Antisense oligonucleotides of mettl3 and their use in prostate cancer

Abstract

The application discloses antisense oligonucleotides of METTL3 and application thereof in prostate cancer. It is found that inhibiting the expression level of METTL3 can reduce the proliferation of castration-resistant prostate cancer cells, and restore the drug sensitivity of drug-resistant prostate cancer cell strains, thereby providing a new means for treating castration-resistant prostate cancer and drug-resistant prostate cancer.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biomedicine, and relates to antisense oligonucleotides against METTL3 and their use in prostate cancer. BACKGROUND

[0002] Prostate cancer, as the second malignant tumor with the highest mortality rate in the world, has attracted the attention of clinicians at home and abroad (Ferlay J, Soerjomataram I, Dikshit R, et al. Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012 [J]. Int J Cancer, 2015, 136(5): E359-86.). The incidence of prostate cancer shows obvious regional differences, and the incidence in the West is about 25 times that in Asia, which may be related to factors such as low PSA screening rate in Asian countries (Ha Chung B, Horie S, Chiong E. The incidence, mortality, and risk factors of prostate cancer in Asian men [J]. Prostate Int, 2019, 7(1): 1-8.). However, due to factors such as population aging, the incidence of prostate cancer in China has an upward trend. Prostate cancer is an androgen-dependent tumor, and some patients who cannot undergo radical surgery usually receive surgical castration or drug castration combined with anti-androgen therapy. Patients are usually sensitive to this treatment regimen at the beginning of treatment, but eventually develop into castration-resistant prostate cancer (CRPC) (Carroll PH, Mohler JL. NCCN Guidelines Updates: Prostate Cancer and Prostate Cancer Early Detection [J]. J Natl Compr Canc Netw, 2018, 16(6): 20-3.).

[0003] 6-methyladenosine (m6A) is the most common methylation modification in both coding and long non-coding RNAs of eukaryotes, which can play a pro-cancer role in the pathogenesis and progression of various tumors. Methyltransferase like 3 (METTL3) is the only catalytic subunit in the RNA m6A methyltransferase complex, and is the most critical protein molecule in regulating the dynamic process of RNA m6A methylation. As a 'writer' in the m6A-related enzyme family, METTL3 has been confirmed to have a pro-cancer effect in the pathogenesis of multiple tumors, including but not limited to the following: in bladder tumors, METTL3 mediates the maturation of miR-221 / 222 through an m6A-dependent pathway, leading to a decrease in PTEN, and thus promoting the proliferation and progression of bladder cancer. In digestive system cancers, Mettl3 promotes the proliferation, metastasis and invasion of gastric cancer cells by regulating the E-cadherin protein signaling pathway. In lung cancer, METTL3 binds to eIF3 and regulates the translation process, thereby playing a role as an oncogene. In liver tumors, it has been confirmed that METTL3 targets SOCS2 and CTNNB1, respectively, to mediate the proliferation and progression of hepatocellular carcinoma and hepatoblastoma. In the female reproductive system, METTL3 upregulates the epithelial-mesenchymal transition of tumor cells by regulating the level of snail protein, thereby promoting the invasion and metastasis of cervical cancer.

[0004] Although there have been many studies on the mechanism of METTL3 as an oncogene, there have been no reports on its mediation of cell resistance to enzalutamide in prostate cancer, and there have been no reports on oligonucleotide drugs targeting METTL3. SUMMARY

[0005] To make up for the shortcomings of the prior art, one of the purposes of the present application is to provide an antisense oligonucleotide targeting METTL3.

[0006] The second purpose of the present application is to provide a means for treating castration-resistant prostate cancer.

[0007] The third purpose of the present application is to provide a means for treating drug-resistant prostate cancer.

[0008] To achieve the above purposes, the present application adopts the following technical solutions:

[0009] The first aspect of the present application provides a modified antisense oligonucleotide, which consists of 15-30 nucleotides, and the antisense oligonucleotide inhibits the expression of METTL3.

[0010] Further, the antisense oligonucleotide consists of 18-22 nucleotides.

[0011] Further, the antisense oligonucleotide consists of 20 nucleotides.

[0012] Further, the antisense oligonucleotide is selected from the sequences recited in any one of SEQ ID NO. 1-11.

[0013] Further, the antisense oligonucleotide has a sequence as set forth in SEQ ID NO. 2.

[0014] Further, the modification comprises at least one internucleoside linkage modification.

[0015] Further, the internucleoside linkage modification is a phosphorothioate modification.

[0016] Further, the modification comprises an internucleoside linkage modification throughout the entire chain.

[0017] Further, the modification comprises at least one sugar modification.

[0018] Further, the sugar modification is a 2'-O-methoxyethyl modification.

[0019] Further, the modification comprises at least 6 sugar modifications.

[0020] Further, the modification comprises 10 sugar modifications.

[0021] Further, the sugar modifications are located at both sides of the antisense oligonucleotide sequence.

[0022] Further, the antisense oligonucleotide comprises at least one internucleoside linkage modification and at least one sugar modification.

[0023] Further, the antisense oligonucleotide comprises an internucleoside linkage modification throughout the entire chain and at least one sugar modification.

[0024] Further, the antisense oligonucleotide comprises an internucleoside linkage modification throughout the entire chain and at least 6 sugar modifications.

[0025] Further, the antisense oligonucleotide comprises an internucleoside linkage modification throughout the entire chain and 10 sugar modifications.

[0026] Further, the modified antisense oligonucleotide has a sequence as set forth in SEQ ID NO. 25.

[0027] The second aspect of the present application provides a composition comprising the antisense oligonucleotide or salt thereof according to the first aspect of the present application.

[0028] Further, the composition further comprises a pharmaceutically acceptable carrier.

[0029] The third aspect of the present application provides a composition comprising an inhibitor of METTL3 and a drug for treating prostate cancer.

[0030] Further, the drug is selected from the group consisting of abiraterone, docetaxel, enzalutamide.

[0031] Further, the drug is enzalutamide.

[0032] Further, the inhibitor reduces the level of METTL3 mRNA or protein.

