that upregulate SCN1A provided herein have properties different from those of naturally occurring transcription factors. In certain embodiments, the eTFs that upregulate SCN1A contain a DBD derived from a naturally occurring protein that has been modified such that, compared to the naturally occurring protein from which the DBD is derived, the DBD binds to a different target site and, compared to the naturally occurring protein from which the DBD is derived (e.g., a gene other than SCN1A), the eTF containing such a modified DBD regulates the expression from a different gene (e.g., SCN1A). In other embodiments, the eTFs that upregulate SCN1A provided herein contain a TAD derived from a naturally occurring protein that has been modified such that, compared to the naturally occurring protein from which the TAD is derived (e.g., a gene other than SCN1A), the eTF containing such a modified TAD regulates the expression from a different gene (e.g., SCN1A) and / or, compared to the naturally occurring protein from which the TAD is derived, the eTF containing such a modified TAD regulates the expression of SCN1A differently (e.g., upregulates versus downregulates). In certain embodiments, the eTFs that upregulate SCN1A provided herein contain a DBD derived from a naturally occurring protein and a TAD derived from a naturally occurring protein (the same or a different protein), wherein both the DBD and the TAD have been modified. In such embodiments, compared to the naturally occurring protein from which the DBD is derived, the DBD can bind to a different target site, and compared to the naturally occurring protein from which the domains are derived (e.g., a gene other than SCN1A), the eTF containing such a modified DBD and TAD regulates the expression from a different gene (e.g., SCN1A) and / or, compared to the naturally occurring protein from which the DBD and TAD domains are derived, the eTF containing such a modified DBD and TAD regulates the expression of SCN1A differently (e.g., upregulates versus downregulates).

[0121] DNA binding domain (DBD)

[0122] The eTFs provided herein that upregulate SCN1A can comprise any suitable DBD that binds to a target site of interest (e.g., a target site that results in SCN1A upregulation when bound by an eTF provided herein). In certain embodiments, the DBD can be a synthetically designed DBD. In other embodiments, the DBD can be derived from a naturally occurring protein. DBD families include basic helix-loop-helix (bHLH) (e.g., c-Myc), basic leucine zipper (e.g., C / EBP), helix-turn-helix (e.g., Oct-1), and zinc finger (e.g., EGR1 or EGR3). These families exhibit a wide range of DNA binding specificities and gene targets. As contemplated herein, any of the known human transcription factor proteins can serve as a protein platform for engineering and / or reprogramming a DBD to recognize a specific target site, thereby resulting in the regulation of endogenous SCN1A gene expression. In an exemplary embodiment, the DBD provided herein comprises a zinc finger domain, a TALEN binding domain, or a gRNA / Cas complex.

[0123] The DBDs provided herein can be designed to recognize any target site that results in SCN1A upregulation. In an exemplary embodiment, the DBD is designed to recognize a genomic location and upregulate the expression of the endogenous SCN1A gene when bound by an eTF. The binding site that is capable of regulating endogenous SCN1A gene expression when bound by an eTF provided herein can be located anywhere in the genome that results in the regulation of SCN1A gene expression. In various embodiments, the binding site can be on a different chromosome than SCN1A, on the same chromosome as SCN1A, upstream of the transcription start site (TSS) of the SCN1A gene, downstream of the TSS of the SCN1A gene, proximal to the TSS of the SCN1A gene, distal to the SCN1A gene, within the coding region of the SCN1A gene, within an intron of the SCN1A gene, downstream of the polyA tail of the SCN1A gene, within the promoter sequence that regulates the SCN1A gene, or within the enhancer sequence that regulates the SCN1A gene.

[0124] The DBD can be designed to bind to a target binding site of any length, so long as it provides specific recognition of the target binding site sequence by the DBD, e.g., with minimal or no off-target binding. In certain embodiments, compared to all other genes, when bound by an eTF, the target binding site can regulate SCN1A expression at levels that are at least 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 75-fold, 100-fold, 150-fold, 200-fold, 250-fold, 500-fold or more. In certain embodiments, compared to 40 nearest neighbor genes (e.g., the 40 genes located closest to the coding sequence of SCN1A on the chromosome, either upstream or downstream), when bound by an eTF, the target binding site can regulate SCN1A expression at levels that are at least 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 75-fold, 100-fold, 150-fold, 200-fold, 250-fold, 500-fold or more. In certain embodiments, the target binding site can be at least 5bp, 10bp, 15bp, 20bp, 25bp, 30bp, 35bp, 40bp, 45bp or 50bp or greater. The specific length of the binding site will depend on the type of DBD in the eTF. Generally, the longer the binding site, the higher the specificity of binding and regulation of gene expression (e.g., longer binding sites have lower off-target effects). In certain embodiments, an eTF with a DBD that recognizes a longer target binding site has a lower off-target effect associated with non-specific binding (e.g., regulating the expression of off-target genes or other genes other than SCN1A) compared to the off-target effects observed with an eTF with a DBD that binds to a shorter target site. In some cases, the reduction in off-target binding is at least 1.2, 1.3, 1.4, 1.5, 2, 3, 4, 5, 6, 7, 8, 9 or 10-fold lower compared to a comparable eTF with a DBD that recognizes a shorter target binding site.

[0125] In certain embodiments, the DBDs provided herein can be modified to have increased binding affinity such that they bind to the target binding site for a longer time, such that the TAD conjugated to the DBD can recruit more transcription factors and / or recruit such transcription factors for a longer time to have a greater impact on the expression level of the endogenous SCN1A gene. In certain embodiments, the DBD can be modified to increase its specific binding (or on-target binding) to a desired target site, and / or the DBD can be modified to reduce its non-specific or off-target binding.

[0126] In various embodiments, various methods can be used to determine the binding between a DBD or eTF and a target binding site. In certain embodiments, electrophoretic mobility shift assays, DNase protection assays, or any other in vitro method known in the art for determining protein-DNA binding can be used to determine specific binding between a DBD or eTF and a target binding site. In other embodiments, functional assays can be used, for example, to determine specific binding between an eTF and a target binding site by measuring the expression (RNA or protein) of a gene (e.g., SCN1A) when the target binding site is bound by the eTF. For example, the target binding site can be upstream of a reporter gene (e.g., eGFP) or the SCN1A gene on a vector contained within a cell or integrated into the cell genome, wherein the cell expresses the eTF. Alternatively, a vector expressing the eTF can be introduced into a cell type that naturally contains the SCN1A gene. Higher expression levels of the reporter gene (or SCN1A) in the presence of the eTF compared to a control (e.g., no eTF or an eTF that recognizes a different target site) indicate that the DBD of the eTF binds to the target site. Suitable in vitro (e.g., cell-free) transcription and translation systems can also be used in a similar manner. In certain embodiments, the eTF that binds to the target site can have at least 2-fold, 3-fold, 5-fold, 10-fold, 15-fold, 20-fold, 30-fold, 50-fold, 75-fold, 100-fold, 150-fold, or higher expression of the reporter gene or SCN1A compared to a control (e.g., no eTF or an eTF that recognizes a different target site).

[0127] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein recognize target binding sites of the following sizes: at least 9 bp, 12 bp, 15 bp, 18 bp, 21 bp, 24 bp, 27 bp, 30 bp, 33 bp, or 36 bp; more than 9 bp, 12 bp, 15 bp, 18 bp, 21 bp, 24 bp, 27 bp, or 30 bp; or 9 - 33 bp, 9 - 30 bp, 9 - 27 bp, 9 - 24 bp, 9 - 21 bp, 9 - 18 bp, 9 - 15 bp, 9 - 12 bp, 12 - 33 bp, 12 - 30 bp, 12 - 27 bp, 12 - 24 bp, 12 - 21 bp, 12 - 18 bp, 12 - 15 bp, 15 - 33 bp, 15 - 30 bp, 15 - 27 bp, 15 - 24 bp, 15 - 21 bp, 15 - 18 bp, 18 - 33 bp, 18 - 30 bp, 18 - 27 bp, 18 - 24 bp, 18 - 21 bp, 21 - 33 bp, 21 - 30 bp, 21 - 27 bp, 21 - 24 bp, 24 - 33 bp, 24 - 30 bp, 24 - 27 bp, 27 - 33 bp, 27 - 30 bp, or 30 - 33 bp. In an exemplary embodiment, the eTFs that upregulate SCN1A disclosed herein recognize target binding sites that are 18 - 27 bp, 18 bp, or 27 bp.

[0128] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein recognize target binding sites located on chromosome 2. In certain embodiments, the eTFs that upregulate SCN1A disclosed herein recognize target binding sites located within 110 kb, 100 kb, 90 kb, 80 kb, 70 kb, 60 kb, 50 kb, 40 kb, 30 kb, 20 kb, 10 kb, 5 kb, 4 kb, 3 kb, 2 kb, or 1 kb upstream or downstream of the TSS of SCN1A on chromosome 2. In certain embodiments, the eTFs that upregulate SCN1A disclosed herein recognize target binding sites located within 110 kb upstream of the TSS of SCN1A on chromosome 2. In certain embodiments, the eTFs that upregulate SCN1A disclosed herein recognize target binding sites located within 110 kb downstream of the TSS of SCN1A on chromosome 2. In an exemplary embodiment, such target binding sites are 18 - 27 bp, 18 bp, or 27 bp.

[0129] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein recognize target binding sites located within positions 166179652 - 165989571, positions 166128050 - 166127958, positions 166155414 - 166140590, positions 166179652 - 1661777272, or positions 1659990246 - 165989592 on chromosome 2 (all with reference to GRCh38.p12). In exemplary embodiments, such target binding sites are 18 - 27 bp, 18 bp, or 27 bp.

[0130] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein recognize target binding sites that (i) are 18 - 27 bp, 18 bp, or 27 bp, (ii) overlap with positions selected from 166178880, 166177369, 166177362, 166177299, 166177299, 166155393, 166155264, 166149373, 166149176, 166149165, 166149118, 166148953, 166148565, 166142396, 166142391, 166142344, 166142239, 166141162, 166140928, 166140590, 165990076, 165989684, 165989571, 166155255, 166155099, 166148843, 166148361, 166142219, 166141090, 165990246, 165990193, 166149168, 166127991, 166128002, 166128037, or 166128025 on chromosome 2 (all with reference to GRCh38.p12), and (iii) are capable of producing at least a 1.2 - fold increase in SCN1A expression when bound by the eTFs disclosed herein.

[0131] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein (i) bind to a target site comprising or consisting of any one of SEQ ID NO:18, 25, 30, 31, or 35 - 66, and (ii) are capable of producing at least a 1.2 - fold increase in SCN1A expression when bound by the eTFs disclosed herein.

[0132] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein identify target binding sites that (i) are 18 - 27 bp, 18 bp, or 27 bp, (ii) overlap with positions on chromosome 2 selected from 166155255, 166155099, 166148843, 166148361, 166142219, 166141090, 165990246, 165990193, 166149168, 166127991, 166128002, 166128037, or 166128025 (all with reference to GRCh38.p12), and (iii) are capable of producing at least a 2-fold increase in SCN1A expression when bound by the eTFs disclosed herein.

[0133] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein (i) bind to a target site comprising any one or consisting of SEQ ID NO: 18, 30, 31, 37, 38, 45, 47, 48, 49, 55, 61, 62, or 64, and (ii) are capable of producing at least a 2-fold increase in SCN1A expression when bound by the eTFs disclosed herein.

[0134] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein identify target binding sites that (i) are 18 - 27 bp, 18 bp, or 27 bp, (ii) overlap with positions on chromosome 2 selected from 166149168, 166127991, 166128002, 166128037, or 166128025 (all with reference to GRCh38.p12), and (iii) are capable of producing at least a 5-fold increase in SCN1A expression when bound by the eTFs disclosed herein.

[0135] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein (i) bind to a target site comprising any one or consisting of SEQ ID NO: 18, 30, 31, 37, or 38, and (ii) are capable of producing at least a 5-fold increase in SCN1A expression when bound by the eTFs disclosed herein.

[0136] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein identify target binding sites that (i) are 18 - 27 bp, 18 bp, or 27 bp, (ii) overlap with positions on chromosome 2 selected from 166128002, 166128037, or 166128025 (all with reference to GRCh38.p12), and (iii) are capable of producing at least a 15-fold increase in SCN1A expression when bound by the eTFs disclosed herein.

[0137] In certain embodiments, the eTF(i) that upregulates SCN1A disclosed herein binds to a target site comprising any one of or consisting of SEQ ID NO: 30, 37, or 38, and (ii) is capable of producing an increase in SCN1A expression of at least 15-fold when bound by the eTF disclosed herein.

[0138] In certain embodiments, the eTF that upregulates SCN1A disclosed herein recognizes a target binding site that (i) is 18 - 27 bp, 18 bp, or 27 bp, (ii) overlaps a position on chromosome 2 selected from 166128037 or 166128025 (both referenced to GRCh38.p12), and (iii) is capable of producing an increase in SCN1A expression of at least 20-fold when bound by the eTF disclosed herein.

[0139] In certain embodiments, the eTF that upregulates SCN1A disclosed herein binds to a target site comprising any one of or consisting of SEQ ID NO: 30 or 38, and (ii) is capable of producing an increase in SCN1A expression of at least 20-fold when bound by the eTF disclosed herein.

[0140] In certain embodiments, the eTF that upregulates SCN1A disclosed herein recognizes a target binding site that (i) is 18 - 27 bp, 18 bp, or 27 bp, (ii) overlaps a position at position 166128025 on chromosome 2, and (iii) is capable of producing an increase in SCN1A expression of at least 25-fold when bound by the eTF disclosed herein.

[0141] In certain embodiments, the eTF that upregulates SCN1A disclosed herein binds to a target site comprising any one of or consisting of SEQ ID NO: 30, and (ii) is capable of producing an increase in SCN1A expression of at least 25-fold when bound by the eTF disclosed herein.

[0142] In certain embodiments, the eTF that upregulates SCN1A disclosed herein recognizes a target binding site that (i) is 18 - 27 bp, 18 bp, or 27 bp, and (ii) binds to a genomic region that is within at least 1 kb, 750 bp, 500 bp, 400 bp, 300 bp, 200 bp, 100 bp, or 50 bp of a genomic position having any one of the sequences of SEQ ID NO: 18, 25, 30, 31, or 35 - 66. In certain embodiments, the target binding site is capable of producing an increase in SCN1A expression of at least 1.2-fold, 2-fold, 5-fold, 15-fold, 20-fold, or 25-fold when bound by the eTF disclosed herein.

[0143] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein identify target binding sites that are (i) 18 - 27 bp, 18 bp, or 27 bp, and (ii) bind to a genomic region that at least partially overlaps with a genomic location having any one of the sequences of SEQ ID NO: 18, 25, 30, 31, or 35 - 66. In certain embodiments, when bound by the eTFs disclosed herein, the target binding sites are capable of producing at least a 1.2 - fold, 2 - fold, 5 - fold, 15 - fold, 20 - fold, or 25 - fold increase in SCN1A expression.

[0144] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein identify target binding sites having any one of the following sequences: SEQ ID NO: 18, 25, 30, 31, or 35 - 66. In certain embodiments, when bound by the eTFs disclosed herein, the target binding sites are capable of producing at least a 1.2 - fold, 2 - fold, 5 - fold, 15 - fold, 20 - fold, or 25 - fold increase in SCN1A expression.

[0145] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein result in at least a 1.5 - fold, 2 - fold, 3 - fold, 4 - fold, 5 - fold, 6 - fold, 7 - fold, 8 - fold, 9 - fold, 10 - fold, 15 - fold, 20 - fold, 25 - fold, 50 - fold, 100 - fold, or higher, or at least 50%, 60%, 70%, 75%, 80%, 90%, 100%, 125%, 150%, 200%, 250%, 300%, 400%, or 500% or higher up - regulation of SCN1A expression (SCN1A RNA and / or Nav1.1 protein) in cells or in vivo compared to a control (e.g., no eTF or an eTF that does not recognize the target site). In various embodiments, PCR methods, Western blotting, or immunoassays can be used to detect the up - regulation of SCN1A expression.

[0146] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein bind to a target site that, in a transcriptional activation assay, increases SCN1A expression by at least 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 3-fold, 4-fold, 5-fold, 8-fold, 10-fold, 12-fold, 15-fold, 18-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold, 75-fold, 100-fold, or higher relative to a control, or at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 100%, 125%, 150%, 200%, 250%, 300%, 400%, or 500% or higher. Exemplary SCN1A transcriptional activation assays are provided in Example 3 herein. Briefly, HEK293 cells are transfected with a plasmid carrying an eTF or control eGFP reporter gene construct. Forty-eight hours after transfection, the cells are harvested, RNA is isolated, reverse transcription is performed, and the resulting cDNA samples are analyzed by qPCR (e.g., using primers having SEQ ID NOs: 185 and 186) to quantify the levels of endogenous SCN1A transcripts. GAPDH can be used as a reference gene to determine the relative levels of SCN1A expression.

[0147] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein have minimal off-target effects, e.g., off-target effects associated with non-specific binding, e.g., regulation of the expression of off-target genes or genes other than SCN1A. In one embodiment, the eTFs that upregulate SCN1A disclosed herein specifically upregulate SCN1A compared to a control by at least 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, or 50-fold the expression produced by the eTF compared to the control for one or more off-target genes. In an exemplary embodiment, the eTFs that upregulate SCN1A disclosed herein specifically upregulate transcription from the SCN1A gene compared to a control by at least 15-fold the transcription of 40 nearest neighbor genes (e.g., the 40 genes closest to the SCN1A coding sequence on chromosome 2) produced by the eTF relative to the control, such genes being, for example, PLA2R1, ITGB6, RBMS1, TANK, PSMD14, TBR1, SLC4A10, DPP4, FAP, IFIH1, GCA, FIGN, GRB14, COBLL1, SLC38A11, SCN3A, SCN2A, CSRNP3, GALNT3, TTC21B, SCN9A, SCN7A, B3GALT1, STK39, CERS6, NOSTRIN, SPC25, ABCB11, DHRS9, BBS5, KLHL41, FASTKD1, PPIG, CCDC173, PHOSPHO2, KLHL23, SSB, METTL5, UBR3, and MYO3B (see Table 14). In various embodiments, PCR methods can be used to detect the upregulation of transcription from the SCN1A gene.

[0148] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein are capable of in Scn1a of Dravet syndrome tm1keaReducing the frequency of seizures in a hyperthermic seizure (HTS) assay in a mouse model. In certain embodiments, compared to a control (e.g., PBS-treated or treated with an AAV vector comprising a sequence encoding eGFP), the eTFs disclosed herein are capable of reducing the seizure frequency at 42.6 °C in an HTS assay by at least 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2.0-fold or more, or at least 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more. In certain embodiments, the eTFs disclosed herein are capable of reducing the seizure frequency at 42.6 °C in an HTS assay such that at least 60%, 62%, 65%, 70%, 75%, 76%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the mice analyzed in the assay do not have seizures at 42.6 °C. Exemplary HTS assays are described in Example 6 herein. Briefly, at P1, bilateral ICV delivery of an AAV9 vector encoding an eTF that upregulates SCN1A as provided herein or a control vector encoding eGFP can be administered to pups generated from a cross of male Scn1a+ / - mice and female C57Bl / 6J mice. The vector can be administered to the mice at about 1.0E10 - 5.0E12 gc / mouse. The HTS assay is performed in P26 - P28 SCN1A heterozygous and SCN1A wild-type mice on a mixed 129Stac X C57BL / 6 background by increasing the body temperature of the mice (under controlled conditions and by body temperature monitoring) by about 0.5 °C every 2 minutes until the first tonic-clonic seizure with loss of posture occurs or until the body temperature reaches 43 °C. A mouse is considered to not have a seizure if no seizure with loss of posture is detected throughout the experiment.

[0149] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein are capable of improving SCN1A heterozygous mice, such as Scn1a tm1keaSurvival rate of the mouse line. In certain embodiments, compared to a control (e.g., PBS-treated or treated with an AAV vector comprising a sequence encoding eGFP), the eTFs disclosed herein are capable of increasing the survival rate of SCN1A heterozygous mice at P100 by at least 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2.0-fold or more, or at least 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more. In certain embodiments, the eTFs disclosed herein are capable of increasing the survival rate of SCN1A heterozygous mice at P100 such that at least 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of the mice analyzed in the assay are still alive at P100. Exemplary survival assays are described in Example 7 herein. Briefly, AAV9 vectors can be administered bilaterally into the ICV at P1 to the pups generated from the cross of male Scn1a+ / - mice and female C57Bl / 6J mice. The mice can be dosed at about 1.0E10 - 5.0E12 gc / mouse. The number of mice surviving to P100 was determined.

[0150] In certain embodiments, the eTFs that upregulate SCN1A provided herein can comprise a DBD that is from a zinc finger protein, derived from a zinc finger protein, or is a nuclease-inactivated zinc finger protein. A zinc finger is a small protein structural motif characterized by the coordination of one or more zinc ions (Zn 2+ ) for stabilizing the fold. The zinc finger (Znf) domain is a relatively small protein motif that contains multiple finger-like protrusions that result in tandem contacts with a DNA target site. The modular nature of the zinc finger motif allows a large number of DNA sequence combinations to bind with high affinity and specificity, and is thus ideally suited for engineering proteins that can be targeted to and bind to specific DNA sequences. Many engineered zinc finger arrays are based on the zinc finger domain of the murine transcription factor Zif268. Zif268 has three individual zinc finger motifs that together bind a 9bp sequence with high affinity. As further described herein, a variety of zinc finger proteins have been identified based on structure and characterized into different types. Any such zinc finger protein can be used in association with the DBDs described herein.

[0151] A variety of methods for designing zinc finger proteins are available. For example, methods for designing zinc finger proteins to bind to a target DNA sequence of interest are described, see, e.g., Liu Q et al., Design of polydactyl zinc-finger proteins for unique addressing within complex genomes, Proc Natl Acad Sci USA. 94(11):5525–30 (1997); Wright DA et al., Standardized reagents and protocols for engineering zinc finger nucleases by modular assembly, Nat Protoc. Nat Protoc. 2006;1(3):1637-52; and CA Gersbach and T Gaj, Synthetic Zinc Finger Proteins: The Advent of Targeted Gene Regulation and Genome Modification Technologies, Am Chem Soc 47:2309-2318 (2014). Additionally, various web-based tools for designing zinc finger proteins to bind to a DNA target sequence of interest are publicly available, see, e.g., the Zinc Finger Nuclease Design Software Tools and Genome Engineering Data Analysis web address of OmicX, which can be found at the World Wide Web address omictools.com / zfns-category; and the Zinc Finger Tools design web address of Scripps, which can be found at the World Wide Web address scripps.edu / barbas / zfdesign / zfdesignhome.php.In addition, various commercially available services for designing zinc finger proteins to bind to a target DNA sequence are available. See, for example, the commercially available services or kits offered by Creative Biolabs (World Wide Web address creative-biolabs.com / Design-and-Synthesis-of-Artificial-Zinc-Finger-Proteins.html), the Zinc Finger Consortium Modular Assembly Kit available from Addgene (World Wide Web address addgene.org / kits / zfc-modular-assembly / ), or the CompoZr Custom ZFN Service from Sigma Aldrich (World Wide Web address sigmaaldrich.com / life-science / zinc-finger-nuclease-technology / custom-zfn.html).

[0152] In certain embodiments, the eTFs that upregulate SCN1A provided herein comprise a DBD containing one or more zinc fingers, or a DBD derived from a zinc finger protein. In some cases, the DBD comprises multiple zinc fingers, wherein each zinc finger is linked to another zinc finger or another domain at its N-terminus or C-terminus or both via an amino acid linker. In some cases, the DBD provided herein comprises one or more zinc fingers from one or more of the zinc finger types described in Table 9. In some cases, the DBD provided herein comprises multiple zinc finger structures or motifs, or multiple zinc fingers having one or more of SEQ ID NOs: 152-167 or any combination thereof. In certain embodiments, the DBD comprises X—[ZF—X]n and / or [X—ZF]n—X, wherein ZF is a zinc finger domain having any of the motifs listed in Table 9 (e.g., any one of SEQ ID NOs: 136-146), X is an amino acid linker comprising 1-50 amino acids, and n is an integer from 1-15, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, wherein each ZF can independently have the same sequence or a different sequence from the other ZF sequences in the DBD, and wherein each linker X can independently have the same sequence or a different sequence from the other X sequences in the DBD. Each zinc finger can be linked to another sequence, zinc finger, or domain at its C-terminus, N-terminus, or both. In the DBD, each linker X can be the same in sequence, length, and / or properties (e.g., flexibility or charge), or different in sequence, length, and / or properties. In some cases, two or more linkers can be the same while other linkers are different. In an exemplary embodiment, the linker can be obtained from or derived from the sequence linking the zinc fingers found in one or more naturally occurring zinc finger proteins provided in Table 9. In other embodiments, suitable linker sequences include, for example, linkers having a length of 5 or more amino acids. For exemplary linker sequences having a length of 6 or more amino acids, also see U.S. Patents 6,479,626, 6,903,185, and 7,153,949, each of which is incorporated herein by reference in its entirety. The DBD proteins provided herein can include any combination of suitable linkers between the individual zinc fingers of the protein. The DBD proteins described herein can include any combination of suitable linkers between the individual zinc fingers of the protein.

[0153] In certain embodiments, the eTFs that upregulate SCN1A provided herein comprise a DBD containing one or more classical zinc fingers. Classical C2H2 zinc fingers have two cysteine residues in one strand and two histidine residues in the other strand, which are coordinated by a zinc ion. The classical zinc finger domain has two β-sheets and one α-helix, where the α-helix interacts with the DNA molecule and forms the basis for the binding of the DBD to the target site, and can be referred to as the "recognition helix". In an exemplary embodiment, the recognition helix of the zinc finger contains at least one amino acid substitution at positions -1, 2, 3, or 6, thereby altering the binding specificity of the zinc finger domain. In other embodiments, the DBDs provided herein comprise one or more non-classical zinc fingers, e.g., C2–H2, C2–CH, and C2–C2.

