A molecular marker for identifying genetic sex of chelonodon lineatus, primer, method and application

Abstract

The application discloses a molecular marker for identifying the genetic sex of a Zebra shark and a method for identifying male and female Zebra sharks, wherein the sequence of the molecular marker is shown as SEQ ID NO. 1. The method for identifying the genetic sex of the Zebra shark is simple and fast in operation, and a small amount of back fin is cut for sample collection, so that the Zebra shark is slightly damaged. An alkali lysis method is used for preparing a genome, and the DNA harvesting amount is high, and the requirement for a tissue sample is low. The gender identification molecular marker and the identification method provided by the application have high accuracy of identification results, are not affected by tissue specificity and environment, and have important values for Zebra shark gender control and all-male seed cultivation.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular to a molecular marker, primer, method, and application for identifying the genetic sex of the lined hippocampus. Background Technology

[0002] Seahorses belong to the Syngnathidae family and possess a unique body structure and a "male-led parenting" reproductive strategy. They are extremely valuable medicinal marine bony fish, often referred to as "Southern Ginseng." The global seahorse trade volume reaches over 20 million individuals annually. Predatory fishing driven by market demand has nearly depleted seahorse natural resources. In 2019, 44 seahorse species were listed in the IUCN Red List of Threatened Species. Therefore, artificial breeding has become an important way to achieve the sustainable use of seahorse resources.

[0003] The striped seahorse (Hippocampus erectus) is native to the Americas and was introduced to my country from the United States in 2009. Compared to the three-spotted seahorse and the large seahorse traditionally farmed in China, the striped seahorse has advantages such as faster growth rate, higher survival rate, and stronger disease resistance. During the growth process, male striped seahorses are larger and grow faster than females. Since the price of striped seahorses in the medicinal market is directly proportional to their size and quality (yuan / kg), developing molecular markers to identify the genetic sex of striped seahorses in order to construct all-male or high-male-ratio farmed populations is one of the key technologies to improve the economic benefits of their farming.

[0004] Because the sex determination system in fish is extremely complex, sex-specific molecular markers between different fish species lack universality. To date, no sex-specific molecular markers for the lined seahorse have been reported.

[0005] A search revealed no patent publications related to this invention's patent application. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a molecular marker, primer, method and application for identifying the genetic sex of the lined hippocampus.

[0007] The technical solution adopted by this invention to solve the technical problem is:

[0008] A molecular marker for identifying the genetic sex of the lined hippocampus, the sequence of which is SEQ ID NO.1.

[0009] Furthermore, the molecular markers can identify male striped seahorses.

[0010] The application of molecular markers as described above in the identification of male striped hippocampi.

[0011] A primer for identifying the genetic sex of the lined hippocampus, the primer comprising an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer being SEQ ID NO.3 and the nucleotide sequence of the downstream primer being SEQ ID NO.4.

[0012] Furthermore, the primers can be used to identify male striped seahorses.

[0013] The application of the primers described above in the identification of male striped hippocampi.

[0014] The preparation method of the primers described above includes the following steps:

[0015] Using 2b-RAD technology, male and female individuals of the striped hippocampus were sequenced and sex-specific fragments were screened. A short sequence specifically present in male striped hippocampus was obtained, and its nucleotide sequence is SEQ ID NO.1.

[0016] Since the male-specific short sequence SEQ ID NO.1 is only 27 bp in length, it is not convenient for PCR primer design. Therefore, BLAST alignment search was performed on SEQ ID NO.1 in the genotype of the linear hippocampus, and 500 bp upstream and downstream of SEQ ID NO.1 were extracted. The nucleotide sequence of SEQ ID NO.2 is SEQ ID NO.2.

[0017] Based on the sequence SEQ ID NO.2, a pair of primers that can distinguish the sex of the striped hippocampus were designed for the male-specific short sequence SEQ ID NO.1, and the primers were obtained.

[0018] A method for identifying the genetic sex of lined seahorses, the steps of which are as follows:

[0019] (1) The 2b-RAD technology was used to sequence the male and female individuals of the striped seahorse and screen for male and female specific fragments. A short sequence specifically present in the male striped seahorse was obtained, and its nucleotide sequence is SEQ ID NO.1;

[0020] (2) Since the length of the male-specific short sequence SEQ ID NO.1 is only 27bp, it is not convenient for PCR primer design. Therefore, BLAST comparison search was performed on SEQ ID NO.1 in the genotype of the linear hippocampus and the sequences of 500bp upstream and downstream of SEQ ID NO.1 were extracted. The nucleotide sequence is SEQ ID NO.2.

