New inhibitors of ferroportin

Abstract

The present invention relates to new compounds of general formula (I), and Het-2 is an optionally substituted bicyclic heteroaryl of the following formula, pharmaceutical compositions comprising the same, and their use as medicaments, in particular as inhibitors of ferroportin, more particularly for the prevention and / or treatment of diseases or iron metabolism disorders caused by the lack of hepcidin, such as in particular iron overload conditions, such as in particular thalassemia and hemochromatosis.

Description

[0001] This application is a divisional application of the application with the filing date of October 21, 2016, application number 201680061941.3, and invention title "Novel Membrane Ferritin Inhibitors". Technical Field

[0002] Introduction

[0003] The present invention relates to novel compounds of general formula (A-I), pharmaceutical compositions containing the same, and their use as medicaments, in particular their use as membrane ferritin inhibitors, and more particularly for the prevention and / or treatment of diseases or iron metabolism disorders caused by a lack of hepcidin (such as especially iron overload states, such as especially thalassemia and hemochromatosis). Background Art

[0004] Iron is an essential trace element for almost all organisms, especially related to growth and blood formation. The balance of iron metabolism is mainly regulated in this case by the level of recycling iron from hemoglobin in aging red blood cells and the absorption of dietary iron in the duodenum. The released iron is taken up through the intestine, especially through specific transport systems (DMT-1, membrane ferritin), transported into the blood circulation, and thus delivered to appropriate tissues and organs (transferrin, transferrin receptor).

[0005] In the human body, elemental iron is very important, especially for oxygen transport, oxygen uptake, cell functions such as mitochondrial electron transport, cognitive functions, etc., and ultimately for the entire energy metabolism.

[0006] On average, the human body contains 4 to 5 g of iron, which is present in enzymes, hemoglobin, and myoglobin, and stores or stores iron in the form of ferritin and hemosiderin. Approximately half of this iron, about 2 g, is present as heme iron, which is bound to hemoglobin in red blood cells. Since these red blood cells have only a limited lifespan (75 - 150 days), new red blood cells must be continuously formed and old red blood cells degraded (more than two million red blood cells are formed per second). This high regenerative capacity is achieved by macrophages phagocytosing aging red blood cells and lysing them, and thus recycling the iron obtained therefrom for iron metabolism. Most of the iron required for erythropoiesis, about 25 mg per day, is provided in this way.

[0007] The daily iron requirement for adults ranges between 0.5 and 1.5 mg, while infants and women during pregnancy require 2 to 5 mg of iron per day. Daily iron losses, such as through the shedding of skin and epithelial cells, are extremely low. An increase in iron loss occurs, for example, during menstrual bleeding in women. Generally, blood loss significantly reduces iron levels because approximately 1 mg of iron is lost per 2 ml of blood. In healthy adults, the normal daily loss of approximately 1 mg of iron is usually replaced by daily food intake, thus rebalancing the daily iron requirement to an appropriate level.

[0008] Iron levels are regulated by the absorption of iron present in food, with an absorption rate between 6 and 12%, and up to 25% in cases of iron deficiency. The absorption rate is regulated by the organism according to iron demand and the size of iron stores. In this process, the human body uses both divalent iron ions and trivalent iron ions. Generally, iron(III) compounds dissolve in the stomach at a sufficiently acidic pH value and are thus available for absorption. Iron absorption occurs through the mucosal cells of the upper part of the small intestine. In this process, trivalent non-heme iron is first reduced to Fe(II) in the intestinal cell membrane, for example, by an iron reductase (membrane-bound duodenal cytochrome b) for absorption, so that it can subsequently be transported into the intestinal cell by means of the transporter DMT1 (divalent metal transporter 1). In contrast, heme iron crosses the cell membrane and enters the intestinal epithelial cell without any change. In the intestinal epithelial cell, iron is either stored as storage iron in ferritin or released into the blood through the transporter ferroportin. Hepcidin plays a central role in this process because it is a key regulator of iron absorption. The divalent iron transported into the blood through ferroportin is converted into trivalent iron by oxidases (ceruloplasmin, hephaestin), and the trivalent iron is then transported to relevant locations in the body by transferrin (see, for example, "Balancing acts: molecular control of mammalian iron metabolism". M. W. Hentze, Cell 117, 2004, 285 - 297.).

[0009] The mammalian body cannot actively excrete iron. Iron metabolism is basically controlled by hepcidin through the cellular release of iron from macrophages, hepatocytes, and intestinal epithelial cells.

[0010] Hepcidin is a peptide hormone produced in the liver. Although two forms with a shortened amino terminus, hepcidin-22 and hepcidin-20, have been discovered, the major active form has 25 amino acids (see, for example: "Hepcidin, a key regulator of iron metabolism and mediator of anaemia of inflammation". T. Ganz, Blood, 102, 2003, 783-8). Hepcidin acts on iron absorbed through the intestine and placenta and on iron released from the reticuloendothelial system. In vivo, hepcidin is synthesized in the liver from so-called prohepcidin, which is encoded by the so-called HAMP gene. Regulation of hepcidin formation is directly related to the body's iron levels, i.e., if the body has sufficient iron and oxygen supply, more hepcidin is formed, and if iron and oxygen levels are low, or in the case of increased erythropoiesis, less hepcidin is formed. In small intestinal mucosal cells and macrophages, hepcidin binds to the transporter ferroportin, which normally transports phagocytosed recycled iron from inside the cell to the blood.

[0011] Ferroportin is a transmembrane protein consisting of 571 amino acids, which is formed in the liver, spleen, kidney, heart, intestine, and placenta. In particular, ferroportin is localized in the basolateral membrane of intestinal epithelial cells. Ferroportin thus bound then exports iron into the blood. In this case, ferroportin most likely transports iron as Fe 2+ . If hepcidin binds to ferroportin, ferroportin is transported into the cell interior, where it is degraded, such that the release of phagocytosed recycled iron from the cell is then almost completely blocked. If this ferroportin, for example, is inactivated by hepcidin such that it cannot export the iron stored in mucosal cells, the stored iron is lost via the feces with the natural shedding of the cells. When ferroportin, for example, is inactivated or inhibited by hepcidin, iron absorption in the intestine is thus reduced. In addition, ferroportin is significantly localized in the reticuloendothelial system (RES), to which macrophages also belong. When iron metabolism is impaired by chronic inflammation, hepcidin plays an important role in this. In the case of inflammation, especially an increase in interleukin-6, triggers an increase in hepcidin levels. As a result, more hepcidin binds to ferroportin in macrophages, thus blocking the release of stored iron and ultimately leading to anemia of chronic disease (ACD or AI).

[0012] On the other hand, if the serum iron level decreases, hepcidin production in hepatocytes of the liver decreases, such that less hepcidin is released, whereby less ferroportin is inactivated, allowing a greater amount of stored iron to be transported into the serum.

[0013] It is thus obvious that the hepcidin-ferroportin system directly regulates iron metabolism, and disorders of the hepcidin regulatory mechanism thus have a direct effect on the body's iron metabolism. In principle, the hepcidin-ferroportin regulatory mechanism works through the following two opposite principles:

[0014] On the one hand, an increase in hepcidin leads to the inactivation of ferroportin, thus blocking the release of stored iron from cells into the serum, thus reducing the serum iron level. In pathological conditions, a decrease in the serum iron level leads to a decrease in the heme level and a decrease in erythropoiesis, thus leading to iron-deficiency anemia.

[0015] On the other hand, a decrease in hepcidin leads to an increase in active ferroportin, thus allowing enhanced release of stored iron and enhanced uptake of iron, for example from food, thus increasing the serum iron level. In pathological conditions, an increase in the iron level leads to iron overload.

