High-throughput method to screen for cognate t cell and epitope reactivity in primary human cells

Abstract

An assay for autologous primary immune cells is described, in which individual blood cells can be functionally screened simultaneously for individual antigens of interest, such as T-cell epitopes, without the need for HLA haplotype-specific reagents. An oligonucleotide-labeled hash-tracking system, followed by deconvolution via single-cell sequencing, correlates antigen reactivity with individual T cells.

Description

[0001] Cross-reference to related applications

[0002] This application claims priority to U.S. Provisional Patent Application Serial No. 62 / 910,379, filed October 3, 2019, under 35 U.S.SC §119(e), the disclosure of which is incorporated herein by reference in its entirety.

[0003] References to sequence lists submitted as text files via EFS Web

[0004] The sequence list in file 10669_ST25.txt is 5 kilobytes long and was created on October 2, 2020. It is hereby incorporated by reference. Background Technology

[0005] With increasing interest in antigen-specific T cell activity in human diseases, there is a need to associate epitope-specific TCR sequences with homologous epitopes presented in the HLA environment. However, identifying which epitopes lead to productive T cell activation and the TCR sequences of responsive T cells has historically been, and will continue to be, a technically challenging task.

[0006] Traditional methods for assessing antigen-specific T cell binding and reactivity include multimer staining and functional T cell assays, in which T cells are re-exposed to epitopes to be detected by cytokines or cell lysis reactions (e.g., ELISPOT, cell killing assays). While these methods are useful, they can require expensive individual HLA haplotype-specific reagents (multimers) and large volumes of blood for high-throughput assessment of potential reactivity. Furthermore, few HLA class II (CD4+ T cell) multimers are available, so most multimer-based studies have focused on HLA class I (CD8+ T cell) reactivity.

[0007] Therefore, there is a particular need for a high-throughput method that can provide information on associating TCR homologous TCRα and β peptides with epitopes recognized by TCR. Summary of the Invention

[0008] Described herein is an immune cell assay that can be used on autologous and primary immune cells, where CD8+ T cell and / or CD4+ T cell responses to multiple T cell epitopes of interest can be simultaneously assayed. Using a hash-tag oligonucleotide (HTO) tracking system, antigen reactivity is associated with individual T cells, which can then be deconvoluted by single cell sequencing to provide single cell level information, such as: (a) epitope specificity, (b) single cell paired a / b chain TCR sequences, (c) endogenous single cell RNA transcriptome information, (d) cell surface protein expression (e.g., using CITE-seq antibodies), (e) multimer staining (if multimers are included), and any combination thereof. Accordingly, provided herein are immune cell assay methods, compositions and kits for use in the methods, and uses thereof, such as for the preparation of TCR therapeutics.

[0009] In one embodiment, the methods described herein include sorting activated T cells from a composition comprising other cells, e.g., autologous antigen presenting cells (APCs), e.g., based on expression of an activation-induced marker (AIM), wherein the activated T cells are labeled with HTO-conjugated molecules.

[0010] In some embodiments, the methods described herein (e.g., for identifying an antigen capable of activating a T cell, and optionally a T cell receptor (TCR) a chain sequence and / or a TCR b chain sequence of a TCR that specifically binds the antigen) include

[0011] (I) sorting activated T cells from a composition comprising a unique biological sample, the unique biological sample comprising: (a) T cells and surface-bound major histocompatibility complex (MHC), wherein the T cells are capable of recognizing a peptide presented in the context of the surface-bound MHC; (b) a unique antigen; (c) a unique hash-tag oligonucleotide (HTO) that can be used to specifically identify (and / or specifically identify) the unique antigen, wherein the unique HTO is conjugated to a molecule that labels the T cells with the unique HTO, and, optionally, (d) a culture medium that supports activation of the T cells, and

[0012] (II) performing single cell sequencing analysis on the activated T cells sorted in (I) to identify the unique HTO conjugated to the molecule that labels the activated T cells with the unique HTO, wherein identifying the unique HTO identifies the antigen capable of activating the activated T cells, and, optionally, wherein the single cell sequencing analysis further identifies (i) one or more genes expressed by the activated T cells, and / or (ii) TCR a and / or b chain sequences of a TCR expressed by the activated T cells.

[0013] Some methods described herein further comprise establishing a plurality of biological samples, e.g., unique biological samples, prior to the sorting step, such that the composition sorted in (I) comprises a plurality of unique biological samples. Some method embodiments comprise a step of establishing a plurality of biological samples prior to sorting by evenly distributing a collection of cells comprising T cells and antigen presenting cells (APCs) isolated from a subject into individual samples, wherein each biological sample optionally comprises media and cytokines that support T cell and / or APC viability, activation, and / or activity.

[0014] Some method embodiments comprise a step of establishing a plurality of unique biological samples prior to sorting by delivering a unique antigen and / or a unique HTO that can be used to specifically identify (and / or specifically identify) the unique antigen to each of the plurality of biological samples, wherein the unique HTO is conjugated to a molecule that labels T cells with the unique HTO, wherein each of the plurality of biological samples comprises a collection of cells comprising T cells and APCs isolated from a subject, wherein each of the plurality of biological samples becomes a unique biological sample comprising: (a) a collection of cells comprising T cells and APCs isolated from a subject; (b) a unique antigen; (c) a unique HTO that specifically identifies the unique antigen and is conjugated to a molecule that labels T cells with the unique HTO, and optionally (d) media that supports T cell and APC viability, activity, and / or activation, upon delivery of the unique antigen and / or the unique HTO that is conjugated to a molecule that labels T cells with the unique HTO. Optionally, the plurality of unique biological samples can be pooled prior to sorting in methods described herein, such that the composition sorted in (I) comprises a plurality of unique biological samples. Some method embodiments herein comprise two steps of establishing a plurality of biological samples prior to the sorting step and establishing (e.g., from the plurality of biological samples) a plurality of unique biological samples, and optionally pooling the plurality of unique biological samples to establish a composition that can be sorted according to methods described herein.

[0015] In some methods described herein, sorting comprises fluorescence-activated cell sorting of activated T cells based on expression of an AIM, e.g., wherein fluorescence-activated cell sorting is based on detecting T cells expressing an AIM with a fluorescently labeled antibody that specifically binds the AIM. Such methods can further comprise incubating the unique biological sample (or a composition comprising one or more unique biological samples) with a fluorescently labeled ligand (e.g., a fluorescently labeled antibody) that specifically binds the AIM.

[0016] In some embodiments, the methods described herein further include functional and / or phenotypic analysis of activated T cells analyzed by single-cell sequencing. In some embodiments, functional and / or phenotypic analysis is performed prior to single-cell sequencing analysis. In some embodiments, functional and / or phenotypic analysis is performed concurrently with single-cell sequencing analysis. In some embodiments, functional and / or phenotypic analysis is performed after single-cell sequencing analysis. In some embodiments, functional and / or phenotypic analysis is performed prior to, concurrently with, and / or after single-cell sequencing analysis. In some embodiments, functional and / or phenotypic analysis comprises flow cytometry analysis. In some embodiments, functional and / or phenotypic analysis comprises CITE-seq analysis. In some embodiments, functional and / or phenotypic analysis comprises multimer analysis. In some embodiments, functional and / or phenotypic analysis comprises any combination of flow cytometry analysis, CITE-seq analysis, and multimer analysis. In some implementations, further functional and / or phenotypic analyses measure the expression levels of one or more of the following proteins and / or RNAs: CD3, CD4, CD8, CD25, CD27, CD28, CD45RA, CD62L, HLA DR, CD137 / 4-1BB, CD69, CD278, CD274, CD279, CD127, CD197, IFNγ, GZMH, GNLY, CD38, CCL3, and LAG3.

[0017] In some embodiments, the method herein includes identifying the TCRα chain sequence and / or TCRβ chain sequence of a TCR that specifically binds to an antigen, preferably wherein the TCRα chain sequence and / or TCRβ chain sequence are respectively a variable region sequence (Vα / Jα sequence) of the TCRα chain and / or a variable region sequence (Vβ / Jβ sequence) of the TCRβ chain. In some embodiments, the method includes identifying the TCRα chain sequence and / or TCRβ chain sequence of a TCR that specifically binds to an antigen, and the method further includes using the TCRα chain sequence and / or TCRβ chain sequence to manufacture a therapeutic agent, such as a human therapeutic agent. Alternatively, the method may also include identifying TCRδ / TCRγ sequences, such as the TCRδ / TCRγ variable region sequence.

[0018] This document also describes compositions that can be used in the methods described herein. In some embodiments, the composition comprises a unique biological sample comprising: (a) a T cell and a surface-bound major histocompatibility complex (MHC), wherein the T cell is capable of recognizing a peptide presented in the environment of the surface-bound MHC; (b) an antigen; (c) a hash-tagged oligonucleotide (HTO) specifically identifying the antigen, wherein the HTO is conjugated to a molecule of the T cell labeled with the HTO; and optionally (d) a culture medium supporting T cell activation. In some embodiments, the composition comprises more than one biological sample, such as first and second biological samples, wherein the first biological sample comprises: (a) a first T cell and a first surface-bound MHC, wherein the first T cell is capable of recognizing a peptide presented in the environment of the first surface-bound MHC; (b) a first antigen; and (c) a first HTO, which is available for specific identification, and preferably specifically identifies the first antigen, wherein the first HTO is conjugated to a first molecule of the first T cell labeled with the first HTO, wherein the second biological sample comprises (a) a second T cell and a second surface-bound MHC, wherein the second T cell is capable of recognizing a MHC bound to the second surface. C) a peptide presented in the environment; (b) a second antigen; and (c) a second HTO specifically identifying the second antigen, wherein the second HTO is conjugated to a second molecule of a second T cell labeled with the second HTO, wherein (i) the first T cell and the second T cell are isolated from the same subject, (ii) the first antigen is different from the second antigen, (iii) the first molecule of the first T cell labeled with the first HTO is the same as the second molecule of the second T cell labeled with the second HTO, and the first HTO is different from the second HTO, and optionally either or both of the first and second biological samples further contain a culture medium supporting the activation of the first T cell and the second T cell.

[0019] This document also describes kits. In some embodiments, the kits described herein comprise multiple unique antigens and multiple unique hash-tagged oligonucleotides (HTOs), each of which can be used for specific identification, and preferably each specifically identifies only one of the multiple unique antigens. In some kit embodiments, each of the multiple unique HTOs is conjugated to the same molecule, such that the kit comprises molecules conjugated with multiple unique HTOs. In some kit embodiments as described herein, each of the multiple unique antigens comprises a unique and overlapping peptide sequence from a single protein, such as a pathogenic antigen, tumor-associated antigen, or transplantation antigen.

[0020] In some embodiments described herein, the surface-bound MHC is cell membrane-bound MHC, for example, surface-bound MHC expressed on the surface of cells, such as antigen-presenting cells (APCs). In some embodiments of methods, compositions, kits, or uses, the APC is a monocyte-derived dendritic cell. In some embodiments of methods, compositions, kits, or uses, the APC is a dendritic cell. In some embodiments of methods, compositions, kits, or uses, the APC is a monocyte. In some embodiments of methods, compositions, kits, or uses, the APC is a macrophage. In some embodiments of methods, compositions, kits, or uses, the APC is a B cell. In some embodiments of methods, compositions, kits, or uses, the surface-bound MHC is expressed on the surface of a cell population, such as an APC population, for example, where the APC population comprises monocyte-derived dendritic cells, dendritic cells, monocytes, macrophages, B cells, and any combination thereof. In some embodiments, T cells and APCs are autologous homologs. In some embodiments, T cells and APCs are each isolated from a human donor. In some implementations, peripheral blood mononuclear cells (e.g., isolated from a human donor) provide T cells and surface-bound MHC (e.g., MHC expressed on the surface of APCs).

[0021] The methods, compositions, kits, and uses described herein are advantageously suited for use with low-volume samples, such as low-volume human samples. In some embodiments, the cell aggregate contains a sufficient number of peripheral blood mononuclear cells (PBMCs) isolated from a subject, such as a human subject, such that the cell aggregate can be uniformly distributed across multiple individual biological samples. In some embodiments, the cell aggregate contains a sufficient number of PBMCs such that the cell aggregate can be uniformly distributed across at least two individual biological samples, each containing at least about 1 × 10⁻⁶ cells. 5 One PBMC, at least approximately 5 × 10 5 One PBMC or at least approximately 1×10 6 Each PBMC, for example, a cell aggregate may be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the cell aggregate contains a sufficient number of PBMCs such that the cell aggregate can be uniformly distributed across at least three individual samples, each containing at least about 1 × 10⁻⁶ PBMCs. 5 One PBMC, at least approximately 5 × 10 5 One PBMC or at least approximately 1×10 6Each PBMC, for example, a cell aggregate may be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the cell aggregate contains a sufficient number of PBMCs such that the cell aggregate can be evenly distributed across at least five individual samples, each containing at least about 1 × 10⁻⁶ PBMCs. 5 One PBMC, at least approximately 5 × 10 5 One PBMC or at least approximately 1×10 6 Each PBMC, for example, a cell aggregate may be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the cell aggregate contains a sufficient number of PBMCs such that the cell aggregate can be evenly distributed across at least ten individual samples, each containing at least about 1 × 10⁻⁶ PBMCs. 5 One PBMC, at least approximately 5 × 10 5 One PBMC or at least approximately 1×10 6 Each PBMC, for example, a cell aggregate may be derived from approximately 1 mL, 3 mL, 5 mL, 10 mL, 15 mL, 20 mL, or 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the cell aggregate contains a sufficient number of PBMCs such that the cell aggregate can be uniformly distributed across at least twenty individual samples, each containing at least approximately 1 × 10⁻⁶ PBMCs. 5 One PBMC, at least approximately 5 × 10 5 One PBMC or at least approximately 1×10 6 Each PBMC, for example, cell aggregate may be derived from approximately 1 mL, 3 mL, 5 mL, 10 mL, 15 mL, 20 mL, or 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the cell aggregate contains a sufficient number of PBMCs such that the cell aggregate can be uniformly distributed across at least thirty individual samples, each containing at least approximately 1 × 10⁻⁶ PBMCs. 5 One PBMC, at least approximately 5 × 10 5 One PBMC or at least approximately 1×10 6 Each PBMC, for example, a cell aggregate may be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the cell aggregate contains a sufficient number of PBMCs such that the cell aggregate can be uniformly distributed across at least fifty individual samples, each containing at least about 1 × 10⁻⁶ PBMCs. 5 One PBMC, at least approximately 5 × 10 5 One PBMC or at least approximately 1×10 6Each PBMC, for example, may be derived from approximately 1 mL, 3 mL, 5 mL, 10 mL, 15 mL, 20 mL, or 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the cell aggregate contains a sufficient number of T cells and antigen-presenting cells (APCs) (e.g., dendritic cells (DCs)) such that the cell aggregate can be uniformly distributed across multiple individual biological samples. In some embodiments, the cell aggregate contains a sufficient number of APCs and T cells isolated from a subject, such as a human subject, such that the cell aggregate can be uniformly distributed across multiple individual biological samples, each containing an APC:T cell ratio of approximately 1:1, approximately 1:5, or approximately 1:10 for APCs and T cells (e.g., DCs and T cells), for example, wherein each sample contains at least approximately 5 × 10⁶ cells. 3 5×10 4 One or 5×10 5 One DC and approximately 5 × 10 3 1×10 4 1, 2.5 × 10 4 5×10 4 1×10 6 1, 2.5 × 10 5 5×10 5 1×10 6 1, 2.5 × 10 6 One or 5×10 6 Individual T cells, such as a cell collection, may be derived from approximately 5 mL, 10 mL, 15 mL, 20 mL, or 50 mL of whole blood isolated from a subject, such as a human subject.

[0022] The antigen used in the methods described herein or as part of the compositions or kits described herein may (I) be an antigen selected from the group consisting of: (i) bacterial antigens or portions thereof, (ii) viral antigens or portions thereof, (iii) allergens or portions thereof, (iv) tumor-associated antigens or portions thereof, and (v) combinations thereof; and / or (II) comprising (i) an amino acid sequence, (ii) a nucleotide sequence, (iii) a lysate, and (iv) a combination thereof.

[0023] The methods, compositions, kits, and uses described herein each comprise a hash-tagged oligonucleotide (HTO) conjugated to a molecule that can be used to label cells (e.g., T cells) with HTO. In some embodiments, the molecule for labeling cells with HTO may comprise a ligand, such as an antibody. In some embodiments, the HTO-conjugated ligand, such as an HTO-conjugated antibody, binds to a cell surface molecule. In some embodiments, the cell surface molecule is universally expressed by most cells. In some embodiments, the cell surface molecule is or comprises β2 microglobulin. In some embodiments, the cell surface molecule is or comprises CD298. In some embodiments, the cell surface molecule may be selectively expressed by T cells. In some embodiments, the cell surface molecule is or comprises a T cell surface molecule selected from the group consisting of CD2, CD3, CD4, CD8, and any combination thereof. In some embodiments, the cell surface molecule is or comprises CD2. In some embodiments, the cell surface molecule is or comprises CD3. In some embodiments, the cell surface molecule is or comprises CD4. In some embodiments, the cell surface molecule is or comprises CD8. In some embodiments, the molecule used for HTO-labeling cells may comprise lipids, preferably incorporated into the cell membrane, such as the cell membrane of dividing cells. In some embodiments, the HTO-conjugated molecule comprises an HTO-conjugated lipid, such as a lipid-modified oligonucleotide. In some embodiments, the molecule used for HTO-labeling cells is or comprises cholesterol. In some embodiments, the HTO-conjugated molecule described herein comprises an HTO-conjugated cholesterol, such as a cholesterol-modified oligonucleotide.

[0024] The methods described herein include sorting activated T cells based on the expression of activation-inducing markers (AIMs). Therefore, some of the methods, compositions, kits, and usage embodiments described herein include agents that can be used in such sorting steps. In some embodiments, the agent comprises a fluorescently labeled ligand that specifically binds to AIM, such as a fluorescently labeled antibody that specifically binds to AIM. In some of the methods, compositions, or kit embodiments described herein, AIM is or is included in any marker upregulated by T cells following T cell activation. In some of the methods, compositions, kits, or usage embodiments described herein, AIM is or is included in AIM selected from the group consisting of: CD137 / 4-1BB, CD107, IFNγ, PD-1, CD40L, OX40, CD25, CD69, CD28, HLA-DR, CX3CR1, TIM3, LAG3, TIGIT, and any combination thereof. In some of the methods, compositions, kits, or usage embodiments described herein, AIM is or is included in CD137 / 4-1BB. In some of the methods, compositions, kits, or usage embodiments described herein, AIM is or is included in CD107. In some of the methods, combinations, kits, or uses described herein, AIM is or contains IFNγ. In some of the methods, combinations, kits, or uses described herein, AIM is or contains PD-1. In some of the methods, combinations, kits, or uses described herein, AIM is or contains CD40L. In some of the methods, combinations, kits, or uses described herein, AIM is or contains OX40. In some of the methods, combinations, kits, or uses described herein, AIM is or contains CD25. In some of the methods, combinations, kits, or uses described herein, AIM is or contains CD69. In some of the methods, combinations, kits, or uses described herein, AIM is or contains CD28. In some of the methods, combinations, kits, or uses described herein, AIM is or contains HLA-DR. In some of the methods, combinations, kits, or uses described herein, AIM is or contains CX3CR1. In some of the methods, combinations, kits, or uses described herein, AIM is or contains TIM3. In some of the methods, combinations, kits, or uses described herein, AIM is or contains LAG3. In some of the methods, combinations, kits, or usage implementations described herein, AIM is or contains TIGIT.

[0025] The methods described herein may include functional and / or phenotypic analysis of activated T cells analyzed by single-cell sequencing. Therefore, in some embodiments, the methods, compositions, kits, or uses described herein may include additional reagents, such as antibodies and / or MHC multimers, one or both of which may be used for flow cytometry and / or CITE-seq analysis.