[0033] Further, the inhibitor is selected from the group consisting of nucleic acid inhibitor, protein inhibitor, proteolytic enzyme, protein binding molecule.

[0034] Further, the nucleic acid inhibitor is selected from the group consisting of shRNA, siRNA, dsRNA, microRNA, antisense oligonucleotide, or a construct capable of expressing or forming the shRNA, siRNA, dsRNA, microRNA, antisense oligonucleotide.

[0035] Further, the nucleic acid inhibitor is selected from the group consisting of shRNA, antisense oligonucleotide or nucleic acid construct thereof.

[0036] Further, the antisense oligonucleotide is as described in the first aspect of the present application.

[0037] Further, the composition further comprises a pharmaceutically acceptable carrier.

[0038] The fourth aspect of the present application provides a product for diagnosing drug-resistant prostate cancer, the product comprising a reagent for detecting METTL3.

[0039] Further, the reagent comprises a probe specifically recognizing METTL3; or

[0040] a primer specifically amplifying METTL3; or

[0041] an antibody or ligand specifically binding to METTL3.

[0042] Further, the product comprises a chip, a kit.

[0043] The fifth aspect of the present application provides a method for screening a candidate drug for treating drug-resistant prostate cancer, comprising: treating a culture system expressing or containing METTL3 gene or protein encoded thereby with a substance to be screened; and detecting the expression or activity of METTL3 gene or protein encoded thereby in the system; wherein, when the substance to be screened promotes the expression level or activity of METTL3 gene or protein encoded thereby, the substance to be screened is a candidate drug for treating drug-resistant prostate cancer.

[0044] The sixth aspect of the present application provides the use of any one of the following:

[0045] (1) the application of the antisense oligonucleotide of the first aspect of the application, the composition of the second aspect of the application or the third aspect of the application in the preparation of a pharmaceutical composition for treating castration-resistant prostate cancer;

[0046] (2) the application of the antisense oligonucleotide of the first aspect of the application, the composition of the second aspect of the application or the third aspect of the application in the preparation of a pharmaceutical composition for treating drug-resistant prostate cancer;

[0047] (3) the application of the reagent for detecting METTL3 in the preparation of a product for diagnosing drug-resistant prostate cancer;

[0048] (4) the application of METTL3 in the screening of candidate drugs for treating drug-resistant prostate cancer.

[0049] Further, the drug-resistant prostate cancer is selected from the group consisting of abiraterone-resistant, docetaxel-resistant and enzalutamide-resistant prostate cancer.

[0050] Further, the drug-resistant prostate cancer is enzalutamide-resistant prostate cancer.

[0051] Further, the product comprises a reagent for detecting the expression level of METTL3 gene or protein by RT-PCR method, RT-qPCR method, biochip detection method, Southern blotting method, in situ hybridization method and immunoblotting method.

[0052] Advantages and beneficial effects of the application:

[0053] The application first discovers that knocking out MEETL3 in combination with drugs for treating prostate cancer has a synergistic effect of resisting castration-resistant prostate cancer, thereby providing a new treatment method for treating castration-resistant prostate cancer.

[0054] The application first discovers that using a MEETL3 inhibitor in combination with drugs for treating prostate cancer can restore the sensitivity of drug-resistant tumors to drugs, thereby providing a new method for treating drug-resistant cancer.

[0055] The application provides a method for designing and modifying antisense oligonucleotides, and the antisense oligonucleotides designed by the method have high knock-out efficiency. BRIEF DESCRIPTION OF DRAWINGS

[0056] Figure 1 is a graph showing the effect of METTL3 on castration-resistant prostate cancer cell lines, wherein 1A is a graph showing the effect of MTT on the proliferation of LNCap-AI by METTL3; 1B is a graph showing the effect of plate cloning on the growth of LNCap-AI by METTL3; Figure 1 C is a graph showing the effect of MTT on the proliferation of C4-2 by METTL3; and 1D is a graph showing the effect of plate cloning on the growth of C4-2 by METTL3.

[0057] Figure 2 Figure 2 is a cell morphology chart, wherein 2A is a cell morphology chart of C4-2; 2B is a cell morphology chart of drug-resistant cell strain C4-2 EnzR ;

[0058] Figure 3 Figure 3 is an enzalutamide dose-dependent curve chart;

[0059] Figure 4 Figure 4 is a METTL3 expression chart;

[0060] Figure 5 Figure 5 is a RT-QPCR detection ASO knockdown effect chart; wherein 5A is a knockdown effect chart of ASO at a concentration of 200nM after 48h; 5B is a knockdown effect chart of ASO at a concentration of 100nM after 24h;

[0061] Figure 6 Figure 6 is a RT-qQPCR detection of different modified ASO knockdown effect chart; wherein 6A is a knockdown effect chart of ASO with different modification methods; 6B is a knockdown effect chart of ASO with different modification site numbers;

[0062] Figure 7 Figure 7 is a METTL3 effect on prostate cancer drug-resistant cell strains chart; wherein 7A is a METTL3 expression chart; 7B is an RNA m6A level chart; 7C is a chart of the effect of METTL3 inhibitor combined with enzalutamide on the proliferation of drug-resistant cell strains. DETAILED DESCRIPTION

[0063] The present application is the first to prove that METTL3 plays an important role in castration-resistant prostate cancer. And further through the design of antisense oligonucleotides with high knockdown efficiency, it is proved that the knockdown of METTL3 can increase the sensitivity of drug-resistant cell strains to drugs.

[0064] The term "oligonucleotide" generally includes a molecule of two or more covalently linked nucleosides. Such covalently linked nucleosides can also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are typically synthesized first by solid-phase chemistry and then purified and isolated. When referring to the sequence of an oligonucleotide, reference is made to the sequence or order of the nucleobase portions of the covalently linked nucleotides or nucleosides, or modifications thereof. The oligonucleotides of the present application are artificial and are chemically synthesized and are typically purified or isolated. The oligonucleotides of the present application can include one or more modified nucleosides or nucleotides, such as 2' sugar modified nucleosides.

