A highly efficient gene editing promoter PAtGCS suitable for Agrobacterium rhizogenes-mediated hairy root transformation and its application

Abstract

The invention discloses a plant high-efficiency promoter P AtGCS , the nucleotide sequence of the promoter is the nucleotide sequence shown in Sequence Table 1. Studies have shown that the promoter is inserted into the pRdCas9 vector to drive the expression of the Cas9 gene, and through Agrobacterium rhizogenes-mediated hairy root transformation, gene editing can be efficiently performed in transgenic hairy roots, and the gene loci of the two chromosomes are mutated simultaneously, which is 1.7-8.3 times more efficient than the 35S promoter driving the Cas9 gene editing vector.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a promoter from Arabidopsis thaliana. Background Art

[0002] CRISPR / Cas9 gene editing technology is widely used in the creation of animal and plant mutants and the study of gene function. The efficiency of gene editing directly affects the difficulty and efficiency of research work. Factors affecting gene editing efficiency include driver Cas9 The promoter of sgRNA expression, the location of the gene where the editing target is located, the chromosome ploidy of the editing recipient plant, etc. Among them, the most studied factor and the factor that has the greatest impact on gene editing efficiency is the driver Cas9 The promoter of the gene, so choose the appropriate promoter to drive Cas9 The expression of is particularly important in improving the efficiency of gene editing. Especially when gene editing is performed through genetic transformation mediated by Agrobacterium rhizogenes, the phenotype analyzed is on the transgenic hairy roots produced. For most traits, the corresponding phenotype can only be observed when the edited gene produces a double mutant genotype. Therefore, when studying the function of a gene through genetic transformation mediated by Agrobacterium rhizogenes, the efficiency of gene editing is the key factor. Only when the gene editing efficiency is high and the proportion of double mutants produced is high, it is conducive to the analysis of gene function. Summary of the invention

[0003] In view of the above defects, the present invention cloned an AtGCS gene promoter from Arabidopsis thaliana. The Arabidopsis thaliana AtGCS gene (AT4G23100) encodes glutamate-cysteine ​​ligase, which is the first and rate-limiting step in catalyzing glutathione biosynthesis, especially necessary for the proliferation of plant root tip cells. In the transformation of plant hairy roots, the efficiency of gene editing driven by the promoter to express the Cas9 gene is higher than that of the 35S promoter to drive the Cas9 gene editing vector.

[0004] The scheme of the present invention is as follows:

[0005] A cloned from Arabidopsis thaliana AtGCS Gene promoter, the longest sequence is 2411bp, the sequence is located at the position of 12109162--12106752 of chromosome 4 of Arabidopsis thaliana, AtGCS The nucleotide sequence of the gene promoter is shown in SEQ ID No.1.

[0006] Said AtGCS Application of gene promoters in driving Cas9 gene expression.

[0007] Compared with the prior art, the present invention has the following advantages:

[0008] The promoter of the present invention drives the expression of the Cas9 gene to obtain a higher gene editing efficiency in hairy root transformation, thereby reducing the workload of scientific research, and in particular, gene editing of multiple genes is more effective. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 For different lengths AtGCS Gene promoter driven GUSPlus vector map;

[0010] Figure 2 Different lengths of soybean hairy roots AtGCSpr oDrive GUSPlus expression, GUS staining results;

[0011] Figure 3 To analyze the activity of AtGCS promoter in other dicotyledonous hairy roots using hairy root transformation;

[0012] Figure 4 It is pRedU3d-35Cas9 vector;

[0013] Figure 5 This is the map of the pRdGaCas9 vector. DETAILED DESCRIPTION

[0014] The technical scheme of the present invention is described in detail below with reference to the embodiments and the accompanying drawings, but the protection scope is not limited thereto. The equipment and raw materials used in the embodiments can all be obtained from the market.

[0015] Embodiment one:

[0016] (1) Functional analysis of AtGCS gene promoter:

[0017] Design PCR primers for promoter amplification. Five pairs of PCR primers were designed, with amplification lengths of 2411 bp, 1990 bp, 1640 bp, 1200 bp and 850 bp, respectively, and connected to the plant expression vector pCAMBIA1305. Hin dⅢ / Nco Ⅰ site to analyze the promoter activity, vector map see Figure 1 The soybean roots were transformed by Agrobacterium rhizogenes-mediated hairy root transformation and GUS staining was performed. The results showed that the five promoters of different lengths were all able to drive the expression of the GUSPlus gene. The first four longer promoters had basically the same driving activity ( Figure 2 , AF), but when the promoter sequence was shortened to 833 bp, its driving expression activity was weakened ( Figure 2, GI). At the same time, this promoter can efficiently drive gene expression in hairy roots of most dicotyledonous plants such as sweet potato, cucumber, tomato, cotton, etc. ( Figure 3 ), indicating that AtGCS Universality of gene promoters in dicotyledons.