[0026] Some of the methods, combinations, kits, and uses described herein include a culture medium that supports the viability, activation, and / or activity of present T cells (and optionally other cells, such as antigen-presenting cells, such as dendritic cells). In some embodiments, the culture medium contains one or more cytokines. In some embodiments, the culture medium contains IL-2. In some embodiments, the culture medium contains IL-4. In some embodiments, the culture medium contains IL-7. In some embodiments, the culture medium contains IL-15. In some embodiments, the culture medium contains IL-21. In some embodiments, the culture medium contains GM-CSF. In some embodiments, the culture medium contains FLT3L. In some embodiments, the culture medium contains any combination of IL-2, IL-4, IL-7, IL-15, GM-CSF, and FLT3L. In some embodiments, the culture medium contains cytokines selected from the group consisting of IL-2, IL-7, IL-15, GM-CSF, IL-4, and any combination thereof.

[0027] This document also describes the use of the methods, compositions, and / or kits described herein for analyzing T-cell-mediated patient immune responses to vaccines. In some embodiments, the methods, compositions, and / or kits described herein can be used to analyze T-cell-mediated patient immune responses to immunotherapy. In some embodiments, the methods, compositions, and / or kits described herein can be used to analyze T-cell-mediated immune responses in patients during immunotherapy. In some embodiments, the methods, compositions, and / or kits described herein can be used to analyze T-cell responses in patients to self-antigens. In some embodiments, the methods, compositions, and / or kits described herein can be used to analyze T-cell responses in patients to transplanted antigens. In some embodiments, the methods, compositions, and / or kits described herein can be used to identify one or more TCR variable region sequences (e.g., the CDR3 sequence of the TCRα chain and / or the CDR3 sequence of the TCRβ chain) that activate T cells. In some embodiments, one or more TCR variable region sequences so identified can be used to generate human therapeutic agents, such as T cells comprising one or more TCR variable region sequences identified using the methods, compositions, and / or kits described herein. Attached Figure Description

[0028] Figure 1Illustrations (not to scale) of a non-limiting exemplary embodiment of the invention are provided. In short, unique biological samples, each comprising cells (e.g., whole peripheral blood mononuclear cells, autologous antigen-presenting cells, and T cells), unique antigens, and unique HTOs identifying the unique antigens, are pooled. The pool of unique biological samples is then enriched with activated T cells, allowing analysis of the functional and phenotypic characteristics of the activated T cells. Detailed steps of the method are described below.

[0029] Figure 2A Fluorescent activated cell sorting (FACS) dot blots of T cell:dendritic cell cocultures induced with DMSO, CMV pp65, or MART 1 antigen are provided: (a) after pre-amplification with the same antigen and before restimulation, and (b) after 24-hour restimulation with the same antigen. Cell surface expression and functional activation of CD8, as measured by CD137 / 4-1BB or the dextramer multimer, were assessed by flow cytometry using fluorescently labeled monoclonal antibodies (CD8 and CD137 / 4-1BB) or dextramer multimer staining. Figure 2B CD8 is provided, separated from four different donors (x-axis). + The percentage of T cells (y-axis) is shown, indicating cells incubated with DMSO or CMV pp65 and bound to negative multimers or pp65-labeled multimers (top) or anti-4-1BB antibody (bottom). *Negative multimer = multimer with irrelevant peptide; FMO = control with fluorescence reduced by one.

[0030] Figure 3A The percentage of functional CD8+ T cells (y-axis) in a whole peripheral blood mononuclear cell (PBMC) population from healthy HLA-A*0201+ human donors (HD3 and HD27; x-axis) after 10 days of pre-expansion and 24 hours of restimulation with either DMSO (baseline) or a short peptide synthesized with MART1 (ELAGIGILTV: SEQ ID NO: 15) (MART-1 re-exposure). The baseline population was stained using multimers, and the restimulated population was stained using anti-CD137 / 4-1BB antibody. *FMO = control with fluorescence reduced by one; negative multimer = multimer with irrelevant peptide. Figure 3B A violin plot is provided, showing the clonal frequency (top; y-axis) of the percentage of T-cell-presenting clones from donor HD27 identified by CD137 / 4-1BB or multimer staining (x-axis) and the clonal size (bottom; y-axis) of the number of T-cell-presenting clones. Embedded in the violin plot is a box plot showing the median, upper quartile, lower quartile, and interquartile range (the distance between the upper and lower quartiles).

[0031] Figure 4A-B provides data derived from unique biological samples containing T cells pre-amplified and restimulated with hCMV pp65 peptide and incubated with one of the following unique antigens: EBV YVL-9, hCMV pp65, EBV LMP2A, EBV BMLF1, or M-type influenza virus. Figure 4A Data from the ELISPOT assay are shown, in which IFNγ production (SFC / 2×10⁻⁶) in these biological samples is measured. 6 The number of peptide-specific T cells is calculated using the y-axis. SPC = Spot-forming colony. Figure 4B Dot plots of flow cytometry analysis from these biological samples stained with anti-CD137 / 4-1BB (y-axis) and anti-CD8 (x-axis) antibodies are shown. The percentages of CD137 / 4-1BB+CD8+ cells incubated with DMSO were 0.25%, EBV YVL-9 peptide was 1.27%, CMV pp65 peptide was approximately 26.2%, EBV LMP2A peptide was approximately 3.21%, EBV BMLF1 peptide was approximately 9.67%, or influenza virus peptide was approximately 5.2%.

[0032] Figure 5 Non-limiting illustrations (not to scale) of a non-limiting embodiment of the invention are provided, in which unique biological samples comprising PBMCs, unique antigenic peptides (e.g., as shown in Figure 4), and unique hash-tagged oligonucleotide conjugates of anti-CD2 antibodies (HTO; 1-6) are pooled to enrich cells expressing CD137 / 4-1BB and CD8, and analyzed by single-cell sequencing (5'scSEQ). Although, for example, six hash wells are shown for each unique biological sample stimulated with DMSO, EBV YVL-9, hCMV pp65, EBV LMP2A, EBV BMLF1, or M-type influenza virus, the DMSO population ultimately does not provide many CD8. + CD137 / 4-1BB + T cells are used for single-cell sequencing analysis.

[0033] Figure 6A This shows the individual CD137 / 4-1BB enriched from unique biological samples. + CD8 + The levels (scales from 0 to 2.5) of T cell-associated hash-tagged oligonucleotides (HTO-1, HTO-2, HTO-3, HTO-4, HTO-5) (y-axis) of the unique biological samples, each stimulated with a unique antigen (EBV YVL-9, CMV pp65, EBV LMP2A, EBV BMLF1, or M-type influenza; y-axis). Also shown are those CD137 / 4-1BB samples with sequencing more than one HTO (dual) or no HTO (HTO-free).+ CD8 + T cells. Figure 6B Provided that if each unique antigen (e.g., EBV YVL-9, CMV pp65, EBV LMP2A, EBV BMLF1, or each of the M-type influenza) amplifies its associated unique biological sample equally, then Figure 6A An illustrative (non-scaled) example of how it looks. Figure 6C The display shows the values ​​for each CD137 / 4-1BB. + CD8 + T cell population, from Figure 6A The number of scattered cells (y-axis) in the sorting pool, the cells being identified with reactivity to EBV YVL-9, CMV pp65, EBV LMP2A, EBV BMLF1, and M-type influenza, and corresponding to HTO-1, HTO-2, HTO-3, HTO-4, and HTO-5, respectively. CD137 / 4-1BB cells sequenced with more than one HTO (dual) or without sequenced HTO (no HTO) were also shown. + CD8 + The number of T cells. Figure 6D The figure above shows the enriched CD137 / 4-1BB hashed with HTO 40 (same as HTO-5, for identifying M-type influenza antigen), HTO 47 (same as HTO-4, for identifying EBV BMLF1 antigen), or HTO-48 (same as HTO-2, for identifying CMV pp65 antigen) after staining with dextramer loaded with various peptides (x-axis). + Normalized dextramer expression of T cells (count; y-axis). Figure 6D The figure below shows the clone size (x-axis) of T cell clones hashed with HTO-40, HTO-47, and HTO-48 and enriched for CD137 / 4-1BB expression, and the clone size of those clones identified in the experiments described in the figure above. The total number of unique clones, such as total clones, is denoted by TC. The number of clones showing high expression of the dextramer corresponding to the hash antigen, such as overlapping clones, is denoted by OC.

[0034] Figure 7A Displayed from individual CD137 / 4-1BB + CD8 + Seven unique clusters (clusters 0-6) were resolved in the RNA transcriptome analysis of T cells, which were enriched from unique biological samples stimulated with unique antigens (EBV YVL-9, CMV pp65, EBV LMP2A, EBV BMLF1, or M-type influenza; y-axis). Each point represents a single cell. Figure 7BA TCR clonal map is provided, showing individual T cells corresponding to homologous reactivity against EBV YVL-9, CMV pp65, EBV LMP2A, EBV BMLF1, or M-type influenza, and the relative TCR clonal size for each reactivity. Each point represents a single cell.

[0035] Figure 8A Individual CD137 / 4-1BB provided + The relative protein expression levels of T cell phenotypes and functional T cell markers (CD3, CD4, CD8a, CD45RA, CD62L, HLA-DR, CD274-PDL1, CD279-PD1, CD127, CD25, CD27, CD28, CD137 / 4-1BB, CD69, CD278 / ICOS, CD197 / CCR7) were measured. These T cells were enriched from unique biological samples stimulated with unique antigens (EBV YVL-9, CMV pp65, EBV LMP2A, EBV BMLF1, or M-type influenza; y-axis), with individual cells represented by a single point and clustered according to the RNA transcriptome analysis depicted in Figure 7. Figure 8B The graph shows the expression levels of corresponding RNAseq transcripts for these identical phenotypes and functional T cell markers in each cell, with each cell represented by a dot.

[0036] Figure 9A Five distinct clusters (1-5) are shown based on HTO identification of individual CD137 / 4-1BB+ T cells enriched from unique biological samples stimulated with unique HPV antigens identified by HTO-1, HTO-2, HTO-3, HTO-4, or HTO-5. Each cluster is identified by numerical and grayscale gradations. Cluster “M” represents individual cells identified by multiple HTOs. Each dot represents an individual cell. Figure 9B copied Figure 9A The cluster diagram shows TCR clones that are not shared throughout the HTO cluster, such as cells expressing TCRs that are specific to a unique antigen identified by HTO. Cells of the same clone are represented by the same grayscale coloring. Figure 9C copied Figure 9A Clustering plots of -B cells show the relative RNA expression levels of CD137 / 4-1BB, IFNγ, GZMH, GNLY, CD38, CCL3, and LAG3 in individual cells. The protein expression levels of CD137 / 4-1BB in these cells are also shown (CITE-Seq). Detailed Implementation

[0037] Oligonucleotide-tagged antibodies have been developed as a method to bypass conventional flow cytometry analysis. See, for example, WO2018144813, which is incorporated herein by reference in its entirety. These oligonucleotide-tagged antibodies can be used as tools to bind proteins on the surface of living cells to aid in single-cell tracking for single-cell RNA sequencing (scRNA SEQ) experiments. One approach described in Stoeckius (2017) bioRxiv (also printed in (2018) Genome Biology 19:224) uses an oligonucleotide-tagged antibody with specificity for a single protein expressed on all target cells; and a unique oligonucleotide tag (also known as a hash-tagged oligonucleotide or HTO) with a unique sequence for each sample to track individual samples ultimately pooled for sequencing library preparation. In this approach, each cell can be tagged with a unique oligonucleotide sequence that identifies the sample from which the cell originated. This oligonucleotide sequence is detected and included in the sequencing library, thus allowing the identification of the sample from the resulting sequencing information. Traditionally, hash antibodies are used to pool multiple samples (e.g., multiplex samples) into a single-cell sequencing (scSEQ) library preparation to normalize data and improve efficiency.

[0038] The use of HTO in functional assays, such as for characterizing specific T cell responses, has been previously described, where HTO is conjugated to a multimer of the major histocompatibility complex (MHC), see, for example, Bentzen et al. (2016) Nature Biotechnology 34:1037-45. MHC is expressed by antigen-presenting cells (APCs) and presents peptides to T cells that recognize them. Dogmatically, CD8... + T cells pair with MHC I, while CD4... + T cells pair with MHC II. Furthermore, the extreme polymorphism of the MHC makes it important to understand which alleles are recognized as themselves by T cells; therefore, any response can be said to be induced by the presentation of the peptide itself, rather than by the presentation of foreign MHC. Thus, in order to effectively stimulate antigen-specific T cells and characterize peptide-specific T cell responses, the peptide must be presented in an MHC that matches the corresponding T cell in both class and haplotype.

[0039] Previously, peptide-specific T-cell responses were characterized by functional assays, such as proliferation assays, chromium-based cytotoxicity assays, and Ca2+ assays. 2+Fluorescence assays, and more commonly, cytokine assays such as ELISPOT and intracellular cytokine flow cytometry staining, are described. Klinger et al. (2015) PLoS One DOI:10.1371 / journal.pone.0141561 describe the multiplexing of such assays. However, these functional assays are limited in that they cannot describe antigen specificity or characterize responses at the single-cell level. Flow cytometry MHC tetramer staining overcomes some of these limitations. Flow cytometry MHC tetramer staining allows the assessment of specific T cell responses using fluorophore-conjugated MHC multimers loaded with the peptide of interest. By sorting cells that bind to fluorescent MHC multimers, and sometimes other antibodies, T cells that specifically bind to and may be activated by the MHC multimer loaded with the peptide of interest are identified. The transition from fluorescently labeled MHC multimers to HTO-conjugated MHC multimers eliminates the limitation of a small number of fluorescent tags that can be used to characterize activated T cells. Furthermore, similar to hash antibodies, hash MHC multimers can be used to track individual samples that are ultimately pooled for sequence analysis, thereby detecting HTO sequences and including them in sequencing libraries, and identifying MHC / peptide combinations that bind to the T cells being analyzed. However, unlike the method described above in Stoeckius (2017) bioRxiv (also printed in (2018) Genome Biology 19:224), using HTO-conjugated MHC multimers offers more than just sample tracking, as such use also provides functional analysis, such as identifying MHC / peptide combinations that can bind to specific T cells.

[0040] This article describes a functional assay for tracking antigen-specific T-cell responses at the single-cell level, but this assay does not require (although it does not preclude) the use of MHC multimers. Typically, the method described herein uses hash molecules to track activated T cells from individual assay wells. Distinctive cultures are pooled only after cells from all wells are uniquely labeled with molecules that are individually labeled with one or more oligonucleotides, such as molecules that can be incorporated into the cell membrane (e.g., lipids labeled with one or more oligonucleotides) and / or molecules that bind one or more ubiquitous cell surface markers (e.g., antigen-binding proteins labeled with one or more oligonucleotides). Because the cells are hash-tagged, their origin and homologous antigens can be determined without separating the samples. Following pooling, a functional assay using flow cytometry analysis of activation-inducing markers (AIMs) can be used to separate those activated cells from those inactive cells in the pool.

[0041] Figure 1The present invention illustratively depicts a non-limiting exemplary illustration of the methods described herein. As shown in this non-limiting example, in step (1), a unique antigen, such as a unique T-cell epitope (e.g., “1”, “2”, “3”), which may be a protein, peptide, RNA, cell, cell lysate, etc., and / or a single stimulant or pool of stimulants, is added to a well containing one of a plurality of biological samples, each of which contains T cells and MHC recognized by the T cells, for example, each of which contains autologous peripheral blood mononuclear cells (PBMCs). The biological samples are cultured with the unique antigen for a sufficient time (e.g., 6-72 hours) to upregulate the activation-inducing markers of activated T cells. In some non-limiting exemplary embodiments, for example during restimulation of activated T cells, upregulation of AIM by activated T cells requires only overnight culture of the biological samples with the antigen (e.g., about 18-24 hours). In some non-limiting embodiments, the biological samples may first be induced with the antigen, for example, for about one or two weeks, such as about 7-14 days, to allow pre-expansion of reactive T cells, before overnight restimulation culture. Following restimulation, in step (2), each individual well is incubated with a unique hash-tagged oligonucleotide (HTO) conjugated to molecules (e.g., lipids, antibodies, etc.) that incorporate into the cell membrane and / or specifically bind to cell surface markers (e.g., β2 microglobulin, CD2, CD298, CD3, CD4, and / or CD8, etc.) expressed by T cells regardless of their activation state, wherein each unique HTO (e.g., “1”, “2”, “3”) identifies a unique antigen in each individual well. In step (3), all unique biological samples are multiplexed, e.g., pooled, and after pooling, in step (4), the composition containing the pool of unique biological samples is incubated with agents that can be used to detect activation-inducing markers (e.g., CD137 / 4-1BB) expressed by activated T cells and other desired single-cell sequencing and flow cytometry reagents (e.g., including but not limited to CITE-seq antibodies, fluorescently labeled antibodies, and oligonucleotide-labeled multimers). Figure 1The non-limiting embodiments depicted show the addition of these additional reagents after pooling, but in other non-limiting embodiments, these additional reagents may be added before pooling. In step (5), cells labeled with an agent that can be used to detect activation-inducing markers, such as fluorescently labeled antibodies that specifically bind to activation-inducing markers and another T-cell marker (e.g., CD137 / 4-1BB+CD3+ T cells), are functionally enriched by AIM fluorescent activation-activated cell sorting (FACS) with an agent that can be used to detect activation-inducing markers, such as fluorescently labeled antibodies that specifically bind to activation-inducing markers and another T-cell marker. In step (6), the transcriptome of each enriched cell is then analyzed, for example, by encapsulating the population of sorted cells into 10X Genomics single-cell gel bead-in emulsions (GEMS) to separate the cells into single cells and performing RNA sequencing on each cell. Figure 1 In the non-limiting embodiment shown, 5' sequencing libraries for HTO, transcriptome (5' mRNA), TCR-seq, CITE-seq, and / or oligonucleotide-multimers are generated for high-throughput single-cell sequencing in step (6). In step (7), individual HTO clusters are bioinformatically demultiplexed to elucidate which antigens individual cells are exposed to.

[0042] The described functional assays offer numerous advantages. For example, the methods described herein can be fully personalized, for instance, by using autologous homologous T cells and MHC. Furthermore, it allows for the simultaneous inquiry of multiple reactivity profiles, even when the biological sample to be tested is limited. Homologous antigen / T cell reactivity can be identified at the single-cell or pooled cell level. The use of non-MHC-specific reagents allows for flexible application of this method in patient samples and enables the capture of information in a non-MHC-restricted manner, such as simultaneously capturing CD4+ and CD8+ T cell information, and the use of functional phenotypes (e.g., activation-inducing markers) helps to identify and assess only activated T cells. Moreover, the methods described herein are compatible with subsequent methods for rapidly and cost-effectively assessing the phenotype and transcriptome of activated T cells, which can inform the development and / or decision-making of personalized therapies. In this way, immune responses to therapies (vaccines, immunotherapies, etc.) can be assessed, such as T cell responsiveness to vaccine-encoded antigens, viral antigens, and / or tumor antigens. Similarly, autoimmune reactivity can be measured, such as immune monitoring of T cell responsiveness to self-antigens. The methods described herein can be used for TCR discovery and therapeutic development, such as screening for TCRs of interest among many antigens of interest, and / or for TCR:epitope binding discovery and algorithmic generation. For example, the compilation of epitope:TCR sequence data provided by the methods described herein can help discover haplotype-specific rules regarding TCR sequences and / or structural features associated with binding to specific HLA-peptides.

[0043] Therefore, this paper describes a method that includes one or more of the following steps:

[0044] Hash biological samples containing T cells and MHC, for example, by incubating the biological sample with unique antigens (e.g., T cell epitopes) and unique barcodes (e.g., hash-tagged oligonucleotides) to form unique biological samples.