[0065] The term "antisense oligonucleotide" is defined as an oligonucleotide capable of modulating the expression of a target gene by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid. The antisense oligonucleotide is not essentially double-stranded, and thus not an siRNA or shRNA.

[0066] Nucleotides are the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present application include both naturally occurring and non-naturally occurring nucleotides. In fact, nucleotides such as DNA and RNA nucleotides include a ribose sugar moiety, a nucleobase moiety, and one or more phosphate groups (which are not present in nucleosides). Nucleosides and nucleotides can also be referred to interchangeably as "units" or "monomers".

[0067] As used herein, the term "modified nucleoside" or "nucleoside modification" refers to a nucleoside that is modified by the introduction of one or more modifications to the sugar moiety or the (nucleo)base moiety as compared to an equivalent DNA or RNA nucleoside. In preferred embodiments, the modified nucleoside comprises a modified sugar moiety. The term modified nucleoside is also used herein interchangeably with the term "nucleoside analog" or modified "unit" or modified "monomer".

[0068] The term modified oligonucleotide describes an oligonucleotide comprising one or more sugar-modified nucleosides and / or modified internucleoside linkages.

[0069] According to the present application, the target nucleic acid is a nucleic acid encoding a mammalian METTL3, and can for example be a gene, an RNA, an mRNA and a pre-mRNA, a mature mRNA or a cDNA sequence. The target can thus be referred to as a METTL3 target nucleic acid. Suitably, the target nucleic acid encodes a METTL3 protein, in particular a mammalian METTL3, for example a human METTL3 (gene ID: 56339).

[0070] For in vivo or in vitro applications, the oligonucleotides of the present application are generally capable of inhibiting the expression of a METTL3 target nucleic acid in a cell expressing the METTL3 target nucleic acid. The contiguous sequence of nucleobases of the oligonucleotides of the present application is generally complementary to the METTL3 target nucleic acid, as measured over the length of the oligonucleotide, optionally except for one or two mismatches, and optionally excluding nucleotide-based linkers that can link the oligonucleotide to an optional functional group, such as conjugates or other non-complementary terminal nucleotides. In some embodiments, the target nucleic acid can be an RNA or a DNA, such as a messenger RNA, for example a mature mRNA or a pre-mRNA.

[0071] Sugar modifications

[0072] The oligomers of the present application can comprise one or more nucleosides with a modified sugar moiety (i.e. a modification of the sugar moiety) when compared to the ribose sugar moiety found in DNA and RNA.

[0073] A number of modified nucleosides with ribose moieties have been prepared, primarily with the aim of improving certain properties of oligonucleotides, such as affinity and / or nuclease resistance.

[0074] Such modifications include those in which the ribose ring structure is modified, for example, by replacing the ribose ring structure with a hexose ring (HNA) or a bicyclic ring, typically with a biradical bridge between the C2 and C4 carbon atoms of the ribose ring (LNA), or an unlinked ribose ring lacking a bond between C2 and C3 (e.g. UNA).

[0075] Sugar modifications also include modifications made by altering the substituent on the ribose ring to a group other than hydrogen or the 2'-OH group naturally occurring in DNA and RNA nucleosides. For example, a substituent can be introduced at the 2', 3', 4' or 5' position.

[0076] 2' sugar modified nucleosides

[0077] A 2' sugar modified nucleoside is a nucleoside having a substituent at the 2' position other than H or -OH (2' substituted nucleoside) or comprising a 2' linking biradical capable of forming a bridge between the 2' carbon and a second carbon atom in the ribose ring, such as a LNA (2'-4' biradical bridged) nucleoside.

[0078] Examples of 2' substituted modified nucleosides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-oxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA and 2'-F-ANA nucleosides.

[0079] The term "treatment" as used herein refers to both the treatment of existing disorders (e.g. a disease or condition as referred to herein) and the prophylaxis or prevention of disease. It will therefore be appreciated that, in some embodiments, treatment as referred to herein can be prophylactic in nature.

[0080] Antisense oligonucleotide

[0081] The present application provides a modified antisense oligonucleotide consisting of 15-30 nucleotides, which inhibits the expression of METTL3.

[0082] In some embodiments, the antisense oligonucleotide consists of 18-22 nucleotides.

[0083] In a particular embodiment of the application, the antisense oligonucleotide consists of 20 nucleotides.

[0084] In some embodiments, the antisense oligonucleotide is selected from the sequences described in any one of SEQ ID NO. 1-11.

[0085] In preferred embodiments, the sequence of the antisense oligonucleotide is set forth in SEQ ID NO. 2.

[0086] In some embodiments, the modification of the antisense oligonucleotide comprises at least one internucleoside linkage modification.

[0087] As a preferred embodiment, the modification of the antisense oligonucleotide comprises a full chain of internucleoside linkage modification.

[0088] In some embodiments, the internucleoside linkage modification is a phosphorothioate modification.

[0089] In specific embodiments, the antisense oligonucleotide is selected from the sequences set forth in any one of SEQ ID NOs. 12-22.

[0090] In preferred embodiments, the antisense oligonucleotide is the sequence set forth in SEQ ID NO. 13.

[0091] In some embodiments, the modification of the antisense oligonucleotide comprises at least one sugar modification.

[0092] In some embodiments, the modification of the antisense oligonucleotide comprises at least 6 sugar modifications.

[0093] In some embodiments, the modification of the antisense oligonucleotide comprises at least 10 sugar modifications.

[0094] In some embodiments, the sugar modification of the antisense oligonucleotide is located at both sides of the antisense oligonucleotide sequence.

[0095] As a preferred embodiment, the sugar modification is a 2’-O-methoxyethyl modification.

[0096] In preferred embodiments, the antisense oligonucleotide comprises at least one internucleoside linkage modification and at least one sugar modification. Preferably, the antisense oligonucleotide comprises a full chain of internucleoside linkage modification and at least one sugar modification. More preferably, the antisense oligonucleotide comprises a full chain of internucleoside linkage modification and at least 6 sugar modifications. More preferably, the antisense oligonucleotide comprises a full chain of internucleoside linkage modification and 10 sugar modifications.