[0016] The state of iron overload and diseases are characterized by an excess of iron levels. Among them, the problem lies in an excess of serum iron levels that results in non-transferrin-bound iron (NTBI). NTBI is rapidly and non-specifically taken up by organs, leading to the accumulation of iron in tissues and organs. Iron overload leads to many diseases and unwanted medical conditions, including damage to the heart, liver, and endocrine system. Furthermore, in patients suffering from neurodegenerative diseases, for example, in Alzheimer's disease and Parkinson's disease, an accumulation of iron in the brain has been observed. As a particularly harmful aspect of excess free iron, the formation of unwanted free radicals must be mentioned. In particular, iron (II) ions catalyze the formation of reactive oxygen species (ROS) (especially through the Fenton reaction). These ROS cause damage to DNA, lipids, proteins, and carbohydrates, which have far-reaching effects in cells, tissues, and organs. The formation of ROS is well known and described in the literature as the cause of so-called oxidative stress.

[0017] The well-established existing methods for treating iron overload to date are based on the concept of reducing the amount of iron in the serum by increasing the removal of iron from the body. The earliest known and still conventional treatment method in otherwise healthy humans includes regular phlebotomies (bloodletting). When first diagnosed, phlebotomies are usually scheduled quite frequently, for example once a week, until the iron level reaches the normal range, and then, depending on the patient's iron loading rate, phlebotomies are scheduled monthly or every three months subsequently.

[0018] For patients who cannot tolerate conventional blood draws, chelating agents are available. For example, deferoxamine (also known as desferrioxamine B, N'-{5-[acetyl(hydroxy)amino]pentyl}-N-[5-({4-[(5-aminopentyl)(hydroxy)amino]-4-oxobutanoyl}amino)pentyl]-N-hydroxysuccinamide or ), which is a bacterial siderophore and is an established drug for chelation therapy. Deferoxamine, as a chelating agent, binds iron in the bloodstream and increases excretion via urine and feces. Typical treatment for chronic iron overload requires subcutaneous injection for 8 - 12 hours per day. Parenterally injectable compositions of desferrioxamine salts are described, for example, in WO1998 / 25887.

[0019] Two newer drugs - deferasirox and deferiprone - are licensed for use in patients receiving regular transfusions to treat thalassemia, which leads to the development of iron overload.

[0020] Deferasirox ( 4-(3,5-bis(2-hydroxyphenyl)-1H-1,2,4-triazol-1-yl)benzoic acid), described, for example, in WO1997 / 49395, and deferiprone ( 3-hydroxy-1,2-dimethylpyridin-4(1H)-one) also act as iron chelators and are thus suitable as drugs for iron chelation therapy.

[0021] Other compounds that have been described as acting as iron chelates for the treatment of iron overload are known. For example, WO2013 / 142258 relates to encapsulated particles of diethylenetriaminepentaacetate (DTPA) and zinc salts. WO2003 / 041709 relates to 4-hydroxy-2-alkylquinolines, such as 4-hydroxy-2-nonylquinoline, as iron chelates. WO1998 / 09626 relates to chelating agents for the treatment of iron overload states based on compositions containing dithiocarbamates.

[0022] WO2015 / 077655 relates to desferrithiocin derivatives of formula (A) or (J) for the treatment of iron overload diseases According to WO2015 / 077655, it has been found that the desferrithiocin derivatives act as iron chelators.

[0023] WO2005 / 051411 relates to new antibiotics or antifungals based on oxachelin and its derivatives according to the following formula

[0024]

[0025] It is described to act as an iron chelate and is used for treating iron overload diseases.

[0026] The disadvantage of treating iron overload by chelation therapy is that when iron overload has occurred, the chelated iron is removed from the body rather than preventing the occurrence of the disease. Moreover, the drugs known for established iron chelation therapy show potential toxicity.

[0027] It can be expected that modern approaches will increasingly replace this method, especially with the increase in knowledge of the underlying mechanisms and appropriate treatment methods developed based on such knowledge. Hepcidin agonists or compounds that have an inhibitory or supportive effect on the biochemical regulatory pathways in iron metabolism are basically known from the prior art.

[0028] For example, if hepcidin expression is blocked, for example, due to a genetic defect, iron overload can occur such as in the known iron overload disease haemochromatosis. Haemochromatosis is an iron overload disease caused by mutations in the gene that controls hepcidin synthesis or the hepcidin gene itself. In such patients, low or no levels of hepcidin lead to an increase in the amount of active membrane iron transporters, resulting in increased absorption of dietary iron, leading to severe iron overload, which causes heart, liver, and endocrine damage. In hepcidin knockout mice (a model of type 2 (juvenile) haemochromatosis), it has been shown that hepcidin-mimetic peptides, which are peptides that also bind and inactivate membrane iron transporters, effectively reverse tissue iron accumulation (Ramos et al., Blood 2012).

[0029] In the known iron overload disease β-thalassemia, mutations in the β-globin gene result in reduced heme production and ineffective erythropoiesis, where insufficient numbers of red blood cells are produced due to damage and death of red blood cells developing in the bone marrow. This leads to an upregulation of the erythropoiesis rate and a decrease in hepcidin levels, such that more iron is available to increase erythropoietic activity. Due to the reduced hepcidin levels, this adverse reaction results in iron overload, which leads to an increased amount of active membrane ferroportin, such that dietary iron absorption is increased, as described above. Due to the toxicity of the imbalance in the ratio of α- and β-hemoglobin subunits, the red blood cells in thalassemia have a shortened half-life. Furthermore, in the treatment of β-thalassemia, the use of hepcidin mimetic peptides has been described, where treatment principles based on increased hepcidin activity to limit iron and reduce iron mediate damage to red blood cells. Administration of hepcidin mimetic peptides to th3 / + mice, a model of non-transfusion-dependent β-thalassemia, resulted in the alleviation of ineffective erythropoiesis, increased red blood cell survival time and improved anemia. In this model, prevention of iron overload due to reduced dietary iron absorption was an additional benefit of hepcidin mimetic therapy (Gardenghi et al, 2010; Casu et al, 2013).

[0030] The described treatment modality is directly involved in interfering with the iron metabolic pathway by providing a direct effect of primary hepcidin regulation through a hepcidin mimetic or hepcidin agonist, i.e., acting in the sense of a hepcidin substitute or supply. This modality is based on the treatment principle of treating iron overload (i.e., elevated serum iron levels) by inhibiting membrane ferroportin through a hepcidin-inactivation mechanism, thereby blocking excessive iron absorption.

[0031] Additional known iron overload-related diseases are diseases associated with ineffective erythropoiesis, such as myelodysplastic syndrome (also known as MDS or myelodysplasia), polycythemia vera, etc.

[0032] Furthermore, mutations in genes involved in sensing systemic iron stores (such as hepcidin (Hamp1), hemochromatosis protein (HFE), hemojuvelin (HJV), and transferrin receptor 2 (TFR2)) can lead to iron overload in mice and humans. Accordingly, diseases related to HFE and gene mutations, diseases related to chronic hemolysis, sickle cell disease, erythrocyte membrane disorders, as well as glucose-6-phosphate dehydrogenase deficiency (G6PD deficiency), erythropoietic porphyria, and Friedrich’s Ataxia can be mentioned. Furthermore, the iron overload subgroups include transfusion iron overload, iron poisoning, pulmonary hemosiderosis, osteopenia, insulin resistance, African iron overload, Hallervordan-Spatz disease, hyperferritinemia, ceruloplasmin deficiency, neonatal hemochromatosis, and erythrocyte disorders including thalassemia, alpha-thalassemia, thalassemia intermedia, sickle cell disease, and myelodysplastic syndrome are included.

[0033] Additional diseases and / or disorders and / or morbid conditions associated with elevated iron levels include, but are not limited to, diseases with elevated iron levels, including ataxia, Friedrich’s Ataxia, age-related macular degeneration, age-related cataract, age-related retinal diseases, and neurodegenerative diseases, and accordingly, such neurodegenerative diseases include Alzheimer’s disease, Parkinson’s disease, pantothenate kinase-associated neurodegeneration, restless legs syndrome, and Huntington’s disease.

