KIF11 gene mutant and its application

Abstract

The present invention belongs to the field of gene technology, and in particular to KIF11 gene mutants and applications. Specifically disclosed is a nucleic acid comprising the following target fragment, wherein the target fragment has a c.2680C>T mutation compared with the wild-type KIF11 gene. A polypeptide, wherein the polypeptide has a p.Gln894Ter mutation compared with the wild-type KIF11. A gene mutation, wherein the gene mutation has a c.2680C>T mutation compared with the wild-type KIF11 gene. Application of a biological model containing the aforementioned mutation in the preparation of a screening preparation for microcephaly, without chorioretinopathy, lymphedema, or mental retardation. A screening reagent for microcephaly, without chorioretinopathy, lymphedema, or mental retardation, comprising a reagent capable of detecting KIF11 gene mutants. The present invention provides new mutation sites associated with microcephaly, without chorioretinopathy, lymphedema, or mental retardation, provides a new scheme for the diagnosis and treatment of the disease, and also provides related drugs capable of preventing and treating the disease.

Description

Technical Field

[0001] The invention belongs to the field of gene technology, and in particular relates to a KIF11 gene mutant and an application thereof. Background Art

[0002] KIF11—kinesin family member 11 (KIF11), also known as the spindle motor protein encoded by the kinesin Eg5 (kinesin-5) gene, is a member of the cell division kinesin family and is involved in the formation of the bipolar mitotic spindle during cell division. Studies have found that this type of motor protein is widely expressed and plays an important role in cell division and intracellular transport. The localization of KIF11 in cells varies from species to species. The human KIF11 gene (Chromosome 10:94,353,043-94,415,150) is located at 10q24.1, with a total genome length of 6216kb, containing 22 exons, encoding a KIF11 protein consisting of a 1057 amino acid sequence, and its structure is conserved among multiple species. KIF11 is mainly composed of a motor domain, an internal stem domain, and a tail domain. The 320 amino acid residues at the N-terminus of its monomer are the transport domain, which obtains energy by breaking down ATP and moves along microtubules. The ATPase activity and microtubule binding properties are both achieved by the motor domain of KIF11. The secondary structure consists of 8 positive β segments, 3 side β segments and 6 α helical structures. The intracellular KIF11 protein forms a bipolar homotetramer complex through the interaction between the stem domains, thereby positioning two motor domains at each end of the tetramer. The tetramer can move toward the positive ends of two antiparallel microtubules at the same time. This movement pushes the antiparallel microtubules in opposite directions and promotes cell division. However, the non-motor stem and tail domains are also necessary for the protein to cross-link microtubules and slide to separate antiparallel microtubules. In addition, the tail domain of KIF11 helps its positioning during mitosis and enhances its binding to microtubules. Studies have confirmed that its biological function is mainly to participate in cell mitosis. Its mechanism is that it is connected to the central region of the microtubule in reverse parallel with the structural characteristics of the tetramer. Due to its ATPase characteristics, it decomposes ATP to obtain energy and moves along the microtubule toward the positive pole. The reverse force generated by the movement pushes the spindle to separate to the two poles, and then the chromatids are pulled to separate to the two poles through the power microtubules, finally completing the cell mitosis.

[0003] One of the physiological functions of KIF11 is to complete cell mitosis. Studies have shown that it is involved in the occurrence and development of breast cancer, renal clear cell carcinoma, lung cancer, gastric cancer, intestinal cancer, liver cancer, uterine cancer, ovarian cancer, etc. In the past few years, the motor proteins involved in mitosis (kinesin Eg5 and centromere-associated protein CENPE) have become potential targets for cancer drug development.

[0004] Studies have shown that KIF11 gene mutations are associated with MCLMR, and the mutations that have been identified include nonsense, missense, frameshift, and splice site mutations. Mutations can make transcribed RNA unstable, directly affect the high conservation of genes, cause premature termination of encoded proteins, and affect the normal translation of proteins, causing disease. Most pathogenic variants associated with microcephaly will lead to reduced protein synthesis or the production of partially or completely nonfunctional short proteins.

[0005] Microcephaly with or without chorioretinopathy, lymphedema, or mental retardation (MCLMR, OMIM: 152950) is a disease inherited in an autosomal dominant manner. The main clinical features are microcephaly, obvious facial features, including tissue hypertrophy, protruding ears, wide supraorbital ridges, bilateral ptosis and eyelid hypertrophy, upturned palpebral fissures, thick epicanthus, wide nose bridge, blunt and wide nose tip with anteverted nostrils, round face, long philtrum, thick protruding lips, micrognathia and pointed chin (Lim-wongse et al., 1999; Opitz, 1986; Vasudevan et al., 2005), nystagmus, hearing loss, decreased vision, myopia, hyperopia, astigmatism, corneal opacity, cataract, chorioretinopathy, hyperactivity, mild to moderate mental retardation, etc. Some patients show lower palpebral fissures, etc. The phenotype of this disease is highly variable. Those without lymphedema are diagnosed as CDMMR (chorioretinal dysplasia, microcephaly and mental retardation). Studies have found that heterozygous mutations in the kinesin family member 11 (KIF11) gene were found in patients with both diseases, MCLMR and CDMMR (P Ostergaard et al., 2012; Hazan et al., 2012; Jones et al., 2013), indicating that this gene mutation is related to MCLMR. Gabriela E Jones et al. cohort studies have shown that among MCLMR patients, 86% have microcephaly, 78% have eye abnormalities consistent with the diagnosis, 46% have lymphedema, 73% have mild-moderate learning difficulties, 8% have epilepsy, and 8% have heart abnormalities.