[0097] In specific embodiments, the antisense oligonucleotide is selected from the sequences set forth in any one of SEQ ID NOs. 24-27. In preferred embodiments, the antisense oligonucleotide is selected from the sequence set forth in SEQ ID NO. 25.

[0098] Compositions

[0099] In some embodiments, the present application provides a composition comprising an inhibitor of METTL3.

[0100] The inhibitor of METTL3 refers to any substance that can reduce the activity of METTL3 protein, reduce the stability of METTL3 gene or protein, down-regulate the expression of METTL3 protein, reduce the effective action time of METTL3 protein, or inhibit the transcription and translation of METTL3 gene, which can be used in the present application as a substance useful for down-regulating METTL3, thereby being useful for preventing or treating prostate cancer. For example, the inhibitor includes nucleic acid inhibitors, protein inhibitors, proteolytic enzymes, and protein binding molecules. Among them, the nucleic acid inhibitors include, but are not limited to, shRNA (small hairpin RNA), small interfering RNA (siRNA), dsRNA, microRNA, antisense oligonucleotide, or a construct capable of expressing or forming the shRNA, small interfering RNA, dsRNA, microRNA, or antisense oligonucleotide. The protein binding molecules are selected from substances that specifically bind to METTL3 protein, such as antibodies or ligands capable of inhibiting the activity of METTL3 protein.

[0101] As an alternative way of the present application, the inhibitor of METTL3 is an antibody that specifically binds to METTL3. The specific antibody includes monoclonal antibodies, polyclonal antibodies; the present application not only includes intact antibody molecules, but also any fragments or modifications of antibodies, for example, chimeric antibodies, scFv, Fab, F(ab')2, Fv, etc. As long as the fragments can retain the binding ability to METTL3 protein. The preparation of antibodies at the protein level is well known to those skilled in the art, and any method can be used to prepare the antibodies in the present application

[0102] As a preferred way of the present application, the inhibitor of METTL3 is a small interfering RNA molecule specific to METTL3. As used herein, the "small interfering RNA" refers to a short fragment of double-stranded RNA molecule, which can target specific mRNA for degradation with homologous complementary sequence, which is the process of RNA interference (RNA interference). Small interfering RNA can be prepared in the form of double-stranded nucleic acid, which contains a sense strand and an antisense strand, and the two strands form a double strand only under hybridization conditions. A double-stranded RNA complex can be prepared from a sense strand and an antisense strand separated from each other. Therefore, for example, the complementary sense strand and antisense strand are chemically synthesized, and then can be hybridized by annealing to produce a synthetic double-stranded RNA complex.

[0103] As an alternative of the present application, the inhibitor of METTL3 can also be a "small hairpin RNA (shRNA)", which is a non-coding small RNA molecule capable of forming a hairpin structure. The small hairpin RNA can inhibit the expression of a gene through the RNA interference pathway. As described above, the shRNA can be expressed from a double-stranded DNA template. The double-stranded DNA template is inserted into a vector, such as a plasmid or a viral vector, and then connected to a promoter for expression in vitro or in vivo. The shRNA is cut into small interfering RNA molecules by DICER enzyme in eukaryotic cells, thereby entering the RNAi pathway.

[0104] The "shRNA expression vector" refers to a plasmid commonly used in the art for constructing the shRNA structure. Generally, there is a "spacer sequence" and a multiple cloning site or a replacement sequence on both sides of the "spacer sequence" on the plasmid, so that people can insert the corresponding DNA sequence of the shRNA (or analog) into the multiple cloning site or replace the replacement sequence on it in a forward and reverse manner. The RNA transcribed after the DNA sequence can form a shRNA (Short Hairpin) structure. The "shRNA expression vector" can be completely purchased through commercial channels at present, such as some viral vectors.

[0105] As a preferred embodiment of the present application, the inhibitor of METTL3 is an antisense oligonucleotide. In the present application, the antisense oligonucleotide is as described above.

[0106] In some embodiments, the composition further comprises a drug for treating prostate cancer. The drug includes but is not limited to abiraterone, docetaxel, enzalutamide.

[0107] In the present application, the pharmaceutically acceptable carrier includes but is not limited to diluents, buffers, suspensions, emulsions, granules, encapsulations, excipients, fillers, binders, sprays, transdermal absorption agents, wetting agents, disintegrants, absorption promoters, surfactants, colorants, flavoring agents, adsorption carriers, etc.

[0108] In embodiments, the practice of the invention includes administering at least one of the above antisense oligonucleotides or compositions with an appropriate nucleic acid delivery system. In one embodiment, the system includes a non-viral vector operably linked to the polynucleotide. Examples of such non-viral vectors include the oligonucleotide alone or in combination with an appropriate protein, polysaccharide, or lipid formulation.

[0109] Further suitable nucleic acid delivery systems include viral vectors, typically sequences from at least one of an adenovirus, an adeno-associated virus (AAV), a helper-dependent adenovirus, a retrovirus, or a hemagglutinating virus of Japan-liposome (HVJ) complex. Preferably, the viral vector includes a strong eukaryotic promoter, such as a cytomegalovirus (CMV) promoter, operably linked to the polynucleotide.

[0110] Further preferred vectors include viral vectors, fusion proteins, and chemical conjugates. Retroviral vectors include Moloney's murine leukemia virus and HIV-based viruses. One preferred HIV-based viral vector includes at least two vectors, wherein the gag and pol genes are from the HIV genome and the env gene is from another virus. DNA viral vectors are preferred. These vectors include poxvirus vectors such as orthopoxvirus or fowlpox virus vectors, herpesvirus vectors such as herpes simplex virus type I (HSV) vectors, adenovirus vectors, and adeno-associated virus vectors.

[0111] The compositions of the present application encompass any pharmaceutically acceptable salt, ester, or salt of such ester, or any other compound or residue thereof which, when administered to an animal (including a human), is capable of providing (directly or indirectly) the biologically active metabolite.

