Application of rice plant height gene LOC_Os03g64415 in rice plant type improvement

Abstract

The application discloses application of a rice plant height gene LOC_Os03g64415 in rice plant type improvement and belongs to the field of genetic breeding. The nucleotide sequence of the gene is shown in SEQ ID NO. 1; the CDS sequence corresponding to the gene is shown in SEQ ID NO. 2, or is generated by adding, substituting or deleting one or more bases of the sequence shown in SEQ ID NO. 2, and encodes a nucleotide sequence for controlling rice plant height; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO. 3, or is an amino acid sequence with equivalent functions formed by substitution, deletion or addition of one or more amino acid residues. The gene is reduced in expression or is functionally deficient in mutation to realize rice plant type improvement including reduction in plant height and increase in tiller number, and different allelic genotypes of the gene will have wide application prospects in optimization of rice plant type and shaping of ideal plant type.

Description

Technical Field

[0001] This invention belongs to the field of genetic breeding, specifically involving the application of the rice plant height gene LOC_Os03g64415 in the improvement of rice plant type. Background Technology

[0002] Developing high-yielding and stable-yielding rice varieties (Oryza sativa L.) is a crucial guarantee for my country's food security. Analysis of modern rice variety breeding reveals that it primarily involves breeding to cultivate ideal plant architecture, which efficiently aggregates superior allelic forms of key genes for important agronomic traits related to ideal plant architecture to form super varieties. Among these, large panicles, appropriate tillering, plant height, and robust stems with lodging resistance are key to ideal plant architecture. Rice plant height directly affects the overall plant morphology, total biomass, lodging resistance, and harvest index, making it the primary phenotype to focus on and cultivate for ideal plant architecture.

[0003] The promotion of dwarfing and semi-dwarf rice varieties in the 1960s revolutionized rice breeding, making rice plant height research a crucial topic in rice biology and plant type improvement. While some progress has been made in QTL cloning for plant height, the vast majority of dwarfing genes are obtained through cloning abnormal dwarf mutants (small-grained dwarf, multi-tillering dwarf). Due to their abnormal characteristics, these mutants cannot be practically utilized in breeding. Only a few plant height-related genes have been applied to rice breeding, such as DEP1, widely used in japonica rice, and sd1, widely used in indica rice. However, the sd1 gene also has its drawbacks. While reducing plant height, minimizing lodging-induced yield reduction, and increasing yield per unit area, it leads to decreased nitrogen fertilizer utilization, making its yield-increasing effect highly dependent on chemical fertilizers. Therefore, truly ideal rice plant height genes for breeding still need to be further discovered and analyzed through populations derived from superior rice varieties to fill the current gaps in plant height genes and provide more gene options for ideal rice breeding.

[0004] Following the Green Revolution, three-line hybrid rice, and two-line hybrid rice, shaping ideal plant architecture in rice and utilizing the heterosis of indica and japonica varieties are considered crucial breakthroughs for further increasing rice yield. Academician Li Jiayang and others proposed a new model of "molecular design breeding of super hybrid rice," which involves cultivating super-ideal indica-japonica subspecies hybrids with ideal plant architecture and excellent qualities. Subsequently, several pleiotropic genes related to plant height were cloned in different indica-japonica hybrid populations, achieving excellent application results in production. These include the ideal plant architecture gene IPA1, and the pleiotropic control gene Ghd7 for plant height and heading date. This confirms that ideal plant architecture and the utilization of heterosis in indica-japonica varieties are inseparable from plant height research. Furthermore, the analysis of new plant height genes in indica-japonica derived populations can safeguard further yield increases and optimize plant architecture in rice. Therefore, finding new QTL and PH heterosis loci in superior rice variety derived populations is of great significance for breeding ideal plant architecture.

[0005] The LOC_Os03g64415 gene of this invention is of great significance in the regulation of rice plant height and the breeding of ideal plant type. Summary of the Invention

[0006] The purpose of this invention is to provide the application of the rice plant height gene LOC_Os03g64415 in the improvement of rice plant architecture.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] This invention provides the application of the rice plant height gene LOC_Os03g64415 in rice plant architecture improvement.

[0009] The protein encoded by the rice plant height gene LOC_Os03g64415 has the amino acid sequence shown in SEQ ID NO.3; or an amino acid sequence with equivalent function formed by substitution, deletion or addition of one or more amino acid residues from the amino acid sequence shown in SEQ ID NO.3.