[0006] Microcephaly refers to an occipital-frontal head circumference (OFC) that is less than 2 standard deviations (SD) below the mean for sex, age, and race, and more than 3 standard deviations below the mean for sex, age, and race after 6 months of age. Primary microcephaly reflects an imbalance between the production of progenitor cells and cell death. Interruption of neural progenitor cell proliferation (defects in mitosis or progenitor cell cycle regulation) or DNA damage response can lead to a reduction in the number of neurons and glial cells in the brain. The incidence of primary microcephaly ranges from 1.3 to 150 cases per 100,000 live births. Microcephaly is divided into primary, secondary, metabolic, and syndromic microcephaly. It is mainly related to intrauterine infection, malnutrition, radiation, drugs / toxins, genetic / gene mutations, metabolic abnormalities, environment, hypoxia, trauma, and other factors.

[0007] So far, at least 25 genes of primary microcephaly from different populations around the world are known, including: BRIT1, WDR62, CDK5RAP2, CASC5, ASPM, CENPJ, STIL, CEP135, CEP152, ZNF335, PHC1, CDK6, CENPE, SAS-6, MFSD2A, ANKLE2, CIT, WDFY3, COPB2, KIF14, NACAPD2, NACAPD3, NCAPH / BRRN, NUP37 and MAP11, which have elucidated the molecular basis of microcephaly genetic diseases. As a class of neurodevelopmental disease-related proteins, most of their mechanisms are related to cell division, so they are highly expressed in tissues with active cell division. Through protein sequence analysis or structural prediction, it was found that most of these proteins are located in the cytoskeleton and nucleus. The centrosome is the center of microtubule organization, and most of them are located in mitotic apparatus such as centrosome or spindle. During brain development, the correct assembly of centrosomes and spindles plays a critical role in generating and maintaining normal nerve cell function and quantity. The absence or mutation of related proteins will interfere with the normal formation of centrosomes or spindles, affect processes such as cell cycle and DNA replication, and further affect the proliferation, differentiation and apoptosis of neural precursor cells, ultimately leading to a reduction in the number of neurons and a smaller brain. Summary of the invention

[0008] In view of the above problems, the present invention provides KIF11 gene mutants and applications, mainly to make up for new mutants of the KIF11 gene and some diseases caused by the mutants, and also to provide new solutions for the treatment of these diseases.

[0009] In order to solve the above problems, the present invention adopts the following technical solutions:

[0010] A nucleic acid comprising the following target fragment, wherein the target fragment has a c.2680C>T mutation compared to the wild-type KIF11 gene.

[0011] A polypeptide having a p.Gln894Ter mutation compared to wild-type KIF11.

[0012] Gene mutation, compared with the wild-type KIF11 gene,

[0013] The gene mutation has a c.2680C>T mutation.

[0014] Use of a biological model in the preparation of a screening preparation for microcephaly, without chorioretinopathy, lymphedema, or mental retardation, wherein the biological model carries at least one of the following

[0015] a. the aforementioned nucleic acid having a mutation,

[0016] b. the aforementioned polypeptide having a mutation,

[0017] c. The aforementioned gene mutations.

[0018] Use of a detection reagent in the preparation of a screening reagent for microcephaly, without chorioretinopathy, lymphedema, or mental retardation, wherein the detection reagent is at least one of the following

[0019] a. The aforementioned nucleic acid detection reagent with mutation;

[0020] b. the aforementioned polypeptide detection reagent having mutations;

[0021] c. Reagents for detecting the aforementioned gene mutations.

[0022] A screening reagent for one of microcephaly, chorioretinopathy without chorioretinopathy, lymphedema, and mental retardation, comprising a reagent capable of detecting a KIF11 gene mutant, wherein the KIF11 gene mutant includes at least one of the following

[0023] a. the aforementioned nucleic acid having a mutation,

[0024] b. the aforementioned polypeptide having a mutation,

[0025] c. The aforementioned gene mutations.

[0026] In some cases, the reagents comprise nucleic acid probes or primers;

[0027] Preferably, the sequence of the primer is

[0028] Forward primer sequence: GGTTGTAAGCCAATGTTGTG,

[0029] Reverse primer sequence: TCAGGCAATGGCAGGAC.

[0030] A construct comprising the aforementioned nucleic acid or the aforementioned gene mutation.

[0031] Use of a mutation inhibitor in the preparation of a drug for microcephaly, chorioretinopathy without chorioretinopathy, lymphedema, and mental retardation, wherein the mutation inhibitor has an inhibitory effect on at least one of the following:

[0032] a. The aforementioned gene mutations,

[0033] b. p.Gln894Ter mutation of KIF11 polypeptide.

[0034] Drugs for the prevention and treatment of microcephaly, chorioretinopathy without chorioretinopathy, lymphedema, and mental retardation, containing at least one of the following

[0035] a. the aforementioned gene mutation inhibitors,

[0036] b. p.Gln894Ter mutation inhibitor of KIF11 polypeptide,

[0037] c. A gene vector comprising a gene fragment, wherein the gene fragment can replace the 2680th position of the KIF11 gene with base C.