[0045] A collection of multiple unique biological samples,

[0046] Activated T cells are enriched based on functional assays (e.g., AIM sorting, such as using fluorescently labeled antibodies against activation-inducing markers, such as CD137 / 4-1BB, CD107, IFNγ, PD-1, CD40L, OX40, CD25, CD69, CD28, HLA-DR, CX3CR1, TIM3, LAG3, and / or TIGIT).

[0047] Sequencing methods and optional other well-known methods (e.g., CITE-seq analysis, flow cytometry analysis, and / or multimer staining) are used on activated cells (e.g., on a single-cell basis) to identify (a) a unique barcode for activating T cells, thereby identifying antigens that activate T cells, and optionally (b) other sequences that can be used to identify, for example, the TCRα and β sequences that activate T cells, for example, for therapeutic agent development.

[0048] definition

[0049] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0050] Unless the context clearly specifies otherwise, the singular forms “a / an” and “described” include plural references. Thus, for example, a reference to “a method” includes one or more methods, and / or steps of the type described herein and / or steps that will become obvious to a person skilled in the art upon reading this disclosure.

[0051] The term “about” or “approximately” includes a meaningful range of values. The permissible variations covered by the term “about” or “approximately” depend on the specific system being studied, and this is readily understood by those skilled in the art.

[0052] T cells bind to epitopes on small antigenic determinants associated with the major histocompatibility complex (MHC) on the surface of antigen-presenting cells. T cells bind to these epitopes via the T cell receptor (TCR) complex on their surface. The T cell receptor is a heterodimeric structure composed of two types of chains: an α (α) and β (β) chain, or a γ (γ) and δ (δ) chain. The α chain is encoded by a nucleic acid sequence located at the α locus on human chromosome 14 (which also encompasses the entire δ locus), while the β chain is encoded by a nucleic acid sequence located at the β locus on human chromosome 7. Most T cells possess an αβTCR; a minority of T cells possess a γδTCR. Although the α and β chains are generally referred to herein, the methods, compositions, and kits described herein can be similarly applied to the γδTCR chain.

[0053] T cell receptor α and β polypeptides (and similar γ and δ polypeptides) are interconnected via disulfide bonds. Each of the two polypeptides constituting the TCR contains an extracellular domain comprising a constant region and a variable region, a transmembrane domain, and a cytoplasmic tail (the transmembrane domain and cytoplasmic tail are also part of the constant region). The variable region of the TCR determines its antigen specificity and, similar to immunoglobulins, contains three complementarity-determining regions (CDRs), such as CDR1, CDR2, and CDR3. Also similar to immunoglobulin genes, T cell receptor variable loci (e.g., TCRα and TCRβ loci) contain numerous unrearranged V(D)J segments (variable (V) segments, linking (J) segments, and diversity (D) segments in TCRβ and δ). During thymic T cell development, the TCRα variable locus rearranges, resulting in a TCRα variable domain encoded by a specific combination of VJ segments (Vα / Jα sequences); and the TCRβ variable locus rearranges, resulting in a TCRβ variable domain encoded by a specific combination of VDJ segments (Vβ / Dβ / Jβ sequences). The TCRα and β variable domains, particularly CDR1, CDR2, and CDR3, and especially CDR3, provide the specificity for TCR binding to MHC.

[0054] The terms "major histocompatibility complex" and "MHC" encompass the terms "human leukocyte antigen" or "HLA" (the latter two are generally reserved for human MHC), naturally occurring MHC, individual chains of MHC (e.g., MHC class I α (heavy) chain, β2 microglobulin, MHC class II α chain, and MHC class II β chain), individual subunits of such MHC chains (e.g., α1, α2, and / or α3 subunits of the MHC class I α chain, α1-α2 subunits of the MHC class II α chain, and β1-β2 subunits of the MHC class II β chain), and their portions (e.g., peptide-binding moieties, such as peptide-binding grooves), mutants, and various derivatives (including fusion proteins), wherein such portions, mutants, and derivatives retain the ability to display antigenic peptides for recognition by T cell receptors (TCRs), such as antigen-specific TCRs. MHC I contains a peptide-binding groove formed by the α1 and α2 domains of the heavy α chain, which can store a peptide of approximately 8-10 amino acids. Although both classes of MHC bind to a core of approximately nine amino acids (e.g., 5 to 17 amino acids) within a peptide, the open nature of the MHC class II peptide-binding groove (where the α1 domain of an MHC class II α-peptide binds to the β1 domain of an MHC class II β-peptide) allows for a wider range of peptide lengths. The length of MHC class II-binding peptides typically varies between 13 and 17 amino acids, but shorter or longer lengths are not uncommon. Therefore, peptides can move within the MHC class II peptide-binding groove, thus changing which decimator is directly located within the groove at any given time.

[0055] The term "antigen" encompasses any agent (e.g., protein, peptide, polysaccharide, glycoprotein, glycolipid, nucleotide, part thereof, or combination thereof) that is recognized by the host's immune system and elicits an immune response when introduced into an immune-active host. T cell receptors (TCRs) recognize peptides presented in the environment of the major histocompatibility complex (MHC) as part of an immune synapse. Peptide-MHC (pMHC) complexes are recognized by TCRs, where the peptide (antigenic determinant) and the TCR idiotype provide specificity for the interaction. Therefore, the term "antigen" encompasses peptides presented in the environment of the MHC, such as peptide-MHC complexes, such as pMHC complexes. Peptides displayed on the MHC can also be referred to as "epitopes" or "antigenic determinants." The terms "peptide," "antigenic determinant," "epitope," etc., not only encompass those naturally presented by antigen-presenting cells (APCs) but can be any desired peptide, provided it is recognized by T cells when properly presented. For example, peptides with artificially prepared amino acid sequences can also be used as epitopes.

[0056] The binding of TCRs to homologous pMHCs is typically transient; however, this interaction can be stabilized by an “affinity effect,” provided, for example, by using polymers such as tetramers, dextramers, etc., to incorporate multiple pMHCs onto a single backbone (e.g., a surface). Various pMHC polymerization platforms have been used, many of which are commercially available. See, for example, Wooldridge et al. (2009) Immunol. 126:147-64. To provide this affinity effect, in some embodiments, the MHCs described herein are preferably surface-bound so that an appropriate density of MHCs can be obtained.

[0057] In the non-limiting embodiments disclosed herein, the non-limiting exemplary surfaces that the MHC can be combined with include

[0058] a. Cell membranes, for example, where MHC is expressed on antigen-presenting cells (e.g., professional antigen-presenting cells, such as dendritic cells, monocytes, macrophages, and B cells), the surface of liposomes, viral vector envelopes, etc.

[0059] b. Beads,

[0060] c. Cell culture dishes, such as the wells of multi-well plates, and

[0061] d. Polymers, such as tetramers, dextramers, etc.

[0062] Antigens may include synthetic peptides, proteins, mRNA, viruses, viral vectors, DNA, live cells, cell lysates, etc. In some non-limiting embodiments, the antigen is a tumor-associated antigen, including its peptide portion. In such embodiments, the tumor-associated antigen may be selected from the group consisting of: ALK, BAGE protein, BIRC5 (survivin), BIRC7, CA9, CALR, CCR5, CD19, CD20 (MS4A1), CD22, CD27, CD30, CD33, CD38, CD40, CD44, CD52, CD56, CD79, CDK4, CEACAM3, CEACAM5, CLEC12A, EGFR, EGFR variant III, ERBB2 (HER2), ERBB3, ERBB4, EPCAM, EPHA2, EPHA3, FCRL5, FLT3, FOLR1, GAGE ​​protein, GD2, GD3, GPNMB, GM3, GPR 112, IL3RA, KIT, KRAS, LGR5, EBV-derived LMP2, L1CAM, MAGE protein, MLANA, MSLN, MUC1, MUC2, MUC3, MUC4, MUC5, MUC16, MUM1, ANKRD30A, NY-ESO1 (CTAG1B), OX40, PAP, PAX3, PAX5, PLAC1, PRLR, PMEL, PRAME, PSMA (FOLH1), RAGE protein, RET, RGS5, ROR1, SART1, SART3, SLAMF7, SLC39A6 (LIV1), STEAP1, STEAP2, TERT, TMPRSS2, Thompson-nouvelle antigen, TNFRSF17, TYR, UPK3A, VTCN1, WT1.

[0063] In another implementation, the antigen may be associated with an infectious disease. In such an implementation, for example, by adding an infectious agent or an epitope derived therefrom, the biological sample can become a unique biological sample. In one such implementation, the infectious disease-associated antigen may be a viral antigen, and the viral antigen is selected from the group consisting of: HIV, hepatitis A, hepatitis B, hepatitis C, herpesviruses (e.g., HSV-1, HSV-2, CMV, HAV-6, VZV, Epstein-Barr virus), adenovirus, influenza virus, flavivirus, echovirus, rhinovirus, coxsackie virus, coronavirus (e.g., SARS-CoV-2), respiratory syncytial virus, mumps virus, rotavirus, measles virus, rubella virus, parvovirus, vaccinia virus, HTLV, dengue virus, papillomavirus, molluscum contagiosum virus, poliovirus, rabies virus, JC virus, Ebola virus, and arbovirus encephalitis virus antigens. In another such implementation, the infectious disease-related antigen may be a bacterial antigen, and the bacterial antigen is selected from the group consisting of: Chlamydia, Rickettsia, Mycobacteria, Staphylococcus, Streptococcus, Pneumococcus, Meningococcus, Gonococcus, Klebsiella, Proteus, Serratia, Pseudomonas, Legionella, Diphtheria, Salmonella, Bacilli, Cholera, Tetanus, Botulinum toxin, Anthrax, Plague, Leptospira, and Lyme disease bacterial antigens.

[0064] As used in the methods described herein, the term "biological sample" refers to a culture containing bioactive cells, an activator of the bioactive cells, and a culture medium optionally supporting cell viability and / or bioactivation, such as cell activity. Bioactive cells can be a homogeneous population of cells, such as isolated cells of a specific type (e.g., T cells), or a mixture of different cell types (e.g., a co-culture of peripheral blood mononuclear cells (PBMCs), antigen-presenting cells (APCs), and T cells, a co-culture of dendritic cells (DCs), and T cells, etc.), which can be isolated from or contain biological fluids or tissues isolated from a subject (e.g., a human, mammalian, or other species subject). As a non-limiting example, biological fluids or tissues may include serum, plasma, whole blood, peripheral blood, saliva, urine, vaginal or cervical secretions, amniotic fluid, placental fluid, cerebrospinal fluid, serous fluid, or mucosal secretions (e.g., oral, vaginal, or rectal). Other samples include biological samples or tissues of blood or biopsy origin, such as tissues containing tumor-infiltrating lymphocytes (e.g., tumors), indurations, etc.

[0065] Some non-limiting biological samples disclosed herein comprise surface-bound MHCs of T cells and presenting antigens (e.g., T cell epitopes), such as when the bioactive cell is a T cell and the activator is a surface-bound MHC of the presenting antigen (e.g., T cell epitope). Some non-limiting biological samples disclosed herein comprise T cells, surface-bound MHCs of presenting antigens (e.g., T cell epitopes), and one or more cytokines that support the viability, activation, and / or activity of T cells, such as when the bioactive cell is a T cell, the activator is a surface-bound MHC of the presenting antigen (e.g., T cell epitope), and the culture medium contains one or more cytokines that support the viability, activation, and / or activity of T cells. In some embodiments, the cytokines supporting the viability, activation, and / or activity of T cells comprise interleukins selected from the group consisting of IL-2, IL-4, IL-7, IL-15, IL-21, and combinations thereof. Some non-limiting biological samples disclosed herein contain surface-bound MHC for T cells and antigen-presenting cells, wherein the MHC is expressed on the surface of antigen-presenting cells, such as somatic cells, which may optionally be professional antigen-presenting cells selected from the group consisting of dendritic cells, monocytes, macrophages, and B cells of monocyte origin. These non-limiting biological samples containing surface-bound MHC for T cells and antigen-presenting cells (where the MHC is expressed on the surface of antigen-presenting cells) may optionally further contain cytokines (e.g., IL-2, IL-4, IL-7, IL-15, and / or IL-21) that support the viability, activation, and / or activity of T cells and / or cytokines (e.g., GM-CSF, FLT3L, and / or IL-4) that support the viability, activation, and / or activity of antigen-presenting cells. Additional cytokines or combinations of cytokines (and the amounts thereof supporting the viability, activation, and / or activity of T cells and / or antigen-presenting cells) that may be used to support the viability, activation, and / or activity of T cells and / or antigen-presenting cells are well known in the art. In some implementations, the cell viability-supporting culture medium includes other factors that activate APCs, such as IFNα, LPS, poly-IC, TNF, IL-1β, IL-6, PGE2, etc.

[0066] Biological samples are typically obtained from or derived from specific sources, subjects, or patients.

[0067] "Individual," "subject," or "animal" refers to humans, veterinary animals (e.g., cats, dogs, cattle, horses, sheep, pigs, etc.), and experimental animal models of diseases (e.g., mice, rats). In one implementation, the subject is a human.

[0068] In a non-limiting embodiment described herein, the biological sample comprises peripheral blood mononuclear cells (PBMCs) derived from the subject. The biological sample described herein may comprise newly isolated PBMCs, freshly thawed PBMCs that have been frozen, or PBMCs that have been induced, for example, cultured for about one week in the presence of an antigen to amplify memory reactivity and increase assay signal.

[0069] Typically, biological samples as described herein (e.g., unique biological samples) contain a sufficient number of T cells and surface-bound MHC to support T cell activation in response to antigens, such as at least 1 × 10⁻⁶. 5 5×10 5 1×10 6 One or more whole peripheral blood mononuclear cells. The combination of hashing and multiplexing advantageously provides for performing the methods described herein on low-volume blood samples, such as low-volume human blood samples, since 1 mL of whole (human) blood can contain 5 × 10⁶ cells. 5 Up to 3×10 6 Any number of peripheral blood mononuclear cells (PBMCs) and / or cells that can be used to isolate 5 × 10 3 Up to 5×10 5 Any number of APCs (e.g., dendritic cells) and 5 × 10 3 Up to 5×10 6 Any number of T cells. As a non-limiting example, a cell collection derived from 10 mL of whole blood isolated from a subject may contain 5 × 102 T cells. 6 Up to 3×10 7 Any number of PBMCs allows the cell aggregates to be evenly distributed across multiple individual biological samples, for example, at least 20 biological samples, each containing approximately 1 × 10⁻⁶ cells. 5 Up to 1×10 6 One PBMC and / or 1×10 5 Up to 5×10 5 One DC and 1×10 5 Up to 5×10 6 T cells, etc., can then be pooled (after each is added with a unique antigen and / or a unique HTO) and assayed according to the methods described herein. Therefore, in some embodiments, the cell pool contains a sufficient number of peripheral blood mononuclear cells (PBMCs) such that the cell pool can be uniformly distributed across multiple biological samples. In some embodiments, the cell pool contains a sufficient number of PBMCs such that the cell pool can be uniformly distributed across at least two individual biological samples, each containing at least about 1 × 10⁻⁶ T cells. 5 One PBMC, at least approximately 5 × 10 5 One PBMC or at least approximately 1×10 6Each PBMC, for example, a cell aggregate may be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the cell aggregate contains a sufficient number of PBMCs such that the cell aggregate can be uniformly distributed across at least three individual samples, each containing at least about 1 × 10⁻⁶ PBMCs. 5 One PBMC, at least approximately 5 × 10 5 One PBMC or at least approximately 1×10 6 Each PBMC, for example, a cell aggregate may be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the cell aggregate contains a sufficient number of PBMCs such that the cell aggregate can be evenly distributed across at least five individual samples, each containing at least about 1 × 10⁻⁶ PBMCs. 5 One PBMC, at least approximately 5 × 10 5 One PBMC or at least approximately 1×10 6 Each PBMC, for example, a cell aggregate may be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the cell aggregate contains a sufficient number of PBMCs such that the cell aggregate can be evenly distributed across at least ten individual samples, each containing at least about 1 × 10⁻⁶ PBMCs. 5 One PBMC, at least approximately 5 × 10 5 One PBMC or at least approximately 1×10 6 Each PBMC, for example, a cell aggregate may be derived from approximately 1 mL, 3 mL, 5 mL, 10 mL, 15 mL, 20 mL, or 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the cell aggregate contains a sufficient number of PBMCs such that the cell aggregate can be uniformly distributed across at least twenty individual samples, each containing at least approximately 1 × 10⁻⁶ PBMCs. 5 One PBMC, at least approximately 5 × 10 5 One PBMC or at least approximately 1×10 6 Each PBMC, for example, cell aggregate may be derived from approximately 1 mL, 3 mL, 5 mL, 10 mL, 15 mL, 20 mL, or 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the cell aggregate contains a sufficient number of PBMCs such that the cell aggregate can be uniformly distributed across at least thirty individual samples, each containing at least approximately 1 × 10⁻⁶ PBMCs. 5 One PBMC, at least approximately 5 × 10 5 One PBMC or at least approximately 1×10 6Each PBMC, for example, a cell aggregate may be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the cell aggregate contains a sufficient number of PBMCs such that the cell aggregate can be uniformly distributed across at least fifty individual samples, each containing at least about 1 × 10⁻⁶ PBMCs. 5 One PBMC, at least approximately 5 × 10 5 One PBMC or at least approximately 1×10 6 Each PBMC, for example, may be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the cell aggregate contains a sufficient number of T cells and antigen-presenting cells (APCs) (e.g., dendritic cells (DCs)) such that the cell aggregate can be uniformly distributed across multiple individual biological samples. In some embodiments, the cell aggregate contains a sufficient number of APCs and T cells isolated from a subject, such as a human subject, such that the cell aggregate can be uniformly distributed across multiple individual biological samples, each containing an APC:T cell ratio of about 1:1, about 1:5, or about 1:10 for APCs and T cells (e.g., DCs and T cells), for example, where each sample contains at least about 5 × 10⁶ cells. 3 5×10 4 One or 5×10 5 One DC and approximately 5 × 10 3 1×10 4 1, 2.5 × 10 4 5×10 4 1×10 6 1, 2.5 × 10 5 5×10 5 1×10 6 1, 2.5 × 10 6 One or 5×10 6 Individual T cells, such as a cell collection, may be derived from approximately 5 mL, 10 mL, 15 mL, 20 mL, or 50 mL of whole blood isolated from a subject, such as a human subject.

[0070] Biological samples isolated from subjects may be further diluted with saline, buffer, or physiologically acceptable diluents. Alternatively, biological samples from subjects may be concentrated using conventional methods. Biological samples isolated from subjects may also be aliquoted into two or more equal portions to form “multiple biological samples,” each of which contains approximately the same number of bioactive cells (e.g., T cells) and approximately the same amount of supporting reagents. Therefore, unless otherwise stated, “multiple biological samples” as used herein refers to multiple distinct populations of bioactive cells, each isolated from the same subject, containing approximately the same number of bioactive cells, and maintained under similar culture conditions, such as supporting reagents that support the viability, activation, and / or activity of the bioactive cells.

[0071] In some embodiments of the invention, biological samples are incubated with an antigen for about one week (e.g., about 7-10 days) to initiate in vitro, such as for pre-amplification, followed by in vitro restimulation with the antigen for about one to three days (e.g., 6-72 hours, or 18-24 hours) and then hashed, enriched, and / or analyzed to identify the unique biological sample. In some embodiments of the invention, biological samples are not incubated before in vitro restimulation with the antigen and subsequent hashing, enrichment, and / or analysis to identify the unique biological sample. For biological samples that may have already encountered the antigen in vivo, in vitro initiation is generally not required. Initiation and restimulation protocols for biological samples containing T cells, including the same time selection (e.g., initiation for 7-10 days and restimulation for 6-72 hours, or 18-24 hours), are well known in the art.