[0010] Furthermore, the rice plant height gene LOC_Os03g64415 has a CDS coding sequence as shown in SEQ ID NO.2; or is generated by adding, substituting, or deleting one or more bases from the nucleotide sequence shown in SEQ ID NO.2, and encodes a nucleotide sequence that controls rice plant height.

[0011] Furthermore, the nucleotide sequence of the rice plant height gene LOC_Os03g64415 is shown in SEQ ID NO.1.

[0012] The aforementioned rice plant architecture improvement includes reducing rice plant height and increasing the number of tillers. Specifically, this can be achieved by reducing the expression of the LOC_Os03g64415 gene or by causing a loss-of-function mutation in the LOC_Os03g64415 gene.

[0013] In some implementations, rice plant architecture improvement is achieved by knocking out the LOC_Os03g64415 gene. The LOC_Os03g64415 gene can be knocked out using a CRISPR / Cas9 system. The preferred sequences for sgRNA target sites 1 and 2 of the LOC_Os03g64415 gene knockout are:

[0014] The nucleotide sequence of sgRNA target 1 (designed on the sense strand) is: CTCTCTCCCGAAGGCTGCTACGG (SEQ ID NO.4).

[0015] The nucleotide sequence of target 2 of the sgRNA (designed on the antisense strand) is: CCGGAGGGGCCAGATCTGGCCGG (SEQ ID NO.5).

[0016] The preferred primer pair for detecting transgenic plants in which the LOC_Os03g64415 gene has been knocked out using the CRISPR / Cas9 system is:

[0017] The nucleotide sequence of primer JC-F is: AGTCTTCGATATTCCCGTCCGTG (SEQ ID NO. 6).

[0018] The nucleotide sequence of primer JC-R is: TCTTGCTCGCCGAAGTCGCTC (SEQ ID NO.7).

[0019] Compared with the existing technology, the beneficial results of this invention are as follows:

[0020] (1) This invention provides a method for breeding dwarf rice varieties by targeting the rice plant type-related gene LOC_Os03g64415 through gene editing to obtain stable dwarf rice varieties; (2) The rice plant height trait gene of this invention has a good regulatory effect. Its gene knockout line can significantly reduce rice plant height and increase tiller number. Different allelic genotypes of this gene will have broad application prospects in optimizing rice plant type and shaping ideal plant type. Attached Figure Description

[0021] Figure 1 Sequence analysis and gene editing target design of the rice LOC_Os03g64415 gene. Blue boxes represent exons, blue lines represent introns, and white boxes represent untranslated regions. Two Cas9 recognition sites are shown in the figure, with sequences CTCTCTCCCGAAGGCTGCTACGG and CCGGAGGGGCCAGATCTGGCCGG, respectively.

[0022] Figure 2 .Cas9-mediated acquisition of different mutant genotypes of LOC_Os03g64415. WT is the wild-type sequence, and the Arabic numerals indicate the number of deleted or added bases (a "-" before the number indicates a base deletion, and a "+" before the number indicates a base addition).

[0023] Figure 3 Phenotypic investigation of different mutant genotypes of LOC_Os03g64415 mediated by Cas9. Whole plant morphology was examined. WT was the wild-type control plant ZH11, and qph-3.1 was the representative plant of the LOC_Os03g64415 mutant line (qph-3.1-crispr1).

[0024] Figure 4 Phenotypic analysis of different mutant genotypes of LOC_Os03g64415 mediated by Cas9. Ear morphology analysis included: ear (left) and internode below the ear (right). WT represents the ZH11 wild-type control plant, and qph-3.1 represents the LOC_Os03g64415 mutant line (qph-3.1-crispr1).

[0025] Figure 5 Phenotypic investigation of different mutant genotypes of LOC_Os03g64415 mediated by Cas9. Internode length morphology was examined. WT represents the ZH11 wild-type control plant, and qph-3.1 represents the representative plant of the LOC_Os03g64415 mutant line (qph-3.1-crispr1). D2 represents the second-to-last internode, D3 represents the third-to-last internode, and D4 represents the fourth-to-last internode.