[0038] The beneficial effects of the present invention are:

[0039] It provides new mutation sites associated with microcephaly, non-chorioretinopathy, lymphedema, and mental retardation, provides new options for the diagnosis and treatment of the disease, and also provides relevant drugs that can prevent and treat the disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is the proband and family pedigree;

[0041] Figure 2 This is the Sanger sequencing map of the proband's mutation site;

[0042] Figure 3 This is the Sanger sequencing map of the proband's father at this locus;

[0043] Figure 4 This is the Sanger sequencing map of the proband's mother at this site;

[0044] Figure 5 Diagram of PCR amplification procedure. DETAILED DESCRIPTION

[0045] The present invention will be further described below:

[0046] The first aspect of this section is as follows:

[0047] First: nucleic acid, comprising the following target fragment, wherein the target fragment has a c.2680C>T mutation compared to the wild-type KIF11 gene (such as SED IQNO: 1). Among them, one form of nucleic acid is DNA. The aforementioned has several forms of deletion mutations, when multiple deletion mutations coexist: in some cases, any two deletion mutation sites do not overlap, of course, in other cases, even if the sites overlap, as long as it is also related to the relevant diseases targeted by the present invention, then the content of this mutation mode should also be within the scope of the present invention.

[0048] Second, a polypeptide having a p.Gln894Ter mutation compared to wild-type KIF11 (such as SED IQ NO: 2), and not limited to the fact that the other sequences except the p.Gln894Ter mutation must be consistent with the gene NM_004523.

[0049] Third: gene mutation. Compared with the wild-type KIF11 gene, the gene mutation has a c.2680C>T mutation.

[0050] The wild type mentioned above includes other forms of genotypes. As long as the mutation site of the present invention is contained, mutations and changes in other sites do not affect the scope of the present invention. The wild gene sequence mentioned above is only partially listed and is not particularly limited. As long as the mutation site of KIF11 is the same or equivalent to the present invention, it is within the scope of the present invention.

[0051] The second aspect of this section introduces some applications of related mutations:

[0052] First: Use of a biological model in the preparation of a screening preparation for microcephaly, without chorioretinopathy, lymphedema, or mental retardation, wherein the biological model carries at least one of the following

[0053] a. the aforementioned nucleic acid having a mutation,

[0054] b. the aforementioned polypeptide having a mutation,

[0055] c. The aforementioned gene mutations.

[0056] Second: Use of a detection reagent in the preparation of a screening reagent for microcephaly, without chorioretinopathy, lymphedema, or mental retardation, wherein the detection reagent is at least one of the following

[0057] a. The aforementioned nucleic acid detection reagent with mutation;

[0058] b. the aforementioned polypeptide detection reagent having mutations;

[0059] c. Reagents for detecting the aforementioned gene mutations.

[0060] The third aspect of this section introduces some products produced based on mutations:

[0061] One of them: a screening reagent for microcephaly, without chorioretinopathy, lymphedema, and mental retardation, containing a reagent capable of detecting a KIF11 gene mutant, wherein the KIF11 gene mutant includes at least one of the following

[0062] a. the aforementioned nucleic acid having a mutation,

[0063] b. the aforementioned polypeptide having a mutation,

[0064] c. The aforementioned gene mutations.

[0065] In some cases, the reagents comprise nucleic acid probes or primers;

[0066] Preferably, the sequence of the primer is

[0067] Forward primer sequence: GGTTGTAAGCCAATGTTGTG,

[0068] Reverse primer sequence: TCAGGCAATGGCAGGAC.

[0069] The second one is a construct, which includes the aforementioned nucleic acid with mutation or the aforementioned gene mutation. The construct can also be used as a drug efficacy test model in the pharmaceutical process.

[0070] Three of them: Use of a mutation inhibitor in the preparation of a drug for preventing and treating microcephaly, non-chorioretinopathy, lymphedema, and mental retardation, wherein the mutation inhibitor has an inhibitory effect on at least one of the following:

[0071] a. The aforementioned gene mutations,

[0072] b. p.Gln894Ter mutation of KIF11 polypeptide.

[0073] Four of the following: drugs for the prevention and treatment of microcephaly, chorioretinopathy without chorioretinopathy, lymphedema, and mental retardation, containing at least one of the following

[0074] a. the aforementioned gene mutation inhibitors,

[0075] b. p.Gln894Ter mutation inhibitor of KIF11 polypeptide,

[0076] c. A gene vector containing a gene fragment, wherein the gene fragment can replace the 2680th position of the KIF11 gene with base C. The site referenced in this section is SDE IQ NO: 1, which serves only as a reference, mainly for describing the mutation site compared with the wild type, and is not limited to position 2680. As the reference sequence table changes, the site number may also change, but in essence, the base C at the corresponding site is mutated.

[0077] "Microcephaly, without chorioretinopathy, lymphedema, mental retardation" means at least one of them. It is not limited to only one of them.

[0078] The mutation inhibitors in this section are directed to the above mutations. Existing or newly developed compounds or other drugs, which are used for any disease related to the above symptoms, should be within the scope of protection of the present invention.