[0072] In some non-limiting embodiments, each of the multiple biological samples becomes a unique biological sample by incubating it with its own unique stimuli or unique combination of stimuli (e.g., antigens or pools of antigens (e.g., T-cell epitopes)) and / or its own unique barcode, such as for hashing and optional multiplexing (hash-tagged oligonucleotides).

[0073] As used herein, terms such as “hash tag,” “hash,” and “tag” encompass contact between a bioactive cell of a unique biological sample and a molecule conjugated to a unique barcode, such as a unique hash-tagged oligonucleotide (HTO), wherein the unique barcode identifies a unique characteristic of the unique biological sample, such as a unique antigen (e.g., a unique T-cell epitope) or the absence of a unique antigen, and wherein the molecule is incorporated into the cell membrane of the bioactive cell and / or specifically binds to a cell surface marker expressed by the bioactive cell, regardless of the activation state of the bioactive cell. In some embodiments, the HTO molecule may be incorporated into any cell, such as any dividing cell, and / or bind to a cell surface marker (e.g., β2-microglobulin, CD298) expressed by most or all cells. In some embodiments, the selected cell marker is expressed by T cells regardless of their activation state (e.g., CD2, CD3, CD4, and / or CD8, etc.). In some embodiments, where two or more molecules that label cells with HTO in two or more different ways (e.g., one molecule may incorporate itself into the cell membrane while another binds a marker, or two or more molecules may bind two or more different markers) are each conjugated with HTO and used in a hashing method to label the same unique biological sample, the two or more molecules may contain the same barcode. In some embodiments, the two or more markers used for hashing and labeling unique biological samples may be the same or different markers. In some implementations, a first unique biomarker may be labeled with a first molecule conjugated to a first unique barcode, such as a first HTO; a second unique biological sample may be labeled with a second molecule conjugated to a second unique barcode, such as a second HTO; and a third biological sample may be labeled with a third molecule conjugated to a third barcode, such as a third barcode. Each of the first, second, and third molecules is identical, for example, each incorporating itself into the cell membrane or specifically binding to the same biomarker. However, each of the first, second, and third molecules contains a unique barcode sufficiently distinct to distinguish each of the first, second, and third molecules. After washing away unbound molecules, the uniquely hashed biological samples may be pooled and optionally incubated with additional reagents for further functional and phenotypic analysis of antigen-specific activated T cell populations (e.g., flow cytometry analysis and / or fluorescent cell activation sorting, single-cell sequence analysis, etc.), because the hash label allows for subsequent detection, tracking, and / or quantification of each sample and target originating from the same sample.

[0074] Some non-limiting embodiments can further enhance the sensitivity and / or robustness of the methods described herein. For example, in some non-limiting embodiments, the assay sample, which aggregates 20 potentially reactive oligonucleotide hashes per scSEQ sample, typically results in sufficient enrichment. In some embodiments, a combined hashing approach can be employed to increase the sensitivity of the assay. For example, two or more molecules of a cell (e.g., one molecule may incorporate itself into the cell membrane while another binds a marker, two or more molecules may bind two or more different markers, etc. (e.g., β2 microglobulin and CD2)) are each labeled with the same barcode, for example, an HTO conjugate containing the same sequence, and each is used in a hashing method to label the same unique biological sample.

[0075] The generation and use of “hash-tagged oligonucleotides,” “HTOs,” etc., including the conjugation of hash-tagged oligonucleotides, for example, to molecules (e.g., antibodies or other macromolecules, such as lipids), which optionally and preferably bind to activation-inducing markers in some non-limiting embodiments, are well known. See, for example, WO2018144813; Stoeckius et al. (2018) Genome Biol. 19:224; van Buggenum JAGL et al., each of which is incorporated herein by reference in its entirety. Typically, an HTO contains a unique barcode, such as a nucleic acid containing a unique sequence that can be determined according to a standard polymerase chain reaction protocol, such as a single-cell RNA sequencing protocol for sequencing the cellular transcriptome (see, for example, Stoeckius et al. (2017) Nat. Method 9:2579-10), which, in the embodiments described herein, identifies activating biological samples, for example, stimuli or combinations of stimuli that cause the biological sample to express activation-inducing markers. Conjugation chemistry, such as iEDDA click chemistry, can be used to conjugate, for example, hash-tagged oligonucleotides to molecules (e.g., ligands that bind cell surface markers, such as constitutively expressed cell surface markers). In some embodiments, the cell surface markers are expressed by most or all cells, including T cells (e.g., β2 microglobulin, CD298). In some embodiments, cell markers (e.g., CD2, CD3, CD4, and / or CD8, etc.) expressed by T cells regardless of their activation state are selected. Although oligonucleotide-tagged antibodies are described herein, other oligonucleotide-tagged tracking molecules besides antibodies, such as oligonucleotide-tagged lipids incorporated into the cell membrane and cell-permeable nucleic acids, can be used, particularly for further functional and / or phenotypic characterization based on single-cell sequencing analysis.

[0076] The hash-tagged oligonucleotides (HTOs) used in these compositions and methods can conjugate any naturally occurring or synthetic biological or chemical molecule that can be used to label cells, such as lipids incorporated into the cell membrane and / or ligands that specifically bind to a single identified marker. Binding can be covalent or non-covalent, i.e., conjugated or by any known manner taking into account the nature of the ligand and its corresponding target. The terms “first HTO-conjugated molecule” and “additional HTO-conjugated molecule” or “second HTO-conjugated molecule” refer to HTO-conjugated molecules that label cells in different ways; for example, one molecule may incorporate itself into the cell membrane while a second molecule binds to the marker, and two or more molecules may bind to different targets or different portions of a target. For example, multiple “first HTO-conjugated molecules” may be incorporated into the cell membrane or bind to the same marker at the same site. Multiple additional HTO-conjugated molecules may bind to markers that are different from the first HTO-conjugated molecules and different from any additional HTO-conjugated molecules. HTO-conjugated molecules (e.g., first HTO-conjugated molecules and additional HTO-conjugated molecules, such as second, third, fourth and fifth HTO-conjugated molecules, etc.) can be independently selected from peptides, proteins, antibodies or antibody fragments (e.g., antigen-binding portions of antibodies), antibody mimics, affibody, ribonucleic acid sequences, aptamers, lipids, cholesterol, polysaccharides, lectins or chimeric molecules formed from multiple identical or different molecules. Other non-limiting examples of HTO-conjugated molecules include those comprising Fab, Fab', F(ab')2, Fv fragments, single-chain Fv (scFv), double-chain antibodies (Dab), synthetic antibodies, nanobodies, BiTE, SMIP, DARPin, DNL, ​​dual-carrier proteins (Duocalin), adnectin, fynomer, Kunitz domain Albu-dab, DART, DVD-IG, Covx bodies, peptide bodies, scFv-Ig, SVD-Ig, dAb-Ig, knob-in-Hole structures, triomAbs, and combinations thereof. In some embodiments, the HTO-conjugated molecule is a recombinant or naturally occurring protein. In some embodiments, the HTO-conjugated molecule is a monoclonal or polyclonal antibody or fragment thereof. In one embodiment, the HTO-conjugated molecule itself may also be directly labeled with one or more detectable markers, such as fluorophores that can be measured by well-known methods independently of methods for measuring or detecting barcodes such as HTO.

[0077] In some embodiments, the HTO-conjugated molecule comprises lipids that are incorporated into the cell membrane. In some embodiments, the HTO-conjugated molecule comprises cholesterol that is incorporated into the cell membrane. In some embodiments, the HTO-conjugated molecule comprises lipid- and cholesterol-modified oligonucleotides (LMO and CMO). See, for example, McGinnis et al. (2019) Nature Methods 16:619-26, incorporated herein by reference in its entirety.

[0078] Assays for further functional and phenotypic analysis of antigen-specific activated T cell populations are well known in the art and include, but are not limited to, fluorescent cell activation sorting and / or flow cytometry analysis using fluorescently labeled binding proteins (e.g., antibodies) or MHC multimers, single-cell RNA sequencing (scRNA-seq), and / or cell indexing of transcriptomes and epitopes by sequencing (CITE-seq). "Flow cytometry" encompasses methods involving suspending cells or particles in a fluid and injecting the suspension into a flow cytometer that concentrates the sample to ideally pass one cell at a time through a laser beam, wherein the scattered light is specific to the cell and its components. Fluorescently labeled cells absorb the laser and emit at wavelengths that can be used to distinguish the cells. In a preferred embodiment, after hashing and pooling, a unique biological sample is enriched for activated T cells, for example, sorted for those expressing activation-inducing markers. In one embodiment, before or simultaneously with any further functional and phenotypic analysis of the cells, such as before or simultaneously with any additional flow cytometry analysis and / or single-cell sequencing analysis (which may include CITE-seq analysis of any CITE-seq reagents added to the biological sample before or after sorting), cells are enriched for activated T cells using fluorescently labeled antibodies against activation-inducing markers and fluorescent activated cell sorting (FACS), for example, sorting. “CITE-seq” encompasses methods in which the use of oligonucleotide-labeled molecules (e.g., oligonucleotide-labeled antibodies) to measure protein expression levels in a sample, for example during single-cell sequencing methods described, such as those described in Stoeckius et al. (20017) Nat. Methods 14:865-868 (incorporated herein by reference in its entirety). In some non-limiting embodiments, further functional and phenotypic analysis of the cells includes flow cytometry analysis with fluorescently labeled antibodies that detect protein expression levels of cell surface markers (e.g., additional activation markers) or intracellular proteins (e.g., intracellular cytokines). In some non-limiting embodiments, further functional and phenotypic analysis of the cells includes single-cell RNA sequencing for each activated cell. Non-limiting exemplary platforms for single-cell RNA sequencing include, but are not limited to, plate-based methods or microfluidic / nanopore methods, such as droplet-based microfluidic methods, such as, but not limited to, Dr op-seq (Macosko et al. (2015) Cell 161:1202-14), InDrop (Kein et al. (2015) Cell 161:1187-1201), 10X Genomics (Zhen et al. (2017) Nat. Commun. 8:1-12), and... Single-cell sequencing solutions. Since mRNA expression levels may not correlate well with protein expression levels in cells, in some non-limiting embodiments, single-cell RNA sequencing is combined with CITE-Seq analysis using, for example, oligonucleotide-labeled antibodies, MHC multimers, etc. (see, for example, WO2018144813, which is incorporated herein by reference in its entirety).

[0079] An activation-inducing marker (AIM) is a marker that is expressed or upregulated after T cell activation. Well-known T cell activation-inducing markers include, but are not limited to, CD137 / 4-1BB, CD107, IFNγ, PD-1, CD40L, OX40, CD25, CD69, CD28, HLA-DR, CX3CR1, TIM3, LAG3, TIGIT, etc. In some embodiments, the T cell activation marker, such as the activation-inducing marker, comprises CD40L. CD40L may also be referred to as CD154. In some embodiments, the T cell activation marker, such as the activation-inducing marker, comprises CD137. CD137 is also referred to herein as 4-1BB. Therefore, CD137 / 4-1BB refers to molecules known in the art as CD137, 4-1BB, etc., and the phrases "CD137", "4-1BB", and "CD137 / 4-1BB" are used interchangeably. CD137 / 4-1BB is a transient T-cell activation marker that is rapidly upregulated upon antigen-specific TCR binding and remains expressed on cells for approximately 72 hours. In the methods described herein, 20–36 hours after antigen exposure appears to be the optimal time point for functional enrichment and detection of CD137 / 4-1BB expression. In some embodiments, the activation-inducing marker comprises CD107. CD107 may also be referred to as CD107a or LAMP1. In some embodiments, the activation-inducing marker comprises interferon-γ (IFNγ), which may also be referred to as interferon-gamma, IFNG, IFG, etc. In some embodiments, the activation-inducing marker comprises PD-1, which may also be referred to as programmed cell death 1, CD279, and HPD-1. In some embodiments, the activation-inducing marker comprises TNF receptor superfamily member 4, which may also be referred to as OX40 and / or CD134. In some embodiments, the activation-inducing marker comprises interleukin-2 receptor α, which may also be referred to as IL-2R, IL-2Rα, and / or CD25. In some embodiments, the activation-inducing marker includes CD69, which may also be referred to as leukocyte surface antigen Leu-23 and / or MLR3. In some embodiments, the activation-inducing marker includes CD28, which may also be referred to as Tp44 and / or T cell-specific surface glycoprotein. In some embodiments, the activation-inducing marker includes major histocompatibility complex class II DR, which may also be referred to as HLA-DR. In some embodiments, the activation-inducing marker includes CXC motif chemokine receptor (CX3CR1), which may also be referred to as IL-8 receptor, IL-8Rα, and / or CDw128a. In some embodiments, the activation-inducing marker includes TIM3, which may also be referred to as hepatitis A virus cell receptor 2, T cell membrane protein 3, and / or CD366. In some embodiments, the activation-inducing marker includes lymphocyte activation gene 3 (LAG3), which may also be referred to as CD223.In some implementations, the activation-inducing marker comprises a T-cell immune receptor (TIGIT) with Ig and ITIM domains, which may also be referred to as protein 9 (VSIG9) containing V-Set and immunoglobulin domains and / or protein 3 (VSTM3) containing V-Set and / or transmembrane domains.

[0080] The terms “immunoglobulin,” “antibody,” “antibodies,” and “binding protein” refer to monoclonal antibodies, multispecific antibodies, human antibodies, humanized antibodies, chimeric antibodies, single-chain Fv (scFv), single-chain antibodies, Fab fragments, F(ab') fragments, disulfide-linked Fv (sdFv), intracellular antibodies, microantibodies, double-chain antibodies, and anti-idiotype (anti-Id) antibodies (including, for example, anti-Id antibodies against antigen-specific TCRs), and epitope-binding fragments of any of the above antibodies. The term “antibody” also refers to covalently coupled double-chain antibodies, such as those disclosed in U.S. Patent Application Publication 20070004909 (integrated herein by reference in its entirety), and Ig-DARTS, such as those disclosed in U.S. Patent Application Publication 20090060910 (integrated herein by reference in its entirety).

[0081] As used herein, the term "detectable label" refers to a reagent, fraction, or compound capable of providing a detectable signal, depending on the assay format employed. The label may be associated solely with the molecule and / or with a unique barcode (e.g., a unique HTO) or its functional portion. Alternatively, different labels may be used for each component of an HTO-conjugated molecule. Such labels can provide a detectable signal, alone or in conjunction with other compositions or compounds. In one embodiment, the labels interact to generate a detectable signal. In a specific embodiment, the label is visually detectable, such as through colorimetric detection. Various enzyme systems can display colorimetric signals in assays; for example, glucose oxidase (which uses glucose as a substrate) releases peroxides as a product, which, in the presence of the peroxidase and a hydrogen donor (such as tetramethylbenzidine (TMB)), produces oxidized TMB, appearing blue. Other examples include horseradish peroxidase (HRP) or alkaline phosphatase (AP), and hexokinase bound to glucose-6-phosphate dehydrogenase, reacting with ATP, glucose, and NAD+ to produce NADH, among other products, which is detected by an increase in absorbance at 340 nm. Other labeling systems that can be used for the methods and molecules described herein can be detected in other ways, such as colored latex microparticles embedded with dyes (Bangs Laboratories, Indiana) which can be used instead of enzymes to provide a visual signal indicating the presence of the labeled molecule in applicable assays. Other labels include fluorescent compounds, fluorophores, radioactive compounds, or elements. In one embodiment, fluorescence can detect fluorescent dyes such as fluorescein isothiocyanate (FITC), phycoerythrin (PE), allophycocyanin (APC), coriphosphine-0 (CPO) or tandem dyes, PE-anthocyanin-5 or -7 (PC5 or PC7), PE-Texas Red (ECD), PE-anthocyanin-5.5, rhodamine, PerCP, and Alexa dyes. Combinations of these labels may be used, such as Texas Red and Rhodamine, FITC+PE, FITC+PECy5, and PE+PECy7, depending on the assay method. The selection and / or production of labels for any component of the labeled molecules and / or polymer molecules are within the scope of the art as provided in this specification.

[0082] The terms “specific binding” and “binding in a specific manner” indicate that the molecules involved in specific binding (1) can bind stably under physiological conditions, such as association, such as forming intermolecular non-covalent bonds, and (2) cannot bind stably to other molecules besides the specified binding pair under physiological conditions.

[0083] The term "protein" encompasses all kinds of naturally occurring and synthetic proteins, including protein fragments of all lengths, fusion proteins, and modified proteins, including but not limited to glycoproteins, as well as all other types of modified proteins (e.g., proteins produced by phosphorylation, acetylation, myristylation, palmitoylation, glycosylation, oxidation, formylation, amidation, polyglutamylation, ADP-ribosylation, PEGylation, biotinylation, etc.).

[0084] Unless otherwise stated, the terms "oligonucleotide," "nucleic acid," and "nucleotide" cover DNA, RNA, modified bases, or combinations of these bases. In some embodiments, the hash-tagged oligonucleotide comprises DNA. In some embodiments, the hash-tagged oligonucleotide comprises 3 to 100, 3 to 50, 3 to 30, 5 to 30, 10 to 20, 5 to 20, or 5 to 15 nucleotides. In some implementations, the hash tag oligonucleotides contain at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, and 5 A sequence of 1, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 80, 91, 92, 93, 94, 95, 96, 97, 98, 99, or up to 100 nucleotides. In some embodiments, the hash-tagged oligonucleotide comprises a polyA sequence which may contain ten or more (e.g., 10-40, 10-30, or 10-20) consecutive adenosine nucleotides, derivatives of adenosine nucleotides, or variants thereof.

[0085] The term "self-homogeneous" refers to biological components isolated from the same source, and includes those biological components that are not isolated from the same source but possess physical (e.g., amino acid sequence) and functional characteristics as if they were isolated from the same source. Conversely, "heterogeneous" refers to agents or entities from different sources.

[0086] Based on the information disclosed herein, conventional molecular biology, microbiology, and recombinant DNA techniques within the scope of this art can be employed. These techniques are well-explained in the literature. See Sambrook, Fritsch, and Maniatis, Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989 (Sambrook et al., 1989 in this article); DNA Cloning: A Practical Approach, Volumes I and II (edited by DN Glover, 1985); Oligonucleotide Synthesis (edited by MJ Gait, 1984); Nucleic Acid Hybridization [edited by BD Hames and SJ Higgins, 1985]; Transcription and Translation [edited by BD Hames and SJ Higgins, 1984]; Animal Cell Culture [edited by RI Freshney, 1986]; Immobilized Cells and Enzymes [IRLPress, 1986]; B. Perbal, A Practical Guide to Molecular Cloning (1984); Ausubel, FM et al. (editors). Current Protocols in Molecular Biology. John Wiley & Sons, 1994. Each of these publications is incorporated herein by reference in its entirety.These techniques include site-directed mutagenesis, see, for example, Kunkel, Proc. Natl. Acad. Sci. USA 82:488-492 (1985); U.S. Patent No. 5,071,743; Fukuoka et al., Biochem. Biophys. Res. Commun. 263:357-360 (1999); Kim and Maas, BioTech. 28:196-198 (2000); Parikh and Guengerich, BioTech. 24:4 28-431 (1998); Ray and Nickoloff, BioTech. 13:342-346 (1992); Wang et al., BioTech. 19:556-559 (1995); Wang and Malcolm, BioTech. 26:680-682 (1999); Xu and Gong, BioTech. 26:639-641 (1999); U.S. Patent Nos. 5,789,166 and 5,932,419; Hogrefe, Strategies l4.3:74-75 (2001); U.S. Patent Nos. 5,702,931, 5,780,270 and 6,242,222; Angag and Schutz, Biotech. 30:486-488 (2001); Wang and Wilkinson, Biotech. 29:976-978 (2000); Kang et al., Biotech. 20:44-46 (1996); Ogel and McPherson, Protein Engineer. 5:467-468 (1992); Kirsch and Joly, Nucl. Acids. Res. 26:1848-1850 (1998); Rhem and Hancock, J. Bacteriol. 178:3346-3,349 (1996); Boles and Miogsa, Curr. Genet. 28:197-198 (1995); Barrenttino et al., Nuc. Acids. Res. 22:541-542 (1993); Tessier and Thomas, Meths. Molec. Biol. 57:229-237; and Pons et al., Meth. Molec. Biol. 67:209-218; each of these publications is incorporated herein by reference in its entirety.