[0154] In another embodiment, the eTFs that upregulate SCN1A provided herein comprise a DBD that contains a zinc finger motif having the following structure: LEPGEKP–[YKCPECGKSFS X HQRTH TGEKP]n-YKCPECGKSFS X HQRTH–TGKKTS (SEQ ID NO:147), where n is an integer from 1 to 15, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, and each X is independently a recognition sequence (e.g., a recognition helix) capable of binding to 3bp of the target sequence. In an exemplary embodiment, n is 3, 6, or 9. In a particularly preferred embodiment, n is 6. In various embodiments, each X can independently have the same or a different amino acid sequence compared to the other X sequences in the DBD. In an exemplary embodiment, each X is a sequence of 7 amino acids that has been designed using the Scripps Zinger Finger Design Tool at the World Wide Web address scripps.edu / barbas / zfdesign / zfdesignhome.php to interact with 3bp of the target binding site of interest.

[0155] Since each zinc finger within the DBD recognizes 3 bp, the number of zinc fingers contained within the DBD will inform the length of the binding site recognized by the DBD. For example, a DBD with 1 zinc finger will recognize a target binding site with 3 bp, a DBD with 2 zinc fingers will recognize a target binding site with 6 bp, a DBD with 3 zinc fingers will recognize a target binding site with 9 bp, a DBD with 4 zinc fingers will recognize a target binding site with 12 bp, a DBD with 5 zinc fingers will recognize a target binding site with 15 bp, a DBD with 6 zinc fingers will recognize a target binding site with 18 bp, a DBD with 9 zinc fingers will recognize a target binding site with 27 bp, and so on. Generally, a DBD that recognizes a longer target binding site will exhibit higher binding specificity (e.g., less off-target binding or non-specific binding).

[0156] In other embodiments, the eTFs that upregulate SCN1A provided herein comprise a DBD that is derived from a naturally-occurring zinc finger protein by one or more amino acid substitutions in one or more recognition helices of the zinc finger domain so as to alter the binding specificity of the DBD (e.g., alter the target site recognized by the DBD). The DBDs provided herein can be derived from any naturally-occurring zinc finger protein. In various embodiments, such DBDs can be derived from zinc finger proteins of any species such as mouse, rat, human, etc. In an exemplary embodiment, the DBDs provided herein are derived from human zinc finger proteins. In certain embodiments, the DBDs provided herein are derived from the naturally-occurring proteins listed in Table 9. In an exemplary embodiment, the DBD proteins provided herein are derived from human EGR zinc finger proteins, e.g., EGR1, EGR2, EGR3, or EGR4.

[0157] In certain embodiments, the eTFs that upregulate SCN1A provided herein comprise a DBD that is derived from a naturally occurring protein by modifying the DBD, the modification increasing the number of zinc finger domains in the DBD protein by duplicating one or more zinc fingers within the DBD of the naturally occurring protein. In certain embodiments, such a modification comprises a double duplication, a triple duplication, a quadruple duplication, or further multiplication of zinc fingers within the DBD of the naturally occurring protein. In some cases, one zinc finger of the DBD from a human protein is duplicated, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more copies of the same zinc finger motif are repeated in the DBD of the eTF. In some cases, a set of zinc fingers from the DBD of a naturally occurring protein is duplicated, for example, a set of 3 zinc fingers from the DBD of a naturally occurring protein is duplicated twice to produce an eTF comprising a DBD with 6 zinc fingers, triplicated to produce a DBD of an eTF with 9 zinc fingers, or quadruplicated to produce a DBD of an eTF with 12 zinc fingers, and so on. In some cases, a set of zinc fingers from the DBD of a naturally occurring protein is partially duplicated to form a DBD of an eTF with a greater number of zinc fingers, for example, the DBD of the eTF comprises four zinc fingers, where the zinc fingers represent one copy of the first zinc finger from a naturally occurring protein, one copy of the second zinc finger, and two copies of the third zinc finger, for a total of four zinc fingers in the DBD of the eTF. Such a DBD is then further modified by making one or more amino acid substitutions in one or more recognition helices of the zinc finger domain so as to alter the binding specificity of the DBD (e.g., alter the target site recognized by the DBD). In an exemplary embodiment, the DBD is derived from a naturally occurring human protein, such as a human EGR zinc finger protein, for example, EGR1, EGR2, EGR3, or EGR4.

[0158] The human EGR1 and EGR3 are characterized by a three-finger C2H2 zinc finger DBD. The general binding rules for zinc fingers dictate that all three fingers interact with a cognate DNA sequence of similar geometry, using the same amino acids in the α-helix of each zinc finger to determine the specificity or recognition of the target binding site sequence. Such binding rules allow one to modify the DBD of EGR1 or EGR3 to engineer a DBD that recognizes a desired target binding site. In some cases, the DNA recognition helices of 7 amino acids in the zinc finger motifs of EGR1 or EGR3 are modified according to published zinc finger design rules. In certain embodiments, each zinc finger in the three-finger DBD of EGR1 or EGR3 is modified, for example, by altering the sequence of one or more recognition helices and / or by increasing the number of zinc fingers in the DBD. In certain embodiments, EGR1 or EGR3 is reprogrammed to recognize a target binding site of at least 9, 12, 15, 18, 21, 24, 27, 30, 33, 36 or more base pairs at a desired target site. In certain embodiments, such DBDs derived from ERG1 or EGR3 contain at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more zinc fingers. In an exemplary embodiment, one or more zinc fingers in the DBD contain at least one amino acid substitution at positions -1, 2, 3 or 6 of the recognition helix.

[0159] In various embodiments, an eTF that upregulates SCN1A and contains a DBD derived from EGR1 or EGR3 has a DNA binding specificity different from that of the naturally occurring EGR1 or EGR3. For example, the target binding site recognized by the DBD has a sequence different from the following sequence of the binding site recognized by unmodified EGR1 or EGR3: (GCG(T / G)GGGCG) (SEQ ID NO:182).

[0160] In other embodiments, the eTFs that upregulate SCN1A provided herein comprise the DBD as a gRNA / Cas complex. CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 is a genome editing tool that allows for site-specific genome targeting. Type II CRISPR / Cas systems are prokaryotic adaptive immune response systems that use non-coding RNAs to direct Cas9 nucleases to induce site-specific DNA cleavage. A simple, RNA-programmable method has been exploited using the CRISPR / Cas9 system to mediate genome editing in mammalian cells. Single guide RNAs (sgRNAs) can be generated to direct the Cas9 nuclease to specific genomic locations, which are then bound by the gRNA / Cas9 complex. Multiple methods and tools can be used to design gRNAs to bind to target sites of interest. For example, methods for designing gRNAs to bind to target DNA sequences of interest are described in Aach et al., Flexible algorithm for identifying specific Cas9 targets in genomes. BioRxiv, Cold Spring Harbor Labs. doi: http: / / dx.doi.org / 10.1101 / 005074 (2014); Bae et al., Cas-OFFinder: a fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics. 30(10):1473–1475 (2014); Doench, J.G. et al., Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotech 34, 184–191 (2016); Gratz et al., Highly specific and efficient CRISPR / Cas9-catalyzed homology-directed repair in Drosophila. Genetics. 196(4):961–971 (2014); Heigwer et al., E-CRISP: fast CRISPR target site identification. Nat Methods.11(2):122–123(2014); Ma et al., A guide RNA sequence design platform for the CRISPR / Cas9 system for model organism genomes. Biomed Res Int. doi: http: / / doi.org / 10.1155 / 2013 / 270805(2013); Montague et al., CHOPCHOP: a CRISPR / Cas9 and TALEN web tool for genome editing. Nucleic Acids Res. 42(W1):W401–W407(2014); Liu et al., CRISPR-ERA: a comprehensive design tool for CRISPR-mediated gene editing, repression and activation. Bioinformatics. 31(22):3676–3678(2015); Ran et al., In vivo genome editing using Staphylococcus aureus Cas9. Nature. 520(7546):186–191(2015); Wu et al., Target specificity of the CRISPR-Cas9 system. Quant Biol. 2(2):59–70(2015); Xiao et al., CasOT: a genome-wide Cas9 / gRNA off-target searching tool. Bioinformatics. 30(8):1180–1182(2014); Zetsche et al., Cpf1 is a single RNA-guided endonuclease of a Class 2 CRISPR-Cas System. Cell. 163(3):759–771(2015). Additionally, various web-based tools for designing gRNAs to bind to a target DNA sequence of interest are publicly available, see, for example, the CRISPR gRNA Design tool of AUTM found at the World Wide Web address atum.bio / eCommerce / cas9 / input?multipleContacts=false; available from the World Wide Web address portals.broadinstitute.the CRISPRa / i gRNA design tool of the Broad Institute found at org / gpp / public / analysis-tools / sgrna-design-crisprai; the E-CRISP design tool of the DKFZ German Cancer Research Center found at the World Wide Web address e-crisp.org / E-CRISP / ; and the Knockout Guide Design tool of Synthego found at the World Wide Web address design.synthego.com / # / . Additionally, various commercially available services for designing gRNAs to bind to a desired DNA target sequence are available, see, for example, the commercially available services provided by IDT (World Wide Web address idtdna.com / site / order / designtool / index / CRISPR_SEQUENCE), ThermoFisher (World Wide Web address thermofisher.com / order / custom-oligo / crispr), and GenScript (World Wide Web address genscript.com / gRNA-design-tool.html).

[0161] In an exemplary embodiment, the DBD of the gRNA / Cas complex comprises a nuclease-inactivated Cas protein or dCas, such as dCas9, e.g., nuclease-inactivated Staphylococcus aureus Cas9 (dSaCas9) or nuclease-inactivated Streptococcus pyogenes Cas9 (dSpCas9). The gRNA is provided as a sequence comprising a targeting region and a scaffold region, the targeting region targeting the gRNA / Cas complex to the desired target site, while the scaffold region facilitates interaction with the Cas protein. Any suitable gRNA scaffold can be used with the gRNAs provided herein. In an exemplary embodiment, the gRNA is a single gRNA or sgRNA and comprises the following scaffold sequence: 5’-GTTTTAGTACTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGA-3’ (SEQ ID NO:183). The targeting region of the guide RNA is linked to the 5' end of the scaffold sequence to form a complete sgRNA. In certain embodiments, the gRNA and the dCas protein can be expressed from the same expression cassette. In certain embodiments, the U6 promoter is used to express the gRNA. In other embodiments, e.g., by stably integrating dCas into the genome or on a plasmid stably maintained extrachromosomally, the gRNA can be expressed in cells engineered to stably express the dCas-TAD protein.

[0162] In other embodiments, the eTFs that upregulate SCN1A provided herein can comprise a DBD that is from a TALEN, derived from a TALEN, or is a nuclease-inactivated TALEN. Transcription activator-like effector nucleases (TALENs) are restriction enzymes that comprise a DBD and a nuclease domain that can be engineered to cut specific DNA sequences. TALENs are created by conjugating a TAL effector DNA-binding domain to a DNA cleavage domain (such as a nuclease). Transcription activator-like effectors (TALEs) can be engineered to bind to a desired target DNA sequence, thereby directing the nuclease domain to a specific location.

[0163] TAL effectors are bacterial proteins from bacteria of the genus Xanthomonas. The DNA-binding domain contains repeated highly conserved sequences of 33-34 amino acids with variable 12th and 13th amino acids. These two positions, known as the repeat variable diresidue (RVD), are highly variable and show a strong correlation with specific nucleotide recognition. This direct relationship between the amino acid sequence and DNA recognition allows for engineering of a DBD that specifically targets a desired sequence by selecting a combination of repeat segments containing appropriate RVDs.

[0164] Multiple methods for designing TALEs are available. For example, methods for designing TALEs to bind to a target DNA sequence of interest are described in T. Cermak et al., Nucleic Acids Research. 39(12):e82 (2011); F. Zhang et al., Nature Biotechnology. 29(2):149–53 (2011); R. Morbitzer et al., Nucleic Acids Research. 39(13):5790–9 (2011); T. Li et al., Nucleic Acids Research. 39(14):6315–25 (2011); R. Geissler et al., PLOS One. 6(5):e19509 (2011); and E. Weber et al., PLOS One. 6(5):e19722 (2011). Additionally, various web-based tools for designing TALEs to bind to a DNA target sequence of interest are publicly available, see, for example, E-Talen, which can be found at the World Wide Web address e-talen.org / E-TALEN / TAL, and the Effector Nucleotide Targeter 2.0 tool, which can be found at the World Wide Web address tale-nt.cac.cornell.edu / node / add / single-tale. Additionally, various commercially available services for designing TALEs to bind to a DNA target sequence of interest are available, see, for example, the commercially available services offered by OmicX (World Wide Web address omictools.com / ), Addgene (World Wide Web address addgene.org / talen / guide / ), or ThermoFisher (World Wide Web address thermofisher.com / us / en / home / life-science / genome-editing / geneart-tals / tal-design-tool.html). Additionally, publicly available software programs (DNAWorks) can be used to design oligonucleotides suitable for assembling TALEs, see, for example, D. Hoover, D Methods in Molecular Biology. 852:215–23 (2012).

[0165] Transcription regulatory domain

[0166] The eTFs that upregulate SCN1A provided herein can include any suitable domain capable of recruiting one or more protein factors that can regulate transcription from a target gene (e.g., RNA polymerase II, CBP / p300, CREB, or KRAB) or gene expression levels when the eTF binds to the target site through a DBD (e.g., a zinc finger DBD, a gRNA / Cas DBD, or a TALE DBD). In certain embodiments, such a domain recruits protein factors that increase transcription or gene expression levels of the target gene and is a transcriptional activation domain (TAD). In other embodiments, such a domain recruits protein factors that decrease transcription or gene expression levels of the target gene and is a transcriptional repression domain (TRD). In certain embodiments, the transcriptional regulatory domain (TAD or TRD) can be a synthetically designed domain. In other embodiments, the transcriptional regulatory domain (TAD or TRD) can be derived from a naturally occurring protein, e.g., a transcription factor, a transcriptional co-activator, a transcriptional co-repressor, or a silencer protein. In various embodiments, the transcriptional regulatory domain (TAD or TRD) can be derived from a protein of any species such as mouse, rat, monkey, virus, or human.

[0167] In one exemplary embodiment, the TAD suitable for use in the eTFs that upregulate SCN1A provided herein is derived from a viral protein. Exemplary TADs derived from viral proteins include, for example, VP64 (SEQ ID NO:133), VPR (SEQ ID NO:132), VP16, VP128, the TAD domain of p65, p300, or any functional fragment or variant thereof, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0168] In another exemplary embodiment, the TAD suitable for use in the eTFs that upregulate SCN1A provided herein is derived from a human protein. Exemplary TADs derived from human proteins include, for example, the TAD domain of CBP / p300 interacting transactivator 2 (CITED2) (SEQ ID NO:134), CBP / p300 interacting transactivator 4 (CITED4) (SEQ ID NO:135), EGR1 (SEQ ID NO:176), CREB3 (SEQ ID NO:224), or EGR3 (SEQ ID NO:175), or any functional fragment or variant thereof, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0169] In certain embodiments, the eTFs that upregulate SCN1A comprise a zinc finger DBD conjugated to a transcriptional activation domain or TAD. In various embodiments, the zinc finger DBD can be conjugated to a TAD from a viral protein such as VP64 or VPR or a TAD from a human protein such as CITED2, CITED4, or CREB3. In certain embodiments, a zinc finger DBD derived from a human protein such as EGR1 or EGR3 is conjugated to a TAD derived from a human protein such as CITED2, CITED4, or CREB3. In certain embodiments, a zinc finger DBD derived from a human protein such as EGR1 or EGR3 is conjugated to a VP64 or VPR TAD. In certain embodiments, a synthetic zinc finger DBD or a zinc finger DBD having less than 75% sequence identity to a human protein such as EGR1 or EGR3 is conjugated to a TAD derived from a human protein such as CITED2, CITED4, or CREB3. In certain embodiments, a synthetic zinc finger DBD or a zinc finger DBD having less than 75% sequence identity to a human protein such as EGR1 or EGR3 is conjugated to a VP64 or VPR TAD.

[0170] In certain embodiments, the dCas protein is conjugated to a TAD. In various embodiments, the dCas can be conjugated to a TAD from a viral protein such as VP64 or VPR or a TAD from a human protein such as CITED2, CITED4, or CREB3. In an exemplary embodiment, dCas9 is conjugated to a VP64 or VPR TAD.

[0171] In certain embodiments, the TALE protein is conjugated to a TAD. In various embodiments, the TALE can be conjugated to a TAD from a viral protein such as VP64 or VPR or a TAD from a human protein such as CITED2, CITED4, or CREB3. In an exemplary embodiment, the TALE is conjugated to a VP64 or VPR TAD.

[0172] eTFs that upregulate SCN1A and are highly homologous to human proteins

[0173] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein have a high percent identity with one or more human proteins (as further described below). In certain embodiments, such eTFs have an overall sequence identity of at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with one or more human proteins. In certain embodiments, such eTFs exhibit reduced immunogenicity compared to eTFs having a lower overall sequence identity percent with one or more human proteins. In various embodiments, the reduction in immunogenicity can be measured using an elispot assay, an immunoassay or in silico methods. In certain embodiments, such eTFs may comprise a DBD derived from human EGR1 or EGR3 and a TAD derived from human EGR1, EGR3, CITED2, CITED4 or CREB3. Such eTFs have no or little immunogenicity or have reduced immunogenicity when administered to a subject compared to eTFs having a lower percent identity with the human protein sequence.

[0174] In certain embodiments, the eTFs that upregulate SNC1A provided herein have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with one or more human proteins. When the eTFs that upregulate SNC1A provided herein contain a DBD and a TAD derived from the same protein, the percentage of identity with a human protein can be determined by calculating the total number of amino acid residues in the eTF that match the human protein from which it is derived (e.g., EGR1 or EGR3) divided by the total number of amino acid residues in the eTF. When the eTFs that upregulate SNC1A provided contain a DBD from one human protein and a TAD derived from a different human protein, the percentage of identity with the human counterpart can be determined by calculating the percentage of identity of each domain with the human counterpart and adding the two together. For example, (i) calculate the total number of amino acid residues in the DBD that match the human protein from which it is derived (e.g., EGR1 or EGR3), divided by the total number of amino acid residues in the eTF; (ii) calculate the total number of amino acid residues in the TAD that match the human protein from which it is derived (e.g., CITED2, CITED4 or CREB3), divided by the total number of amino acid residues in the eTF; and (iii) add the sums of (i) and (ii). In such embodiments, the domains are divided as follows: the first domain extends from the N-terminus of the eTF to the start of the coding sequence of the second domain, and the second domain extends from the start of the coding sequence of the second domain to the C-terminus of the eTF (e.g., for an eTF having the configuration NLS-DBD-linker-NLS-TAD, the first domain is NLS-DBD-linker and the second domain is NLS-TAD).When the eTF that upregulates SNC1A provided herein comprises a DBD from one human protein and two TADs derived from one or more different human proteins, the percent identity with the human counterpart can be determined by calculating the percent identity of each domain with the human counterpart separately and adding all three together. For example, (i) calculate the total number of amino acid residues in the DBD that match the human protein from which it is derived (e.g., EGR1 or EGR3), and divide by the total number of amino acid residues in the eTF; (ii) calculate the total number of amino acid residues in the first TAD that match the human protein from which it is derived (e.g., CITED2, CITED4, or CREB3), and divide by the total number of amino acid residues in the eTF; (iii) calculate the total number of amino acid residues in the second TAD that match the human protein from which it is derived (e.g., CITED2, CITED4, or CREB3), and divide by the total number of amino acid residues in the eTF; and (iv) add the sums of (i), (ii), and (iii). In such an embodiment, the domains are divided as follows: the first domain extends from the N-terminus of the eTF to the start of the coding sequence of the second domain, the second domain extends from the start of the coding sequence of the second domain to the start of the coding sequence of the third domain, and the third domain extends from the start of the coding sequence of the third domain to the C-terminus of the eTF (e.g., for an eTF having the configuration NLS-TAD1-linker-NLS-DBD-linker-NLS-TAD2, the first domain is NLS-TAD1-linker, the second domain is NLS-DBD-linker, and the third domain is NLS-TAD2). As described in this section, the percent identity with one or more human proteins can be determined using a percent identity output obtained using the standard protein BLAST tool available from NCBI (e.g., the blastp suite alignment tool, using the blastp (protein->protein) algorithm with default parameters), which can be obtained from the NCBI website at blast.ncbi.nlm.nih.gov / on the World Wide Web.

[0175] In certain embodiments, due to the high sequence identity with naturally occurring human proteins, the eTFs that upregulate SNC1A provided herein have the benefit of eliciting a very low, minimal, or no adverse immune response in human subjects. In certain embodiments, the eTFs that upregulate SNC1A provided herein elicit reduced immunogenicity as compared to the immunogenicity observed with eTFs having a lower percentage identity with one or more human proteins (e.g., eTFs having a sequence identity of less than 50%, 55%, 65%, or 70% with one or more human proteins), such as at least 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50-fold or more reduction in immunogenicity. In some cases, the reduction in immunogenicity can be measured using an elispot assay, an immunoassay, or in silico methods. Gene therapies with low or minimal immunogenicity have several advantages, including improved patient tolerance, reduced doses required to achieve a therapeutic effect, extended therapeutic effects after a single administration, the ability to administer multiple times or in multiple doses as needed, therapeutic efficacy that persists over a longer period of time per administration, increased safety and / or increased effectiveness of the gene therapy.

[0176] In certain embodiments, the eTFs provided herein that upregulate SNC1A and have a high percentage sequence identity with one or more human proteins comprise a DBD and a TAD derived from one or more naturally occurring human proteins. In certain embodiments, such eTFs can comprise a DBD derived from any naturally occurring human protein that comprises a DBD. In an exemplary embodiment, the eTFs provided herein that upregulate SNC1A and have a high percentage sequence identity with one or more human proteins comprise a DBD derived from a naturally occurring zinc finger protein, such as any one of constructs 5-27, 36-41, or 44-53 listed in Table 1. In certain embodiments, the eTFs provided herein that upregulate SNC1A and have a high percentage sequence identity with one or more human proteins comprise a DBD derived from a human EGR protein such as EGR1, EGR2, EGR3, or EGR4. In an exemplary embodiment, the eTFs provided herein that upregulate SNC1A and have a high percentage sequence identity with one or more human proteins comprise a DBD derived from human EGR1 or EGR3. In various embodiments, the eTFs provided herein that upregulate SNC1A and have a high percentage sequence identity with one or more human proteins comprise a DBD derived from a human zinc finger protein, wherein minimal amino acid changes (e.g., 1, 2, 3, 4, 5, 6, 7, or 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 2-3, 2-4, 2-5, 2-6, 2-7, 3-4, 3-5, 3-6, or 3-7 amino acid changes) have been made in one or more zinc finger domains of the DBD to alter the binding specificity of the DBD for the target binding site of interest. Such sequence modifications are preferably made in the recognition helix of the zinc finger domains of the DBD, while the remaining human zinc finger DBD or protein (including the TAD) remains unmodified, thereby maintaining as high a sequence identity as possible with the naturally occurring human protein.

[0177] In certain embodiments, the eTFs provided herein that upregulate SNC1A and have a high percent sequence identity to one or more human proteins comprise one or more transcriptional regulatory domains (e.g., TADs) derived from a human protein conjugated to a DBD derived from a human protein. In various embodiments, the transcriptional regulatory domain can be derived from any naturally occurring human protein that has a domain capable of recruiting one or more protein factors that can regulate transcription (e.g., RNA polymerase II, co-activator proteins, or co-repressor proteins) or gene expression levels from a target gene when the eTF binds to the target site via the DBD. In an exemplary embodiment, the TAD is derived from a human EGR protein, such as human EGR1, EGR2, EGR3, or EGR4, or a cited human protein, such as the human CITED2 or CITED4 protein. In an exemplary embodiment, the eTFs provided herein that upregulate SNC1A and have a high percent sequence identity to one or more human proteins comprise a TAD from a human EGR1 or EGR3 protein. In another exemplary embodiment, the eTFs provided herein that upregulate SNC1A and have a high percent sequence identity to one or more human proteins comprise a TAD from a human CITED2 or CITED4 protein.

[0178] In one embodiment, the eTFs provided herein that upregulate SNC1A and have a high percent sequence identity to one or more human proteins can comprise a human DBD (hDBD) and a human TAD (hTAD) (e.g., hTAD-hDBD or hDBD-hTAD), wherein the hDBD and hTAD can be derived from the same human protein or different human proteins. In another embodiment, the eTFs provided herein that have a high percent sequence identity to one or more human proteins can comprise an hDBD and two hTADs, wherein the hDBD and hTADs are derived from the same human protein, the hDBD is derived from a first human protein and both hTADs are derived from a second human protein, the hDBD and one hTAD are derived from a first human protein and the second hTAD is derived from a second human protein, or the hDBD is derived from a first human protein, one hTAD is derived from a second human protein, and the second hTAD is derived from a third human protein (e.g., hTAD1-hDBD-hTAD1, hTAD1-hDBD-hTAD2, hTAD1-hTAD1-hDBD, hTAD1-hTAD2-hDBD, hDBD-hTAD1-hTAD1, or hDBD-hTAD1-hTAD2).