[0034] Hepcidin is a host defense peptide and represents a component of the innate immune system in response to invasion of the body.

[0035] Many bacteria have been described as highly dependent on iron supply from the host (so-called siderophilic organisms) and have evolved mechanisms to capture iron from local tissues. The ability to limit the amount of iron available to such organisms by means of membrane iron transporter-inhibitors could represent an effective adjuvant therapy. One such siderophilic organism is Vibrio vulnificus, which causes rare but extremely severe infectious diseases in coastal communities, usually occurring in subjects with undiagnosed iron overload. Studies on animals inoculated with a lethal dose of Vibrio vulnificus have demonstrated that treatment with hepcidin-mimetic peptides results in a response of nearly 100% survival with inactivation of membrane iron transporters, regardless of whether the treatment is initiated before or after the onset of infection (Arezes et al 2015).

[0036] As known hepcidin mimetics, so-called minihepcidins can be mentioned, which are described, for example, in WO2013 / 086143. Minihepcidins are small synthetic peptide analogues of the N-terminus of hepcidin, which are crucial for hepcidin to interact with membrane iron transporters. Minihepcidins were developed based on the discovery that the first 9 amino acids of hepcidin (DTHFPICIF) have sufficient in vitro activity (measured by degradation of membrane iron transporter-GFP). Minihepcidins have a modified hepcidin-9 amino acid sequence to exhibit improved proteolytic resistance and enhanced biophysical interaction with membrane iron transporters. Minihepcidins are described as being useful for treating human iron overload conditions caused by hepcidin deficiency.

[0037] WO2015 / 069660 describes a method of increasing hepcidin expression to treat iron overload disorders by administering a modified iron-binding / releasing transferrin to reduce non-transferrin-bound iron (NTBI).

[0038] All of the compounds described above that act as hepcidin agonists, hepcidin mimetics or membrane iron transporter inhibitors, etc. are relatively high molecular weight compounds, especially those that can be obtained mainly by genetic engineering. Various additional ways based on molecular interactions and biomolecules have been described. The disadvantages are the complexity of preparation and high sensitivity of such biomolecular compounds. In particular, methods based on membrane iron transporter antibodies are not effective enough because the membrane iron transporters inhibited by the antibodies can be permanently regenerated by the body, so this inhibition is not sufficient to continuously achieve the desired therapeutic effect.

[0039] Low molecular weight compounds that are also known to play a role in iron metabolism and can have inhibitory or promoting effects are also known.

[0040] For example, WO 2008 / 151288, WO 2008 / 118790, WO 2008 / 115999, and WO 2008 / 109840 describe compounds that act as divalent metal transporter-1 (DMT1) inhibitors and their use in the treatment of iron disorders such as thalassemia or hemochromatosis.

[0041] WO 2008 / 123093 relates to an agent for preventing or treating iron overload disorders, comprising 22β-methoxyolean-12-ene-3β,24(4β)-diol.

[0042] EP 1074254 and EP1072265 relate to the use of plant polyphenols with catechol- and flavonoid structures in the treatment of iron overload.

[0043] WO 2011 / 029832 relates to thiazole and oxazole compounds that act as hepcidin antagonists and are thus described as suitable for the treatment of iron deficiency diseases. Among them, the activity of hepcidin antagonism is described as inhibiting the inhibition of ferroportin by hepcidin, which has an effect opposite to that of the new thiazole and oxazole compounds described herein discovered by the inventors of the present invention.

[0044] So far, no chemical compounds based on the general formula structure of the present invention have been disclosed to be related to the activity of ferroportin inhibitors or their use in the prevention and treatment of iron metabolism disorders associated with increased iron levels (such as iron overload).

[0045] US2004 / 0138268A1, US2011 / 0224136A1, CN103508957, WO2006 / 062224A1, WO2015 / 051362A1, EP1953145A1, WO2009 / 154739A2, GB937878A, WO2011 / 023722A1, WO2010 / 020556A1, WO2005 / 011685A1, WO00 / 56724A1, WO2010 / 036632A1, WO2005 / 014576A1, WO2013 / 067578A1, WO2005 / 116355A1 or Zou Yiquan et al., "Discovery of pyrazole as C-terminus of selective BACE 1 inhibitors"; Eur. J. of Medicinal Chemistry 68 (2013) 270 - 283, Tussing-Humphreys et al., "Rethinking Iron Regulation and Assessment in Iron Deficiency, Anemia of Chronic Disease, and Obesity: Introducing Hepcidin” J. Academy of Nutrition and Dietetics (2012), Vol. 122, No. 3, 391 - 400, Riordan et al., “Bleomycin analogs. Synthesis and proton NMR spectral assignments of thiazole amides related to bleomycin A2(1)”; J. Heterocyclic Chem. 18, 1213 (1981), Hideaki Sasaki, “Synthesis of a novel bis(2,4’-bithiazole) derivative as a Co(II)-activated DNA cleaving agent”; Chem. Pharm. Bull. 42(8) 1685 - 1687 (1994), and Ballell et al., “Fueling open-source drug discovery."177 small-molecule leads against tuberculosis"; ChemMedChem 2013, 8, 313 - 321 describes compounds for different medical uses and mechanisms of action. Summary of the Invention

[0046] Objectives

[0047] The objective of the present invention is in particular to provide new therapeutically effective compounds which can be used for the prevention and treatment of iron metabolism disorders associated with increased iron levels, such as in particular the effective treatment of iron overload. In a further objective, the new compounds should exhibit few side effects and have extremely low toxicity as well as good bioavailability and compatibility. Furthermore, contrary to known iron-chelating compounds, these new compounds should be suitable for preventing the increase in iron levels and thus the occurrence of associated diseases, rather than removing excess iron from the body when iron overload has already occurred. In a further objective, the new compounds should have a defined structure (stoichiometry) and should be preparable by simple synthetic methods, showing lower sensitivity and increased long-term efficiency compared to known biomolecular compounds, such as antibodies.

[0048] This objective is achieved by the development of new compounds according to the chemical formulas defined in the present case, such as in particular compounds of formula (A-I), which have been found to act as inhibitors of ferroportin, and are thus suitable for inhibiting iron transport and are therefore effective in the prevention and treatment of iron metabolism disorders associated with increased iron levels (such as in particular iron overload), as well as in the prevention and treatment of diseases caused by the lack of hepcidin, diseases related to or caused by increased iron levels or iron overload, and diseases associated with ineffective erythropoiesis. Sequence Listing <110> Vifor (International) AG <120> New Ferroportin Inhibitors <130> LHB2267012D <150> EP15191176.5 <151> 2015 - 10 - 23 <150> EP15191179.9 <151> 2015 - 10 - 23 <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 9 <212> PRT <213> Homo sapiens <400> 1 Asp Thr His Phe Pro Ile Cys Ile Phe 1 5 <210> 2 <211> 21 <212> DNA <213> Artificial sequence (non) <400> 2 caggtttgtg agcatcctga a 21 <210> 3 <211> 19 <212> DNA <213> Artificial sequence (non) <400> 3 ggcggcgact aaggagagg 19 Description of the Drawings

[0049] Figure 1 : In the mouse macrophage cell line, the Fpn inhibitor triggers the ubiquitination and degradation of the expressed Fpn. The J774 cell line was incubated overnight with Fe(III)-NTA to induce Fpn expression. Subsequently, the cells were treated with hepcidin (hepcidin, 150 nM) or the Fpn inhibitor Example Compound No. 208 (210 nM), Example Compound No. 167 (1.5 μM), Example Compound No. 127 (120 nM), Example Compound No. 152 (40 nM) at approximately 10-fold the IC 50 concentration for 10 or 120 min, and then harvested and immunoprecipitated with the anti-Fpn antibody F308. Mock-treated cells were harvested after 120 min (control group).