[0021] (3) Based on the sequence SEQ ID NO.2, a pair of primers that can distinguish the sex of the striped hippocampus were designed for the male-specific short sequence SEQ ID NO.1. The nucleotide sequences of the upstream primer and the downstream primer are SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0022] (4) Genomic DNA was extracted from the dorsal fin tissue of the lined seahorse to be identified using the alkaline lysis method;

[0023] (5) Using the extracted genomic DNA as a template, perform PCR amplification with the upstream and downstream primers described above;

[0024] (6) The obtained PCR products were detected by electrophoresis with 1% agarose gel. Individuals with a specific band at 179bp were male lined hippocampi, and individuals without a specific band were female lined hippocampi.

[0025] The application of the method described above in identifying the genetic sex of the lined hippocampus.

[0026] The beneficial effects achieved by this invention are:

[0027] 1. The sample collection method of this invention involves cutting off a small amount of the dorsal fin, which causes minimal damage to the striped seahorse and does not affect the survival and growth of the sampled seahorse, and is of great significance for maintaining the parent species.

[0028] 2. This invention provides a rapid DNA molecular marker and identification method for sex inheritance in the striped seahorse. The genome preparation adopts the alkaline lysis method, which yields high DNA yield and has low requirements for tissue samples. The PCR amplification products are subjected to gel electrophoresis, and the presence or absence of bands determines the sex. The results are intuitive and clear. The method of this invention can easily and quickly determine the genetic sex of the striped seahorse.

[0029] 3. The sex identification molecular markers and identification methods provided by this invention have high accuracy and are not affected by tissue specificity or environment, which is of great value for sex control of the striped seahorse and the breeding of all-male seedlings. Attached Figure Description

[0030] Figure 1 This image shows the results of genetic sex identification of known-sex seahorse populations from three different regions (Fujian, Hainan, and Shandong) using upstream primer (SEQ ID NO.3) and downstream primer (SEQ ID NO.4) in an embodiment of the present invention. Groups A, B, and C represent seahorses collected from farms in Fujian, Hainan, and Shandong, respectively. Lane M is a marker, and the numbers in the lanes represent different male and female seahorse individuals. Detailed Implementation

[0031] To better understand the present invention, the present invention will be further described in detail below with reference to the embodiments. However, the scope of protection of the present invention is not limited to the scope represented by the embodiments.

[0032] Unless otherwise specified, all raw materials used in this invention are conventional commercially available products. Unless otherwise specified, all methods used in this invention are conventional methods in the field. All substances used in this invention are of conventional quality.

[0033] A molecular marker for identifying the genetic sex of the lined hippocampus, the sequence of which is SEQ ID NO.1.

[0034] Preferably, the molecular marker can identify male striped seahorses.

[0035] The application of molecular markers as described above in the identification of male striped hippocampi.

[0036] A primer for identifying the genetic sex of the lined hippocampus, the primer comprising an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer being SEQ ID NO.3 and the nucleotide sequence of the downstream primer being SEQ ID NO.4.

[0037] Preferably, the primers can be used to identify male striped seahorses.

[0038] The application of the primers described above in the identification of male striped hippocampi.

[0039] The preparation method of the primers described above includes the following steps:

[0040] Using 2b-RAD technology, male and female individuals of the striped hippocampus were sequenced and sex-specific fragments were screened. A short sequence specifically present in male striped hippocampus was obtained, and its nucleotide sequence is SEQ ID NO.1.

[0041] Since the male-specific short sequence SEQ ID NO.1 is only 27 bp in length, it is not convenient for PCR primer design. Therefore, BLAST alignment search was performed on SEQ ID NO.1 in the genotype of the linear hippocampus, and 500 bp upstream and downstream of SEQ ID NO.1 were extracted. The nucleotide sequence of SEQ ID NO.2 is SEQ ID NO.2.

[0042] Based on the sequence SEQ ID NO.2, a pair of primers that can distinguish the sex of the striped hippocampus were designed for the male-specific short sequence SEQ ID NO.1, and the primers were obtained.