[0079] The term "nucleic acid" used in some of the aforementioned aspects can be any polymer containing deoxyribonucleotides or ribonucleotides, including but not limited to modified or unmodified DNA, RNA, and its length is not subject to any particular restrictions. For constructs used to construct recombinant cells, it is preferred that the nucleic acid is DNA, because DNA is more stable and easy to handle relative to RNA.

[0080] It should be noted that the mutation sites and sequences given above are all based on the content of the proteon sequencing platform as a reference. Those skilled in the art should understand that due to the update of the database or the difference in the database, the mutation sites and sequences shown may be slightly different or changed. These differences or changes can be found based on the content of the database given as a standard, and these differences or changes are also included in the scope of protection of the present invention.

[0081] The fourth aspect of this section is introduced in conjunction with a specific research project:

[0082] 1. Sample collection

[0083] The inventor collected a pedigree of microcephaly in Wuhan, such as Figure 1 As shown, a total of 3 family members were collected (shown in the black box in the figure). There is 1 patient (III-1) and 2 healthy people (II-1, II-2) in the family. □ represents a healthy male, ○ represents a healthy female, ■ represents a sick male, ● represents a sick female, and ↗ represents a proband. A total of 3 people in the family participated in the study of the present invention (shown in the black box), and all family members participating in the study of the present invention signed an informed consent form. The inventor collected peripheral blood samples from the proband (III-1), the proband's father (II-1), and the proband's mother (II-2).

[0084] Human peripheral blood genomic DNA extraction and freezing:

[0085] (1) Collect 2-5 ml of peripheral blood or oral saliva from the subjects using EDTA anticoagulated blood collection tubes, number them, and record clinical data;

[0086] (2) Number the 1.5 ml and 2 ml EP tubes and collection tubes and keep records;

[0087] (3) Mix the blood sample by inversion, take 1 ml of whole blood sample and place it in a sterile 2 ml EP tube, and divide the remaining blood sample into other 2 ml EP tubes, with 1 ml of whole blood sample in each tube, and keep 1 ml of whole blood in a -80 degree refrigerator;

[0088] (4) Add 1 ml of cell lysis buffer CL to the EP tube, invert and mix several times, then centrifuge at 10,000 rpm for 1 min, discard the supernatant, and retain the precipitate;

[0089] (5) Add 1 mL of CL to the EP tube again, shake and let stand for 5 minutes, centrifuge at 10,000 rpm for 1 minute, discard the supernatant, and keep the precipitate

[0090] (6) Add 200 μL of buffer GS to the precipitate and shake until thoroughly mixed;

[0091] (7) Add 20 μL of Protease K solution and mix by inverting;

[0092] (8) Add 200 μL of buffer GB to the EP tube, invert to mix, and shake vigorously for about 1 min;

[0093] (9) Place in a 56°C oven for about 10 minutes, inverting several times to mix;

[0094] (10) Add 200 ml of anhydrous ethanol to the above solution and mix thoroughly;

[0095] (11) Load the solution and flocculent precipitate obtained in the previous step into the DNA adsorption column CB3 (the adsorption column CB3 is placed in the collection tube). Centrifuge at 12,000 rpm for 30 seconds, pour out the waste liquid in the collection tube, and put the adsorption column CB3 back into the collection tube;

[0096] (12) Add 500 ml of buffer GD to the adsorption column (make sure that anhydrous ethanol has been added in the appropriate proportion before use), centrifuge at 12,000 rpm for 30 s, discard the waste liquid, and return the adsorption column to the collection tube;

[0097] (13) Add 600 ml of rinse solution PW (make sure that anhydrous ethanol has been added in proportion before use) to the adsorption column, centrifuge at 12,000 rpm for 30 s, discard the waste liquid, and return the adsorption column to the collection tube;

[0098] (14) Repeat step (13) once;

[0099] (15) Centrifuge at 12,000 rpm for 2 min and discard the liquid in the collection tube. Leave the adsorption column at room temperature for several minutes to completely dry the rinsing liquid remaining in the adsorption material;

[0100] (16) Transfer the adsorption column CB3 into a 1.5 ml sterile EP tube, add 60 μl of elution buffer TB to the middle of the adsorption membrane, let it stand at room temperature for 5 min, and centrifuge it at 12,000 rpm for 2 min;

[0101] (17) Add 60 μl of eluent TB to the middle of the adsorption membrane and repeat the above steps once more;

[0102] (18) The concentration and purity of DNA in 1.5 ml EP were detected by agarose gel electrophoresis, NanoDrop 2000, and Qubit 3.0, and the resulting DNA solution was frozen at -20 °C.

[0103] 2. Whole exome sequencing and mitochondrial genome testing

[0104] (1) The inventors used the QIAamp DNA BloodMidi Kit (Cat. No. 51185) produced by Qiagen to extract genomic DNA from peripheral blood samples, and the IDT The ExomeResearch Panel v1.0 kit was used to perform targeted capture on the amplified library. The concentration and purity of the DNA were tested by Qubit and Bioanalyzer 2100. PE150 sequencing was performed using Illumina Novaseq 6000. Sanger sequencing was used for site verification and analysis. After the mutation site was identified, Sanger sequencing was performed on the father and mother of the proband. Figure 2-4 (Note: Since the Sanger plot uses forward 5' flipping processing, the peak plot only shows sequence variations on the forward chain).