[0018] (2) Construction of AtGCS promoter-driven Cas9 editing vector:

[0019] Step 1: The DsRed reporter gene on the pRed1305 vector (Fan Y, Xu F, Zhou H, Liu X,Yang X, Weng K, Sun X and LyuS. A fast, simple, high efficiency and one-stepgeneration of composite cucumber plants with transgenic roots byAgrobacterium rhizogenes-mediated transformation. Plant Cell, Tissue and OrganCulture (PCTOC). 2020, 141: 207–216.) was digested with EcoRⅠ / SacⅡ and inserted into the EcoRⅠ / SacⅡ restriction site of the gene editing vector pGSE401 (Fan YL, ZhangXH, Zhong LJ, Wang XY, Jin LS, Lyu SH. One-stepgeneration of composite soybean plants with transgenic roots by Agrobacteriumrhizogenes-mediated transformation. BMC Plant Biol. 2020, 20(1):208.), replacing the GUSplus reporter gene. The promoter AtU3d (Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu YG. A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant. 2015, 8(8):1274-84.) was used to replace AtU6-26p, and the vector was named pRedU3d-35Cas9 vector ( Figure 4 ).

[0020] Step 2: Insert the AtGCS promoter into the KpnI / XbaI sites of pRedU3d-35Cas9 (using Arabidopsis thaliana genomic DNA as a template, and using primers GaB1 (5'-acGGTCTCAGTACATGTGTAGTTGGGCTTCGGT, with a BsaI restriction site added) and GaX2 (5'-GCGTCTAGAGGTATATATAGCTCCTGCAATT, with a XbaI restriction site added) as a combination for PCR amplification. The amplified product was digested with BsaI / XbaI to construct the AtGCS gene promoter-driven Cas9 vector pRdGaCas9 ( Figure 5 );

[0021] (3) The soybean super-nodulation gene Rj7 was selected for editing, and the editing efficiency of two vectors, pRedU3d-35Cas9 and pRdGa1Cas9, was compared:

[0022] The editing target site of soybean Rj7 gene (Glyma.12g040000) was selected as: AGGGTACAACGAG GAATTC GGG (the underlined sequence is Eco RⅠ restriction site, the bold part is PAM).

[0023] Two primers were synthesized (Ktrj71: GTCAAGGGTACAACGAGGAATTC;

[0024] Ktrj72:AAACGAATTCCTCGTTGTACCCT) were annealed and connected to pRedU3d-35Cas9 and pRdGa1Cas9 vectors respectively (construction method reference: Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, LiuB, Wang XC, Chen QJ. A CRISPR / Cas9 toolkitfor multiplex genome editing inplants. BMC Plant Biol. 2014, 14:327.). The constructed editing vector was transformed into Agrobacterium rhizogenes K599 and transformed into soybean variety williams82 by one-step cutting method (transformation method reference: Fan YL, Zhang XH, Zhong LJ, Wang XY, Jin LS, Lyu SH. One-step generation of composite soybean plants with transgenic roots by Agrobacterium rhizogenes-mediated transformation. BMC Plant Biol. 2020, 20(1):208.).

[0025] Efficiency comparison: After extracting the DNA of soybean transgenic roots, PCR amplification was performed and the amplified products were used Eco The results showed that: p AtGCSpro 2411 -Cas9-Rj7 editing system produced double mutation / homozygous mutation type at Rj7 locus with an efficiency of 76.7%, while p 2×35Spro -The efficiency of the Cas9-Rj7 editing system in generating double mutations was 56.7%.

[0026] (4) Choose the right Radix Euphorbiae LjNLP Perform editing and verify the editing efficiency of two vectors pRedU3d-35Cas9 and pRdGa1Cas9:

[0027] Choose from Lotus japonicus NRSYM1 / LjNLP The sequence of (Lj5g3v1999250.1) is CCAAA GGATCC ATCAGAACAACA (the underlined sequence is Bam The HⅠ restriction site (the bold part is PAM) was used as the editing target, and the construction method was the same as step (4). The editing efficiency comparison results showed that: AtGCSpro 1200-Cas9- LjNLP The efficiency of producing double spikes is 82.5%, and p 2×35Spro 1200 -Cas9- LjNLP The efficiency of producing double spikes is 32.5%.