[0043] A method for identifying the genetic sex of lined seahorses, the steps of which are as follows:

[0044] (1) The 2b-RAD technology was used to sequence the male and female individuals of the striped seahorse and screen for male and female specific fragments. A short sequence specifically present in the male striped seahorse was obtained, and its nucleotide sequence is SEQ ID NO.1;

[0045] (2) Since the length of the male-specific short sequence SEQ ID NO.1 is only 27bp, it is not convenient for PCR primer design. Therefore, BLAST comparison search was performed on SEQ ID NO.1 in the genotype of the linear hippocampus and the sequences of 500bp upstream and downstream of SEQ ID NO.1 were extracted. The nucleotide sequence is SEQ ID NO.2.

[0046] (3) Based on the sequence SEQ ID NO.2, a pair of primers that can distinguish the sex of the striped hippocampus were designed for the male-specific short sequence SEQ ID NO.1. The nucleotide sequences of the upstream primer and the downstream primer are SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0047] (4) Genomic DNA was extracted from the dorsal fin tissue of the lined seahorse to be identified using the alkaline lysis method;

[0048] (5) Using the extracted genomic DNA as a template, perform PCR amplification with the upstream and downstream primers described above;

[0049] (6) The obtained PCR products were detected by electrophoresis with 1% agarose gel. Individuals with a specific band at 179bp were male lined hippocampi, and individuals without a specific band were female lined hippocampi.

[0050] The application of the method described above in identifying the genetic sex of the lined hippocampus.

[0051] Specifically, the relevant preparation and testing methods are as follows:

[0052] Example:

[0053] Obtaining the male-specific short sequence SEQ ID NO.1 from the lined hippocampus:

[0054] Twenty male and twenty female *Hippocampus fasciatus* were identified by gonadal section observation. Muscle tissue was harvested and whole-genome DNA extracted. The whole-genome DNA from each sample was digested with Bsa XI restriction endonuclease. The digestion products were ligated with standard Illumina sequencing adapters to construct sequencing libraries. 2b-RAD sequencing was performed on an Illumina sequencing platform. Comparative genomic analysis of the sequencing fragments from male and female individuals was conducted using the published *Hippocampus fasciatus* genome sequence as a reference. A male-specific short sequence was obtained, which was present only in the 20 male *Hippocampus fasciatus* and not detected in the 20 female *Hippocampus fasciatus*. Its nucleic acid sequence is SEQ ID NO.1, 5'-CCGGTTTCAACTCCGGCTCCAGTCTCC-3'.

[0055] Elongation of male-specific short sequences in the lined hippocampus:

[0056] A BLAST search was performed on the male-specific short sequence SEQ ID NO.1 in the published genome of the lined hippocampus. 500 bp sequences upstream and downstream of SEQ ID NO.1 were extracted, and their nucleotide sequences are SEQ ID NO.2, 5'-GATGGACTTACTGTGGCACATTCTTTCCCAGTGACCCACCTTTTTGCAGTTGTTGCTTGTAGATTTAATCGGTGGACATTTACTTTGGACTTTGTGCTTTATTTTTTTTTCTACATCTTCCACATTTTGGCTCTGTGTGCTCCCCACTCACTCGCTTTTTAATTTTCCACTGCTGCTTTCGTCCGAATGCAATTTTAGGGTGTGAAACCCTAAAATTGCGCGCGCTTCCCCCTGCGAGTGCACTTG TCTCGTCACCTCCTCGGACTGGCTCACGGACTAAACAGTTTGGGCTAGTGTGAGCTGTGACTGTAGCTGGAGTTTACCAGACATCTCTTCGTCTGTGTTTCCCACTACTTTGCGATCTCTGATGTGT TCCTCTCTGTGCATCCCAAAGTCACAATGTTCCGACAGTTCATACAGAGCTCTGATAAATATTTTGACTTTCTCACCGCTGTACTCTCGGTTGTCCAGTGGATTACACGACTCACAGTGCGGAGGTT[ CCGGTTTCAACTCCGGCTCCAGTCTCC]TTGTGTGGAGTTTGCATGTTCTCCCCGGGCCTGCGTGGGTTTTCTCCGGGTACTCCGGTTTCTCACACATTCCAAAAACATGCATGGCAGGCTGATTGAACACTCTAAATTGTCCCGAGGTGTG AGTGTGGGCGTGGATGGTTGTTTGTCTATGTGCCCTGCGATTGGCTGGCGACCAGTTATTTTGCGGAGAAGGAAAGTTGCACTCGTATGTACTCTGTGTAGCTGCTCAAAATGCTGATTGCGCTGG CCTTCACCACCTCCCAACATGATAAAATTAGAGCGCTCCATGCTTTTTTCTTTTCTTTTTCTTTTTTAAATAAATCTCATCATTTTTTTGGAAAGACTTTCGTTGTCTTGGTTTCCCTGGACAAGAC AATGTGTTGAAAGTAGGGGTTCTAGTGACGATACGTGCTGAAGAATTCTGGACCAGGTGAAGTTTATGGAGGAATTTGTGATGGGCACAGAAAAGGAGTGAATTGTAAGAATATATACGCAAG-3'