[0105] (2) Mutation detection, annotation, and database comparison

[0106] The raw data from whole exome sequencing were spliced, aligned, and annotated, and the variant sites in the results were analyzed. The results showed that the proband had more than 88,000 mutations, including 12,182 synonymous mutations, 53,120 mutations in intronic regions, 10,887 missense mutations, 294 frameshift mutations, and the rest were mutations in splicing regions or gene intervals. Variants with an allele frequency greater than 0.01 in public population frequency databases (GnomAD, ExAc, 1000 Genomes) were filtered out to screen out pathogenic variants associated with the phenotype. As a result, the inventors found that the proband had a nonsense mutation in exon 19 of KIF11, such as Figure 2As shown, the base mutation caused the nucleotide C at position 2680 of the KIF11 gene to be replaced by T (c.2680C>T), causing the amino acid 894 to change from glutamine to a stop codon (p.Gln894Ter). This mutation is a stop codon that terminates transcription prematurely. This site has not been recorded in the reference population gene frequency database GnomAD, ExAc, and the 1000 Genome Database. This site has not been reported in the ClinVar database.

[0107] 3. Sanger sequencing verification

[0108] Peripheral blood samples from the proband's father II-1 and mother II-2 were collected to verify the KIF11 gene mutation site. Sequencing results showed that the proband's parents had no base mutations in the gene, and it was speculated that the proband's mutation was a new mutation.

[0109] (1) Primer design

[0110] According to the location of the gene mutation in the genome, the human genome sequence where the mutation is located was queried in the Ensembl database, and primers were designed in the primer design software Primer Premier 5. The primer sequences are as follows: forward primer sequence: GGTTGTAAGCCAATGTTGTG; reverse primer sequence: TCAGGCAATGGCAGGAC.

[0111] (2) PCR amplification

[0112] Prepare the PCR reaction system of each DNA sample according to the following ratio and perform PCR reaction: Reaction system (30ul):

[0113]

[0114]

[0115] (3) Amplification procedures, such as Figure 5 as shown in .

[0116] (4) Sanger sequencing

[0117] The amplified PCR product was purified and then bidirectionally sequenced using an ABI3730xl sequencer.

[0118] 4. Bioinformatics prediction

[0119] KIF11, chr10:94408101, gene NM_004523.4:c.2680C>T (p.Gln894Ter), resulting in the replacement of nucleotide C at position 2680 of the KIF11 gene with T (c.2680C>T), resulting in the conversion of amino acid 894 from glutamine to a stop codon (p.Gln894Ter). This mutation is located in exon 19, resulting in the premature appearance of the stop codon, affecting the normal translation of the protein. According to the NMD (nonsense-mediated mRNA degradation, a genetic error correction mechanism present in all eukaryotic organisms) mechanism, abnormal mRNA transcripts containing premature stop codons are degraded to reduce errors in gene expression. According to the theory, KIF11:c.2680C>T will lead to the appearance of NMD, resulting in the degradation of the wrongly encoded protein. The KIF11 gene is associated with microcephaly, photoreceptor cilopathy, lymphedema, and mental retardation (MLCRD). Abnormalities in KIF11 protein can lead to abnormalities in the central nervous system, eyes, etc.

[0120] 5. Clinical analysis

[0121] (1) ACMG Standard Rating

[0122] According to the ACMG genetic variation classification standards and guidelines, this site can be rated as very pathogenic.

[0123] PVS1: When the pathogenic mechanism of a disease is loss of function (LOF), there are no functional variants (nonsense mutations, frameshift mutations, splicing mutations of canonical ±1 or 2, start codon variants, single or multiple exon deletions)

[0124] PS2: New mutation in the patient with no family history. (Verified by both parents)

[0125] PM2: Variants that are not found in the normal control population in the ESP database, the Thousand People database, and the EXAC database (or extremely low frequency sites in recessive genetic diseases).

[0126] (2) Clinical auxiliary examination and medication

[0127] The proband, male, was admitted to the hospital on March 3rd due to "fever for 3 hours". He had very poor swallowing ability after birth and was slow to feed. Physical examination: clear consciousness, head circumference of 36 cm, closed anterior fontanelle, pointed skull, narrow forehead, small mandible, 90° pursuit of red objects, unstable neck, 45° head lift in prone position, increased muscle tone of limbs, and primitive reflexes. Scattered pinpoint rashes can be seen on the trunk; weak tongue depressor reflex; coarse breath sounds in both lungs, and sputum sounds can be heard. Auxiliary examination: Brain plain scan (MR) examination results: 1. Widening of the extracerebral space 2. Thin corpus callosum. Lung CT examination results: 1. Pneumonia 2. Localized emphysema in the right lower lobe. Diagnosis: 1. Pneumonia 2. Microcephaly 3. Developmental delay. After clinical diagnosis, anti-infection and electronic fiber bronchoscopic lavage treatment were given, and pneumonia was clinically cured and discharged; developmental delay was planned to undergo rehabilitation treatment and regular follow-up.