[0112] Applications

[0113] The present application provides the aforementioned antisense oligonucleotides against METTL3 and compositions in the treatment of castration-resistant prostate cancer and in the treatment of drug-resistant prostate cancer.

[0114] In some embodiments, the castration-resistant prostate cancer is treated using an inhibitor of METTL3. When an inhibitor of METTL3 is used, the cell proliferative activity of the castration-resistant prostate cancer is reduced;

[0115] In a preferred embodiment, the castration-resistant prostate cancer is treated using an inhibitor of METTL3 in combination with a drug for treating prostate cancer. The inhibitor of METTL3 and the drug for treating prostate cancer produce a synergistic therapeutic effect when used to treat the castration-resistant prostate cancer.

[0116] In some embodiments, the drug-resistant prostate cancer is treated using a composition typically consisting of an inhibitor of MEETL3 in combination with a drug for treating prostate cancer. The drug includes but is not limited to abiraterone, docetaxel, enzalutamide, depending on the type of drug-resistant prostate cancer. The inhibitor of MEETL3 can restore the sensitivity of the drug-resistant cancer to the drug.

[0117] In some embodiments, the drug-resistant prostate cancer is enzalutamide-resistant prostate cancer, and the prostate cancer is treated using an inhibitor of MEETL3 in combination with enzalutamide.

[0118] In some embodiments, when the drug-resistant prostate cancer is abiraterone-resistant prostate cancer, the MEETL3 inhibitor is used in combination with abiraterone to treat the prostate cancer.

[0119] In some embodiments, when the drug-resistant prostate cancer is docetaxel-resistant prostate cancer, the MEETL3 inhibitor is used in combination with docetaxel to treat the prostate cancer.

[0120] The present application is based on the up-regulation of METTL3 expression in drug-resistant prostate cancer, and further provides the use of METTL3 in the diagnosis of drug-resistant prostate cancer. By detecting the expression level of METTL3, it is determined whether the subject is drug-resistant.

[0121] The METTL3 of the present application is detected using various nucleic acid and protein techniques known to those of ordinary skill in the art, including but not limited to: nucleic acid sequencing, nucleic acid hybridization, nucleic acid amplification techniques, protein immunological techniques.

[0122] Exemplary non-limiting examples of nucleic acid sequencing techniques include, but are not limited to, chain terminator (Sanger) sequencing and dye terminator sequencing. Those of ordinary skill in the art will recognize that, because RNA is less stable in cells and more susceptible to nuclease attack in experiments, RNA is typically reverse transcribed into DNA prior to sequencing.

[0123] Exemplary non-limiting examples of nucleic acid hybridization techniques include, but are not limited to, in situ hybridization (ISH), microarray, and Southern or Northern blotting. In situ hybridization (ISH) is a hybridization that uses a labeled complementary DNA or RNA strand as a probe to locate specific DNA or RNA sequences in a portion of a tissue or a section of a tissue (in situ) or the entire tissue if it is small enough (whole tissue-embedded ISH). DNA ISH can be used to determine the structure of a chromosome. RNA ISH is used to measure and locate mRNA and other transcripts (e.g., ncRNA) within a tissue section or whole tissue-embedded. Sample cells and tissues are typically treated to fix target transcripts in situ and to increase probe access. The probe is hybridized to the target sequence at high temperature, and then the excess probe is washed away. The probes labeled with radioactive, fluorescent, or antigenic bases in the tissue are located and quantified using autoradiography, fluorescent microscopy, or immunohistochemistry, respectively. ISH can also use two or more probes labeled with radioactivity or other non-radioactive markers to detect two or more transcripts simultaneously.

[0124] The present application can amplify the nucleic acid (e.g., ncRNA) prior to detection or concurrently with detection. Exemplary, non-limiting examples of nucleic acid amplification techniques include, but are not limited to, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), transcription-mediated amplification (TMA), ligase chain reaction (LCR), strand displacement amplification (SDA), and nucleic acid sequence-based amplification (NASBA). One of ordinary skill in the art will recognize that certain amplification techniques (e.g., PCR) require reverse transcription of RNA to DNA prior to amplification (e.g., RT-PCR), while other amplification techniques directly amplify RNA (e.g., TMA and NASBA).

[0125] Protein immunoassays include sandwich immunoassays, such as sandwich ELISA, in which detection of a biomarker is performed using two antibodies recognizing different epitopes on the biomarker; radioimmunoassays (RIA), direct, indirect or competitive enzyme-linked immunosorbent assays (ELISA), enzyme immunoassays (EIA), fluorescence immunoassays (FIA), Western blotting, immunoprecipitation and any particle-based immunoassay (e.g. using gold particles, silver particles or latex particles, magnetic particles or quantum dots). Immunoassays can be performed, for example, in the format of microtiter plates or strips.

[0126] The application will be further described in greater detail by way of reference to the following drawings and embodiments. Thus, the breadth and scope of the present application should not be limited to any of the above described embodiments. The following examples are intended to illustrate but not limit the scope of the present application. Methods of experiments not specifically described in the examples were generally performed according to routine conditions, or according to the conditions recommended by the manufacturer.

[0127] Example 1 Effect of METTL3 on enzalutamide resistance in castration-resistant prostate cancer cell lines C4-2 and LNCap-AI

[0128] Using lentivirus transfection, a vector carrying sh-METTL3 sequence and puromycin resistance gene was transfected into LNCAP-AI and C4-2 cell lines. After transfection of the virus, the cells were cultured for one week, and then selected using puromycin to obtain stable cell lines with METTL3 knockdown.

[0129] The control cells and the knockdown cells were plated in 96-well plates (n=5) and 6-well plates, respectively, at 2000 cells per well, and were given enzalutamide and DMSO, respectively.

[0130] For 96-well plates, place in a 37°C, 5% CO2 incubator, and take out a 96-well plate every 24 hours. Prepare a tetramethylazoline (MTT) solution using PBS solution or physiological saline as a solvent, with a final concentration of 5 mg / ml. Add 10 μl of MTT solution to each well, and incubate again at 37°C, 5% CO2 incubator for 2 hours. After 2 hours, take out the 96-well plate, gently invert it on filter paper, add 150 μl of DMSO solution to each well, and shake on a shaker for 30 minutes in the dark to fully dissolve the formazan crystals. Use a microplate reader to detect the absorbance of each well at OD 490 nm, record the values, and then take out a 96-well plate every 24 hours for the above operation, and calculate uniformly.