[0057] Primer design based on male-specific short sequence extensions from the linear hippocampus:

[0058] A pair of male-specific short extended sequence SEQ ID NO.2 targeting the lined hippocampus was designed using the online primer design software Primer3 (https: / / bioinfo.ut.ee / primer3-0.4.0 / primer3 / ), and its sequence is as follows:

[0059] SEQ ID NO.3, 5'-TGCGATCTCTGATGTGTTCC-3'

[0060] SEQ ID NO.4, 5'-CCACACAAGGAGACTGGAGC-3'

[0061] Preparation of genomic DNA template from the linear hippocampus:

[0062] Five, eighteen, and thirty-six striped seahorses of equal sex were collected from breeding farms in Fujian, Hainan, and Shandong provinces, respectively. The sex of the striped seahorses was identified by examining their brood pouches and gonadal tissue sections.

[0063] Genomic DNA was extracted from the lined hippocampus using an alkaline lysis method, as detailed below:

[0064] 1. Cut a small amount of the dorsal fin of the lined seahorse, add 100 μl of 1×Base solution (0.025M NaOH, 0.2mMEDT A, pH 12.0), and incubate in a 95℃ metal bath for 30 min until the tissue is completely lysed;

[0065] 2. Cool the lysate on ice for 2 min, add 100 μl of 1×Neutralizaton solution (0.04M Tris-HCl, pH 5.0), mix well, centrifuge at 8000g for 1 min, and use the supernatant as a genomic DNA template. Store at 4℃ for later use.

[0066] PCR amplification:

[0067] The 20 μl PCR reaction mixture consisted of: 2 μl 10×PCR buffer (Mg2+ excluding), 1.2 μl 25 mM MgCl2, 1.6 μl ldNTP Mixture (2.5 mM each), 4 μl genomic DNA template, 0.5 μl each of 10 μM SEQ ID NO.3 and SEQ ID NO.4 primers, and 10.2 μl sterile water. PCR amplification conditions were: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 33 cycles; 72℃ extension for 10 min; and storage at 16℃.

[0068] Amplification result detection and gender identification:

[0069] A 1% agarose gel was prepared for electrophoresis detection of the PCR amplification products. Results Figure 1 As shown, groups A, B, and C represent lined seahorses collected from farms in Fujian, Hainan, and Shandong, respectively. Lane M is the marker. A specific band of approximately 179 bp was amplified in the genomic DNA of all male individuals from different regions, while no specific band was amplified in the genomic DNA of all female individuals.

[0070] The genetic sex of the striped seahorse identified by this method was consistent with the sex confirmed by observation of the brood pouch and gonadal tissue sections.