[0050] Figure 2 : Hepcidin (IC 50 : 0.086 μM) and the representative iron efflux inhibition of Example Compound No. 127 (IC 50 : 0.080 μM).

[0051] Figure 3: Serum iron reduction induced by hepcidin and the membrane iron transporter inhibitor according to Example Compound 94 (Example Compound No. 94).

[0052] A Serum iron kinetics of naive C57BL / 6 mice at specified times after intraperitoneal (i.p.) injection of synthetic hepcidin (5 mg / kg). *-***- indicates a statistically significant reduction in serum iron compared to PBS-treated mice.

[0053] Serum iron levels in naïve C57BL / 6 mice treated with a specified amount of hepcidin (i.p.) or Example Compound 94 (Example Compound No. 94) (p.o.) for 3 h.

[0054] Figure 4 : Dose-dependent blockade of iron absorption by the Fpn inhibitor Example Compound No. 55 in anemic rats.

[0055] Figure 5 : Complete correction of elevated serum iron levels in b2m- / - mice treated with the ferroportin inhibitor Example Compound No. 40 / methylcellulose (A.) and Example Compound No. 94 / polyoxyl castor oil EL (B.) for 3 h. Embodiment

[0056] Description of the Invention

[0057] The inventors have unexpectedly found specific compounds having the general structural formula (A-I) as defined herein, which act as ferroportin inhibitors and can thus effectively inhibit iron transport. Therefore, they are particularly suitable for use as pharmaceuticals, especially for treating and / or preventing diseases caused by hepcidin deficiency, and diseases related to ineffective erythropoiesis or iron metabolism disorders leading to increased iron levels (such as especially iron overload states, such as especially thalassemia and hemochromatosis). Very particularly, the new compounds have been shown to be suitable for treating thalassemia and hemochromatosis. The new compounds are also suitable for treating diseases caused by pathological low hepcidin levels and for inhibiting iron transport.

[0058] Accordingly, the present invention relates to new compounds of general formula (A-I)

[0059]

[0060] wherein

[0061] Het-2 is an optionally substituted bicyclic heteroaryl of the following formula

[0062]

[0063] where * represents the binding site attached to A 2 and

[0064] R 4 represents 1, 2 or 3 optional substituents, which may independently be selected from the group consisting of

[0065] -halogen,

[0066] -cyano,

[0067] - Optionally substituted alkyl,

[0068] - Optionally substituted alkoxy, and

[0069] - Carboxyl;

[0070] X 1 is C, N, S or O;

[0071] X 2 is C or N;

[0072] X 3 is C, N, S or O; and

[0073] X 4 is C, N, or S

[0074] Provided that there are 1 to 3 heteroatoms X,

[0075] and wherein X 1 、X 3 and X 4 , when having the meaning of C or N, may carry further substituents, such as preferably hydrogen or substituents as defined above for substituting heteroaryl;

[0076] R 1 is selected from the group consisting of

[0077] - Hydrogen and

[0078] - Optionally substituted alkyl;

[0079] Cycl is selected from the group consisting of

[0080] - Substituted aryl and

[0081] - Substituted or unsubstituted heteroaryl;

[0082] Q is

[0083] - Hydrogen or

[0084] - C1-C4-alkyl, which may form a fused 5- or 6-membered ring with Cycl;

[0085] n is an integer from 0 or 1 to 8, preferably n is 0 or 1 to 4, preferably n is 0, 1, 2 or 3;

[0086] A 1 is

[0087] - Optionally substituted alkanediyl;

[0088] A 2 is

[0089] - Optionally substituted alkanediyl or

[0090] - a direct bond;

[0091] R 3 is

[0092] - hydrogen, or

[0093] - optionally substituted alkyl; or

[0094] A 1 and R 3 together with the nitrogen atom to which it is attached form an optionally substituted 4- to 6-membered mono- or bicyclic ring; or

[0095] R 3 and A 2 together with the nitrogen atom to which it is attached form an optionally substituted 4- to 7-membered ring;

[0096] and

[0097] Y 2 is C or N, where

[0098] - two Y 2 can be C or

[0099] - one Y 2 can be N and one Y 2 can be C;

[0100] or a pharmaceutically acceptable salt thereof.

[0101] Wherein throughout the present invention, the substituents mentioned above are defined as follows:

[0102] Optionally substituted alkyl preferably includes:

[0103] Straight-chain or branched-chain alkyl, which preferably contains 1 to 8, more preferably 1 to 6, particularly preferably 1 to 4, and even more preferably 1, 2 or 3 carbon atoms.

[0104] Optionally substituted alkyl further includes cycloalkyl containing preferably 3 to 8, more preferably 5 or 6 carbon atoms.

[0105] Examples of alkyl residues having 1 to 8 carbon atoms include: methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, sec-butyl, t-butyl, n-pentyl, i-pentyl, sec-pentyl, t-pentyl, 2-methylbutyl, n-hexyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 1-ethylbutyl, 2-ethylbutyl, 3-ethylbutyl, 1,1-dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl, 1-ethyl-1-methylpropyl, n-heptyl, 1-methylhexyl, 2-methylhexyl, 3-methylhexyl, 4-methylhexyl, 5-methylhexyl, 1-ethylpentyl, 2-ethylpentyl, 3-ethylpentyl, 4-ethylpentyl, 1,1-dimethylpentyl, 2,2-dimethylpentyl, 3,3-dimethylpentyl, 4,4-dimethylpentyl, 1-propylbutyl, n-octyl, 1-methylheptyl, 2-methylheptyl, 3-methylheptyl, 4-methylheptyl, 5-methylheptyl, 6-methylheptyl, 1-ethylhexyl, 2-ethylhexyl, 3-ethylhexyl, 4-ethylhexyl, 5-ethylhexyl, 1,1-dimethylhexyl, 2,2-dimethylhexyl, 3,3-dimethylhexyl, 4,4-dimethylhexyl, 5,5-dimethylhexyl, 1-propylpentyl, 2-propylpentyl, and so on. These having 1 to 6, preferably 1 to 4 carbon atoms, such as especially methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, sec-butyl, and t-butyl are preferred. C1-C3 alkyl groups, especially methyl, ethyl, and i-propyl are more preferred. Most preferred are C1 and C2 alkyl groups, such as methyl and ethyl.

[0106] Cycloalkyl residues having 3 to 8 carbon atoms preferably include: cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl are preferred. Cyclopentyl and cyclohexyl are especially preferred.

[0107] The substituents of the optionally substituted alkyl groups defined above preferably include 1 to 3 identical or different substituents, more preferably 1 or 2 identical or different substituents, which are selected from, for example, the group consisting of: optionally substituted cycloalkyl as defined above, hydroxy, oxo group (=O), carboxyl, halogen as defined below, cyano, alkoxy as defined below, optionally substituted acyl as defined below, optionally substituted acyloxy as defined below, optionally substituted aryl as defined below, optionally substituted heteroaryl as defined below, optionally substituted heterocyclic group as defined below, optionally substituted amino as defined below, optionally substituted alkyl, aryl or heterocyclic sulfonyl (R-SO2-), and also alkylene, such as especially methylene, forming, for example, a methylene-substituted ethyl group (CH3-(C=CH2)- or Wherein * represents a binding site). Preferably, 1 to 3 substituents of the alkyl group are selected from optionally substituted cycloalkyl, hydroxy, oxo group (=O), carboxyl, optionally substituted acyloxy, halogen, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted heterocyclic group, optionally substituted amino, optionally substituted alkyl, aryl or heterocyclic sulfonyl (R-SO2-), and alkylene, such as especially a methylene group. More preferably, 1 to 3 substituents of the alkyl group are selected from optionally substituted aryl, optionally substituted heteroaryl, and optionally substituted heterocyclic group and alkylene, such as especially a methylene group. More preferably, there is one substituent of the alkyl group. Most preferably, there is one substituent of the alkyl group, which is an optionally substituted aryl or an optionally substituted heteroaryl as defined below.