[0131] For 6-well plates, place in a 37°C, 5% CO2 incubator, and plate for 6 days. Then fix the cell colonies using methanol (15 min), and then use crystal violet staining (30 min) and gently rinse clean. Finally, observe the number / size of clone formation.

[0132] The experimental results show that knocking out METTL3 significantly reduces the proliferation ability and cell viability of the cells, and sh-METTL3 combined with enzalutamide produces a synergistic effect.

[0133] Example 2 Expression of METTL3 in drug-resistant castration-resistant prostate cancer cell lines

[0134] 1. Construction of enzalutamide-resistant castration-resistant prostate cancer cell lines

[0135] The prostate cancer cell line C4-2 was cultured in RPMI-1640 medium containing 10% fetal bovine serum, and different concentrations of enzalutamide (5 μM, 10 μM, 20 μM, 40 μM) were gradually added to the medium. The cells were cultured in a cell culture incubator at 37°C, 5% CO2. During the culture process, it was determined whether to change the cell liquid and subculture the cells according to the actual growth of the cells. When the cells were cultured in 40 μM enzalutamide, the growth and proliferation rate was generally consistent with that of the primary C4-2 cells cultured in 10% fetal bovine serum RPMI-1640 medium.

[0136] Using a microscope to observe the drug-resistant cells and the original cells showed significant morphological differences Figure 2 ).

[0137] 2. MTT detection of the response of different cell lines to enzalutamide

[0138] After giving different concentrations of enzalutamide to the two types of cells, MTT experiments were performed (the detailed steps are the same as in Example 1).

[0139] Calculate the IC of enzalutamide on different cell lines 50, results showed IC 50 original 17.1 μΜ rose to 62.8 μΜ( Figure 3 ), indicating that enzalutamide-resistant cell lines were successfully constructed, and the cell line at this stage became C4-2 EnzR .

[0140] 3, detect the expression level of METTL3 in drug-resistant cell lines

[0141] Using Western Blotting to detect the expression of METTL3 protein in drug-resistant cells, the results showed that compared with cell line C4-2, the METTL3 protein in C4-2 EnzR significantly increased( Figure 4 ).

[0142] Example 3 Design and detection of antisense oligonucleotide of METTL3

[0143] 1. Biological identification of ASO sequence and comparison of modification scheme and site effect

[0144] Using BLAST biological serial information primary structure online comparison tool in NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to compare and analyze the mRNA structure information of Mettl3 mRNA each transcript, and record its consensus sequence. Using the "soligo" page in the sfold RNA secondary structure online prediction tool (http: / / sfold.wadsworth.org / cgi-bin / index.pl), input the consensus sequence of each transcript of Mettl3, the oligo length is selected as 20 nt, submit and record the screening results.

[0145] All ASO sequences (Table 1) were purchased from the company (Shengong Sagon) and only basic modification (Table 2) was used.

[0146] Table 1 ASO sequence

[0147] ASO sequence Sequence ID NO. GGTGTAGCAACTTCTTCTCT SEQ ID NO. 1 TCTTTTCTGCCACAGCACCC SEQ ID NO. 2 GTTGGTTCAGAAGGCTCTCT SEQ ID NO. 3 CGTGTGGTCTTTGCTGCCAG SEQ ID NO. 4 AGGGTGGGTCAGCCATCACA SEQ ID NO. 5 CCAAGCAGTGTTCCTTCCCA SEQ ID NO. 6 GAGTGCCAGGAGATAGTCTT SEQ ID NO. 7 GGTGGATCCCATCCAGTTGG SEQ ID NO. 8 GTAGGTGGATCCCATCCAGT SEQ ID NO. 9 GGCTATGGATTCTTAGCTCT SEQ ID NO. 10 GAGCCATGGCTATGGATTCT SEQ ID NO. 11

[0148] Table 2 modified ASO sequence

[0149] Number ASO sequence Sequence ID NO. ASO-1 G*G*T*G*T*A*G*C*A*A*C*T*T*C*T*T*C*T*C*T SEQ ID NO. 12 ASO-2 T*C*T*T*T*T*C*T*G*C*C*A*C*A*G*C*A*C*C*C SEQ ID NO. 13 ASO-3 G*T*T*G*G*T*T*C*A*G*A*A*G*G*C*T*C*T*C*T SEQ ID NO. 14 ASO-4 C*G*T*G*T*G*G*T*C*T*T*T*G*C*T*G*C*C*A*G SEQ ID NO. 15 ASO-5 A*G*G*G*T*G*G*G*T*C*A*G*C*C*A*T*C*A*C*A SEQ ID NO. 16 ASO-6 C*C*A*A*G*C*A*G*T*G*T*T*C*C*T*T*C*C*C*A SEQ ID NO. 17 ASO-7 G*A*G*T*G*C*C*A*G*G*A*G*A*T*A*G*T*C*T*T SEQ ID NO. 18 ASO-8 G*G*T*G*G*A*T*C*C*C*A*T*C*C*A*G*T*T*G*G SEQ ID NO. 19 ASO-9 G*T*A*G*G*T*G*G*A*T*C*C*C*A*T*C*C*A*G*T SEQ ID NO. 20 ASO-10 G*G*C*T*A*T*G*G*A*T*T*C*T*T*A*G*C*T*C*T SEQ ID NO. 21 ASO-11 G*A*G*C*C*A*T*G*G*C*T*A*T*G*G*A*T*T*C*T SEQ ID NO. 22 SEQ ID NO. 22

[0150] Note: * represents phosphorothioate modification.