[0179] In exemplary embodiments, the eTFs provided herein having a high percentage of sequence identity with one or more human proteins include any of the following configurations: (i) an hDBD and an hTAD both derived from human EGR1; (ii) an hDBD and an hTAD both derived from human EGR3; (iii) an hDBD derived from human EGR1 and an hTAD derived from CITED2 (e.g., hEGR1 DBD-hCITED2 TAD or hCITED2 TAD-hEGR1 DBD); (iv) an hDBD derived from human EGR1 and an hTAD derived from human CITED4 (e.g., hEGR1 DBD-hCITED4 TAD or hCITED4 TAD-hEGR1 DBD); (v) an hDBD derived from human EGR3 and an hTAD derived from CITED2 (e.g., hEGR3 DBD-hCITED2 TAD or hCITED2 TAD-hEGR3 DBD); (vi) an hDBD derived from human EGR3 and an hTAD derived from human CITED4 (e.g., hEGR3 DBD-hCITED4 TAD or hCITED4 TAD-hEGR3 DBD); (vii) an hDBD derived from human EGR1 and two hTADs derived from CITED2 (e.g., hCITED2 TAD-hEGR1 DBD-hCITED2 TAD, hCITED2 TAD-hCITED2 TAD-hEGR1 DBD, or hEGR1 DBD-hCITED2 TAD-hCITED2 TAD); (viii) an hDBD derived from human EGR1 and two hTADs derived from human CITED4 (e.g., hCITED4 TAD-hEGR1 DBD-hCITED4 TAD, hCITED4 TAD-hCITED4 TAD-hEGR1 DBD, or hEGR1 DBD-hCITED4 TAD-hCITED4 TAD); (ix) an hDBD derived from human EGR3 and two hTADs derived from human CITED2 (e.g., hCITED2 TAD-hEGR3 DBD-hCITED2 TAD, hCITED2 TAD-hCITED2 TAD-hEGR3 DBD, or hEGR3 DBD-hCITED2 TAD-hCITED2 TAD); (x) an hDBD derived from human EGR3 and two hTADs derived from human CITED4 (e.g., hCITED4 TAD-hEGR3 DBD-hCITED4 TAD, hCITED4 TAD-hCITED4 TAD-hEGR3 DBD, or hEGR3 DBD-hCITED4 TAD-hCITED4 TAD);(xi) The hDBD derived from human EGR1, the first hTAD derived from human CITED2, and the second hTAD derived from human CITED4 (e.g., hCITED2 TAD-hEGR1 DBD-hCITED4 TAD, hCITED4 TAD-hEGR1 DBD-hCITED2 TAD, hCITED2 TAD-hCITED4 TAD-hEGR1 DBD, hCITED4 TAD-hCITED2 TAD-hEGR1 DBD, hEGR1 DBD-hCITED4 TAD-hCITED2 TAD, or hEGR1 DBD-hCITED2 TAD-hCITED4 TAD); or (xii) The hDBD derived from human EGR3, the first hTAD derived from human CITED2, and the second hTAD derived from human CITED4 (e.g., hCITED2 TAD-hEGR3 DBD-hCITED4 TAD, hCITED4 TAD-hEGR3 DBD-hCITED2 TAD, hCITED2 TAD-hCITED4 TAD-hEGR3 DBD, hCITED4 TAD-hCITED2 TAD-hEGR3 DBD, hEGR3 DBD-hCITED4 TAD-hCITED2 TAD, or hEGR3 DBD-hCITED2 TAD-hCITED4 TAD).;

[0180] In certain embodiments, the eTFs provided herein that upregulate SNC1A and have a high percentage of sequence identity with one or more human proteins include any of the following: (i) a sequence comprising any one of SEQ ID NOs: 103-124, 128-131, 205, 207, 209, 213, 217, 219, 221, or 223; (ii) a sequence comprising any one of SEQ ID NOs: 92-98; (iii) a sequence having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with any one of the sequences of (i) or (ii), or (iv) a functional fragment or variant of any one of the sequences of (i), (ii), or (iii). In an exemplary embodiment, such eTFs are capable of upregulating SCN1A expression by at least 2-fold, 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold, or more compared to a control, or by at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 100%, 125%, 150%, 200%, 250%, 300%, 400%, or 500% or more compared to a control. In an exemplary embodiment, such eTFs have an overall sequence identity of at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% with one or more human proteins. In certain embodiments, such eTFs exhibit reduced immunogenicity compared to eTFs having a lower overall percentage of sequence identity with one or more human proteins. In various embodiments, the reduction in immunogenicity can be measured using an elispot assay, an immunoassay, or in silico methods.

[0181] In certain embodiments, the eTFs provided herein that upregulate SNC1A and have a high percentage of sequence identity with one or more human proteins may additionally comprise one or more amino acid sequences or domains, such as a nuclear localization signal or a linker, etc., in addition to the DBD and TAD domains. Additionally, the polynucleotide encoding the eTFs provided herein that have a high percentage of sequence identity with one or more human proteins may additionally comprise one or more nucleic acid sequences, such as a promoter, an enhancer, a poly-A tail, etc., in addition to the coding sequence of the eTF. In such embodiments, the one or more additional amino acid sequences and / or nucleic acid sequences are preferably human sequences, derived from human sequences, or have at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with human proteins.

[0182] Exemplary SCN1A eTF

[0183] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein comprise a DNA-binding domain having one or more zinc finger domains, wherein the zinc finger domains comprise recognition helices containing any one of SEQ ID NOs: 152-167. In certain embodiments, the eTFs that upregulate SCN1A disclosed herein comprise a DNA-binding domain having at least one, two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve zinc finger domains, wherein each zinc finger domain independently comprises a recognition helix containing any one of SEQ ID NOs: 152-167. In certain embodiments, the eTFs that upregulate SCN1A disclosed herein comprise a DNA-binding domain having six zinc finger domains, wherein each zinc finger domain independently comprises a recognition helix containing any one of SEQ ID NOs: 152-167. In certain embodiments, the eTFs that upregulate SCN1A disclosed herein comprise a DNA-binding domain having nine zinc finger domains, wherein each zinc finger domain independently comprises a recognition helix containing any one of SEQ ID NOs: 152-167. In an exemplary embodiment, such an eTF comprises a DNA-binding domain having SEQ ID NO: 147, wherein each X is independently selected from any one of SEQ ID NOs: 152-167, and n is 6 or 9.

[0184] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein comprise a DNA binding domain having any of the following sequences: (i) a sequence comprising RSDNLVR x REDNLHT x RSDELVR x QSGNLTE x TSGHLVR x QNSTLTE (SEQ ID NO: 148), wherein x can be a linker of 1-50 amino acids, (ii) a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 148, or (ii) a functional fragment of (i) or (ii). In certain embodiments, such eTFs further comprise one or more TADs selected from VP64, VPR, CITED2, CITED4 or CREB3. In one embodiment, such eTF comprises a VPR TAD domain conjugated to the C-terminus of the DBD. In certain embodiments, such eTF comprises a CITED2 TAD conjugated to the N-terminus, C-terminus or both the N-terminus and C-terminus of the DBD. In certain embodiments, such eTF comprises a CITED4 TAD conjugated to the N-terminus, C-terminus or both the N-terminus and C-terminus of the DBD. In certain embodiments, such eTF comprises two CITED4 TADs conjugated to the N-terminus or C-terminus of the DBD. In certain embodiments, such eTF is capable of binding to a target site having SEQ ID NO: 18 and upregulating the expression of SCN1A by at least 2-fold, 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold or more compared to a control, or by at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 100%, 125%, 150%, 200%, 250%, 300%, 400% or 500% or more compared to a control.

[0185] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein comprise a DNA binding domain having any of the following sequences: (i) a sequence comprising RSDNLVR x HRTTLTN x REDNLHT x TSHSLTE x QSSSLVR x REDNLHT (SEQ ID NO: 149), where x can be a linker of 1-50 amino acids, (ii) a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 149, or (ii) a functional fragment of (i) or (ii). In certain embodiments, such eTFs further comprise one or more TADs selected from VP64, VPR, CITED2, CITED4 or CREB3. In one embodiment, such an eTF comprises a VPR TAD domain conjugated to the C-terminus of the DBD. In certain embodiments, such an eTF comprises a CITED2 TAD conjugated to the N-terminus, C-terminus or both the N-terminus and C-terminus of the DBD. In certain embodiments, such an eTF comprises a CITED4 TAD conjugated to the N-terminus, C-terminus or both the N-terminus and C-terminus of the DBD. In certain embodiments, such an eTF comprises two CITED4 TADs conjugated to the N-terminus or C-terminus of the DBD. In certain embodiments, such an eTF is capable of binding to a target site having SEQ ID NO: 30 and upregulating the expression of SCN1A by at least 2-fold, 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold or more compared to a control, or by at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 100%, 125%, 150%, 200%, 250%, 300%, 400% or 500% or more compared to a control.

[0186] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein comprise a DNA binding domain having any of the following sequences: (i) a sequence comprising RRDELNV x RSDHLTN x RSDDLVR x RSDNLVR x HRTTLTN x REDNLHT x TSHSLTE x QSSSLVR x REDNLHT (SEQ ID NO: 151), (ii) a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 151, or (ii) a functional fragment of (i) or (ii). In certain embodiments, such eTFs further comprise one or more TADs selected from VP64, VPR, CITED2, CITED4 or CREB3. In one embodiment, such an eTF comprises a VPR TAD domain conjugated to the C-terminus of the DBD. In certain embodiments, such an eTF comprises a CITED2 TAD conjugated to the N-terminus, C-terminus or both the N-terminus and C-terminus of the DBD. In certain embodiments, such an eTF comprises a CITED4 TAD conjugated to the N-terminus, C-terminus or both the N-terminus and C-terminus of the DBD. In certain embodiments, such an eTF comprises two CITED4 TADs conjugated to the N-terminus or C-terminus of the DBD. In certain embodiments, such an eTF is capable of binding to a target site having SEQ ID NO: 32 and upregulating the expression of SCN1A by at least 2-fold, 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold or more compared to a control, or by at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 100%, 125%, 150%, 200%, 250%, 300%, 400% or 500% or more compared to a control.

[0187] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein comprise a DNA-binding domain having any of the following sequences: (i) a sequence comprising DPGALVR x RSDNLVR x QSGDLRR x THLDLIR x TSGNLVR x RSDNLVR (SEQ ID NO: 150), (ii) a sequence having at least 89%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 150, or (ii) a functional fragment of (i) or (ii). In certain embodiments, such eTFs further comprise one or more TADs selected from VP64, VPR, CITED2, CITED4 or CREB3. In one embodiment, such an eTF comprises a VPR TAD domain conjugated to the C-terminus of the DBD. In certain embodiments, such an eTF comprises a CITED2 TAD conjugated to the N-terminus, C-terminus or both the N-terminus and C-terminus of the DBD. In certain embodiments, such an eTF comprises a CITED4 TAD conjugated to the N-terminus, C-terminus or both the N-terminus and C-terminus of the DBD. In certain embodiments, such an eTF comprises two CITED4 TADs conjugated to the N-terminus or C-terminus of the DBD. In certain embodiments, such an eTF is capable of binding to a target site having SEQ ID NO: 31 and upregulating the expression of SCN1A by at least 2-fold, 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold or more compared to a control, or by at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 100%, 125%, 150%, 200%, 250%, 300%, 400% or 500% or more compared to a control.

[0188] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein comprise any of the following sequences: (i) a sequence comprising any one of SEQ ID NO: 99 - 131, 205, 207, 209, 213, 217, 219, 221, or 223; (ii) a sequence comprising any one of SEQ ID NO: 77 - 98; (iii) a sequence having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the sequences of (i) or (ii), or (iv) a functional fragment or variant of any one of the sequences of (i), (ii), or (iii). In exemplary embodiments, such eTFs are capable of upregulating SCN1A expression by at least 2-fold, 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold, or more compared to a control, or by at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 100%, 125%, 150%, 200%, 250%, 300%, 400%, or 500% or more compared to a control.

[0189] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein comprise any of the following sequences: (i) a sequence comprising any one of SEQ ID NO: 99 - 102 or 125 - 127; (ii) a sequence comprising any one of SEQ ID NO: 77 - 91; (iii) a sequence having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the sequences of (i) or (ii), or (iv) a functional fragment or variant of any one of the sequences of (i), (ii), or (iii). In exemplary embodiments, such eTFs are capable of upregulating SCN1A expression by at least 2-fold, 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold, or more compared to a control, or by at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 100%, 125%, 150%, 200%, 250%, 300%, 400%, or 500% or more compared to a control.

[0190] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein comprise any of the following sequences: (i) a sequence comprising any one of SEQ ID NO: 103-124, 128-131, 205, 207, 209, 213, 217, 219, 221, or 223; (ii) a sequence comprising any one of SEQ ID NO: 92-98; (iii) a sequence having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the sequences of (i) or (ii), or (iv) a functional fragment or variant of any one of the sequences of (i), (ii), or (iii). In an exemplary embodiment, such eTFs are capable of upregulating SCN1A expression by at least 2-fold, 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold, or more compared to a control, or by at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 100%, 125%, 150%, 200%, 250%, 300%, 400%, or 500% or more compared to a control. In an exemplary embodiment, such eTFs have at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% overall sequence identity to one or more human proteins. In certain embodiments, such eTFs exhibit reduced immunogenicity compared to eTFs having a lower percentage of overall sequence identity to one or more human proteins. In various embodiments, the reduction in immunogenicity can be measured using an elispot assay, an immunoassay, or in silico methods.

[0191] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein comprise any of the following sequences: (i) a sequence comprising SEQ ID NO: 127; (ii) a sequence having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 127, or (iii) a functional fragment or variant of any of the sequences in (i) or (ii). In an exemplary embodiment, such an eTF comprises SEQ ID NO: 77 and binds to a target site having SEQ ID NO: 18. In an exemplary embodiment, such an eTF is capable of upregulating SCN1A expression by at least 2-fold, 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold or more compared to a control, or by at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 100%, 125%, 150%, 200%, 250%, 300%, 400% or 500% or more compared to a control.

[0192] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein comprise any of the following sequences: (i) a sequence comprising SEQ ID NO: 128; (ii) a sequence having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 128, or (iii) a functional fragment or variant of any of the sequences in (i) or (ii). In an exemplary embodiment, such an eTF comprises SEQ ID NO: 92 and binds to a target site having SEQ ID NO: 18. In an exemplary embodiment, such an eTF is capable of upregulating SCN1A expression by at least 2-fold, 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold or more compared to a control, or by at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 100%, 125%, 150%, 200%, 250%, 300%, 400% or 500% or more compared to a control. In an exemplary embodiment, such an eTF has at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% overall sequence identity to one or more human proteins. In certain embodiments, such eTFs exhibit reduced immunogenicity compared to eTFs having a lower overall sequence identity percentage to one or more human proteins. In various embodiments, the reduction in immunogenicity can be measured using an elispot assay, an immunoassay or in silico methods.

[0193] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein comprise any of the following sequences: (i) a sequence comprising SEQ ID NO: 129; (ii) a sequence having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 129, or (iii) a functional fragment or variant of any of the sequences in (i) or (ii). In an exemplary embodiment, such an eTF comprises SEQ ID NO: 92 and binds to a target site having SEQ ID NO: 18. In an exemplary embodiment, such an eTF is capable of upregulating SCN1A expression by at least 2-fold, 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold or more compared to a control, or by at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 100%, 125%, 150%, 200%, 250%, 300%, 400% or 500% or more compared to a control. In an exemplary embodiment, such an eTF has at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% overall sequence identity to one or more human proteins. In certain embodiments, such eTFs exhibit reduced immunogenicity compared to eTFs having a lower overall sequence identity percentage to one or more human proteins. In various embodiments, the reduction in immunogenicity can be measured using an elispot assay, an immunoassay or in silico methods.

[0194] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein comprise any of the following sequences: (i) a sequence comprising SEQ ID NO: 130; (ii) a sequence having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 130, or (iii) a functional fragment or variant of any of the sequences in (i) or (ii). In an exemplary embodiment, such an eTF comprises SEQ ID NO: 92 and binds to a target site having SEQ ID NO: 18. In an exemplary embodiment, such an eTF is capable of upregulating SCN1A expression by at least 2-fold, 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold or more compared to a control, or at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 100%, 125%, 150%, 200%, 250%, 300%, 400% or 500% or more compared to a control. In an exemplary embodiment, such an eTF has at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% overall sequence identity to one or more human proteins. In certain embodiments, such eTFs exhibit reduced immunogenicity compared to eTFs having a lower overall sequence identity percentage to one or more human proteins. In various embodiments, the reduction in immunogenicity can be measured using an elispot assay, an immunoassay or in silico methods.

[0195] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein comprise any of the following sequences: (i) a sequence comprising SEQ ID NO: 131; (ii) a sequence having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 131, or (iii) a functional fragment or variant of any of the sequences in (i) or (ii). In an exemplary embodiment, such an eTF comprises SEQ ID NO: 92 and binds to a target site having SEQ ID NO: 18. In an exemplary embodiment, such an eTF is capable of upregulating SCN1A expression by at least 2-fold, 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold, or more compared to a control, or by at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 100%, 125%, 150%, 200%, 250%, 300%, 400%, or 500% or more compared to a control. In an exemplary embodiment, such an eTF has at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% overall sequence identity to one or more human proteins. In certain embodiments, such an eTF exhibits reduced immunogenicity compared to an eTF having a lower overall sequence identity percentage to one or more human proteins. In various embodiments, the reduction in immunogenicity can be measured using an elispot assay, an immunoassay, or in silico methods.

[0196] In certain embodiments, the eTFs that upregulate SCN1A disclosed herein comprise a DBD containing a gRNA / Cas complex, wherein the gRNA comprises a targeting sequence containing any one of SEQ ID NOs: 35 - 66. The target sequence of the gRNA is linked to the 5' end of a scaffold sequence having the following sequence: 5'-GTTTTAGTACTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGA-3' (SEQ ID NO: 183). In an exemplary embodiment, the Cas protein is a nuclease-inactivated Cas9 protein. In certain embodiments, such eTFs further comprise one or more TADs conjugated to the Cas protein, wherein the TAD is selected from VP64, VPR, CITED2, CITED4, or CREB3. In one embodiment, such an eTF comprises a VPR TAD domain conjugated to the C-terminus of the Cas protein. In certain embodiments, such eTFs comprise a CITED2 TAD conjugated to the N-terminus, C-terminus, or N-terminus and C-terminus of the Cas protein. In certain embodiments, such eTFs comprise a CITED4 TAD conjugated to the N-terminus, C-terminus, or N-terminus and C-terminus of the Cas protein. In an exemplary embodiment, compared to a control, such eTFs are capable of upregulating SCN1A expression by at least 2-fold, 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold, or higher.

[0197] Polynucleotide

[0198] In another aspect, the present application provides a polynucleotide encoding any of the eTFs that upregulate SCN1A disclosed herein. In another aspect, the present application provides a polynucleotide comprising a PV-selective microRNA binding site. In certain embodiments, the present application provides a polynucleotide comprising a PV-selective regulatory element and a PV-selective microRNA binding site operably linked to a transgene. In certain embodiments, the present application provides a polynucleotide comprising a sequence encoding an eTF that upregulates SCN1A disclosed herein and a PV-selective microRNA binding site. In certain embodiments, the present application provides a PV-selective regulatory element and a PV-selective regulatory element operably linked to a transgene encoding an eTF that upregulates SCN1A.

[0199] Polynucleotide encoding an eTF that upregulates SCN1A

[0200] In certain embodiments, the present application provides a polynucleotide comprising any one of the following sequences: (i) a nucleic acid sequence encoding an eTF or a variant or functional fragment thereof that upregulates SCN1A, the eTF comprising any one of SEQ ID NOs: 77 - 131, 205, 207, 209, 213, 217, 219, 221, or 223; (ii) a nucleic acid encoding a functional fragment of an eTF that upregulates SCN1A, the eTF having any one of SEQ ID NOs: 77 - 131, 205, 207, 209, 213, 217, 219, 221, or 223; or (iii) a nucleic acid encoding an eTF or a variant or functional fragment thereof that upregulates SCN1A, the eTF having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to an eTF that upregulates SCN1A having any one of SEQ ID NOs: 77 - 131, 205, 207, 209, 213, 217, 219, 221, or 223.

[0201] In certain embodiments, the present application provides a polynucleotide comprising any one of the following sequences: (i) a nucleic acid sequence encoding a DBD or a variant or functional fragment thereof, the DBD comprising any one of SEQ ID NOs: 92 - 98; (ii) a nucleic acid encoding a functional fragment of a DBD, the DBD having any one of SEQ ID NOs: 92 - 98; or (iii) a nucleic acid encoding a DBD or a variant or functional fragment thereof, the DBD having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to a DBD having any one of SEQ ID NOs: 92 - 98, wherein the DBD is capable of binding to a target site bound by any one of SEQ ID NOs: 92 - 98.

[0202] In certain embodiments, the present application provides polynucleotides encoding eTFs that upregulate endogenous SCN1A, wherein the polynucleotide comprises any one of the following sequences: (i) a nucleic acid sequence encoding an eTF comprising any one of SEQ ID NOs: 103-124, 128-131, 205, 207, 209, 213, 217, 219, 221, or 223; (ii) a nucleic acid encoding a functional fragment of an eTF having any one of SEQ ID NOs: 103-124, 128-131, 205, 207, 209, 213, 217, 219, 221, or 223; or (iii) a nucleic acid encoding an eTF that has at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to an eTF having any one of SEQ ID NOs: 103-124, 128-131, 205, 207, 209, 213, 217, 219, 221, or 223, wherein the eTF is capable of upregulating SCN1A.

[0203] In certain embodiments, the present application provides polynucleotides encoding DBDs that bind to genomic target sites of endogenous SCN1A and are capable of upregulating them when bound to the eTFs disclosed herein, wherein the polynucleotide comprises any one of the following sequences: (i) a nucleic acid sequence encoding a DBD comprising any one of SEQ ID NOs: 77-98; (ii) a nucleic acid encoding a functional fragment of a DBD having any one of SEQ ID NOs: 77-98; or (iii) a nucleic acid encoding an eTF that has at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to a DBD having any one of SEQ ID NOs: 77-98, wherein the DBD is capable of binding to a target site that binds to any one of SEQ ID NOs: 77-98.

[0204] In certain embodiments, the present application provides a polynucleotide encoding a DBD that, when bound to an eTF disclosed herein, is capable of upregulating binding to the genomic target site of endogenous SCN1A, wherein the polynucleotide comprises any one of the following sequences: (i) a nucleic acid sequence encoding a DBD comprising any one of SEQ ID NOs: 148-151; (ii) a nucleic acid encoding a functional fragment of a DBD having any one of SEQ ID NOs: 148-151; or (iii) a nucleic acid encoding an eTF that has at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to a DBD having any one of SEQ ID NOs: 148-151, wherein the DBD is capable of binding to a target site that binds to any one of SEQ ID NOs: 92-98.

[0205] In certain embodiments, the present application provides a polynucleotide encoding an eTF capable of regulating endogenous SCN1A, wherein the polynucleotide comprises any one of the following sequences: (i) a nucleic acid sequence having any one of SEQ ID NOs: 70-76 or 184; (ii) a nucleic acid having a functional fragment of any one of the sequences of (i); or (iii) a nucleic acid having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to any one of the sequences of (i) or (ii), wherein the polynucleotide encodes an eTF capable of upregulating SCN1A.

[0206] In certain embodiments, the present application provides a polynucleotide encoding an eTF capable of regulating endogenous SCN1A, wherein the polynucleotide comprises any one of the following sequences: (i) a nucleic acid sequence having SEQ ID NO: 70; (ii) a nucleic acid having a functional fragment of SEQ ID NO: 70; or (iii) a nucleic acid having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to any one of the sequences of (i) or (ii). In an exemplary embodiment, such a polynucleotide encodes an eTF having SEQ ID NO: 127, or a functional fragment or variant thereof that is capable of upregulating SCN1A.

[0207] In certain embodiments, the present application provides polynucleotides encoding eTFs capable of modulating endogenous SCN1A, wherein the polynucleotide comprises any one of the following sequences: (i) a nucleic acid sequence having SEQ ID NO:71; (ii) a nucleic acid having a functional fragment of SEQ ID NO:71; or (iii) a nucleic acid having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to any one of the sequences of (i) or (ii). In an exemplary embodiment, such polynucleotides encode an eTF having SEQ ID NO:127, or a functional fragment or variant thereof that is capable of upregulating SCN1A.

[0208] In certain embodiments, the present application provides polynucleotides encoding eTFs capable of modulating endogenous SCN1A, wherein the polynucleotide comprises any one of the following sequences: (i) a nucleic acid sequence having SEQ ID NO:72; (ii) a nucleic acid having a functional fragment of SEQ ID NO:72; or (iii) a nucleic acid having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to any one of the sequences of (i) or (ii). In an exemplary embodiment, such polynucleotides encode an eTF having SEQ ID NO:130, or a functional fragment or variant thereof that is capable of upregulating SCN1A.

[0209] In certain embodiments, the present application provides polynucleotides encoding eTFs capable of modulating endogenous SCN1A, wherein the polynucleotide comprises any one of the following sequences: (i) a nucleic acid sequence having SEQ ID NO:73; (ii) a nucleic acid sequence having a functional fragment of SEQ ID NO:73; or (iii) a nucleic acid having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to any one of the sequences of (i) or (ii). In an exemplary embodiment, such polynucleotides encode an eTF having SEQ ID NO:131, or a functional fragment or variant thereof that is capable of upregulating SCN1A.

[0210] In certain embodiments, the present application provides polynucleotides encoding eTFs capable of modulating endogenous SCN1A, wherein the polynucleotide comprises any one of the following sequences: (i) a nucleic acid sequence having SEQ ID NO:74; (ii) a nucleic acid sequence having a functional fragment of SEQ ID NO:74; or (iii) a nucleic acid having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to any one of the sequences of (i) or (ii). In an exemplary embodiment, such polynucleotides encode an eTF having SEQ ID NO:127, or a functional fragment or variant thereof that is capable of upregulating SCN1A.