[0087] Methods and compositions

[0088] The compositions and methods described herein can be used to (a) detect the absence or presence of functional activation of biological samples, such as cells, isolated from subjects, such as human subjects, and / or (b) identify stimuli and optionally unique homologous TCR sequences.

[0089] In one embodiment, the method described herein for identifying antigens capable of activating T cells, such as T cell epitopes, and optionally T cell receptor (TCR) α-chain sequences and / or TCR β-chain sequences, such as T cell epitopes, that specifically bind to said antigens comprises:

[0090] (I) Sorting activated T cells from a composition containing a unique biological sample based on the expression of an activation-inducing marker (AIM), said unique biological sample comprising:

[0091] (a) T cells and surface-bound major histocompatibility complex (MHC), wherein the T cells are capable of recognizing peptides presented in the environment of the surface-bound MHC.

[0092] (b) Unique antigens,

[0093] (c) A unique hash-tagged oligonucleotide (HTO) that can be used for specific identification, preferably for specific identification of the unique antigen, wherein the unique HTO is conjugated to a molecule that has been labeled with the unique HTO on T cells, and optionally,

[0094] (d) Culture medium that supports T cell activation.

[0095] (II) Single-cell sequencing analysis of the activated T cells sorted in (I) to identify unique HTOs that are molecularly conjugated to activated T cells labeled with unique HTOs, wherein identifying unique HTOs identifies antigens capable of activating activated T cells, and optionally, the single-cell sequencing analysis also identifies one or more of the following:

[0096] (i) One or more genes expressed by activated T cells, and / or

[0097] (ii) TCRα and / or β chain sequences of TCRs expressed by activated T cells.

[0098] In some implementations, such as the methods described herein, include

[0099] (I) Sorting one or more activated T cells from a composition containing a unique biological sample pool, and

[0100] (II) Single-cell sequencing analysis was performed on the activated T cells sorted in (I) to identify the antigens that elicited a response in the activated T cells.

[0101] In some implementations, each unique biological sample sorted in (I) includes:

[0102] (a) T cells and surface-bound major histocompatibility complexes (MHCs), wherein the T cells are capable of recognizing peptides presented in the context of surface-bound MHCs, wherein each T cell of each unique biological sample is isolated from the same subject and wherein each MHC of each unique biological sample has the same haplotype (optionally, wherein each MHC of each unique biological sample originates from the same sample, binds to the same surface (e.g., the cell membrane of antigen-presenting cells), etc.).

[0103] (b) Unique antigens, such as T-cell epitopes.

[0104] (c) A unique hash-tagged oligonucleotide (HTO), wherein the unique hash-tagged oligonucleotide is conjugated to a T cell labeled with the HTO, wherein the unique HTO contains a unique antigen specifically identifying (b), such as a unique nucleotide sequence of a T cell epitope, and optionally,

[0105] (d) Culture medium that supports T cell activation.

[0106] This enables single-cell sequencing analysis in (II) to identify unique HTOs conjugated to entities, wherein the unique nucleotide sequence of the unique HTO identifies antigens capable of activating T cells, such as T cell epitopes. In some embodiments, the HTO-conjugated molecule contains lipids incorporated into the cell membrane. In some embodiments, the HTO-conjugated molecule contains ligands that specifically bind to cell surface markers expressed by T cells. In some embodiments, the cell surface markers expressed by T cells are universally expressed by many cells; for example, the cell surface marker may be β2-microglobulin. In some embodiments, the cell surface marker may be selectively expressed by all T cells, regardless of activation state. In some embodiments, the cell marker is selected from the group consisting of β2-microglobulin, CD298, CD2, CD3CD4, CD8, and combinations thereof. In some embodiments, single-cell sequencing analysis also identifies one or more genes expressed by activated T cells, and / or the TCRα and / or β chain sequences of TCRs expressed by activated T cells.

[0107] In some embodiments, the method further includes forming a unique pool of biological samples. Forming a unique pool of biological samples may include, for example, establishing multiple biological samples by: evenly distributing biological samples isolated from a subject and containing at least T cells and preferably MHC (e.g., peripheral blood mononuclear cells (PBMCs), T cells, and APCs, etc.) into individual samples; and maintaining the biological samples under conditions that support the viability, activation, and / or activity of T cells (e.g., wherein each biological sample contains culture media and cytokines that support the viability and activity of PBMCs, such as T cells and APCs). As described herein, the T cells and MHC used in the methods described herein may be derived from any source. In some embodiments, MHC is expressed on antigen-presenting cells; for example, the biological sample contains T cells and MHC expressed on the surface of antigen-presenting cells (APCs). In some embodiments, the T cells and APCs are autologous. Non-limiting and exemplary sources of APCs include whole peripheral blood mononuclear cells (PBMCs), monocyte-derived dendritic cells (DCs), B cells, macrophages, normal tissue or tumor cells, APC cell lines, etc. T cells can be stimulated using a co-culture of APCs and T cells. In some implementations, the entire PBMC provides both APCs and T cells.

[0108] In some embodiments of these and other implementations, the method further includes establishing a unique biological sample by delivering (i) a unique antigen, such as a unique T-cell epitope, to a biological sample isolated from a subject and containing at least T cells and preferably also MHC and / or (ii) a unique HTO conjugated to a molecularly labeled T cell. In some embodiments, the unique biological sample is primed with the unique antigen for approximately 7-10 days, then simultaneously restimulated with the antigen, and subsequently hashed with the unique HTO. In some embodiments, the unique biological sample is not primed in vitro (e.g., primed in vivo) before simultaneous restimulation with the antigen and hashing with the unique HTO. In some embodiments, the sample is restimulated for at least 6 hours before hashing. In some embodiments, the sample is restimulated for at least 16 hours before hashing. In some embodiments, the sample is restimulated for at least approximately 18-24 hours before hashing. In some embodiments, the sample is restimulated for approximately 48 hours before hashing. In some embodiments, the sample is restimulated for approximately 72 hours before hashing. In some embodiments, the sample is restimulated for no more than 96 hours before being hashed. In some embodiments, the method further includes collecting unique biological samples to create a composition comprising the unique biological samples.

[0109] In some embodiments, sorting one or more activated T cells includes an activation-inducing marker (AIM) assay. In some embodiments, the AIM assay includes fluorescently activated cell sorting of activated T cells that bind to a fluorescently labeled ligand that specifically binds to the activation-inducing marker. Therefore, in some embodiments, the method described herein includes incubating a unique biological sample with a fluorescently labeled ligand that specifically binds to the activation-inducing marker before sorting activated T cells from a composition containing a pool of unique biological samples. The incubation step may be performed concurrently with any hashing step and / or after the pooling of the unique biological sample.

[0110] In some embodiments, the fluorescently labeled ligand is a fluorescently labeled antibody and / or an activation-inducing biomarker selected from the group consisting of: CD137 / 4-1BB, CD107, IFNγ, PD-1, CD40L, OX40, CD25, CD69, CD28, HLA-DR, CX3CR1, TIM3, LAG3, and / or TIGIT and combinations thereof. In some embodiments, the activation-inducing biomarker comprises CD137 / 4-1BB.

[0111] In some embodiments, the method includes further functional and / or phenotypic analysis of activated T cells. In some embodiments, further functional and / or phenotypic analysis includes flow cytometry, CITE-seq, multimer analysis, or combinations thereof. In some embodiments, further functional and / or phenotypic analysis measures the expression levels of one or more of the following proteins: CD3, CD4, CD8, CD25, CD27, CD28, CD45RA, CD62L, HLA-DR, CD137 / 4-1BB, CD69, CD278, CD274, CD279, CD127, CD197, IFNγ, GZMH, GNLY, CD38, CCL3, and LAG3.

[0112] This document also describes bioactive hash samples, such as those in which cells exhibit detectable functions. In some embodiments, the compositions described herein comprise biological samples, said biological samples comprising:

[0113] (a) T cells and surface-bound major histocompatibility complex (MHC), wherein the T cells are capable of recognizing peptides presented in the environment of the surface-bound MHC.

[0114] (b) Antigens, such as T-cell epitopes.

[0115] (c) Hash-tagged oligonucleotides (HTOs), wherein the HTO is conjugated to a molecule labeled with HTO on a T cell, and wherein the HTO contains a nucleotide sequence that specifically identifies (b) an antigen, such as a T cell epitope, and optionally...

[0116] (d) Culture medium that supports T cell activation.

[0117] In some implementations, the molecules used to label T cells with HTO are lipids. In other implementations, the molecules used to label T cells with HTO are antibodies that bind to cell markers.

[0118] This document also describes compositions that can be used in the methods described herein. In some embodiments, the compositions described herein comprise a biological sample, said biological sample comprising:

[0119] (a) T cells and surface-bound major histocompatibility complex (MHC), wherein the T cells are capable of recognizing peptides presented in the environment of the surface-bound MHC.

[0120] (b) Antigen,

[0121] (c) Specific identification of hash-tagged oligonucleotides (HTOs) of the antigen, wherein the HTOs are conjugated to molecules labeled with HTOs on T cells.

[0122] and optional

[0123] (d) Culture medium that supports T cell activation.

[0124] In some embodiments, the composition comprises unique pools of biological samples (e.g., at least two), such that the composition comprises first and second biological samples (and in some embodiments, additional biological samples), wherein each of the first and second biological samples comprises:

[0125] (a) T cells and surface-bound major histocompatibility complex (MHC), wherein the T cells are capable of recognizing peptides presented in the environment of the surface-bound MHC.

[0126] (b) Antigens, such as T-cell epitopes.

[0127] (c) Hash-tagged oligonucleotides (HTOs), wherein the HTOs are conjugated to molecules that label T cells with HTOs, and wherein the HTOs contain a nucleotide sequence that can be used for specific identification, and preferably for specific identification of the antigen of (b), and optionally...

[0128] (d) Culture medium that supports T cell activation.

[0129] In some implementations, the second biological sample contains

[0130] (a) Second T cells and second surface-bound MHC, wherein the second T cells are capable of recognizing peptides presented in the environment of second surface-bound MHC.

[0131] (b) Second antigens, such as second T-cell epitopes.

[0132] (c) A second HTO, wherein the hash-tagged oligonucleotide is conjugated to a second molecule labeled with HTO on T cells, and wherein the second HTO contains a second antigen specifically identifying (b), such as a second sequence of a second T cell epitope, and optionally...

[0133] (d) A secondary culture medium that supports the activation of second T cells.

[0134] Wherein (i) the T cells of the first sample and the second T cells are isolated from the same subject, and the MHC of the first sample and the second MHC bind to the same surface and preferably have the same haplotype (e.g., isolated from the same source); (ii) the antigen of the first sample (e.g., the first T cell epitope) and the second antigen (e.g., the second T cell epitope) are different; (iii) the first molecule and the second molecule are the same, and the first nucleotide sequence of the first HTO and the second nucleotide sequence of the second HTO are different.

[0135] In some embodiments, the composition described herein contains at least two unique biological samples. In some embodiments, the composition described herein contains at least three unique biological samples. In some embodiments, the composition described herein contains at least four unique biological samples. In some embodiments, the composition described herein contains at least five unique biological samples. In some embodiments, the composition described herein contains at least six unique biological samples. In some embodiments, the composition described herein contains at least seven unique biological samples. In some embodiments, the composition described herein contains at least eight unique biological samples. In some embodiments, the composition described herein contains at least nine unique biological samples. In some embodiments, the composition described herein contains at least ten unique biological samples. In some embodiments, the composition described herein contains at least eleven unique biological samples. In some embodiments, the composition described herein contains at least twelve unique biological samples. In some embodiments, the composition described herein contains at least thirteen unique biological samples. In some embodiments, the composition described herein contains at least fourteen unique biological samples. In some embodiments, the composition described herein contains at least fifteen unique biological samples. In some embodiments, the composition described herein contains at least 17 unique biological samples. In some embodiments, the composition described herein contains at least 18 unique biological samples. In some embodiments, the composition described herein contains at least 19 unique biological samples. In some embodiments, the composition described herein contains at least 20 unique biological samples. In some embodiments, the composition described herein contains at least 30 unique biological samples. In some embodiments, the composition described herein contains at least 50 unique biological samples. In some embodiments, the composition described herein contains at least 80 unique biological samples. In some embodiments, the composition described herein contains at least 100 unique biological samples.

[0136] In some of the compositional embodiments described herein, MHC is expressed on the surface of antigen-presenting cells (APCs) such as dendritic cells. In some embodiments, T cells and APCs are autologous homologs, each isolated from a human donor, and / or the APCs are dendritic cells.

[0137] In some of the compositional embodiments described herein, the antigen, such as a T-cell epitope, is selected from the group consisting of: (i) bacterial antigens or portions thereof, (ii) viral antigens or portions thereof, (iii) allergens or portions thereof, (iv) tumor-associated antigens or portions thereof, and (v) combinations thereof. In some of the compositional embodiments described herein, the antigen, such as a T-cell epitope, comprises (i) an amino acid sequence, (ii) a nucleotide sequence, (iii) a cell lysis product, and (iv) a combination thereof.

[0138] In some of the composition embodiments described herein, HTO is conjugated to molecules that are antibodies and / or molecules that bind to cell surface markers selected from the group consisting of β2 microglobulin, CD298, CD2, CD3, CD4 and / or CD8.

[0139] In some embodiments, the culture medium contains cytokines that support the activity of T cells and / or APCs, optionally wherein the cytokines are selected from the group consisting of IL-2, IL-7, IL-15, IL-21, GM-CSF, IL-4, FLT3L, and combinations thereof. In some embodiments, instead of or in addition to the cytokines supporting the activity of T cells and / or APCs, the culture medium contains anti-CD28 and / or anti-CD3 antibodies.

[0140] In some embodiments, the biological sample comprises peripheral blood mononuclear cells (PBMCs) isolated from the subject. In some embodiments, the PBMCs are newly isolated PBMCs. In other embodiments, the PBMCs are freshly thawed PBMCs that have been frozen. In some embodiments, the biological sample comprises dendritic cells and T cells, such as a co-culture of autologous dendritic cells and T cells.

[0141] In some embodiments, the compositions described herein further comprise fluorescently labeled antibodies that specifically bind to T-cell activation markers, optionally wherein the T-cell activation markers are selected from the group consisting of: CD137 / 4-1BB, CD107, IFNγ, PD-1, CD40L, OX40, CD25, CD69, CD28, HLA-DR, CX3CR1, TIM3, LAG3, and / or TIGIT and combinations thereof. In some embodiments, the compositions described herein further comprise additional antibodies that can be used for flow cytometry or CITE-seq analysis and / or MHC multimers (e.g., fluorescently labeled multimers and / or oligonucleotide-labeled multimers).

[0142] Reagent test kit

[0143] The methods and compositions presented in this article can be used for high-throughput assessment of immune responses. Since the methods presented in this article can be used on patient samples regardless of MHC haplotype, off-the-shelf kits for analyzing these T-cell responses are also provided.

[0144] In some embodiments, the kit comprises multiple unique antigens, such as multiple unique T-cell epitopes, and multiple unique HTO-conjugated molecules, each of which comprises a unique HTO containing a unique HTO sequence and the same molecule, and each of the multiple unique HTO sequences is assigned to only one of the multiple unique antigens (e.g., one of the multiple unique T-cell epitopes) such that the unique HTO sequence can identify the unique antigen (e.g., T-cell epitope) assigned to it. In some embodiments, each of the multiple antigens is derived from the same source, for example, the multiple antigens comprise a set of overlapping peptides from a single antigen, such as those that help localize the epitope. In some embodiments, the single antigen may be a pathogenic antigen, such as a bacterial or viral antigen. In non-limiting embodiments, such kits comprise multiple antigens (e.g., T-cell epitopes) derived from pathogenic antigens, which can be used for vaccine development or monitoring of patient immune responses to established vaccines. In some embodiments, the single antigen may be a tumor-associated antigen. In non-limiting embodiments, such kits contain multiple antigens derived from tumor-associated antigens (e.g., T-cell epitopes) that can be used for immunotherapy development, such as for identifying TCR variants (e.g., CDR3) sequences associated with T-cell-mediated cytotoxicity against tumor cells. In some embodiments, the single antigen may be an autoantigen. In non-limiting embodiments, such kits contain multiple antigens derived from autoantigens (e.g., T-cell epitopes) that can be used to monitor a patient's autoimmune response. In some embodiments, the single antigen may be a transplant antigen. In non-limiting embodiments, such kits contain multiple antigens derived from transplant antigens (e.g., T-cell epitopes) that can be used to identify donor organs that are unlikely to be rejected by the subject and / or to establish graft-versus-host disease. Some kit embodiments may also include additional components, such as negative and / or positive control antigens, buffers, vials, instructions for use, multi-well culture plates, etc.

[0145] These kits can be used for high-throughput analysis of T-cell responses, for example, against: (1) potential or ongoing therapies, such as vaccines, immunotherapies, etc.; (2) during autoimmune diseases or transplant rejection; (3) for the development of TCR-based therapies; and / or (4) for determining TCR:epitope binding algorithms. Therefore, this document also provides methods for assessing immune responses and / or identifying TCR sequences (e.g., TCR variable sequences, such as TCRα and / or β variable sequences, such as TCRα and / or βCDR1, CDR2, and / or CDR3 sequences) associated with activated T cells involved in the immune response using the high-throughput screening methods, compositions, and / or kits described herein.

[0146] use

[0147] The methods and compositions provided herein can be used to evaluate immune responses. Therefore, this article also describes methods for studying immune responses in the context of T cell activation, immune tolerance, etc., using high-throughput screening methods, related compositions, and / or related kits.

[0148] From the time of isolation to any pre-stimulated or re-stimulated culture, to the time of cell sorting, the methods described herein appear not to affect the relative fractions of different cell fractions in a sample (e.g., peripheral blood mononuclear cells (PMBC), aspirate), particularly the fractions of antigen-specific T cell populations. Therefore, a method is provided for assessing the relative population size of antigen-specific T cells in a sample using the high-throughput screening methods, compositions, and / or kits described herein.

[0149] Methods for testing candidate vaccines using the high-throughput screening methods, compositions, and / or kits described herein are also provided. In one embodiment, this document provides a method for assessing whether a vaccine will activate an immune response (e.g., T cell proliferation, cytokine release, etc.) in a subject and lead to the generation and / or identification of molecular phenotypes of activated immunological immune responses by effectors and memory T cells (e.g., central and effector memory T cells).

[0150] This invention also provides methods for adoptive T-cell therapy using the high-throughput screening methods, related compositions, and / or kits described herein. Therefore, this invention provides methods for treating or improving a disease or ailment (e.g., cancer) in a subject (e.g., a mammalian subject, such as a human subject). In some embodiments, the disease or ailment is cancer. In other embodiments, the disease or ailment is caused by a virus or bacteria.

[0151] In some embodiments, the adoptive T-cell therapy described herein includes identifying nucleic acid sequences encoding TCRα and / or β variable domains, such as CDR1, CDR2, and / or CDR3 sequences of the TCRα and / or β variable domains of antigen-specific T cells and homologous antigens (or, in other embodiments, nucleic acid sequences encoding TCRδ and / or γ variable domains). In some embodiments, the identified nucleic acid sequences encoding TCRα and / or β variable domains, such as CDR1, CDR2, and / or CDR3 sequences of the TCRα and / or β variable domains (or, in other embodiments, nucleic acid sequences encoding TCRδ and / or γ variable domains), are used to produce human therapeutic agents.