[0151] 2. RT-qPCR detection of ASO Mettl3 knockout effect

[0152] C4-2 cells were cultured in vitro in six-well plates, and the cells were transfected 24 hours after plating. First, the antisense oligonucleotide ASO Mettl3 was mixed with the lipofectin transfection reagent and incubated at room temperature for 20 minutes, and then the mixture was evenly added to the culture medium. The ASO Mettl3 was allowed to have a final concentration of 0 nM, 100 nM, and 200 nM in the culture medium, respectively. After 24 and 48 hours, respectively, the cell culture medium was removed, and Trizol reagent was added to extract total RNA from the cells. The total RNA was reverse transcribed into cDNA using the Thermo RevertAid First Strand cDNA Synthesis Kit, and RT-qPCR reaction was performed using the CWBIO 2x Taq MasterMix, Mettl3 primers, and Sangon Biotech GAPDH internal reference primers, and the Ct value was calculated and converted to obtain the relative level of mRNA.

[0153] The results show that the ASO (ASO-2) has strong knockout ability Figure 5 , and the subsequent modification and modification site experiment will use this sequence.

[0154] 3. Knockout effect detection of different modification methods

[0155] The sequences based on the ASO-2 sequence with different modification methods were synthesized from the company (Shengong Sagon), including full-chain RNA, full-chain DNA, full-chain 2-MOE, and GAPMER-2-MOE different modification strategies, as shown in Table 3. After transfection-RNA extraction-RT-qPCR experiment, the Ct value was calculated and converted to obtain the relative level of mRNA, and the specific operation steps are the same as above.

[0156] Table 3 ASO with different modifications

[0157]

[0158] Note: * represents phosphorothioate modification; i2OMe represents 2'-O-methoxyethyl modification

[0159] The results show that the ASO with GAPMER-2-MOE modification has strong knockout ability Figure 6 A) under the same sequence conditions.

[0160] Since the number of 2-MOE modification on both sides of GAPMER modification strategy is not fixed. In order to further optimize the knockdown efficiency, the number of modification on both sides of ASO was further compared (as shown in Table 4) and synthesized from the company (Shenguo Sagon), in which ASO-2-flank5 and GAPMER-2MOE are the same, and the same ASO transfection-RNA extraction-RT-qPCR experiment process was carried out, and the specific operation steps are the same as above.

[0161] Table 4 ASO with different number of modifications

[0162]

[0163] Note: * represents phosphorothioate modification; i2OMe represents 2'-O-methoxyethyl modification The results show that when using ASO-2-flank5 modification, the number of 2-MOE modification on both sides is 5, which can obtain the strongest knockdown effect Figure 6 B).

[0164] Example 4 Antisense oligonucleotide ASO Mettl3 Effect on C4-2 EnzR cells

[0165] 1, RT-qPCR detection

[0166] The ASO-2-flank5 was transfected into C4-2 EnzR cells, and the relative expression level of METTL3 was detected by RT-qPCR, and the method was the same as that in Example 3.

[0167] The results are shown in Figure 7 A, 48 hours after transfection, the expression level of METTL3 in C4-2 EnzR cells was significantly reduced.

[0168] 2, Dot-blot method for detecting cell m6A level

[0169] Dilute the extracted sample RNA to 100 ng / ul and put into 95℃ constant temperature metal bath for 5 minutes, then immediately put on ice. Drop the RNA on the NC membrane and mark it to show the positive and negative. Put into the ultraviolet crosslinking instrument and crosslink using 254 nm for 5 minutes. Dissolve with PBST buffer solution, configure 5% skim milk powder blocking solution. Put the ultraviolet crosslinked NC membrane into a clean tray containing PBST solution for washing. At room temperature, use a shaker to gently shake for 5 minutes each time for three times. Wash away the unbound RNA. Then discard the PBST buffer solution, add 5% skim milk blocking solution using PBST as the solution, incubate at room temperature for one hour. After blocking is completed, wash the NC membrane with PBST buffer solution again for three times, 5 minutes each time. Dilute the anti-m6A antibody according to the instructions, 1:500 dilution with PBST buffer solution, configure the working solution with a final concentration of 2 ug / ml. Soak the washed NC membrane in the primary antibody working solution, incubate in the refrigerator at 4℃ on the shaker overnight. The next day, recover the primary antibody working solution, and soak the NC membrane in PBST buffer solution for three times, 5 minutes each time, to remove the unbound primary antibody. Then incubate with the secondary antibody, at room temperature, gently shake for 1 hour on the shaker. Then recover the secondary antibody, wash the membrane with PBST buffer solution for three times, 10 minutes each time. Turn on the exposure machine and precool to -40℃. Configure the chemiluminescence developing solution (ECL) freshly, mix A and B solutions in the dark according to 1:1, drop on the membrane, and put into the exposure machine for development and exposure.

[0170] The results show that the level of m6A in the ASO-2-flank5 group is significantly lower than that in the ASO-con group Figure 7 B).

[0171] 3, MTT detection of cell proliferation ability

[0172] The cells in the ASO-con and ASO-2-flank5 groups were given enzalutamide (20 nM) and MTT experiments were performed, with the detailed steps being the same as in Example 1.

[0173] The results show that the enzalutamide-resistant cell line transfected with ASO-2-flank5 has a significantly reduced cell viability in the presence of enzalutamide compared to the control group Figure 7 C), indicating that knocking down Mettl3 can reverse the sensitivity of the drug to enzalutamide.