[0108] In the sense of the present invention, halogen includes fluorine, chlorine, bromine and iodine, preferably fluorine or chlorine, and most preferably fluorine.

[0109] Examples of straight-chain or branched-chain alkyl residues substituted with halogen and containing 1 to 8 carbon atoms include:

[0110] Fluoromethyl, difluoromethyl, trifluoromethyl, chloromethyl, dichloromethyl, trichloromethyl, bromomethyl, dibromomethyl, tribromomethyl, 1-fluoroethyl, 1-chloroethyl, 1-bromoethyl, 2-fluoroethyl, 2-chloroethyl, 2-bromoethyl, difluoroethyl, such as 1,2-difluoroethyl, 1,2-dichloroethyl, 1,2-dibromoethyl, 2,2-difluoroethyl, 2,2-dichloroethyl, 2,2-dibromoethyl, 2,2,2-trifluoroethyl, heptafluoroethyl, 1-fluoropropyl, 1-chloropropyl, 1-bromopropyl, 2-fluoropropyl, 2-chloropropyl, 2-bromopropyl, 3-fluoropropyl, 3-chloropropyl, 3-bromopropyl, 1,2-difluoropropyl, 1,2-dichloropropyl, 1,2-dibromopropyl, 2,3-difluoropropyl, 2,3-dichloropropyl, 2,3-dibromopropyl, 3,3,3-trifluoropropyl, 2,2,3,3,3-pentafluoropropyl, 2-fluorobutyl, 2-chlorobutyl, 2-bromobutyl, 4-fluorobutyl, 4-chlorobutyl, 4-bromobutyl, 4,4,4-trifluorobutyl, 2,2,3,3,4,4,4-heptafluorobutyl, perfluorobutyl, 2-fluoropentyl, 2-chloropentyl, 2-bromopentyl, 5-fluoropentyl, 5-chloropentyl, 5-bromopentyl, perfluoropentyl, 2-fluorohexyl, 2-chlorohexyl, 2-bromohexyl, 6-fluorohexyl, 6-chlorohexyl, 6-bromohexyl, perfluorohexyl, 2-fluoroheptyl, 2-chloroheptyl, 2-bromoheptyl, 7-fluoroheptyl, 7-chloroheptyl, 7-bromoheptyl, perfluoroheptyl and so on. Fluoroalkyl, difluoroalkyl and trifluoroalkyl are especially mentioned, and trifluoromethyl and mono- and di-fluoroethyl are preferred. Especially preferred are trifluoromethyl and 2,2-difluoroethyl.

[0111] Examples of cycloalkyl residues substituted by halogen and containing 3 to 8 carbon atoms include: 2-fluorocyclopentyl, 2-chlorocyclopentyl, 2-bromocyclopentyl, 3-fluorocyclopentyl, 3-chlorocyclopentyl, 3-bromocyclopentyl, 2-fluorocyclohexyl, 2-chlorocyclohexyl, 2-bromocyclohexyl, 3-fluorocyclohexyl, 3-chlorocyclohexyl, 3-bromocyclohexyl, 4-fluorocyclohexyl, 4-chlorocyclohexyl, 4-bromocyclohexyl, di-fluorocyclopentyl, di-chlorocyclopentyl, di-bromocyclopentyl, di-fluorocyclohexyl, di-chlorocyclohexyl, di-bromocyclohexyl, tri-fluorocyclohexyl, tri-chlorocyclohexyl, tri-bromocyclohexyl and the like.

[0112] Examples of alkyl residues substituted by a hydroxy group include the alkyl residues mentioned above, which contain 1 to 3 hydroxy residues. For example, by way of illustration, hydroxymethyl, 2-hydroxyethyl, 3-hydroxypropyl and the like. Hydroxymethyl is preferred.

[0113] Examples of alkyl residues substituted by an oxo group include the alkyl residues mentioned above, in which at least one carbon atom is substituted by an oxo group to form a carbonyl group [–(C=O)-] or an acyl group [alkyl-(C=O)-)] in the alkyl chain, such as C1 to C6 acyl groups, such as formyl, acetyl, propionyl, butyryl, isobutyryl, valeryl, isovaleryl, pivaloyl, hexanoyl and the like. Preferred is the oxo substitution of the alkyl residue in the form of a carbonyl group [–(C=O)-] or an acetyl group, such as [–(C=O)-CH3] or [–(C=O)-CH2–].

[0114] Examples of alkyl residues substituted by an alkoxy group include the alkyl residues mentioned above, which contain 1 to 3 alkoxy residues as defined below. For example, by way of illustration, methoxymethyl, ethoxymethyl, 2-methoxyethylene and the like.

[0115] Examples of alkyl residues substituted by an acyl group include the alkyl residues mentioned above, which contain 1 to 3 acyl residues as defined below.

[0116] Examples of alkyl residues substituted by an acyloxy group include the alkyl residues mentioned above, which contain 1 to 3, preferably 1 acyloxy residue [–O-(C=O)-].

[0117] Examples of alkyl substituted by a cycloalkyl include the alkyl residues mentioned above, which contain 1 to 3, preferably 1 (optionally substituted) cycloalkyl, such as, by way of illustration: cyclopropylmethyl, cyclobutylmethyl, cyclopentylmethyl, cyclohexylmethyl, 2-cyclopropylethyl, 2-cyclobutylethyl, 2-cyclopentylethyl, 2-cyclohexylethyl, 2- or 3-cyclopropylpropyl, 2- or 3-cyclobutylpropyl, 2- or 3-cyclopentylpropyl, 2- or 3-cyclohexylpropyl and the like. Preferably cyclopropylmethyl and cyclohexylmethyl.

[0118] Examples of aryl-substituted alkyls include the alkyl residues mentioned above, which contain 1 to 3, preferably 1 (optionally substituted) aryl, as defined below. For example, phenylmethyl, 1- or 2-phenylethyl, 2- or 3-phenylpropyl, etc. Phenylmethyl, 1-phenylethyl, 2-phenylethyl, and 2-phenylpropyl are preferred. Particularly preferred is the alkyl as defined above, which is substituted by a substituted aryl as defined below, especially by a phenyl substituted with 1 to 3, preferably 1 or 2 identical or different substituents, preferably selected from halogen, for example preferably F and Cl, cyano, optionally substituted alkyl, for example preferably methyl, ethyl, halogen-substituted alkyl, for example trifluoromethyl, optionally substituted alkoxy, for example methoxy, ethoxy, halogen-substituted alkoxy, for example difluoromethoxy, trifluoromethoxy, optionally substituted amino, for example amino (NH2-), or mono- or di-alkylamino, for example preferably dimethylamino, optionally substituted heterocyclic group, for example pyrrolidinyl, alkyl-substituted piperazinyl, or morpholinyl, or optionally substituted heterocyclic sulfonyl, for example N-morpholinyl-sulfonyl, especially forming an alkyl group according to the following formula, which is substituted by a substituted aryl

[0119]

[0120] It is particularly preferably used for R 1 and / or R 2 .

[0121] Examples of heterocyclic-substituted alkyls include the alkyl residues mentioned above, which contain 1 to 3, preferably 1 (optionally substituted) heterocyclic group, as defined below, which may be substituted by 1 to 3, preferably by 1 substituent. Preferably, the heterocyclic group as an alkyl substituent is, for example, morpholinyl, piperazinyl, piperidinyl, etc. As defined above, the heterocyclic group may be substituted and the preferred substituents are optionally substituted alkyl, preferably methyl or ethyl or trifluoromethyl. Particularly preferred are piperidinyl and methyl-substituted morpholinyl.