[0128] Based on the study of the disease and the KIF11 gene background, the gene mutation that caused the clinical phenotype of the proband was found, and the mutated gene was clearly associated with microcephaly with or without chorioretinopathy, lymphedema or mental retardation. According to the ACMG genetic variation classification standards and guidelines, this site can be rated as very pathogenic. At the same time, there is no report or inclusion of this mutation site in domestic and foreign databases. Hereby apply for a patent, hoping to provide more diagnostic basis for the early diagnosis of microcephaly with or without chorioretinopathy, lymphedema or mental retardation and to improve the database of pathogenic mutations of microcephaly with or without chorioretinopathy, lymphedema or mental retardation.

[0129] It will be clear to those skilled in the art that various modifications to the above embodiments may be made without departing from the overall spirit and concept of the present invention. All of these modifications fall within the scope of protection of the present invention. The protection scheme of the present invention shall be subject to the claims attached to the present invention. Sequence Listing <110> Hubei Maternal and Child Health Hospital <120> KIF11 gene mutant and its application <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 3171 <212> DNA <213> Human (Huma) <400> 1 atggcgtcgc agccaaattc gtctgcgaag aagaaagagg agaaggggaa gaacatccag 60 gtggtggtga gatgcagacc atttaatttg gcagagcgga aagctagcgc ccattcaata gtagaatgtg atcctgtacg aaaagaagtt agtgtacgaa ctggaggatt ggctgacaag agctcaagga aaacatacac ttttgatatg gtgtttggag catctaa acagattgat gtttaccgaa gtgttgtttg tccaattctg gatgaagtta ttatgggcta taattgcact atctttgcgt atggccaaac tggcactgga aaaactttta caatggaagg tgaaaggtca cctaatgaag agtatacctg ggaagaggat cccttggctg gtataattcc acgtaccctt catcaaattt ttgagaaact tactgataat ggtactgaat tttcagtcaa agtgtctctg ttggagatct father gctttttgat cttcttaatc catcatctga tgtttctgag agactacaga tgtttgatga tccccgtaac aagagaggag tgataattaa aggtttagaa gaattacag tacacaacaa ggatgaagtc tatcaaattt tagaaaaggg ggcagcaaaa aggacaactg cagctactct gatgaatgca tactctagtc gttcccactc agttttctct gttacaatac atatgaaaga aactacgatt gatggagaag agcttgttaa aatcggaaag ttgaacttgg ttgatcttgc aggaagtgaa aacattggcc gttctggagc tgttgataag 840 agagctcggg aagctgggaaa tataaatcaa tccctgttga ctttgggaag ggtcattact 900 gcccttgtag aaagaacacc tcatgttcct tatcgagaat ctaactaac tagaatcctc 960 caggattctc ttggagggcg tacaagaaca tctataattg caacaatttc tcctgcatct 1020 ctcaatcttg aggaaactct gagtacattg gaatatgctc atagagcaaa gaacatattg 1080 aataagcctg aagtgaatca gaaactcacc aaaaaagctc ttattaagga gtatacggag 1140 gagatagaac gtttaaaacg agatcttgct gcagcccgtg agaaaaatgg agtgtatatt 1200 tctgaagaaa attttagagt catgagtgga aaattaactg ttcaagaaga gcagattgta 1260 gaattgattg aaaaaattgg tgctgttgag gaggagctga atagggttac agagttgttt 1320 atggataata aaaatgaact tgaccagtgt aaatctgacc tgcaaaataa aacacaagaa 1380 cttgaaacca ctcaaaaca tttgcaagaa actaaattac aacttgttaa agaagaatat 1440 atcacatcag ctttggaaag tactgaggag aaacttcatg atgctgccag caagctgctt 1500 aacacagttg aagaaactac aaagatgta tctggtctcc attccaact ggatcgtaag 1560 aaggcagttg accacacaa tgcagaagct caggatattt ttggcaaaaa cctgaatgt 1620 ctgtttaata attggaga atttattag gatggcagct CAAGCAAA ggccatgcta 1680 gaagtacata agaccttatt tgtaatctg ctgtcttcca gtgtctctgc attagatacc 1740 attackacag tagcacttgg atctccaca tctattccag aaatgtgtc tactcatgtt 1800 tctcagattt ttaatgat actaaagaa caatcattag cagcagaag taaaactgta 