[0174] The above description of the embodiments is only for the purpose of understanding the method of the present application and its core idea. It should be noted that those skilled in the art can make several improvements and modifications to the present application without departing from the principles of the present application, and these improvements and modifications will also fall within the scope of protection of the claims of the present application. SEQUENCE LISTING <110> Tianjin Urology Institute <120> Antisense oligonucleotides of METTL3 and their use in prostate cancer <141> 14-February-2022 <160> 27 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <400> 1 ggtgtagcaa cttcttctct 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 tcttttctgc cacagcaccc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 gttggttcag aaggctctct 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 cgtgtggtct ttgctgccag 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 agggtgggtc agccatcaca 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 ccaagcagtg ttccttccca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <400> 7 gagtgccagg agatagtctt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <400> 8 ggtggatccc atccagttgg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <400> 9 gtaggtggat cccatccagt 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <400> 10 ggctatggat tcttagctct 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <400> 11 gagccatggc tatggattct 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> modified_base <222> (1)..(20) <223> phosphorothioate modification <400> 12 ggtgtagcaa cttcttctct 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> modified_base <222> (1)..(20) <223> phosphorothioate modification <400> 13 tcttttctgc cacagcaccc 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> modified_base <222> (1)..(20) <223> phosphorothioate modification <400> 14 gttggttcag aaggctctct 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> modified_base <222> (1)..(20) <223> phosphorothioate modification <400> 15 cgtgtggtct ttgctgccag 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> modified_base <222> (1)..(20) <223> phosphorothioate modification <400> 16 agggtgggtc agccatcaca 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> modified_base <222> (1)..(20) <223> phosphorothioate modification <400> 17 ccaagcagtg ttccttccca 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> modified_base <222> (1)..(20) <223> phosphorothioate modification <400> 18 gagtgccagg agatagtctt 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> modified_base <222> (1)..(20) <223> phosphorothioate modification <400> 19 ggtggatccc atccagttgg 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> modified_base <222> (1)..(20) <223> phosphorothioate modification <400> 20 gtaggtggat cccatccagt 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> modified_base <222> (1)..(20) <223> phosphorothioate modification <400> 21 ggctatggat tcttagctct 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> modified_base <222> (1)..(20) <223> phosphorothioate modification <400> 22 gagccatggc tatggattct 20 <210> 23 <211> 20 <212> DNA / RNA <213> Artificial Sequence <220> <221> modified_base <222> (1)..(20) <223> phosphorothioate modification <400> 23 ucuuuucugc cacagcaccc 20 <210> 24 <211> 20 <212> DNA / RNA <213> Artificial Sequence <220> <221> modified_base <222> (1)..(20) <223> phosphorothioate modification <220> <221> modified_base <222> (1)..(20) <223> methoxyethyl modification <400> 24 ucuuuucugc cacagcaccc 20 <210> 25 <211> 20 <212> DNA / RNA <213> Artificial Sequence <220> <221> modified_base <222> (1)..(20) <223> phosphorothioate modification <220> <221> modified_base <222> (1)..(5) <223> methoxyethyl modification <220> <221> modified_base <222> (16)..(20) <223> methoxyethyl modification <400> 25 ucuuutctgc cacagcaccc 20 <210> 26 <211> 20 <212> DNA / RNA <213> Artificial Sequence <220> <221> modified_base <222> (1)..(20) <223> phosphorothioate modification <220> <221> modified_base <222> (1)..(1) <223> methoxyethyl modification <220> <221> modified_base <222> (20)..(20) <223> methoxyethyl modification <400> 26 ucttttctgc cacagcaccc 20 <210> 27 <211> 20 <212> DNA / RNA <213> Artificial Sequence <220> <221> modified_base <222> (1)..(3) <223> methoxyethyl modification <220> <221> modified_base <222> (18)..(20) <223> methoxyethyl modification <220> <221> modified_base <222> (1)..(1) <223> methoxyethyl modification <400> 27 ucutttctgc cacagcaccc 20

Claims

1. A modified antisense oligonucleotide, characterized in that, The antisense oligonucleotide inhibits the expression of METTL3; the sequence of the antisense oligonucleotide is shown in SEQ ID NO.2, and the modification is a nucleoside modification and / or a nucleoside inter-bond modification.

2. The antisense oligonucleotide according to claim 1, characterized in that, The modification includes at least one nucleoside inter-bond modification.

3. The antisense oligonucleotide according to claim 2, characterized in that, The nucleoside inter-bond modification is a thiophosphate modification.

4. The antisense oligonucleotide according to claim 2 or 3, characterized in that, The modifications include full-chain nucleoside inter-bond modifications.

5. The antisense oligonucleotide according to claim 1, characterized in that, The modification includes at least one sugar modification.

6. The antisense oligonucleotide according to claim 5, characterized in that, The sugar modification is 2′-O-methoxyethyl modification.

7. The antisense oligonucleotide according to claim 6, characterized in that, The modifications include at least six sugar modifications.

8. The antisense oligonucleotide according to claim 7, characterized in that, The modifications include 10 sugar modifications.

9. The antisense oligonucleotide according to any one of claims 5-8, characterized in that, The sugar modification is located on both sides of the antisense oligonucleotide sequence.

10. The antisense oligonucleotide according to claim 1, characterized in that, The antisense oligonucleotide includes at least one nucleoside internucleotide modification and at least one sugar modification.

11. The antisense oligonucleotide according to claim 10, characterized in that, The antisense oligonucleotide includes full-chain nucleoside inter-linking modification and at least one sugar modification.

12. The antisense oligonucleotide according to claim 11, characterized in that, The antisense oligonucleotide includes full-chain nucleoside internucleotide modifications and at least six sugar modifications.

13. The antisense oligonucleotide according to claim 12, characterized in that, The antisense oligonucleotide includes full-chain nucleoside inter-nucleotide modifications and 10 sugar modifications.

14. The antisense oligonucleotide according to claim 13, characterized in that, The sequence of the antisense oligonucleotide is shown in SEQ ID NO.

25.

15. A composition, characterized in that, The composition comprises the antisense oligonucleotide or a salt thereof as described in any one of claims 1-14.

16. The composition according to claim 15, characterized in that, The composition also includes a pharmaceutically acceptable carrier.

17. A composition, characterized in that, The composition comprises an inhibitor of METTL3 and enzalutamide, a drug for treating prostate cancer; the inhibitor is selected from antisense oligonucleotides as described in any one of claims 1-14.

18. The composition according to claim 17, characterized in that, The composition also includes a pharmaceutically acceptable carrier.

19. The use of the antisense oligonucleotide according to any one of claims 1-14, or the composition according to any one of claims 15-18, in the preparation of a pharmaceutical composition for treating drug-resistant prostate cancer.

20. The application according to claim 19, characterized in that, The drug-resistant prostate cancer mentioned is enzalutamide-resistant prostate cancer.

Images