[0152] In one implementation, the human therapeutic agent is a T cell (e.g., a human T cell, such as a T cell derived from a human subject) carrying a nucleic acid sequence of interest (e.g., transfected, transduced, or otherwise introduced with the nucleic acid of interest) so that the T cell expresses a TCR with affinity for the antigen of interest. In one aspect, the subject receiving the therapeutic agent requires a therapy targeting a specific disease or ailment, and the antigen is associated with the disease or ailment. In another aspect, the T cell is a cytotoxic T cell, the antigen is a tumor-associated antigen, and the disease or ailment is cancer. In yet another aspect, the T cell is derived from the subject. Therefore, after identifying the nucleic acid and the homologous antigen, the adoptive T cell therapy described herein may further include cloning a nucleic acid sequence of a T cell receptor identified by the methods described herein, or a portion thereof (e.g., a nucleic acid sequence of the TCR variable domain), into an expression vector (e.g., a retroviral vector), introducing the vector into T cells derived from the subject, causing the T cells to express the antigen-specific T cell receptor, and injecting the T cells into the subject.

[0153] In other embodiments of the adoptive T-cell therapy described herein, nucleic acid sequences encoding the TCRα and / or β variable domains, such as sequences of CDR1, CDR2, and / or CDR3 of the TCRα and / or β variable domains of antigen-specific T cells (or, in other embodiments, nucleic acid sequences encoding the TCRδ and / or γ variable domains), are used to generate human T-cell receptor therapeutics. In one embodiment, the therapeutic receptor is a soluble T-cell receptor. Numerous efforts have been made to generate soluble T-cell receptors, or TCR variable regions, for use in therapeutics. The generation of soluble T-cell receptors depends on obtaining rearranged TCR variable regions. One approach is to engineer single-chain TCRs containing TCRα and TCRβ, and, similar to the scFv immunoglobulin format, fuse them together via a linker (see, for example, International Application No. WO 2011 / 044186). If similar to scFv, the resulting scTv will provide a thermostable and soluble form of the TCRα / β binding protein. Alternative approaches include designing soluble TCRs with a constant TCRβ domain (see, for example, Chung et al., (1994) Functional three-domain single-chain T-cell receptors, Proc. Natl. Acad. Sci. USA. 91:12654-58); and engineering non-natural disulfide bonds into the interface between the constant TCR domains (reviewed in Boulton and Jakobsen (2005) Stable, soluble, high-affinity, engineered T cell receptors: novel antibody-like proteins for specific targeting of peptide antigens, Clinical and Experimental Immunology 142:454-60; see also U.S. Patent No. 7,569,664). Other formats of soluble T-cell receptors have been described. The methods described herein can be used to determine the sequence of a T-cell receptor that binds to an antigen of interest with high affinity, and subsequently to design soluble T-cell receptors based on that sequence.

[0154] Soluble T-cell receptors containing sequences identified according to the high-throughput methods, compositions, and / or kits described herein can be used to block the function of proteins of interest, such as viral, bacterial, or tumor-associated proteins. Alternatively, soluble T-cell receptors can be fused with portions capable of killing infected or cancerous cells, such as cytotoxic molecules (e.g., chemotherapeutic agents), toxins, radionuclides, prodrugs, antibodies, etc. Soluble T-cell receptors can also be fused with immunomodulatory molecules, such as cytokines, chemokines, etc. Soluble T-cell receptors can also be fused with immunosuppressive molecules, such as molecules that inhibit T cells from killing other cells containing antigens recognized by T cells. Such soluble T-cell receptors fused with immunosuppressive molecules can be used, for example, to block autoimmunity. Ravetch and Lanier (2000) Immune Inhibitory Receptors, Science 290:84-89 review various exemplary immunosuppressive molecules that can be fused with soluble T-cell receptors, which are incorporated herein by reference.

[0155] The following provides non-limiting and exemplary implementations.

[0156] Implementation Scheme 1. A method for identifying T cell receptor (TCR) α and / or β chain sequences that identify TCRs of interest epitopes, the method comprising selecting an oligonucleotide-conjugated antibody-tagged T cell population from a T cell pool, wherein the oligonucleotide tag contains a sequence associated with a unique epitope, antigen, or antigen pool.

[0157] Implementation Scheme 2. The method of Implementation Scheme 1, the method comprising the step of determining the sequence of the oligonucleotide tag after sorting, thereby determining the epitope, antigen, or antigen pool that activates the T cells labeled with the antibody conjugated with the oligonucleotide.

[0158] Implementation Scheme 3. The method of Implementation Scheme 1 or Implementation Scheme 2, wherein the method comprises one or more of the following steps prior to the sorting step:

[0159] For example, multiple cultures can be established from peripheral blood mononuclear cell (PBMC) samples in multi-well culture plates, each containing culture medium and cytokines that support the function and growth of antigen-presenting cells (APCs) and T cells.

[0160] To create a unique culture, a unique antigen or antigen pool is delivered to each of the multiple cultures, for example, by adding a single antigen (or antigen pool) of interest to one of the multiple cultures, such as a well in the culture plate, wherein each culture (well) contains a unique antigen or antigen pool.

[0161] Add a unique oligonucleotide tag associated with the unique culture to the unique culture, and

[0162] Optional additions of other surface staining antibodies and polymers may be made, which may also contain oligomer tags, such as CITE-seq and oligonucleotide-dextramer reagents, and

[0163] Collect the cultures.

[0164] Implementation Scheme 4. The method of any one of Implementation Schemes 1-3, wherein the method includes

[0165] For example, multiple cultures can be established from peripheral blood mononuclear cell (PBMC) samples in multi-well culture plates, each containing culture medium and cytokines that support the function and growth of antigen-presenting cells (APCs) and T cells.

[0166] To create a unique culture, a unique antigen or antigen pool is delivered to each of the multiple cultures, for example, by adding a single antigen (or antigen pool) of interest to one of the multiple cultures, such as a well of the culture plate, wherein each culture (well) contains a unique antigen or antigen pool.

[0167] Add an amount sufficient to label all cells present in each well of an antibody binding to a T-cell activation marker and a molecule tagged with a unique oligonucleotide tag associated with the unique culture to the unique culture.

[0168] Optional additions of other surface staining antibodies and polymers may be made, which may also contain oligomer tags, such as CITE-seq and oligonucleotide-dextramer reagents.

[0169] Collect the cultures;

[0170] Those T cells labeled with antibodies that bind to T cell activation markers and tagged with unique oligonucleotides, and

[0171] The nucleic acid sequence, including the unique oligonucleotide tag, is determined from the T cells sorted in step (5).

[0172] Implementation Scheme 5. The method of any one of Implementation Schemes 1-4, wherein the T cell activation marker comprises CD137 / 4-1BB.

[0173] Implementation Scheme 6. A method for identifying an antigen capable of activating T cells, and optionally a T cell receptor (TCR) α chain sequence and / or TCR β chain sequence of a TCR that specifically binds to said antigen, said method comprising:

[0174] (I) Sorting activated T cells from a composition containing a unique biological sample based on the expression of an activation-inducing marker (AIM), said unique biological sample comprising:

[0175] (a) T cells and surface-bound major histocompatibility complex (MHC), wherein the T cells are capable of recognizing peptides presented in the environment of the surface-bound MHC.

[0176] (b) Unique antigens,

[0177] (c) Unique hash-tagged oligonucleotides (HTOs) that can be used and / or used for the specific identification of the unique antigen, such as unique HTOs that specifically identify the unique antigen, wherein the unique HTO is conjugated to a molecularly labeled T cell with the unique HTO, and optionally,

[0178] (d) Culture medium supporting the activation of the T cells

[0179] (II) Single-cell sequencing analysis of the activated T cells sorted in (I) to identify the unique HTO that is molecularly conjugated to the activated T cells labeled with the unique HTO, wherein identifying the unique HTO identifies the antigen capable of activating the activated T cells, and optionally wherein the single-cell sequencing analysis also identifies one or more of the following:

[0180] (i) one or more genes expressed by the activated T cells, and / or

[0181] (ii) The TCRα and / or β chain sequence of the TCR expressed by the activated T cells.

[0182] Implementation Scheme 7. The method of Implementation Scheme 6, wherein the method includes performing one or both of the following steps prior to sorting:

[0183] Multiple biosamples are constructed by evenly distributing a cell collection comprising T cells and antigen-presenting cells (APCs) isolated from the subject into individual samples, wherein each biosample optionally contains culture media and cytokines supporting T cell and / or APC viability, activation, and / or activity, as well as

[0184] A plurality of unique biological samples are constructed by delivering a unique antigen and / or a unique HTO that can be used and / or used for the specific identification of the unique antigen, such as a unique HTO that specifically identifies the unique antigen, to each of a plurality of biological samples, wherein the unique HTO is conjugated to a molecularly labeled T cell with the unique HTO, and optionally the plurality of unique biological samples are combined such that the composition sorted in (I) comprises a plurality of unique biological samples.

[0185] Each of the plurality of biological samples comprises a cell collection containing T cells and APCs isolated from the subject and optionally a culture medium supporting the viability, activity, and / or activation of the T cells and APCs.

[0186] Each of the plurality of biological samples becomes a unique biological sample after delivery of the unique antigen and / or the unique HTO conjugated to a molecule labeled with the unique HTO on T cells, the unique biological sample comprising

[0187] (a) A cell collection containing T cells and APCs isolated from the subject.

[0188] (b) Unique antigens,

[0189] (c) Specific identification of the unique antigen and a unique HTO conjugated to the T cell labeled with the HTO, and optionally

[0190] (d) A culture medium that supports the viability, activity, and / or activation of the T cells and APCs.

[0191] Implementation Scheme 8. The method of Implementation Scheme 7, wherein the APC comprises dendritic cells, monocytes, macrophages, B cells, or combinations thereof derived from monocytes.

[0192] Implementation Scheme 9. The method of any one of Implementation Schemes 6-8, wherein the sorting includes fluorescently activated cell sorting of activated T cells based on the expression of activation-inducing marker (AIM).

[0193] Implementation Scheme 10. The method of Implementation Scheme 9, wherein the AIM is selected from the group consisting of: CD137 / 4-1BB, CD107, IFNγ, PD-1, CD40L, OX40, CD25, CD69, CD28, HLA-DR, CX3CR1, TIM3, LAG3, TIGIT and any combination thereof.

[0194] Implementation Scheme 11. The method of Implementation Scheme 9 or Implementation Scheme 10, wherein fluorescence-activated cell sorting is based on detection with a fluorescently labeled antibody against the AIM.

[0195] Implementation Scheme 12. The method of any one of Implementation Schemes 6-11, the method comprising further functional and / or phenotypic analysis of the activated T cells analyzed in II, wherein optionally the further functional and / or phenotypic analysis is selected from the group consisting of: flow cytometry analysis, CITE-seq analysis, multimer analysis and combinations thereof.

[0196] Implementation Scheme 13. The method of Implementation Scheme 12, wherein the further functional and / or phenotypic analysis measures the expression levels of one or more of the following proteins and / or RNAs: CD3, CD4, CD8, CD25, CD27, CD28, CD45RA, CD62L, HLA-DR, CD137 / 4-1BB, CD69, CD278, CD274, CD279, CD127, CD197, IFNγ, GZMH, GNLY, CD38, CCL3, and LAG3.

[0197] Implementation Scheme 14. The method of any one of Implementation Schemes 6-13, wherein peripheral blood mononuclear cells provide the T cells and surface-bound MHC.

[0198] Implementation Scheme 15. The method of any one of Implementation Schemes 6-14, wherein the molecule of the T cell labeled with the unique HTO contains an antibody that binds to cell surface molecules.

[0199] Implementation Scheme 16. The method of any one of Implementation Schemes 6-15, wherein the AIM is or comprises CD137 / 4-1BB.

[0200] Implementation Scheme 17. The method of any one of Implementation Schemes 6-16, wherein the method includes identifying a TCRα chain sequence and / or a TCRβ chain sequence of a TCR that specifically binds to the antigen, and wherein the TCRα chain sequence and / or the TCRβ chain sequence are respectively a variable region sequence of the TCRα chain and / or a variable region sequence of the TCRβ chain.

[0201] Implementation Scheme 18. The method of any one of Implementation Schemes 6-17, wherein the method includes identifying a TCRα chain sequence and / or a TCRβ chain sequence of a TCR that specifically binds to the antigen, and the method further includes manufacturing a therapeutic agent using the TCRα chain sequence and / or the TCRβ chain sequence.

[0202] Implementation Scheme 19. A composition comprising a biological sample, the biological sample comprising:

[0203] (a) T cells and surface-bound major histocompatibility complex (MHC), wherein the T cells are capable of recognizing peptides presented in the environment of the surface-bound MHC.

[0204] (b) Antigen,

[0205] (c) Hash-tagged oligonucleotides (HTOs) that specifically identify the antigen, wherein the HTOs are conjugated to molecules labeled with the HTOs on the T cells.

[0206] and optional

[0207] (d) Culture medium supporting the activation of the T cells.

[0208] Implementation Scheme 20. The composition of Implementation Scheme 19, wherein

[0209] (a) The MHC is expressed on the surface of antigen-presenting cells (APCs), optionally wherein:

[0210] The T cells and APCs mentioned are autologous.

[0211] The T cells and APCs were each isolated from human donors, and / or

[0212] The APCs are selected from the group consisting of: dendritic cells derived from monocytes, dendritic cells, monocytes, macrophages, B cells, and combinations thereof.

[0213] (b) the antigen

[0214] (I) Choose from the following groups:

[0215] (i) bacterial antigens or parts thereof.

[0216] (ii) Viral antigens or parts thereof.

[0217] (iii) Allergens or parts thereof

[0218] (iv) Tumor-associated antigens or portions thereof, and

[0219] (v) their combination, and / or

[0220] (II) Includes

[0221] (i) Amino acid sequence.

[0222] (ii) Nucleotide sequence,

[0223] (iii) Dissolution products, and

[0224] (iv) Their combinations,

[0225] (c) The HTO-conjugated molecule contains

[0226] (I) Antibodies that bind to cell surface molecules, or

[0227] (II) Lipids, and / or

[0228] (d) The culture medium contains cytokines that support the activity of the T cells and / or APCs.

[0229] Implementation Scheme 21. The composition of Implementation Scheme 20, wherein

[0230] The antibody binds to cell surface markers selected from the group consisting of: β2-microglobulin, CD298, CD2, CD3, CD4, CD8, and any combination thereof, or

[0231] The lipids are incorporated into the cell membrane.

[0232] Implementation Scheme 22. The composition of Implementation Scheme 20 or Implementation Scheme 21, wherein the cytokines supporting the activity of the T cells and / or the APCs are selected from the group consisting of: IL-2, IL-7, IL-15, GM-CSF, IL-4 and any combination thereof.

[0233] Implementation Scheme 23. The composition of any one of Implementation Schemes 20-22, wherein the composition further comprises a second biological sample, wherein the second biological sample comprises:

[0234] (a) MHC bound to a second T cell and a second surface, wherein the second T cell is capable of recognizing peptides presented in the environment of MHC bound to the second surface.

[0235] (b) Second antigen,

[0236] (c) Specific identification of a second HTO of the second antigen, wherein the HTO is conjugated to a second molecule of the second T cell labeled with the second HTO.

[0237] and optional

[0238] (d) Culture medium supporting the activation of the second T cells

[0239] in

[0240] (i) The T cells and the second T cells were isolated from the same subject.

[0241] (ii) The antigen is different from the second antigen.

[0242] (iii) The molecule of the T cell labeled with the HTO is the same as the second molecule of the second T cell labeled with the second HTO, and the HTO and the second HTO are not the same.

[0243] Implementation Scheme 24. A composition of any one of Implementation Schemes 19-23, wherein the composition further comprises an agent that allows T cells to be activated based on the expression of an activation-inducing marker (AIM).

[0244] Implementation Scheme 25. The composition of Implementation Scheme 24, wherein the agent that allows AIM-based expression sorting to activate T cells is a fluorescently labeled antibody that specifically binds to said AIM.

[0245] Implementation Scheme 26. The composition of Implementation Scheme 24 or Implementation Scheme 25, wherein the AIM is selected from the group consisting of: CD137 / 4-1BB, CD107, IFNγ, PD-1, CD40L, OX40, CD25, CD69, CD28, HLA-DR, CX3CR1, TIM3, LAG3 and / or TIGIT.

[0246] Implementation Scheme 27. A composition of any one of Implementation Schemes 19-26, wherein the composition comprises an antibody and / or MHC multimer that can be used for flow cytometry analysis or CITE-seq analysis of the composition.

[0247] Implementation Scheme 28. A reagent kit, the reagent kit comprising

[0248] Multiple unique antigens, and

[0249] Multiple unique hash-tagged oligonucleotides (HTOs), each of which specifically identifies only one of the multiple unique antigens.

[0250] Implementation Scheme 29. The kit of Implementation Scheme 28, wherein the kit further comprises an agent that allows T cell activation based on the expression of an activation-inducing marker (AIM), optionally wherein the agent that allows T cell activation based on the expression of an AIM is a fluorescently labeled antibody that specifically binds to the AIM.

[0251] Implementation scheme 30. The kit of implementation scheme 28 or 29, wherein each of the plurality of unique HTOs is conjugated with the same molecule, such that the kit contains molecules conjugated with a plurality of unique HTOs.

[0252] Implementation scheme 31. A kit according to any one of implementation schemes 28-30, wherein each of the multiple unique antigens comprises a unique and overlapping peptide sequence from a single protein.

[0253] Implementation Scheme 32. The kit of Implementation Scheme 31, wherein the single protein is selected from the group consisting of: pathogenic antigen, tumor-associated antigen, or transplantation antigen.

[0254] Implementation Scheme 33. The use of the method of any one of Implementation Schemes 1-18, the composition of any one of Implementation Schemes 19-27, or the kit of any one of Implementation Schemes 28-32 for analyzing T-cell-mediated patient immune responses to a vaccine.

[0255] Implementation Scheme 34. The use of the method of any one of Implementation Schemes 1-18, the composition of any one of Implementation Schemes 19-27, or the kit of any one of Implementation Schemes 28-32 for analyzing T-cell-mediated immune responses in patients to immunotherapy.

[0256] Implementation Scheme 35. The use of the method of any one of Implementation Schemes 1-18, the composition of any one of Implementation Schemes 19-27, or the kit of any one of Implementation Schemes 28-32 for analyzing a patient’s T-cell-mediated immune response during the patient’s immunotherapy.

[0257] Implementation Scheme 36. The use of the method of any one of Implementation Schemes 1-18, the composition of any one of Implementation Schemes 19-27, or the kit of any one of Implementation Schemes 28-32 for analyzing a patient’s T-cell response to an autoantigen.

[0258] Implementation Scheme 37. The use of the method of any one of Implementation Schemes 1-18, the composition of any one of Implementation Schemes 19-27, or the kit of any one of Implementation Schemes 28-32 for analyzing a patient’s T-cell response to a transplanted antigen.

[0259] Implementation Scheme 38. The use of the method of any one of Implementation Schemes 1-18, the composition of any one of Implementation Schemes 19-27, or the kit of any one of Implementation Schemes 28-32 for identifying one or more TCR variable region sequences that activate T cells.

[0260] Implementation Scheme 39. Use of Implementation Scheme 38, wherein the one or more TCR variable region sequences comprise a CDR3 sequence of the TCRα chain and / or a CDR3 sequence of the TCRβ chain.

[0261] Implementation Scheme 40. Use of one or more TCR variable region sequences identified in Implementation Scheme 38 or 39 for the manufacture of human therapeutic agents.

[0262] Implementation Scheme 41. Use of Implementation Scheme 40, wherein the human therapeutic agent comprises T cells containing one or more TCR variable region sequences identified using the method of any one of Implementation Schemes 1-18, the composition of any one of Implementation Schemes 19-27, or the kit of any one of Implementation Schemes 28-32.