[0122] Examples of heteroaryl-substituted alkyls include the alkyl residues mentioned above which contain 1 to 3, preferably 1 (optionally substituted) heteroaryl as defined below. For example, by way of illustration, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, pyrazolyl, imidazolyl, benzimidazolyl, thienyl, or oxazolyl, such as pyridin-2-yl-methyl, pyridin-3-yl-methyl, pyridin-4-yl-methyl, 2-pyridin-2-yl-ethyl, 2-pyridin-1-yl-ethyl, 2-pyridin-3-yl-ethyl, pyridazin-3-yl-methyl, pyrimidin-2-yl-methyl, pyrimidin-4-yl-methyl, pyrazin-2-yl-methyl, pyrazol-3-yl-methyl, pyrazol-4-yl-methyl, pyrazol-5-yl-methyl, imidazol-2-yl-methyl, imidazol-5-yl-methyl, benzimidazol-2-yl-methyl, thien-2-yl-methyl, thien-3-yl-methyl, 1,3-oxazol-2-yl-methyl.

[0123] Preferred are alkyls substituted by: optionally substituted pyridazinyl, such as especially pyridazin-3-yl-methyl and pyridazin-3-yl-ethyl, optionally substituted pyridyl, such as especially optionally substituted pyridin-2-yl-methyl, pyridin-3-yl-methyl, pyridin-4-yl-methyl, 2-pyridin-2-yl-ethyl, 2-pyridin-1-yl-ethyl, 2-pyridin-3-yl-ethyl, and particularly optionally substituted pyridin-2-yl-methyl and 2-pyridin-2-yl-ethyl, optionally substituted pyrazol-3-yl-methyl, pyrazol-4-yl-methyl, pyrazol-5-yl-methyl, pyrazol-3-yl-ethyl, pyrazol-4-yl-ethyl, pyrazol-5-yl-ethyl. Particularly preferred are substituted pyridylalkyls, such as substituted pyridylmethyl or substituted pyridylethyl, wherein 1, 2 or 3 substituents are selected from halogen (such as fluorine), C1-C3-alkyl (such as methyl), and trifluoromethyl. Particularly preferred are fluorine-substituted pyridylalkyls, such as fluorine-substituted pyridylmethyl or fluorine-substituted pyridylethyl. Most preferred are fluorine-substituted pyridylmethyls according to the following formula

[0124]

[0125] Examples of heteroaryl-substituted alkyls further include especially cycloalkyl residues as defined above which are bound to the heteroaryl substituent by forming a fused ring with the heteroaryl substituent as defined above. Preferably, the fused cycloalkyl residue is cyclopentyl or cyclohexyl. Furthermore, preferably, the fused heteroaryl substituent is pyridyl, forming, for example, a fused ring according to the following formula, such as cyclopentadieno-pyridyl and cyclohexyl-pyridyl,

[0126] which are particularly preferably used for R 2 or the group Cycl-[CQ] n, where Q is a C1-C4-alkyl group which forms a fused 5- or 6-membered ring with Cycl.

[0127] In each case, the heterocyclic substituents of the alkyl residues as defined in the present case can be substituted by 1 to 3, preferably 1 or 2, identical or different substituents, which are preferably selected from halogen, such as preferably F and Cl, cyano, optionally substituted alkyl, such as preferably methyl, ethyl, halogen-substituted alkyl, such as trifluoromethyl, and hydroxy-substituted alkyl, such as hydroxymethyl, optionally substituted alkoxy, such as preferably methoxy and ethoxy, oxo group (=O), heterocyclic groups as defined below, such as N-morpholinyl, aminocarbonyl, optionally substituted amino, such as preferably amino (NH2-) or mono- or di-alkylamino, such as preferably dimethylamino.

[0128] Examples of amino-substituted alkyl residues include the alkyl residues mentioned above which contain 1 to 3, preferably 1 (optionally substituted) amino group as defined below, for example, by way of example, aminoalkyl (NH2-alkyl) or mono- or di-alkylamino-alkyl, such as aminomethyl, 2-aminoethyl, 2- or 3-aminopropyl, methylaminomethyl, methylaminoethyl, methylaminopropyl, 2-ethylaminomethyl, 3-ethylaminomethyl, 2-ethylaminoethyl, 3-ethylaminoethyl and the like or may be a group substituted by an optionally alkoxycarbonylamino group (such as a group according to the following formula),

[0129] wherein R is defined as an alkyl substituent as defined above, preferably phenyl, and this group is particularly preferably used for R 3 .

[0130] Throughout the present invention, optionally substituted aryl preferably includes:

[0131] Aromatic hydrocarbon residues containing 6 to 14 carbon atoms (excluding the carbon atoms of possible substituents), which can be monocyclic or bicyclic, including, by way of example: phenyl, naphthyl, phenanthryl and anthryl, which can be optionally substituted by preferably 1 to 3 identical or different substituents (such as represented by R 6 ), and the 1 to 3 identical or different substituents are selected from hydroxy, halogen as defined above, cyano, optionally substituted amino as defined below, optionally substituted alkyl as defined above, optionally substituted acyl as defined below, and optionally substituted alkoxy as defined below, optionally substituted aryloxy as defined below, optionally substituted heterocyclic oxy as defined below, optionally substituted aryl as defined in the present case, optionally substituted heterocyclic as defined below. Optionally substituted phenyl is preferred, for example unsubstituted phenyl and phenyl substituted by 1 to 3, more preferably 1 or 2 substituents R 6 , and R 6may be the same or different. The 1 to 3 phenyl substituents (such as represented by R 6 ) are especially selected from the group consisting of: a heterocyclic group as defined below, a halogen as defined above (for example especially F), an optionally substituted amino group as defined below (for example especially (-NH2) or mono- or dialkylamino (dimethylamino is preferred)), a cyano group, an optionally substituted alkoxy group as defined below (for example especially difluoromethoxy and trifluoromethoxy), and an optionally substituted sulfonyl group (which may form especially the following groups)

[0132] wherein, * represents the bonding site of the substituted phenyl substituent. Preferably, it is a halogen-substituted phenyl, an alkoxy-substituted phenyl, and a hydroxy-substituted phenyl. The aforementioned substituents of the phenyl are particularly preferably used for the "Cycl" group in the formula defined in the present application, and the substituted aryl means a substituted phenyl.

[0133] Examples of alkyl-substituted aryl preferably include: the aryl as described above, which is substituted by a straight-chain or branched-chain alkyl containing 1 to 8, preferably 1 to 4 carbon atoms, as described above. Toluoyl is preferably an alkyl aryl.

[0134] Examples of hydroxy-substituted aryl preferably include: the aryl as described above, which is substituted by 1 to 3 hydroxy residues, for example, for example, 2-hydroxyphenyl, 3-hydroxyphenyl, 4-hydroxyphenyl, 2,4-dihydroxyphenyl, 2,5-dihydroxyphenyl, 2,6-dihydroxyphenyl, 3,5-dihydroxyphenyl, 3,6-dihydroxyphenyl, 2,4,6-trihydroxyphenyl, and the like.

[0135] Examples of halogen-substituted aryl preferably include: aryl, as described above, which is substituted by 1 to 3 halogen atoms, for example, for example, 2-chloro- or fluorophenyl, 3-chloro- or fluorophenyl, 4-chloro- or fluorophenyl, 2,4-bis-(chloro- and / or fluoro)phenyl, 2,5-bis-(chloro- and / or fluoro)phenyl, 2,6-bis-(chloro- and / or fluoro)phenyl, 3,5-bis-(chloro- and / or fluoro)phenyl, 3,6-bis-(chloro- and / or fluoro)phenyl, 2,4,6-tris-(chloro- and / or fluoro)phenyl, and the like.