[0026] Figure 6 Statistical analysis of plant height and tiller number in different mutant genotypes of .LOC_Os03g64415. WT1, WT2, and WT3 were wild-type control plants of ZH11, while qph-3.1-crispr1, qph-3.1-crispr2, and qph-3.1-crispr3 were mutant lines. Three asterisks indicate p < 0.001, meaning the difference was highly significant. Detailed Implementation

[0027] The following embodiments are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments are commercially available products.

[0028] Example 1: Cloning of the rice LOC_Os03g64415 gene

[0029] Based on the LOC_Os03g64415 gene sequence information included in the Rice Genome Annotation Project (http: / / rice.uga.edu / index.shtml), full-length primer sequences F: ATGTCGTCGCCACCCGGCC (SEQ ID NO.8) and R: GCAACAGAGCATTTGAATTCCAATT (SEQ ID NO.9) were designed. Using Nipponbare genomic cDNA as a template, the full-length CDS sequence of LOC_Os03g64415 was amplified, and sequencing showed that its sequence is shown in SEQ ID NO.2.

[0030] Example 2: Verification of the plant height regulation role of the LOC_Os03g64415 gene in rice materials

[0031] CRISPER-Cas9 gene knockout validation was performed on LOC_Os03g64415. sgRNA target sites were designed using the CRISPERdirect website, with a GC content of at least 40% (50%-70%). The selected 20bp target sequences were ligated to the 5' end of the sgRNA sequence. Finally, two target site sequences were designed on the first exon of LOC_Os03g64415, with PAM sequences of NGG (...). Figure 1 ).

[0032] Based on the target site, a Crisper-cas9 gene knockout vector was constructed using LOC_Os03g64415. The knockout vector was transformed into Agrobacterium tumefaciens via electroporation. T0 plants were obtained by transforming the recipient material ZH11 (Zhonghua 11) with Agrobacterium tumefaciens strain, and T1 positive plants were obtained by planting T0 positive plants. Genomic DNA was extracted from the transformed plants, and PCR amplification was performed using primers JC-F: AGTCTTCGATATTCCCGTCCGTG and JC-R: TCTTGCTCGCCGAAGTCGCTC. Sequencing was performed, and the sequence was compared with the reference sequence (SEQ ID NO.2) to identify the editing status of the transgenic plants. Specifically, the LOC_Os03g64415 gene knockout yielded two 1-base insertion mutant materials, qph-3.1-crispr1 and qph-3.1-crispr3, and one 4-base deletion mutant material, qph-3.1-crispr2, for a total of three homozygous mutant lines. Figure 2 Compared with the ZH11 control material, the LOC_Os03g64415 gene knockout mutant material had a greater plant height (). Figure 3 ), ear length ( Figure 4 ), second-to-last intersegment length ( Figure 5 ), length of the third intersegment ( Figure 5 All were significantly reduced. Furthermore, the LOC_Os03g64415 gene knockout mutant material was found to have an extremely delayed growth period, an extremely low seed setting rate, and a significantly increased tillering rate. Figure 4 and Figure 6 These results indicate that LOC_Os03g64415 regulates rice plant height and has potential value in creating dwarf rice materials. Furthermore, LOC_Os03g64415 is a pleiotropic gene associated with plant height, growth period, seed setting rate, and tillering; its alleles in the population have potential value in shaping ideal plant architecture and creating sterile lines, providing selectable manipulation targets.