[0263] While the invention has been specifically shown and described with reference to many embodiments, those skilled in the art will understand that changes in form and detail may be made to the various embodiments disclosed herein without departing from the spirit and scope of the invention, and that the various embodiments disclosed herein are not intended to serve as a limitation on the scope of the claims.

[0264] Example

[0265] Figure 1The present invention illustrates non-limiting embodiments of the methods described herein. The data provided by the embodiments herein illustrate that hashing methods can be combined with functional assays, such as activation-inducing marker (AIM) cell enrichment and single-cell transcriptome sequencing, to screen for homologous T cells and antigen reactivity, such as T cell epitope reactivity, and that such methods are particularly useful in primary human cells.

[0266] Before describing more specific and exemplary applications of these methods, a general approach is provided here.

[0267] General Materials and Methods

[0268] Human peripheral blood mononuclear cells (PBMCs): Purchase cryopreserved PBMCs (Precision for Medicine, Frederick, Maryland) or isolate them from fresh blood of human subjects. Separate them by density gradient centrifugation using Ficoll-Paque Plus reagent (GE Healthcare Life Sciences, 45-001, 749) according to the manufacturer's instructions and freeze them in freezing medium (90% human serum (Millipore Sigma), 10% tissue culture grade DMSO (Millipore Sigma, 2438)) for later analysis.

[0269] Peptides: The peptides were custom-synthesized in Genscript (Piscataway, NJ). Lyophilized peptides were reconstituted in DMSO at 10–50 mg / mL as a stock solution, and then further diluted to 10 μg / mL in appropriate assay media for use. The CEF control peptide pool (Anaspec, AS-61036-003) was used at 10 μg / mL according to the manufacturer's instructions, along with a cell stimulation mixture (ThermoFisher, 00-4970-93).

[0270] Primary cell cultures: Frozen PBMCs were thawed and incubated in CellGenix GMP DC serum-free medium (CellGenix, 20801-0500) containing 5% human serum AB (MilliporeSigma, H3667) and 1% penicillin-streptomycin (ThermoFisher Scientific, 15140163). The culture was supplemented with dendritic cell and T cell supportive cytokines: T cell culture medium (CellGenix dendritic cell culture medium, catalog number 20801-0500 + 5% human serum AB (Sigma, catalog number H3667)) + 1% penicillin / streptomycin / L-glutamine (ThermoFisher, catalog number 10378-016), 5 ng / ml T cell supportive cytokines IL-7 and IL-15 (CellGenix, catalog numbers 1410-050 and 1413-050 respectively), and 10 U / ml IL-2 (Peprotech, catalog number 200-0).

[0271] Generation of oligonucleotide-tagged hash antibodies: Monoclonal antibodies (CD2, RPA-2.10; Biolegend catalog number 300202) with high specificity for cell surface targets on all human T cells were custom conjugated to various unique 15-base oligonucleotide sequences with poly-A tails using published methods. See, for example, Stoeckius 2017, bioRxiv, ibid.

[0272] Direct in vitro IFNγ / granzyme B ELISPOT: The Dual Human IFNγ / granzyme B FluoroSpot Assay Kit was purchased from ImmunoSpot (Cleveland, OH) and used according to the manufacturer's protocol. Simply put, PBMCs were thawed and incubated in 200 μL in FluoroSpot plates at 200,000 cells / well for 48 hours with peptide stimulation. ELISPOT reactivity was read out on an ImmunoSpot analyzer using the manufacturer's automated software.

[0273] Antibodies and T cell phenotypic characterization by flow cytometry: Fluorescently labeled antibodies were purchased from commercial suppliers. For flow cytometry characterization of surface proteins, cells were harvested, washed, and resuspended in BD BSA staining buffer (BD Biosciences, #554657) containing the antibody of interest. Cells were incubated at 4°C for 30 min, washed twice, and then collected by flow cytometry on an A3 Symphony cytometer (BD Biosciences). Flow cytometry data were analyzed using FlowJo analysis software (FlowJo, Ashland, OR). Gating was based on a fluorescence minus one (FMO) control setting.

[0274] Antigen-specific T-cell reactivity assay: Peripheral blood mononuclear cells (PBMCs) were isolated using the Ficoll-Paque Plus gradient separation method. PBMCs were seeded into culture plates in T cell culture medium (CellGenix GMP DC medium, catalog number 20801-0500 + 5% human serum AB (Sigma, catalog number H3667)) + 1% penicillin / streptomycin / L-glutamine (ThermoFisher, catalog number 10378-016), 1000 U / mL dendritic cell support factor GM-CSF, and 500 U / mL IL-4 (CellGenix, #1412-050 and CellGenix, #1403-050, respectively), 5 ng / mL T cell support cytokines IL-7 and IL-15 (CellGenix, #1410-050 and 1413-050, respectively), and 10 U / mL IL-2 (Peprotech, catalog number 200-0), for example, in equal portions. Individual antigens, such as peptides of interest, are added to the analytical wells at 10 ug / ml (Genscript) to form unique biological samples.

[0275] Overnight cultures were harvested 24 hours after peptide stimulation and prepared for sorting and single-cell sequencing. For 10-day pre-expansion cultures, fresh culture medium and cytokines were fed to cells every two days for one week after the initial peptide addition. Individual peptides of interest were then added to T-cell expansion cultures for overnight restimulation to upregulate the expression of activation-inducing markers (e.g., CD137 / 4-1BB) and enable functional T-cell sorting based on antigen-specific AIMs. Following peptide restimulation, cells were prepared for flow cytometry characterization or further processed to enable hashing, pooling, and single-cell sequencing.

[0276] Cell scattering after functional T cell assay: Following functional stimulation, cells from individual assay wells were collected into 96-well assay blocks, washed, and resuspended in flow cytometry BD BSA staining buffer (BD Biosciences, #554657) containing scattering reagents of interest. Cells were stained with one or two scatter-tagged oligonucleotide (HTO) antibodies at 1 μg / 10- each. 6 Cells. Incubate cells at 4°C for 30 minutes, wash twice, and then pool. If the analysis includes oligonucleotide-labeled dextramer, stain the samples with dextramer before CITE-seq and flow cytometry antibody staining, following the oligonucleotide-labeled dextramer staining protocol below.

[0277] CITE-seq antibody staining and fluorescent antibody staining: After the hash staining procedure, the pooled and hashed samples were resuspended in BDBSA staining buffer containing CITE-seq antibodies at their optimal concentrations and fluorescently labeled flow cytometry antibodies. Cells were incubated at 4°C for 30 minutes, washed twice, and then sorted for single-cell sequencing.

[0278] Oligonucleotide-labeled dextramer staining and FACS sorting: Frozen healthy donor PBMCs were briefly thawed in a 37°C water bath. CD8+ T cells were enriched using magnetic beads (Miltenyi Biotec). Cells were washed by centrifugation and then treated with PBS (Gibco, 14190-250) containing benzonase (Millipore, 70664) and 50 nM dasatinib (Axon Medchem, 1392) at 37°C for 45 min. Cells were transferred to 96-well assay blocks (Corning, 3960), centrifuged, and the supernatant was aspirated. A suitable custom-made Immudex dCODE-PE dextramer pool (Copenhagen, Denmark) was added at 1 μL / 100 μL in the dark for 30 min at room temperature. Next, a fluorescently labeled surface marker was added, and cells were incubated at 4°C for another 30 min. Cells were sorted immediately after washing. Flow cytometry antibody staining and washing were performed in staining buffer (BD, 554657). Surface markers for FACS included the following markers and fluorescent substances: live / dead DAPI added in situ on the sorter (Sigma, 10236276001), CD3 BUV737 (BD Biosciences, 612750), CD4 BV510 (BD Biosciences, 563919), CD8 BUV805 (BD Biosciences, 612889), CCR7 AF647 (BioLegend 353218), and CD45RO BV605 (BioLegend 304238).

[0279] FACS sorting of CD137 / 4-1BB+ T cells: Twenty-four hours after restimulation, cells were collected and stained with FACS fluorescently labeled antibodies using an Astrios cell sorter (Beckman Coulter) for the following surface antibodies: CD3 (BDBiosciences, catalog number 612750) and CD137 / 4-1BB (Biolegend, catalog number 309828). Forward scatter plots, lateral scatter plots, and fluorescence channel gating were set to select live cells while excluding debris and bimodal cells. Individual CD3+CD137 / 4-1BB+ cells were sorted using a 100 μm nozzle for further processing.

[0280] Chromium Single-Cell Partitioning and Library Preparation: The sorted cells were then loaded onto a Chromium single-cell 5' microarray (10x Genomics, 1000287) and processed using a Chromium controller to produce a GEM (gel bead emulsion). RNA-Seq libraries were prepared using the Chromium single-cell 5' library and gel bead kit (10x Genomics, 1000265) according to the manufacturer's protocol.

[0281] Bioinformatics methods

[0282] Transcriptome, TCR (VDJ), hash, CITE-seq, and dextramer libraries were sequenced, and raw sequencing data were processed using the 10X CellRanger analysis pipeline. CellRanger analysis generated a feature barcode UMI count matrix and TCR (VDJ) amino acid sequences. These functions included gene expression, hash antibody, CITE-seq antibody, and dextramer capture. Using the feature barcode matrix as input, the R package Seurat v3.1.4 (Butler et al. 2018) was used for downstream analysis. Gene UMI counts were normalized to standard logarithm, and then the 1000 most variable genes were identified, and the data were scaled and centered. Principal Component Analysis (PCA) was then performed, and 50 PCs were computed and stored. Clustering was then performed using Seurat's graph-based clustering method. k-nearest neighbor (KNN) graphs were computed based on Euclidean distance in the 20-dimensional PCA space, and clustering was performed at various resolutions. At each resolution, top marker genes were identified and used to construct gene expression heatmaps across different clusters. The optimal clustering resolution was determined through visual inspection. Using mitochondrial genes as the top gene marker, all cells belonging to the dead cell cluster were removed from downstream analyses. Cells with fewer than or equal to 500 detected genes and a mitochondrial gene expression fraction greater than or equal to 0.25 were removed. Since one of the primary goals of this assay is to identify T cell responsiveness to various antigens driven by TCR-antigen interactions, any cells with a single TCR chain or non-productive chain, or more than one α or β chain, were also removed. Any anomalous cells with a large number of detected genes and / or a large number of detected UMIs were also removed. For the remaining cells, data from other features (CITE-seq, hash, dextramer) were then processed. The count matrix data corresponding to those features were normalized using a central logarithmic ratio transformation and then scaled. Cells were multiplexed using the MultiSeqDemux algorithm (McGinnis et al. (2019) Nature Methods 16:619-26; default parameters) with hash data. Any cells not assigned a hash tag according to the hashing scheme were removed after multiplexing. For each cell, a paired TCR amino acid sequence defining the cell's unique functional clonal type was obtained. After multiplexing, the clonal type size of each T cell clone in all cells associated with the hash-labeled well was calculated. Any clonal type >20 was considered potentially reactive to the specific antigen in the hash-labeled well.

[0283] Example 1: CD137 / 4-1BB was identified as an activation-inducing marker (AIM) that is functionally equivalent to multimer staining in identifying antigen-specific T cell populations.

[0284] Materials and methods

[0285] Typically, in the method described in this embodiment, T cells from healthy HLA-A*0201+ human donors are pre-amplified in the presence of homologous synthetic peptides according to the method described herein, and then stained with fluorescently labeled antibodies and dextramer multimers for flow cytometry analysis to identify antigen-specific T cell populations.

[0286] result

[0287] exist Figure 2A In this study, dendritic cells (DCs) were derived from whole peripheral blood mononuclear cells (PBMCs) from healthy human donors. Simply put, CD14+ monocytes were isolated from PBMCs via magnetic separation using anti-CD14 magnetic beads (Miltenyi). CD14+ cells were cultured for 5 days in CellGenix CellGro DC medium supplemented with IL-4 and GM-CSF. On day 5, DCs were pulsed for 2 hours with a synthetic short peptide of CMV pp65 (NLVPMVATV; SEQ ID NO:16) or MART1 (ELAGIGILTV; SEQ ID NO:15), which are specific for HLA-A*0201. Then, IFNα was added to the cells to activate them. On day 7, autologous T cells were added to the culture, and the medium was replaced with CellGenix CellGro medium supplemented with 5% human serum and supporting cytokines (IL7, IL-15, IL-2). These autologous DCs and T cells were cultured for 10 days to expand the associated pre-existing antigen-specific T cell population. After 10 days of pre-expansion in culture, the T cells were restimulated for 24 hours with a relevant peptide or DMSO negative control. Cell surface targets of interest were assessed by flow cytometry using fluorescently labeled monoclonal antibodies and dextramer multimers (A3 Symphony analyzer, BD).

[0288] Figure 2AFlow cytometry plots demonstrated that prior to stimulation, the fraction of CD137 / 4-1BB+CD8+ T cells in the culture was low (x-axis, left panel), but the multimer population strongly stained the CD8+ T cell population of interest: 25.5% CMV pp65 CD8+ T cells and 7.79% MART1+ T cells (x-axis, middle panel). In other words, the cell culture conditions used in this particular embodiment expanded pre-existing memory T cells but did not induce de novo T cell expansion. However, after restimulation with homologous peptides for 24 hours, CD137 / 4-1BB expression on CD8+ T cells was upregulated, and the total size of the CD137 / 4-1BB+ population (x-axis) was similar to that of the multimer+ population (right panel).

[0289] exist Figure 2B In this study, using the same cell culture and staining methods as described in this embodiment, cells isolated from four HLA-A*0201+ healthy donors (HD1, HD2, HD3, and HD27) were cultured for 10 days in the presence of DMSO or CMV pp65 synthetic peptide. The fraction of CMVpp65 multimers + CD8+ T cells relative to negative control multimers after 10 days of expansion was assessed by flow cytometry. Figure 2B (See the image above). The expression of CD137 / 4-1BB on CD8+ T cells was also assessed by flow cytometry relative to the DMSO control after 24 hours of restimulation with CMV pp65 synthetic peptides. Figure 2B (See figure below). Three of the four healthy CMV seropositive donors had measurable CMV pp65+CD8+ T cells (HD1, HD2, HD27), while the CMV seronegative donor (HD3) had no detectable CMV pp65+ T cells. Figure 2B Generally, the population size of multimeric +CD8+ and CD137 / 4-1BB+CD8+ T cells is consistent. Figure 2B ).

[0290] exist Figures 3A-3BIn this study, whole peripheral blood mononuclear cells (PBMCs) from healthy HLA-A*0201+ human donors (HD3 and HD27) were cultured for 10 days in a medium containing supporting cytokines (GM-CSF, IL-4, IL-7, IL-15, IL-2) and either DMSO or a synthetic short peptide of MART1 (ELAGIGILTV; SEQ ID NO: 15) to provide a baseline population (DMSO) or to expand pre-existing MART1-specific T cells. After 10 days of pre-expansion in culture, T cells were restimulated for 24 hours with a DMSO negative control or a MART1 peptide. MART1 multimer+CD8+ T cells and CD137 / 4-1BB CD8+ T cells from healthy donor 27 (HD27) were sorted by fluorescence activated cell sorting (FACS) and encapsulated in a 10X Genomics single-cell partitioner for 5' RNA and TCR single-cell sequencing library preparation, followed by high-throughput next-generation sequencing. Only cells that produce complete paired α and β TCR information are evaluated. Overlap in multimer+ and CD137 / 4-1BB+ samples is assessed.

[0291] Prior to restimulation, both donors had detectable MART1+CD8+ T cells ( Figure 3A (See above image). After 24 hours of restimulation with homologous peptides, the two donors (HD3 and HD27) regulated CD137 / 4-1BB on their cell surface. Figure 3A (See figure below). However, the number of CD137 / 4-1BB+ T cells from one donor (HD27) was significantly higher than that of multimer+CD8+ T cells (see figure below). Figure 3A To test this difference, functional T cell clones identified by multimer and CD137 / 4-1BB staining were further evaluated by assessing overlap in multimer+ and CD137 / 4-1BB+ samples. Significant overlap was found in the shared TCR sequences between the multimer+ and CD137 / 4-1BB+CD8+ T cell populations. Figure 3B Overall, the CD137 / 4-1BB+ subset contained a larger clonal population than the MART1 multimer+ population. Most clonal expansions of MART1 multimer+ TCRs were detected in the CD137 / 4-1BB+CD8+ T cell population, and many lower abundance TCRs were also detected in both rich subsets. However, the CD137 / 4-1BB+ population captured TCRs not detected in the multimer+ population. Furthermore, many low-abundance TCR sequences from the MART1 multimer+ population were present with larger clonal sizes in the CD137 / 4-1BB+ population.

[0292] Figure 2AData shown in -B and 3A-B demonstrate that the activation-inducing marker CD137 / 4-1BB is upregulated on human T cells following antigen-specific activation, and there is significant overlap in the single-cell paired α / β chain T cell receptor (TCR) sequences between multimer+ and CD137 / 4-1BB+CD8+ T cells cultured according to the methods described herein. Therefore, CD137 / 4-1BB can be used in functional assays, for example, as a functionally enriched activation-inducing marker (AIM) for antigen-specific T cells. Furthermore, using CD137 / 4-1BB as a functional marker is as effective as conventional multimer staining and provides similar functional assay results.

[0293] Example 2: Characterization of homologous T cells and epitope responsiveness in primary human cells using hash-tagged oligonucleotides and CD137 / 4-1BB enrichment of activated T cells.

[0294] To further validate hashing, AIM sorting, and / or single-cell sequencing as feasible methods for assessing and characterizing homologous antigens and TCR reactivity, unique biological samples containing PBMCs and unique viral peptides were hashed and pooled using hash-tagged oligonucleotides conjugated with anti-CD2 antibodies. Functional activation was identified by CD137 / 4-1BB staining, and the use of CD137 / 4-1BB in functional assays was compared with routine functional assays using ELISPOT and dextramer staining.

[0295] Materials and methods

[0296] ELISPOT: PBMCs from healthy HLA-A*0201+ human donors known to be seropositive for CMV, EBV, and influenza were stimulated with DMSO or individual HLA-A*0201+ restricted viral peptides (EBV YVL-9, CMV pp65, EBV LMP2A, EBV BMLF1, and influenza A) at 2 × 10⁻⁶ ppm. 5 Cells / well concentrations were plated in a dual IFNγ / granzyme B FluoroSpot assay plate (ImmunoSpot, Cleveland, OH) and incubated for 48 hours. Following incubation, ELISPOT reactivity was developed and read on an ImmunoSpot analyzer using the manufacturer's instructions and automated software.

[0297] PBMC culture for hashing and AIM enrichment: Whole peripheral blood mononuclear cells (PBMCs) from healthy HLA-A*0201+ human donors were cultured for 10 days in medium, supporting cytokines (GM-CSF, IL-4, IL-7, IL-15, IL-2), and individual HLA-A*0201+ restricted viral peptides (EBV YVL-9, CMV pp65, EBV LMP2A, EBV BMLF1, and influenza A) to expand the relevant pre-existing antigen-specific T cell population. After 10 days of pre-expansion in culture, T cells were restimulated for 24 hours with the relevant peptide or DMSO negative control. Cell surface targets of interest were assessed by flow cytometry characterization (A3 Symphony Analyzer, BD) using fluorescently labeled monoclonal antibodies. The relative fraction of CD137 / 4-1BB+CD8+ T cells under viral peptide stimulation was assessed by flow cytometry (CD8+CD137 / 4-1BB+ T cell fraction is provided as the percentage of total CD8+ T cells exceeding the threshold).