1860 ctacaggaat tgattaatgt actcagact gatctctaa gttcactgga atgatttta 1920 tcccaactg tggtgtctat actgaaaatc atagtcac taagcatat ttcagact 1980 tcattgacag tggccgaata gatagagat caaaaaagg aactagatgg ctttctcagt 2040 atactgtgta acaatctaca tgaactaca gaaaatacca ttgttcctt ggttgagtca 2100 aaagcaat gtggaaacct aactgaagac ctgaagacaa taaagcagac ccattcccag 2160 gaacttgca agttaatgaa tctttggaca gagagattct gtgctttgga ggaaaagtgt 2220 gaaatatac agaaaccact tagtagtgtc caggaaatac tacagcaga atctaaggat atagtcaaca aaatgacttt tcacagtcaa aaattttgtg ctgattctga tggcttctca 2400. 2400. 2400. 2400. 2400. 2400. 2400. 2400. 2400. 2400. 2400. 2400 tctgataaac tcaatggcaa cctggaaaaa atatctcaag agactgaaca gagatgtgaa tctctgaaca caagaacagt ttttttct gaacagtggg tatcttcctt aaatgaaagg gacaggac ttcacaactt attggaggtt gtaagccaat gttgtgaggc ttcaagttca gcatcatg agaaatcaga tggacgtaag gcagctcatg agaaacagca taacatttt cttgatcaga tgactattga tgaagataaa ttgatagcac aaaatctaga acttaatgaa accataaaaa ttggtttgac tagcttaat tgctttctgg aacaggatct gaaactggat atcccaacag gtacgacacc acagaggaa agttatttat acccatcaac actggtaaga actgaaccac gtgaacatct ccttgatcag ctgaaaagga aacagcctga gctgttaatg atgctaaact gttcagaaaa caacaaaaga gagacaattc cggatgtgga tgtagaagag gcagttctgg ggcagtatac tgaagaacct ctaagtcaag agccatctgt agatgctggt 3000 gtggattgtt catcaattgg cggggttcca tttttccagc ataaaaaatc acatggaaaa 3060 gacaaagaaa acagaggcat taacacactg gagaggtcta aagtggaaga aactacagag 3120 cacttggtta caaagagcag attacctctg cgagcccaga tcaaccttta a 3171 <210> 2 <211> 1056 <212> PRT <213> Human (Huma) <400> 2 Met Ala Ser Gln Pro Asn Ser Ser Ala Lys Lys Lys Glu Glu Lys Gly 1 5 10 15 Lys Asn Ile Gln Val Val Val Arg Cys Arg Pro Phe Asn Leu Ala Glu 20 25 30 Arg Lys Ala Ser Ala His Ser Ile Val Glu Cys Asp Pro Val Arg Lys 35 40 45 Glu Val Ser Val Arg Thr Gly Gly Leu Ala Asp Lys Ser Ser Arg Lys 50 55 60 Thr Tyr Thr Phe Asp Met Val Phe Gly Ala Ser Thr Lys Gln Ile Asp 65 70 75 80 Val Tyr Arg Ser Val Val Cys Pro Ile Leu Asp Glu Val Ile Met Gly 85 90 95 Tyr Asn Cys Thr Ile Phe Ala Tyr Gly Gln Thr Gly Thr Gly Lys Thr 100 105 110 Phe Thr Met Glu Gly Glu Arg Ser Pro Asn Glu Glu Tyr Thr Trp Glu 115 120 125 Glu Asp Pro Leu Ala Gly Ile Ile Pro Arg Thr Leu His Gln Ile Phe 130 135 140 Glu Lys Leu Thr Asp Asn Gly Thr Glu Phe Ser Val Lys Val Ser Leu 145 150 155 160 Leu Glu Ile Tyr Asn Glu Glu Leu Phe Asp Leu Leu Asn Pro Ser Ser 165 170 175 Asp Val Ser Glu Arg Leu Gln Met Phe Asp Asp Pro Arg Asn Lys Arg 180 185 190 Gly Val Ile Ile Lys Gly Leu Glu Glu Ile Thr Val His Asn Lys Asp 195 200 205 Glu Val Tyr Gln Ile Leu Glu Lys Gly Ala Ala Lys Arg Thr Thr Ala 210 215 220 Ala Thr Leu Met Asn Ala Tyr Ser Ser Arg Ser His Ser Val Phe Ser 225 230 235 240 Val Thr Ile His Met Lys Glu Thr Thr Ile Asp Gly Glu Glu Leu Val 245 250 255 Lys Ile Gly Lys Leu Asn Leu Val Asp Leu Ala Gly Ser Glu Asn Ile 260 265 270 Gly Arg Ser Gly Ala Val Asp Lys Arg Ala Arg Glu Ala Gly Asn Ile 275 280 285 Asn Gln Ser Leu Leu Thr Leu Gly Arg Val Ile Thr Ala Leu Val Glu 290 295 300 Arg Thr Pro His Val Pro Tyr Arg Glu Ser Lys Leu Thr Arg Ile Leu 305 310 315 320 Gln Asp Ser Leu Gly Gly Arg Thr Arg Thr Ser Ile Ile Ala Thr Ile 325 330 335 Ser Pro Ala Ser Leu Asn Leu Glu Glu Thr Leu Ser Thr Leu Glu Tyr 340 345 350 Ala His Arg Ala Lys Asn Ile Leu Asn Lys Pro Glu Val Asn Gln Lys 355 360 365 Leu Thr Lys Lys Ala Leu Ile Lys Glu Tyr Thr Glu Glu Ile Glu Arg 370 375 380 Leu Lys Arg Asp Leu Ala Ala Ala Arg Glu Lys Asn Gly Val Tyr Ile 385 390 395 400 Ser Glu Glu Asn Phe Arg Val Met Ser Gly Lys Leu Thr Val Gln Glu 405 410 415 Glu Gln Ile Val Glu