[0211] In certain embodiments, the present application provides polynucleotides encoding eTFs capable of modulating endogenous SCN1A, wherein the polynucleotide comprises any one of the following sequences: (i) a nucleic acid sequence having SEQ ID NO:75; (ii) a nucleic acid sequence having a functional fragment of SEQ ID NO:75; or (iii) a nucleic acid having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to any one of the sequences of (i) or (ii). In an exemplary embodiment, such polynucleotides encode an eTF having SEQ ID NO:127, or a functional fragment or variant thereof that is capable of upregulating SCN1A.

[0212] In certain embodiments, the present application provides polynucleotides encoding eTFs capable of modulating endogenous SCN1A, wherein the polynucleotide comprises any one of the following sequences: (i) a nucleic acid sequence having SEQ ID NO:76; (ii) a nucleic acid sequence having a functional fragment of SEQ ID NO:76; or (iii) a nucleic acid having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to any one of the sequences of (i) or (ii). In an exemplary embodiment, such polynucleotides encode an eTF having SEQ ID NO:106, or a functional fragment or variant thereof that is capable of upregulating SCN1A.

[0213] In certain embodiments, the present application provides polynucleotides encoding eTFs capable of modulating endogenous SCN1A, wherein the polynucleotide comprises any one of the following sequences: (i) a nucleic acid sequence having SEQ ID NO: 184; (ii) a nucleic acid sequence having a functional fragment of SEQ ID NO: 184; or (iii) a nucleic acid having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to any sequence of (i) or (ii). In an exemplary embodiment, such polynucleotides encode an eTF having SEQ ID NO: 106, or a functional fragment or variant thereof capable of upregulating SCN1A.

[0214] A polynucleotide comprising a microRNA binding site for selective expression in PV neurons

[0215] In another aspect, the present application provides a polynucleotide comprising a microRNA binding site that results in selective expression of a gene of interest in parvalbumin (PV) neurons. MicroRNAs or miRNAs are small non-coding RNAs (about 20 nucleotides) that post-transcriptionally regulate gene expression by hybridizing to complementary recognition sites within mRNA molecules, and cause inhibition of gene expression by promoting degradation of mRNA transcripts or by inhibiting translation of the protein encoded by the mRNA. The microRNA binding sites provided herein inhibit expression of the gene of interest in excitatory neurons, thereby promoting selective expression of the gene of interest in PV neurons (e.g., PV-selective microRNA binding sites). In certain embodiments, the excitatory neurons are neurons expressing one or more of STAC, Slc17a7, Car12, Syt17, ITPKA, Col6a1, CamKII, Sv2b, INHBA, and / or DKK3. In an exemplary embodiment, the excitatory neurons are neurons expressing CamKII.

[0216] In certain embodiments, the present application provides polynucleotides comprising one or more microRNA binding sites for one or more microRNAs that promote PV selective expression, e.g., promote the degradation of mRNAs containing such microRNA binding sites in excitatory neurons. Exemplary microRNAs that promote PV selective expression include, for example, miR-128, miR-221, and miR-222. In certain embodiments, the present application provides polynucleotides comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more PV selective microRNA binding sites. In one embodiment, the present application provides a polynucleotide comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more miR-128 binding sites (SEQ ID NO:9). In one embodiment, the present application provides a polynucleotide comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more miR-221 binding sites (SEQ ID NO:11). In one embodiment, the present application provides a polynucleotide comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more miR-222 binding sites (SEQ ID NO:13). In one embodiment, the present application provides a polynucleotide comprising at least 1 miR-128 binding site, at least 1 miR-221 binding site, and at least 1 miR-222 binding site. In one embodiment, the present application provides a polynucleotide comprising at least 1 miR-128 binding site and at least 1 miR-222 binding site. In one embodiment, the present application provides a polynucleotide comprising at least 1 miR-221 binding site and at least 1 miR-222 binding site. In an exemplary embodiment, the present application provides a polynucleotide comprising at least 1 miR-128 binding site (SEQ ID NO:9) and at least 1 miR-221 binding site (SEQ ID NO:11). In one embodiment, the present application provides a polynucleotide comprising at least 2 miR-128 binding sites (SEQ ID NO:9) and at least 2 miR-221 binding sites (SEQ ID NO:11). In one embodiment, the present application provides a polynucleotide comprising at least 3 miR-128 binding sites (SEQ ID NO:9) and at least 3 miR-221 binding sites (SEQ ID NO:11). In one embodiment, the present application provides a polynucleotide comprising at least 4 miR-128 binding sites (SEQ ID NO:9) and at least 4 miR-221 binding sites (SEQ ID NO:11).In one embodiment, the present application provides a polynucleotide comprising at least 5 miR-128 binding sites (SEQ ID NO:9) and at least 5 miR-221 binding sites (SEQ ID NO:11). In such an embodiment, the binding sites can be arranged in any order. For example, for a construct comprising 2 miR-128 binding sites and 2 miR-221 binding sites, the binding sites can be arranged in any of the following configurations: miR-128–miR-128–miR-221–miR221, miR-128–miR-221–miR-128–miR-221, miR-128–miR221–miR221–miR-128, miR-221–miR128–miR221–miR128, miR-221–miR128–miR128–miR221 or miR221–miR221-miR128–miR128. In an exemplary embodiment, the polynucleotide provided herein comprises a sequence having 4 miR-128 binding sites (SEQ ID NO:9) followed by 4 miR-221 binding sites (SEQ ID NO:11), for example, miR-128–miR-128–miR128–miR-128–miR221–miR221–miR-221–miR221. In another exemplary embodiment, the polynucleotide provided herein comprises a sequence having 1 miR-221 sequence (SEQ ID NO:11), 1 miR-222 sequence (SEQ ID NO:13) and 1 miR-128 binding site (SEQ ID NO:9), for example, miR-221–miR222–miR128. In another exemplary embodiment, the polynucleotide provided herein comprises a sequence having 2 miR-221 sequences (SEQ ID NO:11), 2 miR-222 sequences (SEQ IDNO:13) and 2 miR-128 binding sites (SEQ ID NO:9) arranged in the following order: miR-221–miR222–miR128-miR-221–miR222–miR128.

[0217] In a polynucleotide having more than one microRNA binding site, the binding sites can be directly adjacent to each other in the polynucleotide sequence (e.g., there is no linker or intervening sequence between the binding sites), or can be separated from each other by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides, or 1 - 20, 1 - 15, 1 - 10, 1 - 9, 1 - 8, 1 - 7, 1 - 6, 1 - 5, 1 - 4, 1 - 3 or 1 - 2 nucleotides. In an exemplary embodiment, the microRNA binding sites are separated by about 5 nucleotides or 5 nucleotides. In an exemplary embodiment, the sequence separating the microRNA binding sites (and the junction formed between the microRNA binding sites, or the junction formed between the microRNA binding site and the sequence separating the microRNA binding sites) is not complementary to any other microRNA or any other neuronal microRNA.

[0218] In certain embodiments, the polynucleotides provided herein comprise a microRNA binding site having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:7. In an exemplary embodiment, the polynucleotides provided herein comprise a microRNA binding site containing SEQ ID NO:7.

[0219] In certain embodiments, the polynucleotides provided herein comprise a microRNA binding site having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:14. In an exemplary embodiment, the polynucleotides provided herein comprise a microRNA binding site containing SEQ ID NO:14.

[0220] In certain embodiments, the polynucleotides provided herein comprise a microRNA binding site having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:15. In an exemplary embodiment, the polynucleotides provided herein comprise a microRNA binding site containing SEQ ID NO:15.

[0221] In certain embodiments, the microRNA binding sites provided herein are located within the 3' untranslated region of an mRNA transcript, e.g., after the translation termination codon (i.e., TAA, TGA, or TAG) and before the polyA tail. The microRNA binding site can be positioned directly adjacent to the translation termination codon or can be separated from the translation termination codon by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides, or 1 - 20, 1 - 15, 1 - 10, 1 - 9, 1 - 8, 1 - 7, 1 - 6, 1 - 5, 1 - 4, 1 - 3 or 1 - 2 nucleotides, and / or can be adjacent to the polyA tail or can be separated from the polyA tail by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides, or 1 - 20, 1 - 15, 1 - 10, 1 - 9, 1 - 8, 1 - 7, 1 - 6, 1 - 5, 1 - 4, 1 - 3 or 1 - 2 nucleotides.

[0222] In certain embodiments, the microRNA binding sites provided herein result in selective gene expression in PV cells compared to off - target cell types. In some cases, off - target cell types include, but are not limited to, excitatory neurons, non - PVCNS cell types, and non - neuronal CNS cell types. In certain embodiments, the PV - selective microRNA binding sites result in selective gene expression in PV neurons relative to at least one, two, three, four, five or more non - PV CNS cell types. In some cases, the non - PV CNS cells are excitatory neurons, dopaminergic neurons, astrocytes, microglia, motor neurons, vascular cells, or non - GABAergic neurons (e.g., cells that do not express one or more of GAD2, GAD1, NKX2.1, DLX1, DLX5, SST, and VIP), non - PV neurons (e.g., GABAergic neurons that do not express parvalbumin), or other CNS cells (e.g., CNS cell types that never express any of PV, GAD2, GAD1, NKX2.1, DLX1, DLX5, SST, and VIP). In an exemplary embodiment, the PV - selective microRNA binding sites provided herein result in increased selectivity of gene expression in PV neurons compared to excitatory neurons (e.g., neurons that express one or more of STAC, Slc17a7, Car12, Syt17, ITPKA, Col6a1, CamKII, Sv2b, INHBA, and / or DKK3) by reducing expression in excitatory neurons. In some cases, cell types are distinguished by having different cell markers, morphology, phenotype, genotype, function, and / or any other means for cell type classification.

[0223] The selectivity of expression driven by the PV-selective microRNA binding site can be measured in a variety of ways. In one embodiment, the selectivity of gene expression in PV cells relative to non-PV cells can be measured by comparing the number of PV cells that have a detectable level of transcript from a gene containing the PV-selective microRNA binding site to the total number of cells expressing the gene (e.g., the ratio of PV cells expressing the gene to total cells (PV + non-PV cells)). For example, an immunohistochemistry-based co-localization assay can be used to determine selectivity for PV neurons. The co-localization assay uses an expression cassette containing a gene encoding a fluorescent protein (e.g., eGFP) and the PV-selective microRNA binding site to measure gene expression, and an antibody that identifies PV cells (e.g., an anti-PV antibody that specifically interacts with PV neurons) conjugated to a second fluorescent marker (e.g., a red fluorescent protein). The selectivity of expression in PV cells can be calculated as follows: divide the number of cells expressing both PV and eGFP (e.g., PV cells) by the total number of cells expressing eGFP (e.g., PV cells and non-PV cells), and then multiply by 100 to convert to a percentage. In another example, an immunohistochemistry-based co-localization assay can be used to determine selectivity for PV neurons. The co-localization assay uses an expression cassette containing a gene encoding a fluorescent protein (e.g., eGFP) and the PV-selective microRNA binding site to measure gene expression, and a first antibody that identifies PV cells (e.g., an anti-PV antibody that specifically interacts with PV neurons) and a second antibody that identifies excitatory cells (e.g., an anti-CamKII antibody that specifically interacts with excitatory neurons), both conjugated to a second fluorescent marker (e.g., a red fluorescent protein). The selectivity of expression in PV cells can be calculated as follows: divide the number of cells expressing both PV and eGFP (e.g., PV cells) by the number of cells expressing eGFP+PV and eGFP+CamKII (e.g., PV cells and excitatory cells), and then multiply by 100 to convert to a percentage. The higher the percentage of PV cells expressing the transgene, the higher the selectivity of the microRNA binding site for PV cells. In certain embodiments, the PV-selective microRNA binding sites provided herein may be highly selective for expression in PV cells. For example, the PV-selective microRNA binding sites provided herein may exhibit selectivity for PV neurons of about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater than about 99% (e.g., PV neurons / total cells x 100 or PV neurons / PV + excitatory neurons x 100).

[0224] In some cases, the PV-selective microRNA binding sites provided herein are short. In some cases, the size of the PV-selective microRNA binding sites is compatible with the cloning capacity of a vector (e.g., a viral vector or rAAV) such that the combined size of the transgene, promoter (and optional enhancer), and microRNA binding site does not exceed the cloning capacity of the vector. In some cases, the length of the PV-selective microRNA binding site can be up to about 500 bp, 400 bp, 300 bp, 250 bp, 225 bp, 215 bp, 210 bp, 200 bp, 150 bp, 140 bp, 135 bp, 130 bp, 125 bp, 120 bp, 115 bp, 110 bp, 100 bp, 90 bp, 80 bp, 75 bp, 70 bp, 65 bp, 60 bp, or 50 bp. In some cases, the PV-selective microRNA binding site is about 50 - 500 bp, 50 - 400 bp, 50 - 300 bp, 50 - 250 bp, 50 - 200 bp, 50 - 100 bp, 50 - 75 bp, 50 - 70 bp, 100 - 500 bp, 100 - 400 bp, 100 - 300 bp, 100 - 250 bp, 100 - 200 bp, 100 - 150 bp, 100 - 140 bp, 100 - 135 bp, 200 - 500 bp, 200 - 400 bp, 200 - 300 bp, or 200 - 250 bp.

[0225] In an exemplary embodiment, a polynucleotide comprising one or more PV-selective microRNA binding sites provided herein does not comprise SEQ ID NO:67.

[0226] Expression cassette

[0227] In another aspect, the present application provides an expression cassette comprising a polynucleotide provided herein (e.g., a polynucleotide comprising a sequence encoding an eTF that upregulates SCN1A and / or contains a PV-selective microRNA binding site) and one or more regulatory elements. In certain embodiments, the present application provides an expression cassette comprising a polynucleotide provided herein (e.g., a polynucleotide comprising a sequence encoding an eTF that upregulates SCN1A and / or contains a PV-selective microRNA binding site) and a PV-selective promoter.

[0228] In certain embodiments, the polynucleotides provided herein (e.g., polynucleotides comprising a sequence encoding an eTF that upregulates SCN1A and / or contains PV-selective microRNA binding sites) are part of an expression cassette that further comprises one or more regulatory elements in addition to the sequence encoding the eTF. In an exemplary embodiment, the polynucleotides provided herein (e.g., polynucleotides comprising a sequence encoding an eTF that upregulates SCN1A and / or contains PV-selective microRNA binding sites) are part of an expression cassette that comprises a promoter located upstream of the transgene sequence and capable of driving the expression of the transgene (e.g., an eTF that selectively upregulates SCN1A) in cells.

[0229] In certain embodiments, the expression cassettes disclosed herein comprise a polynucleotide provided herein (e.g., a polynucleotide comprising a sequence encoding an eTF that upregulates SCN1A and / or contains PV-selective microRNA binding sites) and a constitutive promoter located upstream of the sequence encoding the transgene and capable of driving the expression of the transgene (e.g., an eTF that selectively upregulates SCN1A) in cells. Examples of constitutive promoters include the GAD2 promoter, the human synapsin promoter, the CBA promoter, the CMV promoter, the minCMV promoter, the TATA box, the supercore promoter, or the EF1α promoter, or combinations thereof.

[0230] In certain embodiments, the expression cassettes disclosed herein comprise a polynucleotide provided herein (e.g., a polynucleotide comprising a sequence encoding an eTF that upregulates SCN1A and / or contains PV-selective microRNA binding sites) and a short promoter capable of driving the expression of a transgene (e.g., an eTF that selectively upregulates SCN1A) in a cell. In certain embodiments, the short promoters suitable for use with the nucleic acid molecules described herein comprise less than 500 bp, 450 bp, 400 bp, 350 bp, 300 bp, 250 bp, 225 bp, 200 bp, 175 bp, 150 bp, 145 bp, 140 bp, 135 bp, 130 bp, 125 bp, 120 bp, 115 bp, 110 bp, 105 bp, 100 bp, 95 bp, 90 bp, 85 bp, 80 bp, or 75 bp, or about 80 - 300 bp, 80 - 275 bp, 80 - 250 bp, 80 - 200 bp, 80 - 150 bp, 80 - 125 bp, 80 - 120 bp, 80 - 115 bp, 80 - 110 bp, 80 - 105 bp, 80 - 100 bp, 85 - 300 bp, 85 - 275 bp, 85 - 250 bp, 85 - 200 bp, 85 - 150 bp, 85 - 125 bp, 85 - 120 bp, 85 - 115 bp, 85 - 110 bp, 85 - 105 bp, 85 - 100 bp, 90 - 300 bp, 90 - 275 bp, 90 - 250 bp, 90 - 200 bp, 90 - 150 bp, 90 - 125 bp, 90 - 120 bp, 90 - 115 bp, 90 - 110 bp, 90 - 105 bp, 90 - 100 bp, 95 - 300 bp, 95 - 275 bp, 95 - 250 bp, 95 - 200 bp, 95 - 150 bp, 95 - 125 bp, 95 - 120 bp, 95 - 115 bp, 95 - 110 bp, 95 - 105 bp, 95 - 100 bp, 100 - 300 bp, 100 - 275 bp, 100 - 250 bp, 100 - 200 bp, 100 - 150 bp, 100 - 125 bp, 100 - 120 bp, 100 - 115 bp, 100 - 110 bp, or 100 - 105 bp. In an exemplary embodiment, the short promoter suitable for use with the expression cassette described herein comprises about 100 - 120 bp, about 117 bp, or about 100 bp.

[0231] In certain embodiments, the expression cassettes disclosed herein comprise a short promoter that comprises or consists of any one of the following sequences: (i) SEQ ID NO:1; (ii) a variant or functional fragment thereof; or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any one of (i) or (ii), the nucleic acid sequence being operably linked to a polynucleotide encoding any one of the eTFs that selectively upregulates SCN1A disclosed herein, and the eTF optionally comprising a microRNA binding site disclosed herein. Other examples of short promoter sequences can be found in PCT Publication WO2018 / 213786.

[0232] In certain embodiments, the expression cassettes disclosed herein comprise a polynucleotide provided herein (e.g., a polynucleotide comprising a sequence encoding an eTF that upregulates SCN1A and / or contains a PV-selective microRNA binding site) and a cell type-selective promoter that is upstream of the sequence encoding the transgene (e.g., an eTF that selectively upregulates SCN1A), such that selective expression of the transgene in a cell of interest can be driven. In certain embodiments, the cell type-selective promoter can be selective (e.g., selectively drive expression therein) for any cell type of interest (e.g., cardiac cells, hepatocytes, muscle cells, bone cells, neurons or subsets thereof). In an exemplary embodiment, the expression cassettes disclosed herein comprise a polynucleotide encoding an eTF that selectively upregulates SCN1A and a PV-selective regulatory element (e.g., a promoter, enhancer and / or promoter and enhancer) upstream of the sequence encoding the eTF, such that selective expression of the eTF in PV cells can be driven, and optionally comprise a PV-selective microRNA binding site. A PV-selective regulatory element refers to a regulatory element that specifically regulates gene expression in PV neurons. In certain embodiments, the PV-selective regulatory element enhances expression in PV neurons relative to one or more other CNS cell types. In certain embodiments, the PV-selective regulatory element inhibits transcription and / or translation processes in off-target cell types.

[0233] In certain embodiments, the PV-selective regulatory elements provided herein result in selective gene expression in PV cells compared to off-target cell types. In some cases, off-target cell types include, but are not limited to, excitatory neurons, non-PV CNS cell types, and non-neuronal CNS cell types. In certain embodiments, the PV-selective regulatory elements result in selective gene expression in PV neurons relative to at least one, two, three, four, five, or more non-PV CNS cell types. In some cases, the non-PV CNS cells are excitatory neurons, dopaminergic neurons, astrocytes, microglia, motor neurons, vascular cells, or non-GABAergic neurons (e.g., cells that do not express one or more of GAD2, GAD1, NKX2.1, DLX1, DLX5, SST, and VIP), non-PV neurons (e.g., GABAergic neurons that do not express parvalbumin), or other CNS cells (e.g., CNS cell types that never express any of PV, GAD2, GAD1, NKX2.1, DLX1, DLX5, SST, and VIP). In some cases, the PV-selective regulatory elements provided herein result in an increased selectivity of gene expression in PV neurons compared to non-PV GABAergic cells. In some cases, cell types are distinguished by having different cell markers, morphology, phenotype, genotype, function, and / or any other means for cell type classification.

[0234] The selectivity of expression driven by a PV-selective regulatory element can be measured in a variety of ways. In one embodiment, the selectivity of gene expression in PV cells relative to non-PV cells can be measured by comparing the number of PV cells expressing a transcript at a detectable level of gene expression operably linked to a PV-selective regulatory element to the total number of cells expressing the gene (e.g., the ratio of PV to total cells expressing the gene (PV + non-PV cells)). For example, a co-localization assay based on immunohistochemistry can be used to determine selectivity for PV neurons, which uses a gene encoding a fluorescent protein (e.g., eGFP) operably linked to a PV-selective regulatory element to measure gene expression and an antibody that identifies PV cells (e.g., an anti-PV antibody that specifically interacts with PV neurons) conjugated to a second fluorescent marker (e.g., a red fluorescent protein). The selectivity of expression in PV cells can be calculated as follows: divide the number of cells expressing both PV and eGFP (e.g., PV cells) by the total number of cells expressing eGFP (e.g., PV cells and non-PV cells), and then multiply by 100 to convert to a percentage. The higher the percentage of PV cells expressing the transgene, the higher the selectivity of the regulatory element for PV cells. In certain embodiments, the PV-selective regulatory elements provided herein may be highly selective for expression in PV cells. For example, the PV-selective regulatory elements provided herein may exhibit selectivity for PV neurons of about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater than about 99% (e.g., PV neurons / total cells x 100).

[0235] In some cases, the PV-selective regulatory elements provided herein are short. In some cases, the size of the PV-selective regulatory element is compatible with the cloning capacity of a vector (e.g., a viral vector or rAAV), such that the combined size of the transgene and one or more PV-selective regulatory elements does not exceed the cloning capacity of the vector. In some cases, the length of the PV-selective regulatory element can be up to about 2050 bp, 2000 bp, 1900 bp, 1800 bp, 1700 bp, 1600 bp, 1500 bp, 1400 bp, 1300 bp, 1200 bp, 1100 bp, 1000 bp, 900 bp, 800 bp, 700 bp, 600 bp, 500 bp, 400 bp, 300 bp, 200 bp or 100 bp. In some cases, the PV-selective regulatory element is about 500 - 600 bp, 500 - 700 bp, 500 - 800 bp, 500 - 900 bp, 500 - 1000 bp, 500 - 1500 bp, 500 - 2000 bp or 500 - 2050 bp.

[0236] In certain embodiments, the PV-selective regulatory elements provided herein comprise or consist of any one of the following sequences: (i) SEQ ID NO: 2-4; (ii) variants, functional fragments, or combinations thereof; or (iii) nucleic acid sequences having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii). In some cases, the regulatory element comprises any one of SEQ ID NO: 2-4. Other examples of PV-selective regulatory elements can be found in PCT Publication WO2018 / 187363.

[0237] In exemplary embodiments, the present application provides an expression cassette comprising a nucleic acid sequence encoding an eTF that selectively upregulates SCN1A under the control of a PV-selective regulatory element. In certain embodiments, the present application provides an expression cassette comprising a nucleic acid sequence encoding an eTF that selectively upregulates SCN1A under the control of a PV-selective regulatory element having any one of SEQ ID NOs: 2-4, wherein the eTF comprises a DBD having any one of the following sequences: SEQ ID NOs: 77-98. In certain embodiments, the present application provides an expression cassette comprising a nucleic acid sequence encoding an eTF that selectively upregulates SCN1A under the control of a PV-selective regulatory element having any one of SEQ ID NOs: 2-4, wherein the eTF comprises any one of the following sequences: SEQ ID NOs: 99-131, 205, 207, 209, 213, 217, 219, 221, or 223. In certain embodiments, the present application provides an expression cassette comprising a nucleic acid sequence comprising any one of the following sequences: SEQ ID NOs: 67-73 under the control of a PV-selective regulatory element having any one of SEQ ID NOs: 2-4. In certain embodiments, the present application provides an expression cassette comprising a nucleic acid sequence encoding an eTF that selectively upregulates SCN1A under the control of a PV-selective regulatory element having any one of SEQ ID NOs: 2, wherein the eTF comprises a DBD having any one of the following sequences: SEQ ID NOs: 148-151. In certain embodiments, the present application provides an expression cassette comprising a nucleic acid sequence encoding an eTF that selectively upregulates SCN1A under the control of a PV-selective regulatory element having any one of SEQ ID NOs: 2, wherein the eTF comprises any one of the following sequences: SEQ ID NOs: 99-131, 205, 207, 209, 213, 217, 219, 221, or 223. In certain embodiments, the present application provides an expression cassette comprising a nucleic acid sequence comprising any one of the following sequences: SEQ ID NOs: 67-76 or 316 under the control of a PV-selective regulatory element having any one of SEQ ID NOs: 2.

[0238] In certain embodiments, the present application provides an expression cassette comprising a PV-selective microRNA binding site and a promoter and / or enhancer sequence. Any of the promoters described herein may be included in the expression cassette. In an exemplary embodiment, the expression cassette provided herein comprises a PV-selective microRNA binding site and a PV-selective regulatory element. In certain embodiments, the expression cassette provided herein comprises a PV-selective microRNA binding site and a PV-selective regulatory element, wherein the PV-selective regulatory element comprises (i) any one of SEQ ID NOs: 2-4; (ii) a variant, functional fragment, or combination thereof; or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii). In certain embodiments, the expression cassette provided herein comprises (1) a PV-selective microRNA binding site, which comprises (i) any one of SEQ ID NOs: 7, 14, or 15; (ii) a variant, functional fragment, or combination thereof; or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii), and (2) a PV-selective regulatory element, which comprises (i) any one of SEQ ID NOs: 2-4; (ii) a variant, functional fragment, or combination thereof; or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii).In certain embodiments, the expression cassettes provided herein comprise (1) a PV-selective microRNA binding site comprising (i) SEQ ID NO:7; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii), and (2) a PV-selective regulatory element comprising (i) SEQ ID NO:2; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii). In one embodiment, the expression cassette provided herein comprises a microRNA binding site containing SEQ ID NO:7 and a PV-selective regulatory element containing SEQ ID NO:2. In certain embodiments, the polynucleotides provided herein comprise (1) a PV-selective microRNA binding site comprising (i) SEQ ID NO:14; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii), and (2) a PV-selective regulatory element comprising (i) SEQ ID NO:2; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii). In one embodiment, the expression cassette provided herein comprises a microRNA binding site containing SEQ ID NO:15 and a PV-selective regulatory element containing SEQ ID NO:2.In certain embodiments, the expression cassettes provided herein comprise (1) a PV-selective microRNA binding site comprising (i) SEQ ID NO:15; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to either (i) or (ii), and (2) a PV-selective regulatory element comprising (i) SEQ ID NO:2; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to either (i) or (ii). In one embodiment, the expression cassette provided herein comprises a microRNA binding site containing SEQ ID NO:15 and a PV-selective regulatory element containing SEQ ID NO:2.