[0028] It should be pointed out that the specific implementation methods are only representative examples of the present invention, and it is obvious that the technical solution of the present invention is not limited to the above-mentioned embodiments. There are also many variations. A person skilled in the art should consider that what is publicly mentioned or associated with this document is within the scope of protection of this patent. Sequence Listing <110> Liaocheng University <120> A highly efficient gene editing promoter P for Agrobacterium rhizogenes-mediated hairy root transformation AtGCS And its application <160> 1 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2411 <212> DNA <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 1 atgtgtagtt gggcttcggt gagacttatg agttgggctt gccatgacaa tcccagatgt 60 tacttttctc ttaatcccta ggaagaaaat cttttggtaa cttcaaatca ttataagcgc 120 aaatagctag ctactatgtc tgatgcattt agttatactttg tgctgaggat tggggtcttt 180 aatgtgaaat cgaaagttta gggtttctcg tggatattag aaaacgttaa ggttggaata 240 taaaggaaaa gattaactga aagagtctgc atagcacact ccagcttaat tccgtatcgt 300 tttaggattt ctgacttcac tctttgacgg ctatatatta atgtgatttt ccattatgtc 360 aaatgttaat tattattttt tagataagtt ttcgtgaaag ttgaaacggt gtgacttgtg 420 agtgacgaat gtataggaag aaactgtgga ggtgggttcc gtttaaggct ttggtggtgt 480 ggagattaga agtcatggcc gccattttttg agtcacgcac gtgtccacct accttacctt 540 cttataactt attcattcat gtgttcgata aaatatattt gatattaatt taaacataca 600 acatagaagt gcacaattac aagagttttt tttgtttttc tatttttgtc gctacaagag 660 tttttagttt ttacttacgt tacgtatatg caaacgcaag caattctgca tctatttgtt 720 tttcaatggc agccataatt gatatcaaat aaataaatta ctaatgccac atgttttttt 780 agcacagctt cataattcat aggagtatcg atatgtaaca caataatgga tcttgtagta 840 aaatttgaat agagtcaatt aaaaaaaaaa aaaaagatag agtcaatctg tgcgatataa 900 tgaaattaga acgaagctcg aattttaaga ttttaaatta taacaaaact caaatgtgtt 960 ataacattca aaaaaaaaaa aaaaaaaaaa cttaacacaa taattagttt ttctcatttt 1020 gagaaaacca aattctcgaa agtagtgaa aaataccatg gatttgaag gattttgtag 1080 attaccaaat agtaaaaaaa atttctaac ttgttttact atgatttgt cacgaataca 1140 aaatcaact cagatagaga aattaggtga tatatagcca taattgtgtt tactaaa 1200 atacagtta tttctaaaaa taagtaaat gaccaccatg gtaccatact attccatgaa 1260 caatagac aaatagcctt ccattgttat aattgggata ttgtcaaatc catcccgtat 1320 ctatatatat tattatacac aagtagaact ttgatggtg attcattatc taccattcac 1380 atgtttttgt atcattaaat tgttgattat aaagcagga tttgattcca cctactaaga 1440 agtaggaat aaaaaacat aacgccaatt ttcgttcatc agaaccaaga ttttttgtc 1500 gandacaatca aaccaatag ataatgatac tgttttttat agtagtatat atatttcttt 1560 tcctatagag tatttct gaggtcatgt gttggttag tgacactt ttcattattt 1620 tacgttctaa atttaatc gtaagttaa acctcgttta aagtatacta taaagatag 1680 aaatatcatt attcattat acacactata aagttaacct ttgtttaaac tactataaa 1740 <h2 style=";text-align:left;direction:ltr">ctggttattt aaaaaactat tagggttaaa tttgtgagaa atggaaaagt aagaggcaaa 1800<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> aaacgaaaga atcttttatt acaatgatta ttaattttat caactttctt ttatagacag 1860<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ctcagctcca ctgatcggct catgctccac tgatcaactt tctttcattt ttttatcagt 1920<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ttctcatttc tctctcagtc gcatataaat ttgaaacgcc gattcgtttt tgctctttaa 1980<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gctttcttct tgatttcgac ggtgtctctc aatctccgtc aagcttgacg aatttcaggt 2040<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gtgatttgct tctcttcttc ttcgctttct ggacttgtgg attttggttt ttgattgatt 2100<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tgttctgctt tttttttttt ggttgaatct tcgctttttc tcatgatttt tttttggctg 2160<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ttgcatgatt ttggtttttttagagtcgaa tttttgcaga tttttgcttt gatttgattt 2220<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ttgttgttgt tgttgtttct ggtttggtga tacacgaatt ttgatttgtt cttccagatg 2280<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> atagttcaat tctgtggtag ctgctgattc taattatgtg atatatgtta ttagaattga 2340<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gaaaaatgca gttatttgtg atttctcata gcttatgatg aattgttata attgcaggag 2400<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ctatatatac c 2411

Claims

1. An application of the AtGCS gene promoter cloned from Arabidopsis thaliana to drive Cas9 for gene editing in hairy root transformation of soybean, sweet potato, cucumber, tomato and cotton, characterized in that: The nucleotide sequence of the AtGCS gene promoter is shown in SEQ ID No.

1.

2. A gene vector containing the AtGCS gene promoter according to claim 1 to drive Cas9 for gene editing in hairy root transformation of soybean, sweet potato, cucumber, tomato and cotton.

3. Application of an engineered bacterium containing the gene vector of the AtGCS gene promoter according to claim 2 to drive Cas9 for gene editing in hairy root transformation of soybean, sweet potato, cucumber, tomato and cotton.

Images