Leu Ile Glu Lys Ile Gly Ala Val Glu Glu Glu 420 425 430 Leu Asn Arg Val Thr Glu Leu Phe Met Asp Asn Lys Asn Glu Leu Asp 435 440 445 Gln Cys Lys Ser Asp Leu Gln Asn Lys Thr Gln Glu Leu Glu Thr Thr 450 455 460 Gln Lys His Leu Gln Glu Thr Lys Leu Gln Leu Val Lys Glu Glu Tyr 465 470 475 480 Ile Thr Ser Ala Leu Glu Ser Thr Glu Glu Lys Leu His Asp Ala Ala 485 490 495 Ser Lys Leu Leu Asn Thr Val Glu Glu Thr Thr Lys Asp Val Ser Gly 500 505 510 Leu His Ser Lys Leu Asp Arg Lys Lys Ala Val Asp Gln His Asn Ala 515 520 525 Glu Ala Gln Asp Ile Phe Gly Lys Asn Leu Asn Ser Leu Phe Asn Asn 530 535 540 Met Glu Glu Leu Ile Lys Asp Gly Ser Ser Lys Gln Lys Ala Met Leu 545 550 555 560 Glu Val His Lys Thr Leu Phe Gly Asn Leu Leu Ser Ser Ser Val Ser 565 570 575 Ala Leu Asp Thr Ile Thr Thr Val Ala Leu Gly Ser Leu Thr Ser Ile 580 585 590 Pro Glu Asn Val Ser Thr His Val Ser Gln Ile Phe Asn Met Ile Leu 595 600 605 Lys Glu Gln Ser Leu Ala Ala Glu Ser Lys Thr Val Leu Gln Glu Leu 610 615 620 Ile Asn Val Leu Lys Thr Asp Leu Leu Ser Ser Leu Glu Met Ile Leu 625 630 635 640 Ser Pro Thr Val Val Ser Ile Leu Lys Ile Asn Ser Gln Leu Lys His 645 650 655 Ile Phe Lys Thr Ser Leu Thr Val Ala Asp Lys Ile Glu Asp Gln Lys 660 665 670 Lys Glu Leu Asp Gly Phe Leu Ser Ile Leu Cys Asn Asn Leu His Glu 675 680 685 Leu Gln Glu Asn Thr Ile Cys Ser Leu Val Glu Ser Gln Lys Gln Cys 690 695 700 Gly Asn Leu Thr Glu Asp Leu Lys Thr Ile Lys Gln Thr His Ser Gln 705 710 715 720 Glu Leu Cys Lys Leu Met Asn Leu Trp Thr Glu Arg Phe Cys Ala Leu 725 730 735 Glu Glu Lys Cys Glu Asn Ile Gln Lys Pro Leu Ser Ser Val Gln Glu 740 745 750 Asn Ile Gln Gln Lys Ser Lys Asp Ile Val Asn Lys Met Thr Phe His 755 760 765 Ser Gln Lys Phe Cys Ala Asp Ser Asp Gly Phe Ser Gln Glu Leu Arg 770 775 780 Asn Phe Asn Gln Glu Gly Thr Lys Leu Val Glu Glu Ser Val Lys His 785 790 795 800 Ser Asp Lys Leu Asn Gly Asn Leu Glu Lys Ile Ser Gln Glu Thr Glu 805 810 815 Gln Arg Cys Glu Ser Leu Asn Thr Arg Thr Val Tyr Phe Ser Glu Gln 820 825 830 Trp Val Ser Ser Leu Asn Glu Arg Glu Gln Glu Leu His Asn Leu Leu 835 840 845 Glu Val Val Ser Gln Cys Cys Glu Ala Ser Ser Ser Asp Ile Thr Glu 850 855 860 Lys Ser Asp Gly Arg Lys Ala Ala His Glu Lys Gln His Asn Ile Phe 865 870 875 880 Leu Asp Gln Met Thr Ile Asp Glu Asp Lys Leu Ile Ala Gln Asn Leu 885 890 895 Glu Leu Asn Glu Thr Ile Lys Ile Gly Leu Thr Lys Leu Asn Cys Phe 900 905 910 Leu Glu Gln Asp Leu Lys Leu Asp Ile Pro Thr Gly Thr Thr Pro Gln 915 920 925 Arg Lys Ser Tyr Leu Tyr Pro Ser Thr Leu Val Arg Thr Glu Pro Arg 930 935 940 Glu His Leu Leu Asp Gln Leu Lys Arg Lys Gln Pro Glu Leu Leu Met 945 950 955 960 Met Leu Asn Cys Ser Glu Asn Asn Lys Glu Glu Thr Ile Pro Asp Val 965 970 975 Asp Val Glu Glu Ala Val Leu Gly Gln Tyr Thr Glu Glu Pro Leu Ser 980 985 990 Gln Glu Pro Ser Val Asp Ala Gly Val Asp Cys Ser Ser Ile Gly Gly 995 1000 1005 Val Pro Phe Phe Gln His Lys Lys Ser His Gly Lys Asp Lys Glu Asn 1010 1015 1020 Arg Gly Ile Asn Thr Leu Glu Arg Ser Lys Val Glu Glu Thr Thr Glu 1025 1030 1035 1040 His Leu Val Thr Lys Ser Arg Leu Pro Leu Arg Ala Gln Ile Asn Leu 1045 1050 1055

Claims

1. Use of a reagent for detecting KIF11 gene mutants in the preparation of a reagent for screening microcephaly with or without chorioretinopathy, lymphedema or mental retardation, characterized in that: The KIF11 gene mutant has a c.2680 C>T mutation compared to the wild-type KIF11 gene with a sequence of SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The reagent for detecting KIF11 gene mutants comprises a nucleic acid probe or a primer.

Images