[0136] Examples of alkoxy-substituted aryl preferably include: the aryl as described above, which is substituted by 1 to 3 alkoxy residues, as described above, for example preferably 2-methoxyphenyl, 3-methoxyphenyl, 4-methoxyphenyl, 2-ethoxyphenyl, 3-ethoxyphenyl, 4-ethoxyphenyl, 2,4-dimethoxyphenyl, and the like, as well as difluoromethoxyphenyl and trifluoromethoxyphenyl.

[0137] Throughout the present invention, the optionally substituted heterocyclic group preferably includes:

[0138] A saturated or unsaturated mono- or bicyclic 4- to 8-membered heterocyclic residue containing 1 to 3, preferably 1 to 2, identical or different heteroatoms selected from N, O, and S, and which may optionally be substituted by preferably 1 to 3 substituents, where reference may be made to the definition of the possible substituents of the optionally substituted heterocyclic group. Optionally substituted 4-, 5-, and 6-membered saturated or unsaturated, mono- or bicyclic rings substituted by a heterocyclic residue are preferred, examples including acridinyl, pyrrolidinyl, tetrahydrofuranyl, tetrahydrothienyl, piperidinyl, piperazinyl, tetrahydropyranyl, tetrahydrothiopyranyl, morpholinyl, etc., such as acridin-1-yl, acridin-2-yl, acridin-3-yl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl, tetrahydro-thiophen-2-yl, tetrahydro-thiophen-3-yl, pyrrolidin-1-yl, pyrrolidin-2-yl, pyrrolidin-3-yl, morpholin-1-yl, morpholin-2-yl, morpholin-3-yl, piperidin-1-yl, piperidin-2-yl, piperidin-3-yl, piperidin-4-yl, piperazin-1-yl, piperazin-2-yl, tetrahydropyran-2-yl, tetrahydropyran-3-yl, tetrahydropyran-4-yl, etc., which may optionally be condensed with an aromatic ring. Particularly preferred are acridinyl, pyrrolidinyl, piperidinyl, and morpholinyl residues. Particularly preferably, the following heterocyclic residues, which may be substituted as defined above:

[0139] (wherein X is N, O, or S, preferably S), which is particularly preferably used for A 1 , and Particularly preferably used for R 1 and / or R 2 , and It is particularly preferably used as a substituent for an aryl group.

[0140] Preferred substituents of the heterocyclic group residue include alkyl groups, such as preferably methyl and ethyl, hydroxy groups, and oxo groups (=O).

[0141] Throughout the present invention, the optionally substituted heteroaryl includes:

[0142] A heteroaromatic hydrocarbon residue having 4 to 9 ring carbon atoms, which preferably further contains 1 to 3 identical or different heteroatoms from the series of S, O, N in the ring, and thus preferably forms a 5- to 12-membered heteroaromatic residue, which may preferably be monocyclic, but may also be bicyclic. Preferred aromatic heterocyclic residues include: azaphenyl (pyridyl), pyridyl-N-oxide, pyridazinyl, pyrimidinyl, pyrazinyl, thienyl (phenylthio), furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, thiazolyl, oxazolyl or isoxazolyl, indolizinyl, indolyl, benzo[b]thienyl, benzo[b]furyl, indazolyl, quinolinyl, isoquinolinyl, naphthyridinyl, quinazolinyl, quinoxalinyl. 5- or 6-membered aromatic heterocycles are preferred, such as from the 5-membered heteroaryl group (for example, thiazolyl, such as thiazol-2-yl, 2-thiazol-2-yl, 2-thiazol-4-yl, thienyl (phenylthio), such as thien-3-yl, pyrazolyl, such as 1-pyrazol-4-yl, 3-pyrazol-5-yl, imidazolyl, such as imidazol-2-yl, 2-imidazol-4-yl, 1-imidazol-4-yl, triazolyl, such as 1-triazol-3-yl, 1-triazol-4-yl, such as 1,2,4-triazol-3-yl or 1,2, and from the 6-membered heteroaryl group (for example, azaphenyl (pyridyl), such as pyridin-1-yl, pyridin-2-yl) pyridin-3-yl, pyridin-4-yl, 2-pyridin-4-yl, 2-pyridin-6-yl, 3-pyridin-5-yl (pyridin-1-yl, pyridin-2-yl, pyridin-3-yl, pyridin-4-yl, 2-pyridin-4-yl, 2-pyridin-6-yl, 3-pyridin-5-yl, pyrimidin-2-yl, pyrimidin-4-yl, pyrimidin-5-yl), and from the group of bicyclic heteroaromatic residues, especially benzimidazolyl, such as benzimidazol-2-yl, benzimidazol-4-yl, benzimidazol-5-yl, and benzimidazolyl-pyridyl according to the following formula

[0143] or benzoxazol-2-yl according to the following formula or benzimidazole fused to a heterocyclic residue as defined above.

[0144] The foregoing heteroaryl may have one or more, preferably 1 to 3, more preferably 1 or 2 identical or different substituents, which are especially selected from halogen, such as preferably F and Cl, cyano, optionally substituted alkyl as defined above (such as preferably methyl, ethyl, n-propyl, i-propyl), halogen-substituted alkyl (such as difluoromethyl or trifluoromethyl), hydroxy-substituted alkyl (such as hydroxymethyl), aminocarbonyl-substituted alkyl (such as aminocarbonylmethyl), carboxy-substituted alkyl (such as carboxymethyl), alkenyl (such as propenyl), optionally substituted alkoxy (such as preferably methoxy and ethoxy), hydroxy (-OH), oxo group (=O), carboxyl [-(C=O)-OH], heterocyclic group as defined above (such as N-morpholinyl), aminocarbonyl (such as NH2-(C=O)-), optionally substituted amino (such as preferably amino (NH2-) or mono- or di-alkylamino, such as preferably dimethylamino).

[0145] In particular, examples of alkyl-substituted heteroaryl preferably include: heteroaryl substituted by straight-chain or branched-chain as defined above, optionally substituted alkyl containing 1 to 8, preferably 1 to 4 carbon atoms as defined above, such as especially methylimidazolyl (such as especially N-methylimidazolyl), methylbenzimidazolyl (such as especially N-methylbenzimidazolyl, 5-methylbenzimidazolyl, 4-trifluoromethylbenzimidazolyl, 5-trifluoromethylbenzimidazolyl, N-aminocarbonylmethylbenzimidazolyl), N-carboxymethylaminocarbonyl, N-methylpyrazolyl, 1(N),5-dimethylpyrazolyl, methylpyridyl (such as 2-methylpyridin-3-yl, 2-methylpyridin-4-yl, 3-methylpyridin-2-yl, 3-methylpyridin-3-yl, 3-methylpyridin-4-yl, 4-methylpyridin-2-yl, 5-methylpyridin-2-yl, 6-methylpyridin-2-yl, etc.), dimethylpyridyl (such as 3,5-dimethylpyridin-2-yl, 4,6-dimethylpyridin-3-yl), trifluoromethylpyridyl (especially 3- or 4-trifluoromethylpyridin-2-yl, 6-trifluoromethylpyridin-3-yl), 3-hydroxymethylpyridin-2-yl, 5-methylpyrimidin-2-yl, etc.