[0298] Hash, AIM enrichment, and single-cell sequencing: Monoclonal human anti-CD2 antibodies labeled with uniquely hashed oligonucleotides were added to each well of the PBMC biological samples described in this experiment to uniquely barcode T cells from a given well with the stimulation received in the same well. All well samples were then pooled and stained with fluorescently labeled surface antibodies for FACS sorting and stained with CITE-seq antibodies for scSEQ phenotypic analysis. The CD137 / 4-1BB+CD8+ T cell population was sorted and multiplexed, analyzed, for example, by single-cell sequencing (10X Genomics 5' RNA and TCR). Expression was normalized using the LogNormalize method, which normalizes gene expression per cell by total expression. Mathematically, the normalization expression is equal to log1p(UMI count * conversion factor / (total UMI count)), where the conversion factor = 10,000, and log1p is log

[0299] Oligonucleotide-labeled dextramer activation and staining: CD8+ T cells were enriched using Miltenyi CD8+ T cell negative enrichment (Miltenyi). Cells were then incubated with totipotent nuclease (Millipore) and dasatinib (Axon) for 45 minutes, followed by staining with oligonucleotide-labeled dextramer pooling at room temperature for 30 minutes. Cells were then stained on ice for 30 minutes with fluorescently labeled CD3 (BD ​​Biosciences, catalog number 612750), CD4 (BD Biosciences, catalog number 563919), CD8 (BD Biosciences, catalog number 612889), CCR7 (Biolegend, catalog number 353218), and CD45RO (Biolegend, catalog number 304238) and CITE-seq antibody. Using an Astrios cell sorter (Beckman Coulter), fluorescence-activated cell sorting (FACS) gating was applied to the forward scatter plot, lateral scatter plot, and fluorescence channel to select live cells while excluding debris and bimodal cells. Individual CD3+CD8+dextramer+ cells were sorted using a 100 μm nozzle for further processing.

[0300] RNA sequencing clustering was used to assess RNA transcript expression in CD137 / 4-1BB+ T cells sorted from AIM enrichment. Clustering was performed using Seurat's graph-based clustering method with a k-nearest neighbor (KNN) graph, calculated based on Euclidean distance in a 20-dimensional PCA space, and then clustered at various resolutions.

[0301] result

[0302] like Figure 4A and 4B As shown, the percentage of antigen-specific cells in biological samples was determined by hashing and AIM enrichment. Figure 4B ), and it is related to the percentage determined using the standard ELISPOT function assay. Figure 4A Therefore, it appears that the pre-amplification and restimulation protocol described in this paper maintains the relative fraction of the antigen-specific T cell population.

[0303] Figure 6 shows the validation of the method provided herein. Further validation is provided by single-cell sequence analysis of antigen-specific cells enriched and analyzed using the method disclosed herein, with non-limiting embodiments described below. Figure 5 As shown in the image. Figure 6AAs shown in -C, single-cell sequence analysis assigned the majority of cells to individual HTOs (80%), while approximately 8% of cells were classified as "dual" and approximately 12% of cells were identified as "HTO-free". The relative number of cells corresponding to each HTO, therefore each reactivity (EBV YVL-9, CMV pp65, EBV LMP2A, EBV BMLF1, M-type influenza) reflects the relative number of cells determined in orthogonal functional assays, which include... Figure 4A The ELISPOT assay shown and Figure 4B The flow cytometry analysis method shown. Figure 6B The figure shows the relative number of cells identified by each hash tag under unrealistically equivalent amplification for each stimulus.

[0304] Parallel experiments using dextramer, based on oligonucleotide marker-based aggregation, confirmed the hashing of CD137 / 4-1BB. + T cell responsiveness to CMV pp65, EBV BMLF1, or M-type influenza clones. Figure 6D TCRs of CD137 / 41BB expanded with HTO-40, HTO-47, and HTO-48 hashes showed reactivity to antigens identified by hash tags: influenza M (HTO-40), EBV-BMLF1 (HTO-47), and pp65-CMV (HTO-48). This was observed through the presence of T cell clones with a clone size >= 20 in the hash-tagged wells corresponding to these antigens. The number of unique clones is expressed as total clones (TC). Parallel experiments using oligonucleotide-tagged pooled dextramers confirmed the reactivity of these expanded clones. The number of CD137 / 4-1BB expanded clones identical to those with a clone size >= 10 in the dextramer experiments is expressed as OC. These overlapping clones (OC) showed high expression of dextramers corresponding to the hash antigens and low expression of dextramers corresponding to irrelevant antigens.

[0305] Further validation was provided through multiplexing of scSEQ data. Seven unique clusters were resolved from RNA transcriptome analysis based on gene expression patterns and levels in individual cells. Figure 7A Notably, the population size comparison of each antigen-specific T cell was discovered through multipath decomposition of scSEQ data. Figure 7B The size of the antigen-specific T cell population was consistent with that obtained by functional flow cytometry. Figure 4BData shows that unique antigen-specific T cells can be identified via HTO multiplexing of scSEQ data, and the relative population size of each antigen-specific T cell population remains unchanged after multiplexing. Furthermore, the CITE-seq reagent is compatible with the hashing, AIM sorting, and single-cell sequence analysis methods described herein. Using such CITE-seq reagents may add a layer of critical information, thereby improving cell subpopulation identification and phenotypic analysis. As a non-limiting example, CITE-seq data provides measurements of protein abundance on the surface of each cell, while RNA-seq data provides measurements of transcript abundance in each cell. Protein abundance and RNA-seq expression may be uncorrelated, thus the two measurements provide complementary information. This is demonstrated by… Figure 8A The CD4 CITE-seq data shown are Figure 8B The comparison of CD4 RNA-seq data shown highlights this point.

[0306] Example 3: Functional and phenotypic analysis of antigen-specific T cells

[0307] This article describes the use of hashing, AIM sorting, single-cell sequencing, and CITE-seq antibody staining for direct antigen-specific T cell functional and phenotypic analysis on PBMCs, without requiring 7-10 days of pre-amplification.

[0308] Materials and methods

[0309] 5' Human TCRα / β and Cell Surface Antibody Staining: Cell Partitioning, Library Preparation and Sequencing

[0310] Single cells suspended in PBS containing 0.04% BSA were loaded onto a Chromium single-cell instrument (10X Genomics). RNA-seq, V(D)J, and antibody-derived tagged libraries were prepared using the Chromium single-cell 5' library, glue beads, and multiplexing kit (10X Genomics) with antibody-derived tagged primers. After amplification, cDNA was aliquoted into small (<300 bp) and large (>300 bp) fragments. RNA-seq and V(D)J libraries were prepared from the >300 bp fragments; cell surface antibody-derived libraries were prepared from the <300 bp fragments. To enrich the V(D)J library aliquots with TCRα / β, the cDNA was aliquoted into two 20 ng aliquots and amplified twice using primers.

[0311] Specifically, for the first round of amplification, the primers used were MP147 (ACACTCTTTCCCTACACGACGC; SEQ ID NO:17) for short R1, MP120 (GCAGACAGACTTGTCACTGGA; SEQ ID NO:18) for human TRAC, and MP121 (CTCTGCTTCTGATGGCTCAAACA; SEQ ID NO:19) for human TRBC. For the second round of amplification, nested R2 additions of MP147 and MP128 (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCAGGGTCAGGGTTCTGGATA; SEQ ID NO:20) were used to add TRAC, and nested R2 additions of MP129 (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCAGGGTCAGGGTTCTGGATA; SEQ ID NO:21) were used to add TRBC, amplifying the 20 ng aliquots from the first round. The V(D)J library was prepared from 25 ng each of hTRAC and hTRBC amplified cDNA. Paired-end sequencing (1 26 bp UMI and cell barcode reads, 8 bp i7 sample index, and 2 55 bp transcript read) and V(D)J library (1 150 bp reads, 8 bp i7 sample index, and 2 150 bp reads) were performed on an Illumina NextSeq500.

[0312] result

[0313] PBMCs isolated from the donor were incubated with one of five unique HPV peptides. Antigen-specific T cells were clustered based on HTO sequences using CD137 / 4-1BB-based AIM sorting and single-cell sequence analysis. Figure 9A Cells representing TCR clones (above the positive signal threshold) not shared in the HTO sample were identified, and the TCR sequences of these clones were obtained (see, for example...). Figure 9B ). Figure 9B An exemplary illustration is provided, in which each unique cell clone is represented by a different grayscale color, and each cell of the clone is represented by the same grayscale color. Table 1 below provides the number of hash-label-restricted clones for each hash label, i.e., the number of clones associated with only one HTO, and the number of cells in each clone.

[0314] Table 1

[0315] Hash tag Number of unique clones Number of cells HTO-1 168 233 HTO-2 176 209 HTO-3 416 1128 HTO-4 188 225 HTO-5 179 342

[0316] As shown in Table 1, cells identified by HTO-3 showed the largest number of TCR clones expressing TCRs specific to the homologous antigen, followed by cells clustering to HTO-5. Clones were identified by amino acid sequence, and exemplary CDR3 sequences of TCRα and β pairs of some HTO-3 restricted TCRs are provided in Table 2 below.

[0317] Table 2

[0318]

[0319] Single-cell sequencing analysis revealed that hash-restricted T-cell clones, i.e., T-cell clones not shared in the HTO samples, expressed markers associated with functional T-cell responses to a higher degree. Figure 9C Again Figure 9B ).

[0320] This article presents a unique method for rapidly identifying distinctive amino acid sequences of T-cell receptors that specifically bind to antigens and providing phenotypic profiles of cells expressing antigen-specific T-cell receptor sequences. This high-throughput approach enables the rapid identification and generation of novel and potentially personalized therapeutics.

[0321] Equivalent solution

[0322] Those skilled in the art will recognize that many equivalents of the particular embodiments of the invention described herein can be determined using only conventional experiments. Such equivalents are intended to be covered by the following claims.

[0323] All non-patent literature, patent applications and patents cited in this application are incorporated herein by reference in their entirety.

Claims

1. A method for identifying antigens capable of activating T cells, the method comprising: (I) Sorting activated T cells from compositions containing unique biological samples based on the expression of activation-inducing markers (AIMs). The AIM is selected from the group consisting of: CD137 / 4-1BB, CD107, IFNγ, PD-1, CD40L, OX40, CD25, CD69, CD28, HLA-DR, CX3CR1, TIM3, LAG3, TIGIT, and any combination thereof. The unique biological sample mentioned above includes: (a) Surface-bound major histocompatibility complex (MHC), (b) A unique antigen, wherein the unique antigen is capable of binding to the MHC bound to the surface. (c) A unique hash-tagged oligonucleotide (HTO) that (i) is used to specifically identify the unique antigen and (ii) is a molecular conjugate that binds specifically to the cell membrane of T cells and / or to cell surface markers expressed by T cells, and, (d) T cells containing the unique HTO, wherein the T cells are able to recognize the unique antigen when the unique antigen binds to the surface-bound MHC. as well as (II) Single-cell sequencing analysis was performed on the activated T cells sorted in (I) to: (a) Identifying the unique HTO, wherein identifying the unique HTO identifies the unique antigen capable of activating the activated T cells, and / or (b) Identify one or more of the following: (i) One or more genes expressed by the activated T cells, and / or (ii) The TCR α and / or β chain sequence of the TCR expressed by the activated T cells.

2. The method of claim 1, wherein the method includes performing one or both of the following steps prior to sorting: Multiple biosamples are constructed by evenly distributing a cell collection comprising T cells and antigen-presenting cells (APCs) isolated from the subject into individual samples, wherein each biosample optionally contains culture media and cytokines supporting T cell and / or APC viability, activation, and / or activity, as well as Multiple unique biological samples are established by delivering a unique antigen and / or a unique HTO for specific identification of the unique antigen to each of multiple biological samples, wherein the unique HTO is conjugated to a molecule that labels T cells with the unique HTO. Each of the plurality of biological samples comprises a cell collection containing T cells and APCs isolated from the subject, and optionally a culture medium supporting the viability, activity, and / or activation of the T cells and APCs. Wherein, after delivery of the unique antigen and / or the unique HTO conjugated to a molecule labeled with the unique HTO on T cells, each of the plurality of biological samples becomes a unique biological sample, the unique biological sample comprising: (a) A cell collection containing T cells and APCs isolated from the subject. (b) Unique antigens, (c) A unique HTO that specifically identifies the unique antigen and conjugates to a molecule labeled with the HTO on the T cell, and optionally (d) A culture medium that supports the viability, activity, and / or activation of the T cells and APCs. This results in the composition sorted in (I) containing multiple unique biological samples.

3. The method of claim 2, wherein the APC comprises dendritic cells, monocytes, macrophages, B cells, or combinations thereof derived from monocytes.

4. The method of claim 1, wherein sorting comprises fluorescently activated cell sorting of activated T cells based on the expression of the activation-inducing marker (AIM).

5. The method of claim 4, wherein fluorescence-activated cell sorting is based on detection using a fluorescently labeled antibody of the AIM.

6. The method of claim 1, wherein the method comprises further functional and / or phenotypic analysis of the activated T cells analyzed in II, wherein optionally the further functional and / or phenotypic analysis is selected from the group consisting of: flow cytometry analysis, CITE-seq analysis, multimer analysis, and combinations thereof.

7. The method of claim 6, wherein the further functional and / or phenotypic analysis measures the expression levels of one or more of the following proteins and / or RNAs: CD3, CD4, CD8, CD25, CD27, CD28, CD45RA, CD62L, HLA-DR, CD137 / 4-1BB, CD69, CD278, CD274, CD279, CD127, CD197, IFNγ, GZMH, GNLY, CD38, CCL3, and LAG3.

8. The method of claim 1, wherein peripheral blood mononuclear cells provide the T cells and the surface-bound MHC.

9. The method of claim 1, wherein the molecule binding to a cell surface marker expressed by a T cell comprises an antibody that binds to the cell surface molecule.

10. The method of claim 1, wherein the AIM is or comprises CD137 / 4-1BB.

11. The method of claim 1, wherein the method further comprises identifying a TCR α chain sequence and / or a TCR β chain sequence of a TCR that specifically binds to the antigen, wherein the TCR α chain sequence and / or the TCR β chain sequence are respectively a TCR α chain variable region sequence and / or a TCR β chain variable region sequence.

12. The method of claim 11, wherein the method comprises manufacturing a therapeutic agent using the TCR α chain sequence and / or the TCR β chain sequence.

13. A composition comprising a biological sample, the biological sample comprising: (a) Surface-bound major histocompatibility complex (MHC), (b) A unique antigen, wherein the unique antigen is capable of binding to the MHC bound to the surface. (c) A unique hash-tagged oligonucleotide (HTO) that (i) specifically identifies the unique antigen and (ii) is conjugated to a molecularly integrated into the cell membrane of a T cell and / or specifically binds to a cell surface marker expressed by the T cell. (d) T cells containing the unique HTO, wherein the T cells are able to recognize the unique antigen when the unique antigen binds to the surface-bound MHC.

14. The composition of claim 13, wherein (a) wherein the surface-bound MHC is expressed on the surface of antigen-presenting cells (APCs); and The T cells and the APCs are autologous. The T cells and APCs were each isolated from a human donor, and / or The APCs are selected from the group consisting of: dendritic cells derived from monocytes, dendritic cells, monocytes, macrophages, B cells, and combinations thereof. (b) The unique antigen (I) Choose from the following groups: (i) bacterial antigens or parts thereof, (ii) Viral antigens or parts thereof, (iii) Allergens or parts thereof, (iv) Tumor-associated antigens or portions thereof, and (v) Their combinations, and / or (II) Includes (i) Amino acid sequence, (ii) Nucleotide sequence, (iii) Dissolution products, and (iv) Their combination, (c) The unique HTO-conjugated molecule contains an antibody or lipid that binds to cell surface markers. (d) The composition further comprises a culture medium containing cytokines that support the activity of the T cells and / or APCs, or... Any combination of (e)(a) to (d).

15. The composition of claim 14, wherein the unique HTO-conjugated molecule comprises an antibody that binds to a cell surface marker, and The cell surface markers mentioned therein are selected from the group consisting of β2 microglobulin, CD298, CD2, CD3, CD4, CD8 and any combination thereof.

16. The composition of claim 14, wherein the cytokines supporting the activity of the T cells and / or the APCs are selected from the group consisting of IL-2, IL-7, IL-15, GM-CSF, IL-4 and any combination thereof.

17. The composition of claim 14, further comprising a second biological sample, wherein the second biological sample comprises: (a) MHC bound to a second T cell and a second surface, wherein the second T cell is capable of recognizing peptides presented in the environment of MHC bound to the second surface. (b) Second unique antigen, (c) Specifically identifying a second HTO of the second unique antigen, wherein the second HTO is conjugated to a second molecule labeled with the second HTO on the second T cell. and optional (d) Culture medium supporting the activation of the second T cells, in (i) The T cell and the second T cell were isolated from the same subject. (ii) The unique antigen and the second unique antigen are not the same. (iii) The molecule of the T cell labeled with the HTO is the same as the second molecule of the second T cell labeled with the second HTO, and the HTO and the second HTO are not the same.

18. The composition of claim 13, wherein the composition further comprises an agent that allows T cells to be sorted and activated based on the expression of an activation-inducing marker (AIM).

19. The composition of claim 18, wherein the agent that allows sorting of the activated T cells based on AIM expression is a fluorescently labeled antibody that specifically binds to the AIM.

20. The composition of claim 18, wherein the AIM is selected from the group consisting of: CD137 / 4-1BB, CD107, IFNγ, PD-1, CD40L, OX40, CD25, CD69, CD28, HLA-DR, CX3CR1, TIM3, LAG3 and / or TIGIT.

21. The composition of claim 13, wherein the composition comprises an antibody and / or MHC multimer that can be used for flow cytometry or CITE-seq analysis of the composition.

22. A kit comprising: (A) A plurality of unique antigens, each of which is capable of binding to surface-bound MHC, optionally wherein each of which is independently selected from the group consisting of: (i) bacterial antigens or parts thereof, (ii) Viral antigens or parts thereof, (iii) Allergens or parts thereof, (iv) Tumor-associated antigens or portions thereof, and (v) Their combination, and, (B) Multiple unique hash-tagged oligonucleotides (HTOs), wherein each unique HTO specifically identifies only one of the multiple unique antigens.

23. The kit of claim 22, wherein the kit further comprises an agent that allows T cells activated based on the expression of an activation-inducing marker (AIM), optionally wherein the agent that allows T cells activated based on the expression of an AIM is a fluorescently labeled antibody that specifically binds to the AIM.

24. The kit of claim 22, wherein each of the plurality of unique HTOs is conjugated to the same molecule, such that the kit comprises molecules conjugated to a plurality of unique HTOs.

25. The kit of claim 22, wherein each of the plurality of unique antigens comprises a unique and overlapping peptide sequence from a single protein.

26. The kit of claim 25, wherein the single protein is selected from the group consisting of: pathogenic antigens, tumor-associated antigens, or transplantation antigens.

27. Use of the method of any one of claims 1-12, the composition of any one of claims 13-21, or the kit of any one of claims 22-26 for analyzing T-cell-mediated patient immune responses to a vaccine.

28. Use of the method of any one of claims 1-12, the composition of any one of claims 13-21, or the kit of any one of claims 22-26 for analyzing T-cell-mediated immune responses in patients to immunotherapy.

29. Use of the method of any one of claims 1-12, the composition of any one of claims 13-21, or the kit of any one of claims 22-26 for analyzing T-cell-mediated immune responses in a patient during immunotherapy.

30. Use of the method of any one of claims 1-12, the composition of any one of claims 13-21, or the kit of any one of claims 22-26 for analyzing a patient’s T-cell response to an autoantigen.

31. Use of the method of any one of claims 1-12, the composition of any one of claims 13-21, or the kit of any one of claims 22-26 for analyzing a patient’s T-cell response to a transplanted antigen.

32. Use of the method of any one of claims 1-12, the composition of any one of claims 13-21, or the kit of any one of claims 22-26 for identifying one or more TCR variable region sequences of activated T cells.

33. The use as claimed in claim 32, wherein the one or more TCR variable region sequences comprise a CDR3 sequence of the TCRα chain and / or a CDR3 sequence of the TCRβ chain.

34. Use of the one or more TCR variable region sequences identified in claim 32 or claim 33 in the manufacture of human therapeutic agents.

Images