[0033] Although the present invention has been described above with reference to specific embodiments, the present invention is not limited to these specific embodiments. Those skilled in the art should understand that any modifications and variations of form and detail made based on these embodiments, without exceeding the scope of the claims, are within the scope of protection of the present invention. Furthermore, some terminology used in the specification and claims of this invention is not restrictive but merely for ease of description. sequence list <110> Wuhan University <120> Application of rice plant height gene LOC_Os03g64415 in rice plant architecture improvement <160> 9 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2668 <212> DNA <213> Oryza sativa <400> 1 atgtcgtcgc cacccggccg ccgtcaccgc ccgctggcct ctcgccggag gggccagatc 60 tggccggcgc gacaaccccc gccgtcaagg cgcgccggtg tccccgccgt agcagccttc 120 gggagagaga gagcctcgcc accgccgtcc ctgcagccgc ccggcttgcc ggccagccgc 180 tcgtgcggcg atgaggcgga gggaggagag agggggtggc ggcggtgggt tgtggggagg 240 cgccgtccgg gtcgcctagg gacggggagcg acacggacgg gaatatcgaa gacttatgtt 300 tctagtgttg ttgctaagac tcttgcattg caggagctta aaggaaacat tcgagtcttc 360 tgtagggtgc gacctttatt gccaaatgaa tcaggagctg ttgctttatcc aaagagtgga 420 gaaacttag gtcgtggcat tgagttgaca cataatggta tagtaacact tgctgcgatc 480 cttctgtgtt ttttactttc atatctgcac ctcttggaaa attcattcca gtaattcttc 540 atttttctt acaggtcaaa tgtatttctt cacatttgac aaagtatttg agcagtcgac 600 atcacaagaa gatgtgttca ttgagatttc ccatctcgtc cagagcgccc ttgatggcta 660 720 gagtgggaaa aaagtttaag tccacaaaag ttagtatcta taattcgtgc tagctaatgt 780 gaaaaact caggtgtgca tatttgcata tggccaaact ggctcgggta aaacatacac 840 aatgatggga aatccagaat tacatgacca gaaggatta attccgagat cacttgaaca 900 aattttccaa acaagccagg ctcttatttc acagggatgg aaataataaga tgcaggtgag 960 ttcttaccca cttcaattgg tcagtttgtt tgagctaaca aaggtgcagg ctttctatag 1020 ttgtaactct catgtttacc tttgaacatc taggcatcta tgttggaaat ctacaatgaa 1080 gccatatgtg atctgctagc cactaatcac acaactattc aagatggtgg cgcttcaaag 1140 tacagtatca agcatgatgc caatggtaat acccatgtat cagatctcat aatcgtcgat 1200 gtgttgagta tcaatgaagt ttcttctc ctcaagcggg ctgctcagag caggttgcac 1260 tctagttctt ctcatcagtt tttcaaatct tcaattaaat ttgtaagaac agaagaacag 1320 aaagaaggca aagaacctgg atatagttc tgtgagcaca tagaaacata atcaggtagt 1380 cataaggcct gaagtgaagt tagaagcata atttcaatga aatgtaataa gtcaaaaact 1440 ggcattatta tgactccatt ttcacaatca tggtatcaac atttgtgcct tacatactgt 1500 tgtgctataa aatgcacgat aatttagctg aattctccaa gaaagaaaat ttgctgccat 1560 acgttgtaaa cagctttatt attatctgc agatctgttg gaagaacaca gatgaacgaa 1620 gaatcatcta gaagtcattg tgtgttcacg cttcgattttt ttggtgtcaa tgaggtatgc 1680 gatatcttct aatgtaggtc ttgctaatgc ctggtaattt tttgtagtca tcatttggat 1740 tgttttctct acagggaaca gaccagcagg tgcaaggagt gctcaatcta atcgatcttg 1800 ccggcagtga gcggcttaac aagagcggtg ccaccggaga taggctaaag gagacacagg 1860 taatttgcta tttcacacct cagtttttgt tgcatctaag gtgtatacat ggtacaatgc 1920 gtaaccactg ttgtgatgta aatttgctat ttaggctatt aataaaagcc tctcgtgctt 1980 gagcgatgta atcttctcca ttgcaaagaa agaggagcac gttccattca ggaactcaaa 2040 attaacgtac ctgctacagg taaattctaa gcactcagct aagaatatct gcaaacttgg 2100 tatggtttcc atggttataa tgtgtgaatg atttgttcc ccttggacaa agccatgcct 2160 tggaggagac tcgaagacac ttatgtttgt gaatctgtct ccagaggtgt cgtctacagg 2220 ggagtcaatt tgctcgctac ggttcgcagc acgggtgaac tcgtgcgaga ttggcatccc 2280 tcgtcgtcaa acccaagtgc gtagcttggc gcaaggatga gttggcttgg acaagatgaa 2340 tgtccatgac taattgtatt tgtgtgttgt ttgagggatg caatggatca tttgcatccc 2400 ctccgtgtgt tgggcatggg catatttgct tagagggtgt gtataatatt ctgatttggc 2460 atgtggcttt gttgattgta ggagcatcgc attgcattac agatagtagt atttaatttg 2520 tggctgcagc actgtgcagt ggtagtaaca agatgtgagg ttggttgtat tttattggag 2580 aggtgccctg tgttgtgttg ggctggcttt gtttggatga agaagacaga ctagtaattg 2640 gaattcaaat gctctgttgc tttttagt 2668 <210> 2 <211> 1389 <212> DNA <213> Oryza sativa <400> 2 atgtcgtcgc caccggccg ccgtcaccgc ccgctggcct ctcgccggag gggccagatc 60 tggccggcgc gacaaccccc gccgtcaagg cgcgccggtg tccccgccgt agcagccttc 120 gggagagaga gagcctcgcc accgccgtcc ctgcagccgc ccggcttgcc ggccagccgc 180 tcgtgcggcg atgaggcgga gggaggagag agggggtggc ggcggtgggt