[0239] In certain embodiments, the expression cassettes provided herein comprise a PV-selective microRNA binding site and a sequence encoding an eTF that upregulates SCN1A expression as provided herein. In an exemplary embodiment, the present application provides an expression cassette comprising a PV-selective regulatory element, an eTF that upregulates SCN1A expression as provided herein, and a PV-selective microRNA binding site. In an exemplary embodiment, the present application provides an expression cassette comprising (1) a PV-selective regulatory element comprising (i) any one of SEQ ID NOs: 2-4; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii), (2) a sequence encoding an eTF that upregulates SCN1A comprising (i) any one of SEQ ID NOs: 77-131, 205, 207, 209, 213, 217, 219, 221, or 223; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii), and (3) a PV-selective microRNA binding site comprising (i) any one of SEQ ID NOs: 7, 14, or 15; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii).In another exemplary embodiment, the present application provides an expression cassette comprising (1) a PV-selective regulatory element comprising (i) SEQ ID NO: 2; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii), (2) a sequence encoding an eTF that upregulates SCN1A, comprising (i) any one of SEQ ID NO: 77 or 127; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii), and (3) a PV-selective microRNA binding site comprising (i) SEQ ID NO: 7; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii).In another exemplary embodiment, the present application provides an expression cassette comprising (1) a PV-selective regulatory element comprising (i) SEQ ID NO: 2; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii), (2) a sequence encoding an eTF that upregulates SCN1A, comprising (i) any one of SEQ ID NO: 77 or 127; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii), and (3) a PV-selective microRNA binding site comprising (i) SEQ ID NO: 14; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii).In another exemplary embodiment, the present application provides an expression cassette comprising (1) a PV-selective regulatory element comprising (i) SEQ ID NO: 2; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii), (2) a sequence encoding an eTF that upregulates SCN1A, comprising (i) either SEQ ID NO: 77 or 127; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii), and (3) a PV-selective microRNA binding site comprising (i) SEQ ID NO: 15; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii).In another exemplary embodiment, the present application provides an expression cassette comprising (1) a PV-selective regulatory element comprising (i) SEQ ID NO: 2; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to either (i) or (ii), (2) a sequence encoding an eTF that upregulates SCN1A, comprising (i) either SEQ ID NO: 92 or 106; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to either (i) or (ii), and (3) a PV-selective microRNA binding site comprising (i) SEQ ID NO: 7; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to either (i) or (ii).In another exemplary embodiment, the present application provides an expression cassette comprising (1) a PV-selective regulatory element comprising (i) SEQ ID NO: 2; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii), (2) a sequence encoding an eTF that upregulates SCN1A, comprising (i) any one of SEQ ID NO: 92 or 106; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii), and (3) a PV-selective microRNA binding site comprising (i) SEQ ID NO: 14; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii).In another exemplary embodiment, the present application provides an expression cassette comprising (1) a PV-selective regulatory element comprising (i) SEQ ID NO:2; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii), (2) a sequence encoding an eTF that upregulates SCN1A, comprising (i) any one of SEQ ID NO:92 or 106; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii), and (3) a PV-selective microRNA binding site, comprising (i) SEQ ID NO:15; (ii) a variant, functional fragment, or combination thereof of (i); or (iii) a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of (i) or (ii).

[0240] In certain embodiments, the expression cassette provided herein that comprises a PV-selective regulatory element and a PV-selective microRNA binding site is less than 5 kb, 4.9 kb, 4.8 kb, 4.7 kb, 4.6 kb, 4.5 kb, 4.4 kb, 4.3 kb, 4.2 kb, 4.1 kb, 4.0 kb, 3.9 kb, 3.8 kb, 3.7 kb, 3.6 kb, 3.5 kb, 3.4 kb, 3.3 kb, 3.2 kb, 3.1 kb, 3.0 kb, 2.9 kb, 2.8 kb, 2.7 kb, 2.6 kb, 2.5 kb, 2.4 kb, 2.3 kb, 2.2 kb, 2.1 kb, 2.0 kb, 1.9 kb, 1.8 kb, 1.7 kb, 1.6 kb, or 1.5 kb or smaller in size, or is about 1.5 - 5 kb, 1.5 - 4.7 kb, 1.5 - 4.5 kb, 1.5 - 4.0 kb, 1.5 - 3.5 kb, 1.5 - 3.0 kb, 1.5 - 2.5 kb, 1.5 - 2.0 kb.

[0241] In certain embodiments, the expression cassettes provided herein may further comprise one or more additional regulatory elements in addition to the promoter, such as sequences related to transcription initiation or termination, enhancer sequences, and efficient RNA processing signals. Exemplary regulatory elements include, for example, introns, enhancers, UTRs, stability elements, WPRE sequences, Kozak consensus sequences, post-translational response elements, microRNA binding sites, or polyadenylation (polyA) sequences or combinations thereof. Regulatory elements can be used to regulate gene expression at the transcriptional, post-transcriptional, or translational stages of gene expression. At the RNA level, regulation can occur at the level of translation (e.g., stability elements that stabilize mRNA for translation), RNA cleavage, RNA splicing, and / or transcription termination. In various embodiments, the regulatory element can recruit a transcription factor to the coding region, which increases the selectivity of gene expression in the target cell type, increases the rate of production of the RNA transcript, increases the stability of the RNA produced, and / or increases the rate of synthesis of protein from the RNA transcript. In an exemplary embodiment, the expression cassette provided herein comprises at least one PV-selective microRNA binding site as provided herein.

[0242] In certain embodiments, the expression cassettes described herein further comprise a polyA sequence. Suitable polyA sequences include, for example, artificial polyA (PA75) of about 75 bp in length (see, e.g., WO 2018 / 126116), bovine growth hormone polyA, SV40 early polyA signal, SV40 late polyA signal, rabbit β-globin polyA, HSV thymidine kinase polyA, protamine gene polyA, adenovirus 5E1b polyA, growth hormone polyA, or PBGD polyA. In an exemplary embodiment, the polyA sequence suitable for the expression cassette provided herein is hGH polyA (SEQ ID NO:17) or synthetic polyA (SEQ ID NO:16). Generally, the polyA sequence is located downstream of the polynucleotide encoding eTF in the expression cassette described herein.

[0243] In certain embodiments, the expression cassettes provided herein further comprise one or more nucleic acid sequences encoding one or more nuclear localization signals (NLSs). Any NLS peptide that facilitates the import of an attached protein into the cell nucleus can be used. Examples of NLSs include, for example, the SV40 large T antigen NLS, nucleoplasmin NLS, EGL-13 NLS, c-Myc NLS, and TUS protein NLS. See, for example, C. Dingwall et al., J. Cell Biol. 107:841-9 (1988); J. P. Makkerh et al., Curr Biol. 6:1025-7 (1996); and M. Ray et al., Bioconjug. Chem. 26:1004-7 (2015). The NLS can be located at any position on the eTF protein sequence, but in a preferred embodiment, it is conjugated to the N-terminus of the eTF or a domain of the eTF. In an exemplary embodiment, the nucleic acid cassette provided herein encodes an eTF having an NLS fused to the N-terminus of the eTF. In other embodiments, the nucleic acid cassette provided herein encodes an eTF having a first NLS fused to the N-terminus of the eTF and a second NLS located between the DBD and TAD domains of the eTF.

[0244] Expression vector

[0245] In certain embodiments, the expression cassettes described herein can be incorporated into an expression vector. The expression vector can be used to deliver the expression cassette to a target cell by transfection or transduction. The vector can be an integrating vector or a non-integrating vector, referring to the ability of the vector to integrate the expression cassette or transgene into the host cell genome. Examples of expression vectors include, but are not limited to: (a) non-viral vectors such as nucleic acid vectors, including linear oligonucleotides and circular plasmids; artificial chromosomes such as human artificial chromosomes (HACs), yeast artificial chromosomes (YACs), and bacterial artificial chromosomes (BACs or PACs); episomal vectors; transposons (e.g., PiggyBac); and (b) viral vectors such as retroviral vectors, lentiviral vectors, adenoviral vectors, and adeno-associated viral vectors.

[0246] The expression vector can be a linear oligonucleotide or a circular plasmid and can be delivered to cells by various transfection methods, including physical and chemical methods. Physical methods generally refer to delivery methods that utilize physical forces against the cell membrane barrier to facilitate the intracellular delivery of genetic material. Examples of physical methods include the use of needles, ballistic DNA, electroporation, sonoporation, photoporation, magnetofection, and hydroporation. Chemical methods generally refer to methods in which chemical carriers deliver nucleic acid molecules to cells and can include inorganic particles, lipid-based carriers, polymer-based carriers, and peptide-based carriers.

[0247] In some embodiments, an expression vector is administered to a target cell using a cationic lipid (e.g., a cationic liposome). A variety of types of lipids have been investigated for gene delivery, such as lipid nanoemulsions (e.g., which are a dispersion of one immiscible liquid in another immiscible liquid, stabilized by an emulsifier) or solid lipid nanoparticles.

[0248] In some embodiments, an expression vector is administered to a target cell using a peptide-based delivery mediator. A peptide-based delivery mediator can have the advantages of protecting the genetic material to be delivered, targeting specific cell receptors, disrupting endosomal membranes, and delivering the genetic material to the cell nucleus. In some embodiments, an expression vector is administered to a target cell using a polymer-based delivery mediator. A polymer-based delivery mediator can comprise natural proteins, peptides, and / or polysaccharides or synthetic polymers. In one embodiment, the polymer-based delivery mediator comprises polyethyleneimine (PEI). PEI can condense DNA into positively charged particles that bind to anionic cell surface residues and are taken into the cell by endocytosis. In other embodiments, the polymer-based delivery mediator can comprise poly-L-lysine (PLL), poly(DL-lactic acid) (PLA), poly(DL-lactide-co-glycolide) (PLGA), polyornithine, polyarginine, histone, protamine, dendrimer, chitosan, synthetic amino derivatives of dextran, and / or cationic acrylic polymers. In certain embodiments, the polymer-based delivery mediator can comprise a mixture of polymers such as PEG and PLL.

[0249] In certain embodiments, the expression vector can be a viral vector suitable for gene therapy. Preferred characteristics of a viral gene therapy vector or gene delivery vector can include the ability to reproducibly and stably propagate and be purified to high titers; the ability to mediate targeted delivery (e.g., delivering a transgene specifically to a tissue or organ of interest without extensive vector dissemination elsewhere); and the ability to mediate gene delivery and transgene expression without inducing harmful side effects.

[0250] Several types of viruses have been engineered for gene therapy purposes by exploiting the viral infection pathway but avoiding subsequent viral gene expression that would lead to replication and toxicity, such as the non-pathogenic parvovirus known as adeno-associated virus. Such viral vectors can be obtained by deleting all or part of the coding regions from the viral genome, but completely retaining sequences that may be necessary for functions such as packaging the vector genome into the viral capsid or integrating the vector nucleic acid (e.g., DNA) into the host chromatin (e.g., terminal repeats).

[0251] In various embodiments, suitable viral vectors include retroviruses (e.g., type A, B, C, and D viruses), adenoviruses, parvoviruses (e.g., adeno-associated virus or AAV), coronaviruses, negative-strand RNA viruses such as orthomyxoviruses (e.g., influenza viruses), rhabdoviruses (e.g., rabies and vesicular stomatitis viruses), paramyxoviruses (e.g., measles and Sendai viruses), positive-strand RNA viruses such as picornaviruses and alphaviruses, and double-stranded DNA viruses, including adenoviruses, herpesviruses (e.g., herpes simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxviruses (e.g., vaccinia, fowlpox, and canarypox). Examples of retroviruses include avian leukosis-sarcoma viruses, human T-lymphotropic virus type 1 (HTLV-1), bovine leukemia virus (BLV), lentiviruses, and foamy viruses. For example, other viruses include Norwalk virus, togavirus, flavivirus, reovirus, papovavirus, hepadnavirus, and hepatitis virus. Depending on the ability to integrate into the host genome, viral vectors can be classified into two groups - integrative and non-integrative. Oncogenic retroviruses and lentiviruses can integrate into the chromatin of host cells, while adenoviruses, adeno-associated viruses, and herpesviruses mainly exist in the nucleus as episomes outside the chromosome.

[0252] In certain embodiments, a suitable viral vector is a retroviral vector. A retrovirus refers to a virus of the Retroviridae family. Examples of retroviruses include oncogenic retroviruses such as murine leukemia virus (MLV), and lentiviruses such as human immunodeficiency virus 1 (HIV-1). The retroviral genome is single-stranded (ss) RNA and contains various genes that can be provided in cis or in trans. For example, the retroviral genome can contain cis-acting sequences such as two long terminal repeats (LTRs), as well as elements for gene expression, reverse transcription, and integration into the host chromosome. Other components include a packaging signal (psi or ψ) for packaging a specific RNA into newly formed virions, and a polypurine tract (PPT), which is the starting site for plus-strand DNA synthesis during the reverse transcription process. Additionally, the retroviral genome can contain the gag, pol, and env genes. The gag gene encodes structural proteins, the pol gene encodes enzymes that accompany the ssRNA and reverse transcribe the viral RNA into DNA, and the env gene encodes the viral envelope. Typically, gag, pol, and env are provided in trans for viral replication and packaging.

[0253] In certain embodiments, the retroviral vectors provided herein can be lentiviral vectors. At least five serogroups or serotypes of lentiviruses have been identified. Viruses of different serotypes can differentially infect certain cell types and / or hosts. For example, lentiviruses include primate retroviruses and non-primate retroviruses. Primate retroviruses include HIV and simian immunodeficiency virus (SIV). Non-primate retroviruses include feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), caprine arthritis-encephalitis virus (CAEV), equine infectious anemia virus (EIAV), and visnavirus. Lentiviruses or lentiviral vectors can be capable of transducing quiescent cells. Like oncoretroviral vectors, the design of lentiviral vectors can be based on the separation of cis-acting sequences from trans-acting sequences.

[0254] In certain embodiments, the present application provides an expression vector that has been designed for delivery by an optimized therapeutic retroviral vector. The retroviral vector can be a lentivirus that includes a left (5’) LTR; sequences that facilitate viral packaging and / or nuclear import; a promoter; optionally one or more additional regulatory elements (e.g., an enhancer or polyA sequence); optionally a lentiviral Rev response element (RRE); a construct that includes a PV selection regulatory element operably linked to a sequence encoding eTF; optionally an insulator; and a right (3’) retroviral LTR.

[0255] In an exemplary embodiment, the viral vector provided herein is an adeno-associated virus (AAV). AAV is a small, replication-defective, non-enveloped animal virus that can infect humans and some other primate species. It is not known whether AAV causes human disease, but it induces a mild immune response. AAV vectors can also infect dividing cells and quiescent cells without integrating into the host cell genome.

[0256] The AAV genome consists of linear single-stranded DNA that is approximately 4.7 kb in length. The genome consists of two open reading frames (ORFs) flanked by inverted terminal repeat (ITR) sequences that are approximately 145 bp in length. The ITR consists of a nucleotide sequence at the 5’ end (5’ ITR) and a nucleotide sequence at the 3’ end (3’ ITR), which contain palindromic sequences. The ITR acts in cis by folding via complementary base pairing to form a T-shaped hairpin structure that serves as a primer during the initiation of DNA replication of second-strand synthesis. These two open reading frames encode the rep and cap genes that are involved in virion replication and packaging. In an exemplary embodiment, the AAV vector provided herein does not contain the rep or cap genes. Such genes can be provided in trans for the production of virions as further described below.

[0257] In certain embodiments, the AAV vector can include filler nucleic acid. In some embodiments, the filler nucleic acid can encode green fluorescent protein or an antibiotic resistance gene, such as a kanamycin or ampicillin resistance gene. In certain embodiments, the filler nucleic acid can be located outside of the ITR sequences (e.g., compared to the eTF transgenic sequence and regulatory sequences located between the 5’ ITR sequence and the 3’ ITR sequence).

[0258] There are various AAV serotypes, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV13. These serotypes have different tropisms or cell types they infect. AAV can contain genomes and capsids from multiple serotypes (e.g., pseudotyped). For example, AAV can contain the genome (e.g., ITR) of serotype 2 packaged in a capsid from serotype 5 or serotype 9. Pseudotyping can increase transduction efficiency and alter tropism.

[0259] In some cases, AAV serotypes that can cross the blood-brain barrier or infect cells of the CNS are preferred. In some cases, AAV9 or a variant thereof is used to deliver an expression cassette of the present disclosure that includes a PV-selective regulatory element operably linked to a transgenic encoding an eTF that selectively upregulates sCN1A. In some cases, AAV9 or a variant thereof is used to deliver an expression cassette of the present disclosure that includes a PV-selective microRNA binding site. In some cases, AAV9 or a variant thereof is used to deliver an expression cassette of the present disclosure that includes a PV-selective regulatory element operably linked to a transgenic encoding an eTF that selectively upregulates sCN1A, and a PV-selective microRNA binding site.

[0260] In an exemplary embodiment, the present application provides an expression vector that has been designed for delivery by AAV. The AAV can be any serotype, such as AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV-DJ, or chimeric, hybrid, or variant AAV. The AAV can also be self-complementary AAV (scAAV). In certain embodiments, the expression vector designed for delivery by AAV includes 5’ ITR and 3’ ITR. In certain embodiments, the expression vector designed for delivery by AAV includes 5’ ITR, a promoter, a transgenic encoding eTF, and 3’ ITR. In certain embodiments, the expression vector designed for delivery by AAV includes 5’ ITR, an enhancer, a promoter, a transgenic encoding eTF, a polyA sequence, and 3’ ITR.

[0261] host cell

[0262] In another aspect, the present invention relates to a host cell comprising an expression cassette or expression vector disclosed herein. The host cell can be a bacterial cell, a yeast cell, an insect cell, or a mammalian cell. In an exemplary embodiment, the host cell refers to any cell line that is susceptible to infection by a virus of interest and is suitable for in vitro culture.

[0263] In certain embodiments, the host cells provided herein can be used for the purposes of ex vivo gene therapy. In such embodiments, the cells are transfected with a nucleic acid molecule or expression vector comprising a PV-selective microRNA binding site and / or a sequence encoding an eTF that selectively upregulates SCN1A as disclosed herein, and the cells are subsequently transplanted into a patient or subject. The transplanted cells can have an autologous, allogeneic, or xenogeneic origin. For clinical use, cell isolation is typically carried out under good manufacturing practice (GMP) conditions. Prior to transplantation, the cell quality and the presence of microorganisms or other contaminants are generally examined, and pretreatment, such as radiation and / or immunosuppressive therapy, can be performed. In addition, the host cells can be transplanted together with growth factors to stimulate cell proliferation and / or differentiation.

[0264] In certain embodiments, the host cells can be used for ex vivo gene therapy. Preferably, the cells are eukaryotic cells, such as mammalian cells, which include but are not limited to humans, non-human primates such as apes, chimpanzees, monkeys, and orangutans, domesticated animals, including dogs and cats, and livestock, such as horses, cows, pigs, sheep, and goats, or other mammalian species, including but not limited to mice, rats, guinea pigs, rabbits, hamsters, etc. Those skilled in the art will select a more suitable cell according to the patient or subject to be transplanted.

[0265] In certain embodiments, the host cells provided herein can be cells having self-renewing and pluripotent properties, such as stem cells or induced pluripotent stem cells. The stem cells are preferably mesenchymal stem cells. Mesenchymal stem cells (MSCs) are capable of differentiating into at least one of osteoblasts, chondrocytes, adipocytes, or myocytes, and can be isolated from any type of tissue. Generally, MSCs will be isolated from bone marrow, adipose tissue, umbilical cord, or peripheral blood. The methods for obtaining them are well known to those skilled in the art. Induced pluripotent stem cells (also known as iPS cells or iPSCs) are a type of pluripotent stem cells that can be generated directly from somatic cells.

[0266] Yamanaka et al. induced iPS cells by transferring the Oct3 / 4, Sox2, Klf4, and c-Myc genes into mouse and human fibroblasts and forcing the cells to express the genes (WO 2007 / 069666). Thomson et al. subsequently generated human iPS cells using Nanog and Lin28 in place of Klf4 and c-Myc (WO 2008 / 118820).

[0267] In an exemplary embodiment, the host cells provided herein are packaging cells. The cells can be adherent cells or suspension cells. The packaging cells and the helper vector or virus or DNA construct together provide in trans all the missing functions required for the complete replication and packaging of the viral vector.

[0268] Preferably, the packaging cells are eukaryotic cells, such as mammalian cells, including simian, human, dog, and rodent cells. Examples of human cells are PER.C6 cells (WO01 / 38362), MRC-5 (ATCC CCL-171), WI-38 (ATCCCCL-75), HEK-293 cells (ATCC CRL-1573), HeLa cells (ATCC CCL2), and embryonic rhesus monkey lung cells (ATCCCL-160). Examples of non-human primate cells are Vero cells (ATCC CCL81), COS-1 cells (ATCC CRL-1650), or COS-7 cells (ATCC CRL-1651). Examples of dog cells are MDCK cells (ATCC CCL-34). Examples of rodent cells are hamster cells, such as BHK21-F, HKCC cells, or CHO cells.

[0269] As an alternative to mammalian sources, the cell lines used in the present invention can be derived from avian sources, such as chickens, ducks, geese, quails, or pheasants. Examples of avian cell lines include avian embryonic stem cells (WO01 / 85938 and WO03 / 076601), immortalized duck retinal cells (WO2005 / 042728), and cells derived from avian embryonic stem cells, including chicken cells (WO2006 / 108846) or duck cells, such as the EB66 cell line (WO2008 / 129058 and WO2008 / 142124).

[0270] In another embodiment, the host cell is an insect cell, such as SF9 cells (ATCC CRL-1711), Sf21 cells (IPLB-Sf21), MG1 cells (BTI-TN-MG1), or High Five TM cells (BTI-TN-5B1-4).

[0271] In certain embodiments, host cells provided herein that contain the recombinant AAV vectors / genomes of the invention (e.g., containing PV-selective microRNA binding sites and / or sequences encoding eTFs that selectively upregulate SCN1A) can further contain one or more additional nucleic acid constructs, e.g., (i) a nucleic acid construct encoding the rep and cap genes but not carrying ITR sequences (e.g., an AAV helper plasmid), and / or (ii) a nucleic acid construct that provides adenovirus functions necessary for AAV replication (e.g., a plasmid). In an exemplary embodiment, host cells provided herein contain: i) an expression vector containing PV-selective microRNA binding sites and / or sequences encoding eTFs that selectively upregulate SCN1A as provided herein (i.e., a recombinant AAV genome); ii) a nucleic acid construct encoding AAV rep and cap genes that do not carry ITR sequences; and iii) a nucleic acid construct containing adenovirus helper genes (described further below).

[0272] In certain embodiments, the rep gene, cap gene, and adenovirus helper genes can be combined on one plasmid (Blouin V et al. J Gene Med. 2004;6(suppl):S223 - S228; Grimm D. et al. Hum. Gene Ther. 2003;7:839 - 850). Thus, in another exemplary embodiment, host cells provided herein contain: i) an expression vector containing PV-selective microRNA binding sites and / or sequences encoding eTFs that selectively upregulate SCN1A as disclosed herein (i.e., a recombinant AAV genome); and ii) a plasmid encoding AAV rep and cap genes that do not carry ITR sequences and further containing adenovirus helper genes.

[0273] In another embodiment, host cells provided herein contain: a) an expression vector containing PV-selective microRNA binding sites and / or sequences encoding eTFs that selectively upregulate SCN1A as disclosed herein (i.e., a recombinant AAV genome); b) a plasmid encoding AAV rep and cap genes that do not carry ITR sequences; and c) a plasmid containing the adenovirus helper genes E2a, E4, and VARNA; wherein co-transfection is performed in cells that constitutively express and trans-complement the adenovirus E1 gene, preferably mammalian cells such as HEK-293 cells (ATCC CRL-1573).

[0274] In some embodiments, host cells suitable for large-scale production of AAV vectors are insect cells that can be infected with a combination of recombinant baculoviruses (Urabe et al., Hum. Gene Ther. 2002; 13:1935-1943). For example, SF9 cells can be co-infected with three baculovirus vectors that express AAV rep, AAV cap, and the AAV vector to be packaged, respectively. The recombinant baculovirus vectors will provide the viral helper gene functions required for viral replication and / or packaging.

[0275] Further guidance on the construction and production of virions for gene therapy according to the present invention can be found in: Viral Vectors for Gene Therapy, Methods and Protocols. Series: Methods in Molecular Biology, Vol. 737. Merten and Al-Rubeai (eds), 2011 Humana Press (Springer); Gene Therapy. M. Giacca. 2010 Springer-Verlag; Heilbronn R. and Weger S. Viral Vectors for Gene Transfer: Current Status of Gene Therapeutics. In: Drug Delivery, Handbook of Experimental Pharmacology 197; M. Schafer-Korting (ed). 2010 Springer-Verlag; pp. 143-170; Adeno-Associated Virus: Methods and Protocols. R.O. Snyder and P. Moulllier (eds). 2011 Humana Press (Springer); Bunning H. et al., Recent developments in adeno-associated virus technology. J. Gene Med. 2008; 10:717-733; and Adenovirus: Methods and Protocols. M. Chillon and A. Bosch (eds); Third Edition. 2014 Humana Press (Springer).