[0071] Although embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the invention and the appended claims. Therefore, the scope of the invention is not limited to the contents disclosed in the embodiments. sequence list <110> Tianjin Agricultural College <120> Molecular markers, primers, methods, and applications for identifying the genetic sex of the lined hippocampus. <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 27 <212> DNA <213> Molecular marker sequence (Unknown) <400> 1 ccggtttcaa ctccggctcc agtctcc 27 <210> 2 <211> 1027 <212> DNA <213> An extended sequence of a male-specific short sequence in the lined hippocampus (Unknown) <400> 2 gatggactta ctgtggcaca ttctttccca gtgacccacc tttttgcagt tgttgcttgt 60 agatttaatc ggtggacatt tactttggac tttgtgcttt attttttttt ctacatcttc 120 cacattttgg ctctgtgtgc tccccactca ctcgcttttt aattttccac tgctgctttc 180 gtccgaatgc aattttaggg tgtgaaaccc taaaattgcg cgcgcttccc cctgcgagtg 240 cacttgtctc gtcacctcct cggactggct cacggactaa acagtttggg ctagtgtgag 300 ctgtgactgt agctggagtt taccagacat ctcttcgtct gtgtttccca ctactttgcg 360 atctctgatg tgttcctctc tgtgcatccc aaagtcacaa tgttccgaca gttcatacag 420 agctctgata aatattttga ctttctcacc gctgtactct cggttgtcca gtggattaca 480 cgactcacag tgcggaggtt ccggtttcaa ctccggctcc agtctccttg tgtggagttt 540 gcatgttctc cccgggcctg cgtgggtttt ctccgggtac tccggtttcc tcacacattc 600 caaaaacatg catggcaggc tgattgaaca ctctaaattg tcccgaggtg tgagtgtggg 660 cgtggatggt tgtttgtcta tgtgccctgc gattggctgg cgaccagtta ttttgcggag 720 aaggaaagtt gcactcgtat gtactctgtg tagctgctca aaatgctgat tgcgctggcc 780 ttcaccacct cccaacatga taaaattaga gcgctccatg cttttttctt ttctttttct 840 tttttaaata aatctcatca ttttttggaa agactttcgt tgtcttggtt tccctggaca 900 agacaatgtg ttgaaagtag gggttctagt gacgatacgt gctgaagaat tctggaccag 960 gtgaagttta tggaggaatt tgtgatgggc acagaaaagg agtgaattgt aagaatatat 1020 acgcaag 1027 <210> 3 <211> 20 <212> DNA <213> Upstream Primer (Unknown) <400> 3 tgcgatctct gatgtgttcc 20 <210> 4 <211> 20 <212> DNA <213> Downstream primer (Unknown) <400> 4 ccacacaagg agactggagc 20

Claims

1. A molecular marker for identifying male striped seahorses, characterized in that: The sequence of the molecular marker is SEQ ID NO.

1.

2. The application of the reagent with the molecular marker as described in claim 1 in the identification of male striped hippocampus.

3. A primer for identifying male striped seahorses, characterized in that: The primers include an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is SEQ ID NO.3, and the nucleotide sequence of the downstream primer is SEQ ID NO.

4.

4. The application of the primers as described in claim 3 in the identification of male striped seahorses.

5. The method for preparing primers as described in claim 3, characterized in that: The steps are as follows: Using 2b-RAD technology, male and female individuals of the striped hippocampus were sequenced and sex-specific fragments were screened. A short sequence specifically present in male striped hippocampus was obtained, and its nucleotide sequence is SEQ ID NO.

1. BLAST alignment was performed on SEQ ID NO.1 in the online hippocampal genome sequence, and 500 bp upstream and downstream of SEQ ID NO.1 were extracted. The nucleotide sequence of SEQ ID NO.2 is SEQ ID NO.

2. Based on the sequence SEQ ID NO.2, a pair of primers that can distinguish the sex of the striped hippocampus were designed for the male-specific short sequence SEQ ID NO.1, and the primers were obtained.

6. A method for identifying the genetic sex of the striped seahorse, characterized in that: The steps are as follows: (1) The 2b-RAD technology was used to sequence the male and female individuals of the lined hippocampus and screen for sex-specific fragments. A short sequence specifically present in the male lined hippocampus was obtained, and its nucleotide sequence is SEQ ID NO.1; (2) BLAST alignment was performed on SEQ ID NO.1 in the online hippocampal genome sequence and the sequences upstream and downstream of SEQ ID NO.1 were extracted. The nucleotide sequence of SEQ ID NO.2 is SEQ ID NO.

2. (3) Based on the sequence SEQ ID NO.2, a pair of primers that can distinguish the sex of the striped hippocampus were designed for the male-specific short sequence SEQ ID NO.

1. The nucleotide sequences of the upstream and downstream primers are SEQ ID NO.3 and SEQ ID NO.4, respectively. (4) Genomic DNA was extracted from the dorsal fin tissue of the lined seahorse to be identified using the alkaline lysis method; (5) Using the extracted genomic DNA as a template, perform PCR amplification with the upstream and downstream primers described above; (6) The obtained PCR products were detected by electrophoresis with 1% agarose gel. Individuals with a specific band at 179bp were male lined hippocampi, and individuals without a specific band were female lined hippocampi.

7. The application of the method as described in claim 6 in identifying the genetic sex of the lined hippocampus.

Images