tgtgggggg 240 cgccgtccgg gtcgcctagg gacgggagcg acacggacgg gaatatcgaa gacttatgtt 300 tctagtgttg ttgctaagac tcttgcattg caggagctta aaggaaacat tcgagtcttc 360 tgtagggtgc gacctttatt gccaaatgaa tcaggagctg ttgcttatcc aaagagtgga 420 gaaaacttag gtcgtggcat tgagttgaca cataatggtc aaatgtattt cttcacattt 480 gacaaagtat ttgagcagtc gacatcacaa gaagatgtgt tcattgagat ttcccatctc 540 gtccagagcg cccttgatgg ctacaaggtg tgcatatttg catatggcca aactggctcg 600 ggtaaaacat acacaatgat gggaaatcca gatttacatg accagaaagg atttattccg 660 agatcacttg aacaatttt ccaacaagc caggctctta ttcacaggg atggaatt 720 aagatgcagg catctatgtt ggaatctac atgaagcca tatgtgat gctagccact 780 aatcacacaa ctattcaaga tggtggcgct tcaaagtaca gtatcaagca tgatgccaat 840 ggtaataccc atgtatcaga tctcataatc gtcgatgtgt tgagtatca tgaagttctct 900 tctctcctca agcgggctgc tcagagcaga tctgttggaa gaacacagat gaacgagaa 960 tcatctagaa gtcattgtgt gttcacgctt cgattttg gtgtcaatga gggaacagac 1020 cagcaggtgc aaggagtgct caatctaatc gatcttgccg gcagtgagcg gcttaacaag 1080 agcggtgcca ccggagatag gctaaaggag acacaggcta ttataaag cctctcgtgc 1140 ttgagcgatg taatctctc cattgcaag aagaggagc acgttccatt caggaactca 1200 aaattaacgt acctgctaca gccatgcctt ggaggact cgagacact tatgtttgtg 1260 aatctgtctc cagaggtgtc gtctacaggg gagtcaattt gctcgctacg gttcgcagca 1320 cgggtgaact cgtgcgagat tggcatccct cgtcgtcaaa cccaagtgcg tagcttggcg 1380 rubber band 1389 <210> 3 <211> 462 <212> PRT <213> Rice <400> 3 Met Ser Ser Pro Pro Gly Arg Arg His Arg Pro Leu Ala Ser Arg Arg 1 5 10 15 Arg Gly Gln Ile Trp Pro Ala Arg Gln Pro Pro Pro Ser Arg Arg Ala 20 25 30 Gly Val Pro Ala Val Ala Ala Phe Gly Arg Glu Arg Ala Ser Pro Pro 35 40 45 Pro Ser Leu Gln Pro Pro Gly Leu Pro Ala Ser Arg Ser Cys Gly Asp 50 55 60 Glu Ala Glu Gly Gly Glu Arg Gly Trp Arg Arg Trp Val Val Gly Arg 65 70 75 80 Arg Arg Pro Gly Arg Leu Gly Thr Gly Ala Thr Arg Thr Gly Ile Ser 85 90 95 Lys Thr Tyr Val Ser Ser Val Val Ala Lys Thr Leu Ala Leu Gln Glu 100 105 110 Leu Lys Gly Asn Ile Arg Val Phe Cys Arg Val Arg Pro Leu Leu Pro 115 120 125 Asn Glu Ser Gly Ala Val Ala Tyr Pro Lys Ser Gly Glu Asn Leu Gly 130 135 140 Arg Gly Ile Glu Leu Thr His Asn Gly Gln Met Tyr Phe Phe Thr Phe 145 150 155 160 Asp Lys Val Phe Glu Gln Ser Thr Ser Gln Glu Asp Val Phe Ile Glu 165 170 175 Ile Ser His Leu Val Gln Ser Ala Leu Asp Gly Tyr Lys Val Cys Ile 180 185 190 Phe Ala Tyr Gly Gln Thr Gly Ser Gly Lys Thr Tyr Thr Met Met Gly 195 200 205 Asn Pro Glu Leu His Asp Gln Lys Gly Leu Ile Pro Arg Ser Leu Glu 210 215 220 Gln Ile Phe Gln Thr Ser Gln Ala Leu Ile Ser Gln Gly Trp Lys Tyr 225 230 235 240 Lys Met Gln Ala Ser Met Leu Glu Ile Tyr Asn Glu Ala Ile Cys Asp 245 250 255 Leu Leu Ala Thr Asn His Thr Thr Ile Gln Asp Gly Gly Ala Ser Lys 260 265 270 Tyr Ser Ile Lys His Asp Ala Asn Gly Asn Thr His Val Ser Asp Leu 275 280 285 Ile Ile Val Asp Val Leu Ser Ile Asn Glu Val Ser Ser Leu Leu Lys 290 295 300 Arg Ala Ala Gln Ser Arg Ser Val Gly Arg Thr Gln Met Asn Glu Glu 305 310 315 320 Ser Ser Arg Ser His Cys Val Phe Thr Leu Arg Phe Phe Gly Val Asn 325 330 335 Glu Gly Thr Asp Gln Gln Val Gln Gly Val Leu Asn Leu Ile Asp Leu 340 345 350 Ala Gly Ser Glu Arg Leu Asn Lys Ser Gly Ala Thr Gly Asp Arg Leu 355 360 365 Lys Glu Thr Gln Ala Ile Asn Lys Ser Leu Ser Cys Leu Ser Asp Val 370 375 380 Ile Phe Ser Ile Ala Lys Lys Glu Glu His Val Pro Phe Arg Asn Ser 385 390 395 400 Lys Leu Thr Tyr Leu Leu Gln Pro Cys Leu Gly Gly Asp Ser Lys Thr 405 410 415 Leu Met Phe Val Asn Leu Ser Pro Glu Val Ser Ser Thr Gly Glu Ser 420 425 430 Ile Cys Ser Leu Arg Phe Ala Ala Arg Val Asn Ser Cys Glu Ile Gly 435 440 445 Ile Pro Arg Arg Gln Thr Gln Val Arg Ser Leu Ala Gln Gly 450 455 460 <210> 4 <211> twenty three <212> DNA <213> Artificial Sequence <400> 4 ctctctcccg aaggctgcta cgg 23 <210> 5 <211> twenty three <212> DNA <213> Artificial Sequence <400> 5 ccggaggggc cagatctggc cgg 23 <210> 6 <211> twenty three <212> DNA <213> Artificial Sequence <400> 6 agtcttcgat attcccgtcc gtg 23 <210> 7 <211> twenty one <212> DNA <213> Artificial Sequence <400> 7 tcttgctcgc cgaagtcgct c 21 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <400> 8 atgtcgtcgc cacccggcc 19 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <400> 9 gcaacagagc atttgaattc caatt 25