[0276] Virions and Methods for Producing Virions

[0277] In certain embodiments, the present application provides virus particles comprising a viral vector that comprises a PV-selective microRNA binding site and / or a sequence encoding an eTF that selectively upregulates SCN1A as disclosed herein. The terms "virus particle" and "virion" are used interchangeably herein and refer to infectious and generally replication-deficient virus particles that comprise a viral genome (e.g., a viral expression vector) packaged within a capsid and, optionally, for example, for retroviruses, a lipid envelope surrounding the capsid. A "capsid" refers to the structure in which the viral genome is packaged. The capsid is composed of a number of oligomeric structural subunits that are made of protein. For example, AAV has an icosahedral capsid formed by the interaction of three capsid proteins: VP1, VP2, and VP3. In one embodiment, the virions provided herein are recombinant AAV virions or rAAV virions obtained by packaging an AAV vector comprising a PV-selective regulatory element and a PV-selective microRNA binding site. In another embodiment, the virions provided herein are recombinant AAV virions or rAAV virions obtained by packaging an AAV vector comprising a PV-selective regulatory element operably linked to a sequence encoding an eTF that selectively upregulates SCN1A as described herein within a protein capsid. In another embodiment, the virions provided herein are recombinant AAV virions or rAAV virions obtained by packaging an AAV vector comprising a PV-selective regulatory element and a PV-selective microRNA binding site operably linked to a sequence encoding an eTF that selectively upregulates SCN1A as described herein within a protein capsid.

[0278] In certain embodiments, the recombinant AAV virions provided herein can be prepared by packaging an AAV genome derived from a particular AAV serotype in viral particles formed by a capsid of native Cap protein (corresponding to the same particular serotype of AAV). In other embodiments, the AAV viral particles provided herein comprise a viral vector that comprises ITRs of a given AAV serotype packaged into a protein from a different serotype. See, e.g., Bunning H et al., J GeneMed 2008;10:717 - 733. For example, a viral vector having ITRs from a given AAV serotype can be packaged into: a) viral particles composed of capsid proteins from the same or different AAV serotypes (e.g., AAV2 ITRs and AAV9 capsid proteins; AAV2 ITRs and AAV8 capsid proteins; etc.); b) mosaic viral particles composed of a mixture of capsid proteins from different AAV serotypes or mutants (e.g., AAV2 ITRs with AAV1 and AAV9 capsid proteins); c) chimeric viral particles composed of capsid proteins that have been truncated by domain swapping between different AAV serotypes or variants (e.g., AAV2 ITRs with an AAV8 capsid protein having AAV9 domains); or d) targeted viral particles engineered to display a selective binding domain that enables stringent interaction with a target cell specific receptor (e.g., AAV5 ITRs and an AAV9 capsid protein genetically truncated by insertion of a peptide ligand; or an AAV9 capsid protein with a peptide ligand conjugated to the capsid surface rather than genetically modified).

[0279] Those skilled in the art will appreciate that the AAV virions provided herein can comprise capsid proteins of any AAV serotype. In one embodiment, the viral particles comprise capsid proteins from AAV serotypes selected from AAV1, AAV2, AAV5, AAV8, and AAV9, which are more suitable for delivery to the CNS (M. Hocquemiller et al., Hum Gene Ther 27(7):478 - 496 (2016)). In a particular embodiment, the viral particles comprise the expression cassette of the present invention, wherein the 5' ITR and 3' ITR sequences of the expression cassette are of the AAV2 serotype and the capsid protein is of the AAV9 serotype.

[0280] Many methods for producing rAAV virions are known in the art, including transfection, stable cell line production, and infectious hybrid virus production systems including adenovirus-AAV hybrids, herpesvirus-AAV hybrids (Conway, J E et al. (1997) J. Virology 71(11):8780-8789), and baculovirus-AAV hybrids. All rAAV production cultures for producing rAAV virus particles require: 1) a suitable host cell, e.g., in the case of the baculovirus production system, including human cell lines such as HeLa, A549, or 293 cells, or insect-derived cell lines such as SF-9; 2) suitable helper virus functions, which are provided by wild-type or mutant adenoviruses (such as temperature-sensitive adenoviruses), herpesviruses, baculoviruses, or plasmid constructs that provide helper functions; 3) AAV rep and cap genes and gene products; 4) a transgene flanked by AAV ITR sequences (e.g., comprising one or more of the following: a PV-selective microRNA binding site, a sequence encoding an eTF that selectively upregulates SCN1A as described herein, and / or a PV-selective promoter); and 5) a suitable culture medium and culture medium components that support rAAV production.

[0281] In various embodiments, the host cells described herein comprise three components: (1) the rep gene and the cap gene, (2) genes that provide helper functions, and (3) a transgene flanked by ITRs (e.g., comprising one or more of the following: a PV-selective microRNA binding site, a sequence encoding an eTF that selectively upregulates SCN1A as described herein, and / or a PV-selective promoter). The AAV rep gene, the AAV cap gene, and the genes that provide helper functions can be introduced into the cell by incorporating the genes into a vector such as a plasmid and introducing the vector into the host cell. The rep, cap, and helper function genes can be incorporated into the same plasmid or different plasmids. In a preferred embodiment, the AAV rep and cap genes are incorporated into one plasmid, and the genes that provide helper functions are incorporated into another plasmid. The various plasmids (e.g., containing the AAV rep and cap genes, helper functions, or transgenes) for creating a host cell that produces virions can be introduced into the cell by using any suitable method known in the art. Examples of transfection methods include, but are not limited to, calcium phosphate co-precipitation, DEAE-dextran, polybrene, electroporation, microinjection, liposome-mediated fusion, lipofection, retroviral infection, and biolistic transfection. In certain embodiments, the plasmids providing the rep and cap genes, helper functions, and a transgene flanked by ITRs can be introduced into the cell simultaneously. In another embodiment, the plasmids providing the rep and cap genes and the helper functions can be introduced into the cell before or after the plasmid containing the transgene. In an exemplary embodiment, the cell is transfected simultaneously with three plasmids (e.g., a triple transfection method): (1) a plasmid containing a transgene flanked by ITRs (e.g., comprising one or more of the following: a PV-selective microRNA binding site, a sequence encoding an eTF that selectively upregulates SCN1A as described herein, and / or a PV-selective promoter), (2) a plasmid containing the AAV rep and cap genes, and (3) a plasmid containing the genes that provide helper functions. Exemplary host cells can be 293, A549, or HeLa cells.

[0282] In other embodiments, one or more of (1) the AAV rep and cap genes, (2) the genes providing helper functions, and (3) the transgene flanked by ITRs (e.g., comprising one or more of: a PV-selective microRNA binding site, a sequence encoding an eTF that selectively upregulates SCN1A as described herein, and / or a PV-selective promoter) can be carried episomally by the packaging cell and / or integrated into the genome of the packaging cell. In one embodiment, the host cell can be a packaging cell in which the AAV rep and cap genes and the helper functions are stably retained in the host cell, and the host cell is transiently transfected with a plasmid containing the transgene flanked by ITRs (e.g., comprising one or more of: a PV-selective microRNA binding site, a sequence encoding an eTF that selectively upregulates SCN1A as described herein, and / or a PV-selective promoter). In another embodiment, the host cell is a packaging cell in which the AAV rep and cap genes are stably retained in the host cell, and the host cell is transiently transfected with a plasmid containing the transgene flanked by ITRs (e.g., comprising one or more of: a PV-selective microRNA binding site, a sequence encoding an eTF that selectively upregulates SCN1A as described herein, and / or a PV-selective promoter) and a plasmid containing the helper functions. In another embodiment, the host cell can be a packaging cell in which the helper functions are stably retained in the host cell, and the host cell is transiently transfected with a plasmid containing the transgene flanked by ITRs (e.g., comprising one or more of: a PV-selective microRNA binding site, a sequence encoding an eTF that selectively upregulates SCN1A as described herein, and / or a PV-selective promoter) and a plasmid containing the rep and cap genes. In another embodiment, the host cell can be a production cell line stably transfected with the rep and cap genes, the helper functions, and the transgene sequence flanked by ITRs (e.g., comprising one or more of: a PV-selective microRNA binding site, a sequence encoding an eTF that selectively upregulates SCN1A as described herein, and / or a PV-selective promoter). Exemplary packaging and production cells can be derived from 293, A549, or HeLa cells.

[0283] In another embodiment, the production cell line is an insect cell line (typically Sf9 cells) infected with a baculovirus expression vector that provides the Rep and Cap proteins. This system does not require adenovirus helper genes (Ayuso E et al., Curr. Gene Ther. 2010, 10:423-436).

[0284] As used herein, the term "cap protein" refers to a polypeptide having at least one functional activity of a native AAV Cap protein (e.g., VP1, VP2, VP3). Examples of the functional activities of a cap protein include the ability to induce capsid formation, promote single-stranded DNA accumulation, promote AAV DNA packaging into the capsid (i.e., encapsidation), bind to cell receptors, and promote virion entry into host cells. In principle, any Cap protein can be used in the present invention.

[0285] It has been reported that Cap proteins have an impact on host tropism, cell, tissue or organ specificity, receptor use, infection efficiency, and immunogenicity of AAV viruses. Thus, the AAV cap for rAAV can be selected by considering, for example, the species of the subject (e.g., human or non-human), the immunological status of the subject, the suitability of the subject for long-term or short-term treatment, or the specific therapeutic application (e.g., treatment of a specific disease or disorder, or delivery to a specific cell, tissue or organ). In certain embodiments, the cap protein is derived from an AAV selected from the serotypes AAV1, AAV2, AAV5, AAV8, and AAV9. In an exemplary embodiment, the cap protein is derived from AAV9.

[0286] In some embodiments, the AAV Cap for use in the methods of the present invention can be generated by mutagenesis (i.e., by insertion, deletion or substitution) of one of the above AAV caps or its encoding nucleic acid. In some embodiments, the AAV cap is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% or higher level similar to one or more of the above AAV caps.

[0287] In some embodiments, the AAV cap is chimeric, comprising domains from two, three, four or more of the above AAV caps. In some embodiments, the AAV cap is a chimera of VP1, VP2, and VP3 monomers derived from two or three different AAVs or recombinant AAVs. In some embodiments, the rAAV composition comprises more than one of the above caps.

[0288] In some embodiments, the AAV cap for rAAV virions is engineered to contain heterologous sequences or other modifications. For example, peptide or protein sequences that confer selective targeting or immune evasion can be engineered into the cap protein. Alternatively or additionally, the cap can be chemically modified such that the surface of the rAAV is polyethylene glycolated (i.e., pegylated), which can promote immune evasion. The cap protein can also be mutagenized (e.g., to remove its native receptor binding or to mask immunogenic epitopes).

[0289] As used herein, the term "rep protein" refers to a polypeptide having at least one functional activity of a native AAV rep protein (e.g., rep 40, 52, 68, 78). Examples of the functional activities of the rep protein include any activity associated with the physiological function of the protein, including promoting DNA replication through recognition, binding to and nicking the AAV origin of DNA replication, and DNA helicase activity. Other functions include regulating transcription from an AAV (or other heterologous) promoter and site-specific integration of AAV DNA into the host chromosome. In certain embodiments, the AAV rep gene can be from serotype AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10 or AAVrh10; more preferably, from an AAV serotype selected from AAV1, AAV2, AAV5, AAV8 and AAV9.

[0290] In some embodiments, the AAV rep protein for use in the methods of the invention can be produced by mutagenesis (i.e., by insertion, deletion or substitution) of one of the above-described AAV reps or its encoding nucleic acid. In some embodiments, the AAV rep is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% or higher level similar to one or more of the above-described AAV reps.

[0291] As used herein, the phrase "helper function" or "helper gene" refers to viral proteins upon which AAV replication depends. Helper functions include those proteins required for AAV replication, including but not limited to those involved in transcriptional activation of AAV genes, stage-specific AAV mRNA splicing, AAV DNA replication, synthesis of the cap expression product, and AAV capsid assembly. The virus-based helper functions can be derived from any known helper virus, such as adenovirus, herpesvirus (other than herpes simplex virus type 1), and vaccinia virus. Helper functions include but are not limited to adenovirus E1, E2a, VA and E4 or herpesvirus UL5, ULB, UL52 and UL29 and herpesvirus polymerase. In a preferred embodiment, the proteins upon which AAV replication depends are derived from adenovirus.

[0292] In some embodiments, the viral proteins upon which AAV replication depends for use in the methods of the invention can be produced by mutagenesis (i.e., by insertion, deletion or substitution) of one of the above-described viral proteins or its encoding nucleic acid. In some embodiments, the viral protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% or higher level similar to one or more of the above-described viral proteins.

[0293] Methods for assaying the functions of the cap protein, rep protein and viral proteins upon which AAV replication depends are well known in the art.

[0294] Host cells for expressing purposeful transgenes (e.g., comprising one or more of the following: PV selective microRNA binding sites, sequences encoding eTFs that selectively upregulate SCN1A as described herein, and / or PV selective promoters) can be grown under conditions sufficient to assemble AAV virions. In certain embodiments, the host cells are grown for a suitable period of time to facilitate the assembly of AAV virions and the release of the virions into the culture medium. Generally, the cells can be grown for about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, or up to about 10 days. After about 10 days (or earlier, depending on the culture conditions and the specific host cells used), the production level generally decreases significantly. Generally, the culture time is measured starting from the point of virus production. For example, in the case of AAV, virus production generally begins when helper virus functions are provided in a suitable host cell as described herein. Generally, the cells are harvested about 48 to about 100, preferably about 48 to about 96, preferably about 72 to about 96, preferably about 68 to about 72 hours after helper virus infection (or after the start of virus production).

[0295] rAAV production cultures can be grown under a variety of conditions (over a wide temperature range, for different lengths of time, etc.) suitable for the specific host cells used. rAAV production cultures include adherent-dependent cultures, which can be cultured in suitable adherent-dependent containers such as roller bottles, hollow fiber filters, microcarriers, and packed bed or fluidized bed bioreactors. rAAV vector production cultures can also contain host cells adapted to suspension, such as HeLa, 293, and SF-9 cells, which can be cultured in a variety of ways, including, for example, spinner flasks, stirred tank bioreactors, and disposable systems such as Wave bag systems.

[0296] Suitable media known in the art can be used to produce rAAV virions. These media include, but are not limited to, media produced by Hyclone Laboratories and JRH, including Modified Eagle Medium (MEM), Dulbecco's Modified Eagle Medium (DMEM), each of which is incorporated herein by reference in its entirety. In certain embodiments, the rAAV production medium can be supplemented with serum or serum-derived recombinant proteins at a level of 0.5%-20% (v / v or w / v). Alternatively, rAAV vectors can be produced under serum-free conditions, which can also be referred to as media without products of animal origin.

[0297] After culturing host cells to allow production of AAV virions, the resulting virions can be harvested and purified. In certain embodiments, (1) AAV virions can be obtained from the host cells of the production culture by lysing the host cells, and / or (2) AAV virions can be obtained from the culture medium of the cells after a period of transfection (preferably 72 hours). As long as the cells are cultured under conditions that result in the release of rAAV virions from intact cells into the culture medium, rAAV virions can be harvested from the spent culture medium of the production culture (see, e.g., U.S. Patent 6,566,118). Suitable methods for lysing cells are also known in the art and include, for example, multiple freeze / thaw cycles, sonication, microfluidization, and treatment with chemicals such as detergents and / or proteases.

[0298] After harvest, the rAAV virions can be purified. As used herein, the term "purified" includes a preparation of rAAV virions that is free of at least some other components that may be present where rAAV virions occur naturally or where rAAV virions are initially prepared. Thus, for example, purification techniques can be used to enrich rAAV virions from a source mixture such as a culture lysate or production culture supernatant to prepare purified rAAV virions. Enrichment can be measured in a variety of ways, such as by the ratio of DNase-resistant particles (DRP) or genomic copies (gc) present in solution, or by infectivity, or it can be measured relative to a second potentially interfering substance present in the source mixture (e.g., contaminants, including production culture contaminants or process contaminants, including helper viruses, culture medium components, etc.).

[0299] In certain embodiments, the rAAV production culture harvest can be clarified to remove host cell debris. In some embodiments, a variety of standard techniques can be used, such as centrifugation or filtration through a filter with a pore size of 0.2 μm or greater (e.g., a cellulose acetate filter or a series of depth filters), to clarify the production culture harvest.

[0300] In certain embodiments, the rAAV production culture harvest is further treated with Benzonase TM to digest any high molecular weight DNA present in the production culture. In some embodiments, the Benzonase TM digestion is carried out under standard conditions, e.g., a final concentration of Benzonase TM of 1 - 2.5 units / ml, a temperature range from ambient temperature to 37°C, and a time of 30 minutes to several hours.

[0301] In certain embodiments, one or more of the following purification steps can be used to isolate or purify rAAV virions: equilibrium centrifugation; flow-through anion exchange filtration; tangential flow filtration (TFF) for concentrating rAAV particles; capture of rAAV by hydroxyapatite chromatography; helper virus heat inactivation; capture of rAAV by hydrophobic interaction chromatography; buffer exchange by size exclusion chromatography (SEC); nanofiltration; and capture of rAAV by anion exchange chromatography, cation exchange chromatography, or affinity chromatography. These steps can be used alone, in various combinations, or in different orders. Methods for purifying rAAV particles can be found in, for example, Xiao et al., (1998) Journal of Virology 72:2224-2232; U.S. Pat. Nos. 6,989,264 and 8,137,948; and WO 2010 / 148143.

[0302] In certain embodiments, purified AAV virions can be dialyzed against PBS, filtered, and stored at –80°C. The titer of the viral genome can be determined by quantitative PCR using linearized plasmid DNA as a standard curve (see, e.g., Lock M et al., Hum. Gene Ther. 2010;21:1273-1285).

[0303] Pharmaceutical composition

[0304] In certain embodiments, the present application provides a composition comprising a PV-selective microRNA binding site and / or a sequence encoding an eTF that selectively upregulates SCN1A, and a pharmaceutically acceptable carrier. In other embodiments, the present application provides a virion comprising a PV-selective microRNA binding site and / or a sequence encoding an eTF that selectively upregulates SCN1A, and a pharmaceutically acceptable carrier. In an exemplary embodiment, such a composition is suitable for gene therapy applications. The pharmaceutical composition is preferably sterile and stable under the preparation and storage conditions. Sterile solutions can be achieved, for example, by filtration through a sterile filter membrane.

[0305] The acceptable carriers and excipients in the pharmaceutical composition are preferably non-toxic to the recipient at the doses and concentrations employed. Acceptable carriers and excipients can include buffers such as phosphate, citrate, EPES, and TAE, antioxidants such as ascorbic acid and methionine, preservatives such as hexamethonium chloride, cetyltrimethylammonium chloride, resorcinol, and benzalkonium chloride, proteins such as human serum albumin, gelatin, dextran, and immunoglobulins, hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, histidine, and lysine, and carbohydrates such as glucose, mannose, sucrose, and sorbitol. The pharmaceutical composition of the present disclosure can be administered parenterally in the form of an injectable preparation. A sterile solution or any pharmaceutically acceptable liquid can be used as a vehicle to formulate the pharmaceutical composition for injection. Pharmaceutically acceptable vehicles include, but are not limited to, sterile water and normal saline.

[0306] The pharmaceutical composition of the present disclosure can be prepared in microcapsules such as hydroxymethylcellulose or gelatin - microcapsules and polymethylmethacrylate microcapsules. The pharmaceutical composition of the present disclosure can also be prepared in other drug delivery systems such as liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules. The pharmaceutical composition for gene therapy can be in an acceptable diluent or can contain a sustained-release matrix in which a gene delivery vehicle is embedded.

[0307] The pharmaceutical compositions provided herein can be formulated for parenteral, subcutaneous, intravenous, intramuscular, intra-arterial, intrasternal, intrathecal, intracisternal, intraventricular, or intraperitoneal administration. The pharmaceutical compositions can also be formulated for or administered by nasal, spray, oral, aerosol, rectal, or vaginal administration. In one embodiment, the pharmaceutical compositions provided herein are administered to the CNS or cerebrospinal fluid (CSF), i.e., by intrasternal injection, intrathecal injection, intracisternal injection, or intraventricular injection. The tissue target can be specific, e.g., CNS-specific, or it can be a combination of several tissues such as muscle and CNS tissue. Exemplary tissues or other targets can include liver, skeletal muscle, cardiac muscle, adipose deposits, kidney, lung, vascular endothelium, epithelium, hematopoietic cells, CNS, and / or CSF. In a preferred embodiment, the pharmaceutical composition comprising a PV-selective microRNA binding site and / or an eTF that selectively upregulates SCN1A provided herein is administered to the CNS or CSF, i.e., by intrasternal injection, intrathecal injection, intracisternal injection, or intraventricular injection. One or more of these methods can be used to administer the pharmaceutical composition of the present disclosure.

[0308] In certain embodiments, the pharmaceutical compositions provided herein comprise an "effective amount" or "therapeutically effective amount." As used herein, such an amount refers to an amount effective at a dosage and for a period of time necessary to achieve the desired therapeutic result, such as increasing the level of SCN1A expression and / or reducing the frequency and / or duration of seizures.

[0309] The dosage of the pharmaceutical compositions of the present disclosure depends on factors including the route of administration, the disease to be treated, and the physical characteristics of the subject (such as age, weight, general health). The dosage can be adjusted to provide an optimal therapeutic response. Generally, the dosage can be an amount effective to treat the disease without inducing significant toxicity. In one embodiment, the AAV vectors provided herein can be administered to a patient in an amount or dosage in the range of 5x10 11 to 1x10 14 gc / kg (genomic copies / kg patient body weight (gc / kg)) to treat SCN1A deficiency (including, for example, Dravet syndrome). In a more specific embodiment, the AAV vector is in an amount contained in the range of about 5x10 11 gc / kg to about 3x10 13 gc / kg, or about 1x10 12 to about 1x10 14 gc / kg, or about 1x10 12 to about 1x10 13 gc / kg, or an amount contained in the range of about 5x10 11 gc / kg, 1x10 12 gc / kg, 1.5x10 12 gc / kg, 2.0x10 12 gc / kg, 2.5x10 12 gc / kg, 3x10 12 gc / kg, 3.5x10 12 gc / kg, 4x10 12 gc / kg, 4.5x10 12 gc / kg, 5x10 12 gc / kg, 5.5x10 12 gc / kg, 6x10 12 gc / kg, 6.5x10 12 gc / kg, 7x10 12 gc / kg, 7.5x10 12 gc / kg, 8x10 12 gc / kg, 8.5x10 12 gc / kg, 9x10 12 gc / kg or 9.5x10 12administered at gc / kg. For example, gc / kg can be determined by qPCR or digital droplet PCR (ddPCR) (see, e.g., M. Lock et al., Hum Gene Ther Methods. April 2014; 25(2):115 - 25). In another embodiment, the AAV vectors provided herein can be administered to a patient in an amount or dose in the range of 1x10 9 to 1x10 11 iu / kg (infection units (iu) of the vector / subject or patient body weight (kg)) to treat SCN1A deficiency (including, e.g., Dravet syndrome). In certain embodiments, the pharmaceutical composition can be in unit dosage form as needed. Such single - dose units can contain from about 1x10 9 gc to about 1x10 15 gc.

[0310] The pharmaceutical compositions of the present disclosure can be administered to a subject in need, for example, daily, weekly, monthly, semi - annually, annually, once or multiple times (e.g., 1 - 10 times or more) or as medically required. In an exemplary embodiment, a single administration is sufficient. In one embodiment, a pharmaceutical composition comprising an expression cassette encoding a PV - selective microRNA - binding site and / or an eTF that selectively upregulates SCN1A is suitable for human subjects and is administered by intrasubstantial injection, intrathecal injection, intracisternal injection, or intraventricular injection. In one embodiment, the pharmaceutical composition is delivered via a bolus injection through a peripheral vein. In other embodiments, the pharmaceutical composition is delivered via a peripheral vein by an infusion over about 10 minutes (±5 minutes), over about 20 minutes (±5 minutes), over about 30 minutes (±5 minutes), over about 60 minutes (±5 minutes), or over about 90 minutes (±10 minutes).

[0311] In another aspect, the present application further provides a kit comprising the nucleic acid molecules, vectors, host cells, virions, or pharmaceutical compositions described herein in one or more containers. The kit can include instructions or packaging materials that describe how to administer the nucleic acid molecules, vectors, host cells, or virions contained within the kit to a patient. The containers of the kit can be any suitable material, such as glass, plastic, metal, etc., and can be of any suitable size, shape, or configuration. In certain embodiments, the kit can include one or more ampoules or syringes containing the nucleic acid molecules, vectors, host cells, virions, or pharmaceutical compositions in a suitable liquid or solution form.

[0312] Methods of treatment

[0313] In one aspect, the present application provides methods of using the eTFs that selectively upregulate SCN1A disclosed herein. In certain embodiments, the present application provides methods of administering an expression cassette, expression vector, or viral particle to upregulate the expression of SCN1A in a cell, the expression cassette, expression vector, or viral particle comprising a polynucleotide encoding an eTF that selectively upregulates SCN1A disclosed herein. In various embodiments, the eTFs that selectively upregulate SCN1A disclosed herein can be used to modulate the expression of SCN1A in a cell in vitro, in vivo, or ex vivo.

[0314] In certain embodiments, the present application provides methods of treating a disease or disorder associated with SCN1A by administering an expression cassette, expression vector, or viral particle to a subject in need thereof, the expression cassette, expression vector, or viral particle comprising a polynucleotide encoding an eTF that selectively upregulates SCN1A disclosed herein. In certain embodiments, the disorder is a central nervous system disorder. In an exemplary embodiment, the disease or disorder is associated with haploinsufficiency of SCN1A. In certain embodiments, the disorder is epilepsy associated with SCN1A haploinsufficiency. In certain embodiments, the haploinsufficiency is the result of the subject being heterozygous for a loss-of-function mutation in the SCN1A gene. In certain embodiments, the disorder is epilepsy associated with an insertion, deletion, or substitution in the SCN1A gene. In certain embodiments, the disorder is epilepsy associated with a point mutation in the SCN1A gene. In certain embodiments, the method of treating a disease or disorder comprises administering an expression cassette, expression vector, or viral particle, the expression cassette, expression vector, or viral particle comprising a polynucleotide encoding an eTF that selectively upregulates SCN1A disclosed herein, thereby correcting the insufficient expression of SCN1A such that it is within the levels of a healthy individual or within the normal range as defined by the standard of medical care. In certain embodiments, the methods disclosed herein are used to treat a disease or disorder associated with endogenous SCN1A, the endogenous SCN1A comprising one or more mutations that result in abnormal expression of SCN1A.

[0315] In certain embodiments, the present application provides methods of ameliorating symptoms associated with a disease or disorder by administering an expression cassette, expression vector, or viral particle to a subject in need thereof, the expression cassette, expression vector, or viral particle comprising a polynucleotide encoding an eTF that selectively upregulates SCN1A disclosed herein.

[0316] In an exemplary embodiment, the present application provides a method for treating a disease, disorder or symptom associated with a SCN1A mutation (e.g., point mutation, substitution, deletion, inversion, etc.), Nav1.1 deficiency and / or reduced Nav1.1 activity by administering an expression cassette, expression vector or viral particle to a subject in need thereof, the expression cassette, expression vector or viral particle comprising a polynucleotide encoding an eTF that selectively upregulates the expression of the SCN1A gene or its protein product Nav1.1. Voltage-gated sodium channels are essential for the generation and propagation of action potentials in skeletal muscle and neuronal tissue. Voltage-gated sodium channels are heteromeric complexes composed of a large central pore-forming glycosylated α subunit and two smaller auxiliary β subunits. The large α subunit Nav1.1 subunit encoded by the SCN1A gene is associated with a variety of diseases or disorders such as Dravet syndrome. Nav1.1 is expressed in neurons and can be assembled from various β subunits including Navβ1 expressed by the SCN1B gene.

[0317] In certain embodiments, the present application provides methods for treating diseases associated with SCN1A mutations (eg, deletions, insertions, inversions, point mutations (eg, nonsense mutations, missense mutations), etc.) or reduced Nav1.1 activity using eTFs that selectively upregulate endogenous SCN1A gene expression. Diseases and conditions associated with SCN1A mutations include, but are not limited to, Dravet syndrome, Ohtahara syndrome, epilepsy, early infantile epileptic encephalopathy 6 (EIEE6), familial febrile seizures 3A (FEB3A), intractable childhood epilepsy with generalized tonic-clonic seizures (ICEGTC), familial hemiplegic migraine 3 (FHM3), Panayiotopoulos syndrome, familial atrial fibrillation 13 (ATFB13), generalized epilepsy with febrile seizures + type 1 (gefs+ type 1), Brugada syndrome, nonspecific cardiac conduction defect, generalized epilepsy with febrile seizures +, benign familial infantile seizures, early infantile epileptic encephalopathy 11 (EIEE11), benign familial infantile epilepsy, neurodegeneration, tauopathy, and Alzheimer's disease. In some cases, the neurological condition is Dravet syndrome. Mutations or abnormalities in SCN1A are also associated with epilepsy conditions, epilepsy, autism, familial hemiplegic migraine type 3 (FHM3), genetic epilepsy with febrile seizures + (GEFS+), and the effectiveness of certain anti-seizure medications. For example, the ICS5N+5G>A mutation in SCN1A is associated with the maximum safe amount (dose) of the anti-epileptic drugs phenytoin and carbamazepine.

[0318] In certain embodiments, the present application provides methods of treating a subject having or at risk of having Dravet syndrome by administering an expression cassette, expression vector, or viral particle comprising a polynucleotide encoding an eTF that selectively upregulates SCN1A. Dravet syndrome is characterized by prolonged febrile and afebrile seizures during the first year of childhood. This disease progresses to other seizure types such as myoclonic seizures and partial seizures, psychomotor retardation, and ataxia. It is characterized by cognitive impairment, behavioral abnormalities, and motor deficits. Behavioral deficits typically include hyperactivity and impulsivity, and in rare cases, autistic-like behavior. Dravet syndrome is also associated with sleep disorders including somnolence and insomnia. In many patients, Dravet syndrome is caused by gene mutations that result in the production of a non-functional protein. There are many challenges in treating conditions related to genetic causes. Thus, most existing treatments have been used for prophylactic medical management of seizures and other symptoms.

[0319] In 70 - 90% of patients, Dravet syndrome is caused by a nonsense mutation in the SCN1A gene, which results in a premature stop codon and thus a non-functional protein. Typically, missense mutations in the S5 or S6 segments of the sodium channel pore result in loss of channel function and the development of Dravet syndrome. Heterozygous inheritance of an SCN1A mutation (e.g., nonsense mutation, missense mutation, deletion, insertion, inversion, etc.) is necessary to form a defective sodium channel; patients with Dravet syndrome still have one normal copy of the gene. Thus, the disease is characterized as a haploinsufficient disorder, and thus increasing the expression of a functional copy of SCN1A can restore normal production levels of Nav1.1.

[0320] Symptoms associated with Dravet syndrome include seizures, memory deficits, developmental delays, poor muscle tone, and / or cognitive problems. Treatment with the expression cassette, expression vector, or viral particle described herein can result in improvement of one or more symptoms, such as a decrease in the frequency, duration, and / or intensity of seizures. Administering the gene therapy described herein to a subject at risk of developing Dravet syndrome can prevent the development or slow the progression of one or more symptoms of Dravet syndrome.

[0321] In certain embodiments, treatment with an expression cassette, expression vector, or viral particle comprising a polynucleotide encoding an eTF that selectively upregulates SCN1A as described herein reduces seizure duration and / or frequency, e.g., seizures associated with Dravet syndrome, by at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more compared to an untreated control or compared to pre-treatment levels.

[0322] In some Alzheimer's patients, the production of amyloid-beta (Aβ) involves numerous peptides and proteases that can affect neuronal excitability, leading to seizures and downregulation of the Nav1.1 sodium channel in PV neurons. In another embodiment, the present application provides a method of treating a subject suffering from Alzheimer's disease by administering an expression cassette, expression vector, or viral particle as described herein comprising a polynucleotide encoding an eTF that selectively upregulates SCN1A. Symptoms associated with Alzheimer's disease include short-term memory loss, cognitive difficulties, seizures, and difficulties with language, executive function, perception (agnosia), and action execution (apraxia). Treatment with an expression cassette, expression vector, or viral particle comprising a polynucleotide encoding an eTF that selectively upregulates SCN1A can result in the improvement of one or more Alzheimer's symptoms, such as a slowed progression of memory loss, or the prevention of one or more symptoms. In some cases, the treatment can result in the correction of high gamma power brain activity. The treatment can result in a reduction in seizure frequency and / or seizure severity, or a reduction in high gamma power activity by 10%, 20%, 30%, 40%, 50%, 60%, 70% or more compared to untreated. In some cases, the treatment can result in an improvement in cognitive function. Learning and / or memory can be improved by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100% compared to untreated or compared to pre-treatment with a polynucleotide encoding an eTF that selectively upregulates SCN1A as disclosed herein.

[0323] In some cases, treatment with an expression cassette, expression vector, or viral particle comprising a polynucleotide encoding an eTF that selectively upregulates SCN1A reduces high gamma power activity (e.g., high gamma power activity associated with Alzheimer's disease) by at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% compared to an untreated control or compared to pre-treatment levels.

[0324] Parkinsonism refers to the collection of signs and symptoms found in Parkinson's disease (PD), including slowness (bradykinesia), stiffness (rigidity), tremors, and imbalance (postural instability). In some cases, administration of an expression cassette, expression vector, or viral particle comprising a polynucleotide encoding an eTF that selectively upregulates SCN1A as described herein to a subject at risk of developing or having Parkinson's disease can prevent the development of one or more of its symptoms, or slow the progression of Parkinson's disease by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% compared to no treatment.

[0325] In certain embodiments, the present application provides methods useful for treating subjects at risk of developing a disease. The subject may be known to be predisposed to a disease, such as a neurological disease or a disease associated with epilepsy, seizures, and / or encephalopathy. The subject may be predisposed to a disease due to a genetic event, or due to known risk factors. For example, the subject may carry a mutation in SCN1A associated with epilepsy (e.g., Dravet syndrome). Any mutation in the SCN1A gene that reduces its activity (by reducing expression levels, impairing protein function, or a combination of both) can predispose the subject to a disease, including any one or more of insertions, deletions, inversions, translocations, or substitutions in the SCN1A gene (e.g., point mutations, including nonsense mutations and / or missense mutations). In some cases, due to the age of the subject, the subject may be predisposed to a disease such as Alzheimer's disease. In some cases, the subject may have an insufficient amount of SCN1A protein, and treating a disease associated with SCN1A includes administering an expression cassette, expression vector, or viral particle comprising a polynucleotide encoding an eTF that selectively upregulates endogenous SCN1A as described herein.

[0326] In certain embodiments, treatment using an expression cassette, expression vector, or viral particle comprising a polynucleotide encoding an eTF that selectively upregulates endogenous SCN1A provided herein can result in a reduction or cessation of symptoms associated with Dravet or other SCN1A-related diseases or disorders (e.g., epilepsy associated with SCN1A haploinsufficiency). For example, the treatment can improve learning, memory, cognitive function, and / or motor function; reduce the frequency and / or duration of seizures; and / or reduce temperature sensitivity (or increase the temperature threshold for triggering seizures).

[0327] In another aspect, the present application provides a method for selectively expressing a transgene in PV neurons by administering an expression cassette, expression vector, or viral particle comprising at least one PV-selective microRNA binding site. In certain embodiments, the present application provides a method for selectively expressing a transgene in PV neurons of a primate by administering an expression cassette, expression vector, or viral particle comprising a transgene and at least one PV-selective microRNA binding site. In certain embodiments, the present application provides a method for selectively expressing a transgene in PV neurons by administering an expression cassette, expression vector, or viral particle comprising a PV-selective regulatory element operably linked to a transgene and at least one PV-selective microRNA binding site. In an exemplary embodiment, the transgene comprises a sequence encoding any eTF that selectively upregulates SCN1A as described herein.

[0328] In certain embodiments, the present application provides a gene therapy method comprising administering to a subject an expression cassette, expression vector, or viral particle comprising a transgene and at least one PV-selective microRNA binding site. In certain embodiments, the present application provides a gene therapy method comprising administering to a subject an expression cassette, expression vector, or viral particle comprising a PV-selective regulatory element operably linked to a transgene and at least one PV-selective microRNA binding site. In an exemplary embodiment, the transgene comprises a sequence encoding any eTF that selectively upregulates SCN1A as described herein.

[0329] In certain embodiments, the present application provides a method of treating a disease or disorder, which comprises administering an expression cassette, an expression vector or a viral particle comprising a transgene and at least one PV-selective microRNA binding site. In certain embodiments, the present application provides a method of treating a disease or disorder, which comprises administering to a subject an expression cassette, an expression vector or a viral particle comprising a PV-selective regulatory element operably linked to a transgene and at least one PV-selective microRNA binding site. In an exemplary embodiment, the transgene comprises a sequence encoding any eTF that selectively upregulates SCN1A as described herein. In certain embodiments, an expression cassette, an expression vector or a viral particle comprising a transgene, a PV-selective microRNA binding site and optionally a PV-selective regulatory element can be used to treat a disease or disorder involving PV neurons. In certain embodiments, an expression cassette, an expression vector or a viral particle comprising a transgene, a PV-selective microRNA binding site and optionally a PV-selective regulatory element is used to treat a neuronal condition. Suitable neuronal diseases or disorders to be treated include, but are not limited to, Dravet syndrome, Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (SMA), epilepsy, neurodegenerative diseases, movement disorders, motility diseases, mood disorders, motor neuron diseases, progressive muscular atrophy (PMA), progressive bulbar palsy, pseudobulbar palsy, primary lateral sclerosis, the neurological consequences of AIDS, developmental disorders, multiple sclerosis, neurogenetic diseases, stroke, spinal cord injury, traumatic brain injury, tauopathies, neuronal hyperexcitability and / or seizures. In some embodiments, a viral vector, a viral particle or a pharmaceutical composition comprising a transgene, a PV-selective microRNA binding site and optionally a PV-selective regulatory element is used to treat mental diseases (e.g., schizophrenia, obsessive-compulsive disorder, addiction, depression, anxiety, psychosis); autism spectrum disorders (e.g., fragile X syndrome, Rett syndrome); epilepsy (e.g., Dravet syndrome, chronic traumatic encephalopathy, generalized epilepsy with febrile seizures plus (GEFS+), epileptic encephalopathy, temporal lobe epilepsy, focal epilepsy, tuberous sclerosis, epilepsy associated with SCN1A haploinsufficiency); and / or neurodegeneration (e.g., Alzheimer's disease, Parkinson's disease).Diseases associated with dysfunctional PV neurons, such as those caused by loss-of-function mutations in SCN1A or Nav1.1, include: Dravet syndrome, Ohtahara syndrome, epilepsy, early infantile epileptic encephalopathy 6 (EIEE6), familial febrile seizures 3A (FEB3A), intractable childhood epilepsy with generalized tonic-clonic seizures (ICEGTC), familial hemiplegic migraine 3 (FHM3), Panayiotopoulos syndrome, familial atrial fibrillation 13 (ATFB13), generalized epilepsy with febrile seizures+ type 1 (gefs+ type 1), Brugada syndrome, nonspecific cardiac conduction defects, generalized epilepsy with febrile seizures+, benign familial infantile seizures, early infantile epileptic encephalopathy 11 (EIEE11), benign familial infantile epilepsy, neurodegeneration, tauopathies, and Alzheimer's disease.

[0330] In certain embodiments, treatment with an expression cassette, expression vector, or viral particle comprising a transgene and a PV-selective microRNA binding site and optionally a PV-selective regulatory element as described herein results in an improvement in symptoms associated with a neuronal disease or disorder. For example, improvements in motor function in patients with Parkinson's disease can be monitored symptomatically, indicating a positive response to treatment. Administration of therapy using the methods described herein to a subject at risk of developing a neuronal disorder can prevent the onset or slow the progression of one or more symptoms.

[0331] In certain embodiments, the expression cassettes, expression vectors or viral particles provided herein comprising a transgene and a PV-selective microRNA binding site and optionally a PV-selective regulatory element can be used to treat a subject who has been diagnosed with a neuronal disease, such as epilepsy associated with SCN1A haploinsufficiency, such as Dravet syndrome. In various embodiments, any neuronal disease or disorder disclosed herein is caused by a known genetic event (e.g., any SCN1A mutation known in the art) or has an unknown cause.

[0332] In certain embodiments, the expression cassettes, expression vectors, or viral particles provided herein that contain a transgene and a PV-selective microRNA binding site and optionally a PV-selective regulatory element can be used to treat a subject at risk of developing a disease or disorder. In some embodiments, it may be known that the subject is predisposed to a disease, e.g., a neuronal disease (e.g., epilepsy associated with SCN1A haploinsufficiency, such as Dravet syndrome). In some embodiments, the subject may be predisposed to a disease due to a genetic event or due to a known risk factor. For example, the subject may carry a mutation in SCN1A associated with epilepsy or Dravet syndrome, e.g., an insertion, deletion, inversion, translocation, or substitution (e.g., a point mutation, including a nonsense mutation and / or a missense mutation).

[0333] In certain embodiments, the expression cassettes, expression vectors, or viral particles provided herein that contain a transgene and a PV-selective microRNA binding site and optionally a PV-selective regulatory element can be used to alleviate one or more symptoms associated with a disease or disorder. For example, symptoms associated with Dravet syndrome include seizures, memory deficits, developmental delays, poor muscle tone, and / or cognitive problems. Treatment with the viral vectors, viral particles, or pharmaceutical compositions provided herein that contain a transgene and a PV-selective microRNA binding site and optionally a PV-selective regulatory element can result in improvement of one or more symptoms, e.g., a decrease in the frequency, duration, and / or intensity of seizures.

[0334] In certain embodiments, the methods described herein are for increasing the expression of a transgene in PV neurons, gene therapy, or treating a disease or disorder in a primate. In certain embodiments, the primate is a human. In certain embodiments, the primate is a non-human primate. In certain embodiments, the non-human primate is an Old World monkey, orangutan, gorilla, chimpanzee, cynomolgus monkey, rhesus monkey, or pig-tailed monkey.

[0335] The terms "subject" and "individual" are used interchangeably herein and refer to a vertebrate, preferably a mammal, more preferably a human. The methods described herein can be used for human therapy, veterinary applications, and / or preclinical studies in animal models of diseases or conditions. In various embodiments, the subjects that can be treated according to the methods described herein are mammals such as mice, rats, hamsters, guinea pigs, gerbils, cows, sheep, pigs, goats, donkeys, horses, dogs, cats, llamas, monkeys (e.g., Old World monkeys, marmosets, or macaques such as rhesus monkeys, pig-tailed monkeys, or cynomolgus monkeys (i.e., cynomolgus macaques)), apes (e.g., orangutans, gorillas, or chimpanzees), or humans. In an exemplary embodiment, the subject is a human.

[0336] The following table provides the sequences disclosed herein.

[0337] Table 1. Exemplary engineered transcription factors disclosed herein. The sequences of the regulatory elements (RE) are disclosed in Table 2 and Table 8 below. For the RE, when m1 is shown, it means that between the coding region and the polyA tail includes an m1 microRNA binding site (SEQ ID NO:7, Table 8). The sequences of the DNA binding domains (DBD) are disclosed in Table 3 below. For the DBD, engineered zinc finger (eZF) indicates that the construct has the general formula shown in SEQ ID NO:147 (Table 10); EGR1 indicates that the DBD is derived from wild-type human EGR1 (SEQ ID NO:176; Table 12); and EGR3 indicates that the DBD is derived from wild-type human EGR3 (SEQ ID NO:175, Table 12). The sequences of the target sites (e.g., the sequences bound by the DBD) are provided in Table 4 below. The sequences of the transcription activation domains (TAD) are disclosed in Table 5 below. For the TAD, (c) indicates that the TAD is located at the c-terminus of the DBD, (n) indicates that the TAD is located at the n-terminus of the DBD, (n / c) indicates that there are TADs located at the n-terminus and c-terminus of the DBD, and 2x CITED4(n) indicates that there are 2 copies of the CITED4 TAD located at the n-terminus of the DBD. The sequences of the full-length engineered transcription factors (DBD + TAD) are provided in Table 6 below.

[0338]

[0339]

[0340] Table 2. Nucleic acid sequences of various regulatory elements (RE) disclosed herein.

[0341]

[0342]

[0343]

[0344]

[0345] Table 3. Amino acid sequences of exemplary DNA binding domains (DBD) provided herein. For the DBD, engineered zinc finger (eZF) indicates that the construct has the general formula shown in SEQ ID NO:147 (Table 10); EGR1 indicates that the DBD is derived from wild-type human EGR1 (SEQ ID NO:176; Table 12); and EGR3 indicates that the DBD is derived from wild-type human EGR3 (SEQ ID NO:175, Table 12). The target sites are the sequences bound by the DBD and are provided in Table 4 below.

[0346]

[0347]

[0348]

[0349] Table 4. Target site sequences and chromosomal locations of exemplary target sites bound by the DNA binding domains disclosed herein.

[0350]

[0351]

[0352] Table 5. Amino acid sequences of exemplary transcriptional activation domains (TADs) disclosed herein.

[0353]

[0354] Table 6. Amino acid sequences of exemplary engineered transcription factors (DBD+TAD) disclosed herein.

[0355]

[0356]

[0357]

[0358]

[0359]

[0360]

[0361]

[0362]

[0363]

[0364]

[0365]

[0366]

[0367]

[0368]

[0369]

[0370] Table 7. Nucleic acid sequences encoding the exemplary engineered transcription factors disclosed herein.

[0371]

[0372]

[0373]

[0374]

[0375]

[0376]

[0377]

[0378]

[0379]

[0380]

[0381]

[0382]

[0383]

[0384]

[0385]

[0386]

[0387]

[0388]

[0389]

[0390]

[0391]

[0392]

[0393] Table 8. Nucleic acid sequences of exemplary microRNAs and microRNA binding sites.

[0394]

[0395]

[0396] Table 9. Different types of zinc finger structures and exemplary zinc finger proteins used to generate eTFs.

[0397]

[0398]

[0399] Table 10. Amino acid sequences of exemplary zinc finger DNA binding domains.

[0400]

[0401]

[0402] Table 11. Amino acid sequences of exemplary zinc finger recognition sequences disclosed herein.

[0403]

[0404] Table 12. Other nucleotide and amino acid sequences disclosed herein.

[0405]

[0406]

[0407]

[0408]

[0409]

[0410]

[0411] Examples

[0412] The following examples are included to further describe some aspects of the present disclosure and should not be used to limit the scope of the invention.

[0413] Example 1

[0414] Identification of target regions capable of upregulating SCN1A using an SCN1A-specific transcriptional activator

[0415] To identify genomic regions capable of upregulating endogenous SCN1A expression, various engineered transcription factors (zinc finger nucleases or gRNA / daCas9 constructs) were designed that targeted various regions of the genome as shown in Tables 4 and 13 above. For the gRNA / daCas9 constructs, since the gRNA was designed to target the complementary genomic strand, the gRNA had the same sequence as the target region. The dCas9 protein was the dCAS9-VP64 construct (SEQ ID NO:174).

[0416] HEK293 cells were cultured according to standard methods and transfected in each well of a 6-well plate with 3 μg of plasmid carrying the engineered transcription factor or control construct (FugeneHD, Promega). Cells were transfected with plasmids expressing the constructs shown in Table 13 below. At 48 h post-transfection, cells were harvested and RNA was isolated (Qiagen RNeasy Mini kit) and treated with DNase. RNA (3 μg) was reverse transcribed using an OligoDT primer (Superscript IV, Invitrogen). cDNA samples were analyzed by qPCR using Phusion polymerase (New England Biolabs) and SYBR Green I: (30 s at 98 °C, 40x [10 s at 98 °C, 15 s at 66 °C, 15 s at 72 °C]). Primers specific for SCN1A (5’-TGTCTCGGCATTGAGAACATTC-3’ (SEQ ID NO:185); 5’-ATTGGTGGGAGGCCATTGTAT-3’ (SEQ ID NO:186)) were used to quantify the level of endogenous SCN1A transcript, and the relative level of SCN1A expression was determined by the delta-delta Ct method using GAPDH as a reference gene (5’-ACCACAGTCCATGCCATCAC’-3’ (SEQ ID NO:187); 5’-TCCACCACCCTGTTGCTGTA-3’ (SEQ ID NO:188)). Data are presented as fold change relative to the control condition.

[0417] Results are shown as fold change in SCN1A transcription relative to the control condition (e.g., EGFP-KASH reporter construct) in Figure 1 and Table 13 below. Table 13 reports values for constructs that resulted in at least a 1.5-fold increase in transcription relative to the control condition.

[0418] Table 13. Effects of different genomic target sites and corresponding eTFs on transcription. CON denotes the zinc finger construct used in the experiment (see Table 1). For the gRNA constructs, the target site and gRNA sequence are the same as the gRNA was designed to target the complementary DNA strand.

[0419]

[0420]

[0421] Example 2

[0422] Upregulation of endogenous SCN1A in HEK293 cells using an SCN1A-specific transcription factor

[0423] HEK293 cells were cultured according to standard methods and seeded into 6-well plates. Cells in each well were transfected (FugeneHD, Promega) with 3 μg of plasmid carrying a single engineered transcription factor construct, WT human CREB3 (SEQ ID NO:211), or EGFP control construct. The engineered transcription factor constructs tested included: constructs 1 - 27 and 46 - 53 (Table 1) and plasmids expressing CREB3-TRE (SEQ ID NO:215; CREB3 in which the bZIP DNA-binding domain was replaced by a synthetic ZF domain targeted by the TET promoter) (each tested individually). At 48 h post-transfection, cells were harvested and RNA was isolated (Qiagen RNeasy Mini kit) and treated with DNase. RNA (3 μg) was reverse transcribed using OligoDT primers (Superscript IV, Invitrogen). cDNA samples were analyzed by qPCR using Phusion polymerase (New England Biolabs) and SYBR Green I: (30 s at 98 °C, 40x [10 s at 98 °C, 15 s at 66 °C, 15 s at 72 °C]). Primers for SCN1A (5’-TGTCTCGGCATTGAGAACATTC-3’ (SEQ ID NO:185); 5’-ATTGGTGGGAGGCCATTGTAT-3’ (SEQ ID NO:186)) were used to quantify the levels of endogenous SCN1A transcripts, and the relative levels of SCN1A expression were determined by the delta-delta Ct method using GAPDH as a reference gene (5’-ACCACAGTCCATGCCATCAC’3’ (SEQ ID NO:187); 5’-TCCACCACCCTGTTGCTGTA-3’ (SEQ ID NO:188)). Data were presented as fold change relative to the control condition (see Figure 2A , Figure 2B and Figure 2C ). The control construct consisted of EGFP expressed under the control of RE 1 (SEQ ID NO:1). Delivery of the engineered transcription factors induced varying degrees of upregulation of endogenous SCN1A transcripts relative to the EGFP condition.