Claims

1. The application of the rice plant height gene LOC_Os03g64415 in rice plant architecture improvement, characterized by: The amino acid sequence of the protein encoded by the rice plant height gene LOC_Os03g64415 is shown in SEQ ID NO.3; The rice plant type improvement mentioned above refers to reducing rice plant height and increasing the number of tillers; The nucleotide sequence of the rice plant height gene LOC_Os03g64415 is shown in SEQ ID NO.1; Rice plant architecture can be improved by reducing the expression of the LOC_Os03g64415 gene or by causing a loss-of-function mutation in the LOC_Os03g64415 gene. Rice plant architecture was improved by knocking out the LOC_Os03g64415 gene; The LOC_Os03g64415 gene was knocked out using the CRISPR / Cas9 system. The sequences of sgRNA target sites 1 and 2 for knocking out the LOC_Os03g64415 gene are as follows: sgRNA target 1: CTCTCTCCCGAAGGCTGCTACGG, sgRNA target 2: CCGGAGGGGCCAGATCTGGCCGG; The primer pair for detecting transgenic plants with the LOC_Os03g64415 gene knocked out using the CRISPR / Cas9 system is: Primer JC-F: AGTCTTTCGATATTCCCGTCCGTG, Primer JC-R: TCTTGCTCGCCGAAGTCGCTC.

Images