[0424] Example 3

[0425] Upregulation of endogenous SCN1A in GABA neurons using an SCN1A-specific transcription factor

[0426] iCell GABA neurons (Cellular Dynamics) were seeded in 6-well plates (about 1E6 cells / well) and maintained according to the manufacturer's recommended protocol. 72 h after seeding, recombinant AAV (serotype AAV-DJ) expressing EGFP or activator ( Figure 3A construct 30 in Figure 3B or construct 25 or construct 16 in Figure 3A ) under the control of a ubiquitous promoter (CBA promoter) was added to the medium at approximately 2E11 genomic copies / well. One week ( Figure 3B ) or two weeks ( Figure 3A ) after infection, RNA was isolated from the cultured cells (Qiagen RNeasy Mini kit) and treated with DNase. Reverse transcription of the recovered RNA was performed using OligoDT primers (Superscript IV, Invitrogen). cDNA samples were analyzed by qPCR using Phusion polymerase (New England Biolabs) and SYBR Green I: (30 s at 98 °C, 40x [10 sec at 98 °C, 15 sec at 66 °C, 15 sec at 72 °C]). Primers specific for SCN1A (5’-TGTCTCGGCATTGAGAACATTC-3’ (SEQ ID NO:185); 5’-ATTGGTGGGAGGCCATTGTAT-3’ (SEQ ID NO:186)) were used to quantify the levels of endogenous SCN1A transcripts, and the relative levels of SCN1A expression were determined by the delta-delta Ct method using GAPDH as a reference gene (5’-ACCACAGTCCATGCCATCAC’3’ (SEQ ID NO:187); 5’-TCCACCACCCTGTTGCTGTA-3’ (SEQ ID NO:188)). Data were presented as fold change relative to the control condition (see Figure 3B ). Expression of the AAV-driven engineered transcription factor resulted in a significant upregulation of endogenous SCN1A transcripts in cultured iPS-derived GABA neurons.

[0427] Example 4

[0428] Specific upregulation of endogenous SCN1A in GABA neurons using an SCN1A-specific transcription factor

[0429] iCell GABA neurons (Cellular Dynamics) were seeded in 6-well plates (∼1E6 cells / well) and maintained according to the manufacturer's recommended protocol. At 72 h post-seeding, recombinant AAV (serotype AAV-DJ) expressing EGFP or an activator (construct 30, which contains a zinc finger DBD fused to the VPR TAD driven by the CBA promoter) under the control of the CBA promoter was added to the medium at ∼2E11 genomic copies / well.

[0430] One week post-infection, RNA was isolated from the cultured cells (Qiagen RNeasy Mini kit) and treated with DNase. RNAseq libraries were prepared from the recovered RNA using the TruSeq Stranded mRNA Library kit (Illumina) and sequenced on an Illumina NextSeq (2x 75-cycle paired-end sequencing). The sequencing reads were aligned to the human genome (RNASTAR), and differential expression analysis was performed using DESeq2. Data are presented as fold change relative to control (AAVDJ-CBA-EGFP) samples (see Figure 4 ). The results are shown in Table 14, Figure 4 showing the relative expression of endogenous SCN1A and 40 nearest neighbor gene transcripts, presented as fold change relative to control conditions. Construct 30, as described in Table 1, was able to specifically increase the expression of the SCN1A gene or Nav1.1 protein compared to other genes examined. This indicates that the target site recognized by the transcriptional activator of construct 30 is specific for the SCN1A gene and thus results in an increase in SCN1A gene expression in GABA neurons.

[0431] Table 14. Effects on transcription of endogenous SCN1A and 40 nearest neighbor genes in GABA neurons treated with an SCN1A-specific transcription factor (construct 30).

[0432]

[0433]

[0434] Example 5

[0435] In vivo expression of SCN1A from an expression cassette

[0436] To test the in vivo expression of the transcriptional activator of SCN1A, a recombinant AAV9 vector was generated by Vector Biolabs (Malvern, PA). Dorsal hippocampus (AP - 2.0 mm, lateral ±1.5, DV - 1.4 mm, from dura mater) and ventral hippocampus (AP - 3.1 mm, lateral ±2.8, DV - 3.8 mm, from dura mater) of male C57Bl / 6 mice (N = 5 per group, 7 - 8 weeks old) were bilaterally infused with 1.5 μl of purified AAV vector, for a total of 4 injection sites. AAV was delivered at a rate of 0.3 μl / min, with a 4 - minute rest period after each injection. Four weeks after treatment, the mice were euthanized and hippocampal tissues were dissected. For each group, tissues from the left and right hippocampal tissues were collected from most animals (N = 4) and pooled for homogenization, except for one animal in which only the left hippocampus was collected and homogenized. RNA was isolated from the homogenate (Qiagen RNeasy Mini kit) and treated with DNase. RNA (3 μg) was reverse - transcribed using OligoDT primers (Superscript IV, Invitrogen). Mouse SCN1A expression in the cDNA samples was analyzed by qPCR using Phusion polymerase (New England Biolabs) and SYBR Green I: 30 s at 98°C, 40x [10 sec at 98°C, 15 sec at 64°C, 15 sec at 72°C]. Primers for mouse SCN1A (5’ - CAAAAAAGCCACAAAAGCCT - 3’ (SEQ ID NO:189); 5’ - TTAGCTCCGCAAGAAACATC - 3’ (SEQ ID NO:190)) were used to quantify the levels of endogenous SCN1A transcripts, and the relative levels of in vivo SCN1A expression were determined by the delta - delta Ct method using GAPDH as a reference gene (5’ - ACCACAGTCCATGCCATCAC’3’ (SEQ ID NO:187); 5’ - TCCACCACCCTGTTGCTGTA - 3’ (SEQ ID NO:188)).

[0437] Figure 5A and Figure 5B Shows the average results of five animals, each injected with the AAV9 construct. The eGFP control construct contains the eGFP reporter transgene. Construct 4 (see Table 1) contains a transcriptional activator that recognizes the target sequence containing SEQ ID NO:18, as described in Table 1 above. Figure 5A Shows the relative expression of SCN1A in vivo. Figure 5BChanges in SCN1A expression in vivo are shown as mean eGFP expression percentages. These results indicate that the SCN1A transcriptional activator of expression cassette A results in an approximately 20%-30% upregulation of SCN1A expression in vivo.

[0438] Such expression cassettes may be suitable for use in humans to treat Dravet syndrome, epilepsy, seizures, Alzheimer's disease, Parkinson's disease, and / or any other disease or condition associated with SCN1A deficiency and / or impaired activity.

[0439] Example 6

[0440] Hyperthermic seizure (HTS) test in a mouse model of Dravet syndrome

[0441] A. Heterozygous Scn1a Knockout Mouse Model

[0442] The treatment of Dravet syndrome and / or its symptoms using an expression cassette was tested in the Scn1a tm1Kea mouse strain. This mouse strain is an established mouse model of Dravet syndrome. The Scn1a tm1Kea mouse strain does not require CRE recombinase. The Scn1a tm1Kea mice (available from the Jackson Laboratory; described in Hawkins et al., Scientific Reports, vol. 7:15327 (2017)) contain a deletion of the first coding exon of SCN1A. Mice homozygous for the SCN1A knockout allele are characterized by tremors, ataxia, seizures, and death by postnatal day 16. Heterozygous mice on a C57BL / 6 background develop spontaneous seizures and most die within a few weeks. Such mouse strains can be used to study the safety and efficacy of treatments for epilepsy and Dravet syndrome. See also Miller et al., Genes Brain Behav. February 2014;13(2):163-72 for additional information.

[0443] To test the transcriptional activator in Scn1a tm1KeaEfficacy in a mouse strain. At P1, AAV vectors were administered bilaterally by ICV to pups generated from a cross between male Scn1a+ / - and female C57Bl / 6J. Constructs 31 - 34 (Table 1) were administered to the mice. The dams were left undisturbed until weaning at P18, and then the mice were left undisturbed again until the high temperature seizure (HTS) test began at P26 - P28. Individual pups of the P1 mice that received the drug were weaned at P18, and mortality was observed daily. High temperature seizure induction was performed in P26 - P28 heterozygous (HET) and WT Scn1a mice in a mixed 129Stac X C57BL / 6 background. Before the test, a lubricated rectal temperature probe (Ret - 4) was inserted into the mice, which was connected to a temperature control module (TCAT 2DF, Physitemp) connected in series with a heating lamp (HL - 1). Then the mice were placed in a large glass beaker to briefly acclimatize to the environment. Thereafter, the body temperature was increased by approximately 0.5°C every 2 minutes until the first tonic - clonic seizure accompanied by loss of posture occurred or until 43°C was reached. If the mouse had a seizure accompanied by loss of posture, the experiment was terminated and the internal body temperature of the mouse was recorded. If no seizure accompanied by loss of posture was detected throughout the experiment, the mouse was considered seizure - free and the test was terminated. Tissue samples were obtained from the mice at P1, and the mice were genotyped using real - time PCR during the experiment. After the test was completed, the genotyping was unblinded, and the status of the mice (HET or WT) was correlated with the data obtained. The data were plotted as Kaplan - Meier survival curves, and significance was determined by the Mantel - Cox test. The results are shown in Tables 15 and 16 and Figure 6A -E.

[0444] Table 15. Summary of the conditions used in Example 6

[0445]

[0446]

[0447] Table 16. Summary of the results of the high temperature seizure test.

[0448]

[0449] As described above, additional experiments were conducted in Scn1a tm1Kea mice to test the effects of constructs 42 and 43 on seizures in the HTS test. In these experiments, construct 42 was administered at P1 bilaterally by ICV at 9x10 10 gc / mouse, while construct 43 was administered at P1 or P5 bilaterally by ICV at 6x10 10 gc / mouse. The results are shown inFigure 6F (Construct 42) and Figure 6G (Construct 43). Compared to the EGFP control, both constructs showed a significant reduction in seizures (P < 0.0001 for both Construct 42 and 43).

[0450] B. Heterozygous Scn1a RX Mutant mouse model

[0451] In Scn1a RX mouse strain, the treatment of Dravet syndrome and / or its symptoms using the expression cassette of the present disclosure was tested. This mouse strain is an established mouse model of Dravet syndrome. Scn1a RX mouse strain does not require CRE recombinase. Scn1a RX mice (available from Jackson Laboratory; described in Ogiwara et al., J. Neuroscience, vol. 27: 5903 - 5914 (2007)) contain a loss - of - function single - base nonsense mutation (CgG mutated to TgA; R1407X) in exon 21 of the SCN1A gene. Heterozygous mice on a C57BL / 6 background develop spontaneous seizures and most die within a few weeks.

[0452] To test the efficacy of the transcriptional activator in the Scn1a RX mouse strain, at P1, by bilateral ICV, to pups obtained by IVF of male Scn1a RX / + sperm and female C57Bl / 6J oocytes and implantation of the embryos into CD - 1 foster mothers were injected with 5.1x10 10Genome copies (gc) / mouse were given an AAV vector (construct 31) or given a PBS control. The dams were left undisturbed until weaning at P18, and then the mice were left undisturbed again until the HTS test began at P26 - P28. Individual pups of the P1 mice given the drug were weaned at P18 and observed daily for mortality. In P26 - P28 heterozygous (HET) and WT Scn1a mice on a C57BL / 6 background, hyperthermic seizure induction was performed. Before the test, a lubricated rectal temperature probe (Ret - 4) was inserted into the mice, which was connected to a temperature control module (TCAT 2DF, Physitemp) connected in series with a heating lamp (HL - 1). Then the mice were placed in a large glass beaker to briefly acclimate to the environment. Thereafter, the body temperature was increased by approximately 0.5 °C every 2 minutes until the first tonic - clonic seizure accompanied by loss of posture occurred or until 43 °C was reached. If the mouse had a seizure accompanied by loss of posture, the experiment was ended and the internal body temperature of the mouse was recorded. If no seizure accompanied by loss of posture was detected throughout the experiment, the mouse was considered seizure - free and the test was ended. Tissue samples were obtained from the mice at P1, and the mice were genotyped using real - time PCR during the experiment. After the test was completed, the genotyping was unblinded, and the status of the mice, HET or WT, was correlated with the data obtained. None of the WT Scna1 mice tested had a seizure. Data on construct 31 - treated (n = 13) and PBS - control - treated (n = 14) HET mice were plotted as Kaplan - Meier survival curves, and significance was determined by the Mantel - Cox test. As Figure 6H shown, construct 31 - treated HET mice showed a significant reduction in hyperthermic seizure induction compared to PBS - control - treated HET mice (P < 0.01).

[0453] Example 7

[0454] Survival test in a Dravet syndrome mouse model

[0455] A. Heterozygous Scn1a Knockout Mouse Model

[0456] To test the efficacy of the transcriptional activator in the Scn1a tm1Kea mouse strain, at P1, bilateral ICV was used to give an AAV vector to pups produced by breeding male Scn1a+ / - with female C57Bl / 6J. The dams were left undisturbed until weaning. After weaning at P18, the health status of the Scn1a+ / - mice was observed daily. For mice found dead in the cage for any reason, the date was recorded. The data were plotted as Kaplan - Meier survival curves, and significance was determined by the Mantel - Cox test.

[0457] The results are shown in Table 17 and Figure 7A -D.

[0458] Table 17. Summary of conditions and results of the survival assay.

[0459]

[0460] B. Heterozygous Scn1a RX Mutant mouse model

[0461] To test the efficacy of the transcriptional activator in the Scn1a RX mouse strain, at P1, bilateral ICV administration was performed in pups obtained by IVF hybridization of male Scn1a RX / + sperm with female C57Bl / 6J oocytes and implantation of the embryos into CD-1 foster mothers, and the pups were given the AAV vector (construct 31) at 5.1x10 10 genomic copies (gc) / mouse or given a PBS control. The foster mothers were left undisturbed until weaning. After weaning at P18, the health status of the Scn1a RX / + mice was observed daily. For mice found dead in the cages for any reason, the date was recorded. Data on construct 31-treated (n = 27) and control-treated (n = 18) mice were plotted as Kaplan-Meier survival curves, and significance was determined by the Mantel-Cox test.

[0462] As Figure 7E shown, compared to Scn1a RX / + mice treated with PBS control, Scn1a RX / + mice treated with construct 31 had increased survival (P < 0.0001).

[0463] Example 8

[0464] SCN1A transcription levels in non-human primates after treatment with AAV encoding an SCN1A-specific transcription factor

[0465] This study used male cynomolgus monkeys (Macaca fascicularis) aged 2 to 3 years. Before inclusion in the study, the animals were pre-screened for cross-reactive antibodies against AAV9 by a cell-based neutralizing antibody assay. AAV9 expressing an SCN1A-specific transcription factor (construct 33) or a control was diluted in PBS and injected intrasubstantially at 1.2E12 gc / animal. Three different stereotaxic coordinates were determined for injection in each hemisphere, six injection sites per animal. A volume of 10 μl was injected at each site. Injections in the right hemisphere were symmetric to those in the left hemisphere. Two untreated animals were used as controls.

[0466] To evaluate Scn1A mRNA expression, reverse transcription was performed followed by qPCR method. At necropsy 28 days after dosing, tissue sections were collected from various regions of the brain (frontal cortex, parietal cortex, temporal cortex, occipital cortex, hippocampus, medulla, cerebellum; 200 mg each) of control and treated animals, placed in RNAlater, and then frozen. Briefly, 30 mg of tissue was cut, RNA was extracted (using Qiagen Rneasy Lipid tissue mini kit, catalog number 1023539), converted to cDNA by reverse transcription (using Applied Biosystems high-capacity cDNA reverse transcription kit, catalog number 4368814), and qPCR was performed using primer / probe sets for Scn1A and the housekeeping gene GAPDH (Applied Biosystems, catalog number Rh02621745-gI FAM).

[0467] The primer / probe set for SCN1A is given below.

[0468] Table 18. Primer sequences used in Example 8.

[0469]

[0470] Using the comparative Ct (ΔCt) method, the gene expression of Scn1A in each test sample was determined by relative quantification (RQ). This method measures the Ct difference (ΔCt) between the target gene and the housekeeping gene, and then compares the ΔCt value of the treated sample with that of the control sample.

[0471] ΔCt = average Ct of the target gene – average Ct of the housekeeping gene

[0472] ΔΔCt = ΔCt of the treated sample – ΔCt of the control sample

[0473] Relative expression (treated sample) = 2 -ΔΔCt

[0474] Data was reported as the normalized expression of the target mRNA in different tissue sections from the brain (see Figure 8 ). As Figure 8 shown, the brain regions proximal to the site of injection in the parenchyma showed the highest levels of SCN1A transcript expression.

[0475] Example 9

[0476] Selective transgene expression in PV neurons of non-human primates after treatment with AAV having a PV-selective promoter and microRNA binding sites

[0477] Six common marmosets (Callithrix jacchus) were used in this study. Before inclusion in the study, they were pre-screened for cross-reactive antibodies against AAV9. Two monkeys were treated with AAV9 containing the EGFP transgene under the control of the EF1alpha promoter, two monkeys were treated with AAV9 containing the EGFP transgene under the control of RE 2 (SEQ ID NO:2), and two monkeys were treated with AAV9 containing the EGFP transgene under the control of RE 2 (SEQ ID NO:2) and also containing a microRNA binding site (SEQ ID NO:7) located between the EGFP coding region and the polyA tail. The AAV9 vector was diluted in PBS and then administered to the animals by three intracerebral injections (2 μL each) into the hippocampus / entorhinal cortex of each cerebral hemisphere - a total of 6 injection sites per animal. The two animals treated with the AAV9 vector containing EF1alpha-EGFP each received a total dose of 5.8E+11 gc / animal, the two animals treated with the AAV9 vector containing RE 2-EGFP each received a total dose of 3.0E+11 gc / animal, and the two animals treated with the AAV9 vector containing RE 2+m1-EGFP each received a total dose of 2.3E+11 gc / animal.

[0478] Immunohistochemistry was used to evaluate parvalbumin (PV) selective expression. At autopsy 28 days after dosing, tissue sections were collected from various regions of the brain. Floating marmoset brain sections (35 μm) were fixed in 4% paraformaldehyde, blocked with buffer (PBS, 3% BSA, 3% donkey serum, 0.3% Triton-X 100, 0.2% Tween-20), and then stained with anti-GFP (Abcam ab290) followed by a secondary antibody conjugated to Alexa-488 (Thermo A21206). This was followed by an anti-PV antibody (Swant) and a secondary antibody conjugated to Alexa-647 (Thermo A31571) and 4’,6-diamidino-2-phenylindole (DAPI). The sections were mounted and imaged using a PerkinElmer Vectra3.

[0479] The results are shown in Figure 9 A-F and Figure 10 A-L.

[0480] Example 10

[0481] eTF SCN1A Biodistribution

[0482] The aim of this study was to compare eTF when administered at a dose of 4.8E+13 by unilateral intracerebroventricular (ICV) injection SCN1ABiodistribution in the central nervous system (CNS) of young cynomolgus monkeys. Each animal was injected with AAV9 containing an expression cassette encoding eTF SCN1A (RE GABA -eTF SCN1A ) under the control of a GABA-selective regulatory element. The AAV9 particles were formulated in PBS + 0.001% pluronic acid and administered at a dose of 4.8E+13 or 8E+13 vg / animal. A 2 ml volume of the formulated virus particles was administered to each animal. The study design is shown in Table 19.

[0483] As shown in Table 19, twenty-four-month-old cynomolgus monkeys were grouped. Before the start of the study, the neutralizing antibody titer levels against AAV9 in blood samples from the animals were detected using the above NAb titration. Animals with low or negative antibody results were selected for the study. The samples were administered by ICV injection using standard surgical procedures. The thawed dosing material was briefly stored on wet ice and warmed to room temperature immediately before dosing. The animals were anesthetized, surgically prepared, and fixed in an MRI-compatible stereotaxic frame (Kopf). Baseline MRI was performed to establish the target coordinates. An incision was made and a hole was drilled through the skull above the target location. A 3 mL BD syringe attached to a 36” microfiltration extension kit was filled with the sample and placed in an infusion pump. The extension line was prepared. The dura mater was opened and the dosing needle was advanced to a depth of 13.0 to 18.1 mm from the pia mater. Contrast agent injection and fluoroscopy were used to confirm the placement of the spinal needle into the right lateral ventricle. Before attaching the prepared extension line and syringe, a 3.0” 22g Quinke BD spinal Huber-point needle was filled with contrast agent to determine the placement. The pump was set at 0.1 mL / min for 19 to 20 minutes. After dosing, the buffer was pushed by hand to clear the extension line. After the infusion was completed, the needle was left in place for 1 to 2 minutes and then removed. The vehicle and the test article were administered once on Day 1, and the subjects were maintained for a recovery period of 27 or 29 days.

[0484] Table 19. Biodistribution study design

[0485]

[0486] After dosing, the animals were routinely monitored throughout the study duration and blood samples were taken regularly. The administration of eTF SCN1A was not associated with any unexpected deaths, clinical findings, or macroscopic observations. The animals treated with AAV9-RE GABA -eTF SCN1A remained alive until the ...

Claims

1. A polynucleotide comprising a nucleic acid sequence containing a regulatory element operably linked to a nucleic acid sequence encoding an engineered transcription factor to form an expression cassette, wherein the engineered transcription factor consists of the amino acid sequence of SEQ ID NO: 127 and the regulatory element consists of the nucleotide sequence of SEQ ID NO: 2, and wherein the engineered transcription factor increases the expression of the SCN1A gene in cells.

2. The polynucleotide according to claim 1, wherein the expression cassette further comprises a microRNA binding site that inhibits the expression of the engineered transcription factor in excitatory neurons.

3. The polynucleotide according to claim 2, wherein the microRNA binding site comprises the sequence of SEQ ID NO: 9, 11 or 13.

4. The polynucleotide according to claim 3, wherein the microRNA binding site comprises SEQ ID NO: 9 and SEQ ID NO:

11.

5. The polynucleotide according to claim 3, wherein the microRNA binding site comprises at least 6 microRNA binding sites.

6. The polynucleotide according to claim 3, wherein the microRNA binding site comprises a sequence having at least 90% identity with SEQ ID NO: 7, 14 or 15.

7. The polynucleotide according to claim 3, wherein the microRNA binding site comprises SEQ ID NO:

7.

8. The polynucleotide according to claim 1, wherein the expression cassette consists of the nucleotide sequence of SEQ ID NO:

70.

9. The polynucleotide according to claim 1, wherein the expression cassette consists of the nucleotide sequence of SEQ ID NO:

71.

10. An expression vector comprising the polynucleotide according to any one of claims 1-9.

11. The expression vector according to claim 10, wherein the expression vector is a viral vector.

12. The expression vector according to claim 11, wherein the viral vector is an adeno-associated virus (AAV).

13. The expression vector according to claim 12, wherein the AAV virus has a serotype selected from the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, rh10, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, ovine AAV, and hybrids of any one of them.

14. The expression vector according to claim 12, wherein the expression cassette further comprises a 5' AAV inverted terminal repeat (ITR) sequence and a 3' AAV ITR sequence.

15. The expression vector according to claim 14, wherein the 5' AAV ITR sequence and the 3' AAV ITR sequence are each independently an ITR sequence derived from AAV1, AAV2, AAV5, AAV8 or AAV9.

16. A composition comprising (i) a polynucleotide according to any one of claims 1-9 and (ii) one or more pharmaceutically acceptable carriers.

17. A cell comprising a polynucleotide according to any one of claims 1-9.

18. The cell according to claim 17, further comprising an AAV rep gene, an AAV cap gene, an adenovirus helper gene, or a combination thereof.

19. The cell according to claim 18, wherein the cell is a 293 cell, an A549 cell, or a HeLa cell.

20. A method for manufacturing an adeno-associated virus (AAV) vector, comprising: (a) Culturing the cell according to claim 18 under conditions for producing recombinant AAV virions; (b) Harvesting the host cell culture; and (c) Purifying the AAV virions produced by the host cell.

21. The method according to claim 20, wherein the purification comprises equilibrium centrifugation; flow-through anion exchange filtration; tangential flow filtration for concentrating rAAV virions; capturing rAAV by hydroxyapatite chromatography; heat inactivation of helper virus; capturing rAAV by hydrophobic interaction chromatography; buffer exchange by size exclusion chromatography; nanofiltration; and capturing rAAV by anion exchange chromatography, cation exchange chromatography, or affinity chromatography.

22. Use of a polynucleotide according to any one of claims 1-9 in the preparation of a medicament for treating a subject suffering from a central nervous system disorder, wherein the central nervous system disorder is epilepsy or Dravet syndrome associated with SCN1A haploinsufficiency.

23. The use according to claim 22, wherein the subject is a mammal.

24. The use according to claim 23, wherein the mammal is a human.

25. The use according to any one of claims 22-24, wherein the central nervous system disorder is epilepsy associated with SCN1A haploinsufficiency.

26. The use according to any one of claims 22-24, wherein the central nervous system disorder is Dravet syndrome.

27. A composition comprising (i) an expression vector according to claim 10 and (ii) one or more pharmaceutically acceptable carriers.

28. A cell comprising an expression vector according to claim 10.

29. Use of the expression vector according to claim 10 in the preparation of a medicament for treating a subject suffering from a central nervous system disorder, wherein the central nervous system disorder is epilepsy or Dravet syndrome associated with SCN1A haploinsufficiency.

30. The use according to claim 29, wherein the subject is a mammal.

31. The use according to claim 30, wherein the mammal is a human.

32. The use according to claim 31, wherein the central nervous system disorder is epilepsy associated with SCN1A haploinsufficiency.

33. The use according to claim 31, wherein the central nervous system disorder is Dravet syndrome.

Citation Information

Patent Citations

  • Poly zinc finger proteins with improved linkers

    US6479626B1

  • Methods for generating high titer helper-free preparations of released recombinant AAV vectors

    US6566118B1

  • Poly zinc finger proteins with improved linkers

    US6903185B2

  • Methods for generating high titer helper-free preparations of released recombinant AAV vectors

    US6989264B2

  • Nucleic acid encoding poly-zinc finger proteins with improved linkers

    US7153949B2