[0146] Examples of halogen-substituted heteroaryls preferably include: the above heteroaryls substituted by 1 to 3, preferably 1 or 2 halogen atoms (e.g., preferably by F and / or Cl), especially including fluoropyridyls such as 3-fluoro-pyridin-2-yl, 4-fluoro-pyridin-2-yl, 5-fluoro-pyridin-2-yl, 6-fluoro-pyridin-2-yl, 3-chloro-pyridin-2-yl, 4-chloro-pyridin-2-yl, 5-chloro-pyridin-2-yl, 6-chloro-pyridin-2-yl, 2-fluoro-pyridin-3-yl, 4-fluoro-pyridin-3-yl, 5-fluoro-pyridin-3-yl, 6-fluoro-pyridin-3-yl, 2-chloro-pyridin-3-yl, 4-chloro-pyridin-3-yl, 5-chloro-pyridin-3-yl, 6-chloro-pyridin-3-yl, 2-fluoro-pyridin-4-yl, 3-fluoro-pyridin-4-yl, 5-fluoro-pyridin-4-yl, 6-fluoro-pyridin-4-yl, 2-chloro-pyridin-4-yl, 3-chloro-pyridin-4-yl, 5-chloro-pyridin-4-yl, 6-chloro-pyridin-4-yl, etc., di-fluoropyridyls such as 3,5-di-fluoropyridin-2-yl, fluoro-chloropyridyls such as 3-chloro-5-fluoro-pyridin-2-yl, etc.

[0147] Examples of halogen- and alkyl-substituted heteroaryls preferably include: heteroaryls as defined above, substituted by 1 to 3 halogen atoms, e.g., preferably by F and / or Cl, and 1 to 3 straight-chain or branched, optionally substituted alkyl residues as defined above, such as especially 3-fluoro-6-methylpyridin-2-yl, 3-chloro-5-trifluoromethylpyridin-2-yl.

[0148] Further preferred examples of substituted heteroaryls include:

[0149] Methoxypyridyls (e.g., 3-, 4-, 5- or 6-methoxypyridin-2-yl, 2-, 4-, 5- or 6-methoxypyridin-3-yl, 2-, 3-, 5- or 6-methoxypyridin-4-yl, etc.), hydroxypyridyls (e.g., 3-, 4-, 5- or 6-hydroxypyridin-2-yl, 2-, 4-, 5- or 6-hydroxypyridin-3-yl, 2-, 3-, 5- or 6-hydroxypyridin-4-yl, etc.), oxo-pyridyls (e.g., 6-oxo-1,6-dihydropyridin-2-yl, 2-oxo-1,2-dihydropyridin-3-yl, etc.), aminopyridyls (e.g., 6-dimethylaminopyridin-3-yl), aminocarbonylpyridyls (e.g., 6-aminocarbonylpyridin-3-yl), cyanopyridyls (e.g., 3-, 4-, 5- or 6-cyanopyridin-2-yl, 2-, 4-, 5- or 6-cyanopyridin-3-yl, 2-, 3-, 5- or 6-cyanopyridin-4-yl, etc.), and 2-morpholin-4-yl-pyridin-4-yl.

[0150] Regarding R 4For the meaning of 1 to 3, preferably 1 or 2, identical or different substituents of the bicyclic heteroaryl Het-2 of any one of the formulas defined in the present case, the heteroaryl substituent is preferably selected from halogen (e.g., preferably F and Cl), cyano, optionally substituted alkyl as defined above (e.g., preferably methyl, ethyl, n-propyl, i-propyl), halogen-substituted alkyl (e.g., difluoromethyl or trifluoromethyl), aminocarbonyl-substituted alkyl (e.g., aminocarbonylmethyl), carboxy-substituted alkyl (e.g., carboxymethyl), optionally substituted alkoxy (e.g., preferably methoxy and ethoxy), and carboxy [-(C=O)-OH]. Best, R 4 represents 1 or 2 identical or different substituents selected from F, Cl, cyano, optionally substituted alkyl (e.g., methyl and trifluoromethyl), aminocarbonyl-substituted alkyl (e.g., aminocarbonylmethyl), carboxy-substituted alkyl (e.g., carboxymethyl), optionally substituted alkoxy (e.g., methoxy and carboxy [-(C=O)-OH]).

[0151] Regarding R 5 For the meaning of 1 to 4, preferably 1 to 3, more preferably 1 or 2, identical or different substituents of the heteroaryl Cycl of any one of the formulas defined in the present case, the heteroaryl substituent is preferably selected from halogen (e.g., preferably F and Cl), cyano, optionally substituted alkyl as defined above (e.g., preferably methyl, ethyl, n-propyl, i-propyl), halogen-substituted alkyl (e.g., difluoromethyl or trifluoromethyl), hydroxy-substituted alkyl (e.g., hydroxymethyl), optionally substituted alkoxy (e.g., preferably methoxy and ethoxy), oxo group (=O), heterocyclic group as defined above (e.g., N-morpholinyl), aminocarbonyl (e.g., NH2-(C=O)-), optionally substituted amino (e.g., preferably amino (NH2-), or mono- or di-alkylamino (e.g., preferably dimethylamino)). Best, R 5 represents 1 or 2 identical or different substituents (selected from F, Cl, cyano, optionally substituted alkyl (e.g., methyl, trifluoromethyl, and hydroxymethyl), optionally substituted alkoxy (e.g., methoxy), oxo group (=O)) to form, for example, an oxo-substituted heteroaryl having the following formula

[0152] heterocyclic group (e.g., N-morpholinyl), aminocarbonyl (e.g., NH2-(C=O)-), optionally substituted amino (e.g., di-alkylamino, e.g., dimethylamino).

[0153] The optionally substituted acyl groups herein and hereinafter include: formyl (-CH(=O)), optionally substituted aliphatic acyl groups (alkanoyl = alkyl-CO, where for alkyl, reference may be made to the aforementioned definition of optionally substituted alkyl), optionally substituted aromatic acyl groups (aroyl = aryl-CO-, where for aryl, reference may be made to the aforementioned definition of optionally substituted aryl), optionally substituted heteroaromatic acyl groups (heteroaroyl = heteroaryl-CO-, where for heteroaryl, reference may be made to the aforementioned definition of optionally substituted heteroaryl), or heterocyclic acyl groups (heterocyclic acyl = heterocyclic-CO-, where for heterocyclic, reference may be made to the aforementioned definition of optionally substituted heterocyclic). Aliphatic acyl group = alkanoyl = alkyl-CO- is preferred.

[0154] The optionally substituted amino groups according to the present invention preferably include: amino (-NH2), optionally substituted mono- or dialkylamino (alkyl-NH-, (alkyl)2N-), where for "alkyl", reference may be made to the above definition of optionally substituted alkyl. Further included are optionally substituted mono- or diarylamino, mono- or diheteroarylamino, and mono- or diheterocyclicamino or mixed optionally substituted alkylarylamino, alkylheteroarylamino, and alkylheterocyclicamino, where reference may be made to the above definitions of optionally substituted alkyl, aryl, heteroaryl, and heterocyclic. According to the present invention, the amino group further includes the -NH- group.

[0155] The optionally substituted amino group is preferably an optionally substituted mono- or dialkylamino (alkyl-NH-, (alkyl)2N-), especially containing 1 to 8, preferably 1 to 6, more preferably 1 to 3 carbon atoms, as described above. The most preferred optionally substituted amino groups are mono- or dimethylamino and mono- or diethylamino. Most preferably, it is amino (-NH2) or (-NH-) and dimethylamino.

[0156] Throughout the present invention, the optionally substituted alkanediyl is preferably a divalent straight-chain or branched-chain alkanediyl having 1 to 7, preferably 1 to 6, more preferably 1 to 4 carbon atoms, which may optionally carry 1 to 3, preferably 1 or 2 substituents (selected from the group consisting of: halogen, hydroxy, oxo group (forming a carbonyl or acyl), and amino), as defined above. The following preferred examples may be mentioned: methylene, ethane-1,2-diyl, ethane-1,1-diyl, propane-1,3-diyl, propane-1,1-diyl, propane-1,2-diyl, propane-2,2-diyl, butane-1,4-diyl, butane-1,2-diyl, butane-1,3-diyl, butane-2,3-diyl, butane-1,1-diyl, butane-2,2-diyl, butane-3,3-diyl, pentane-1,5-diyl, and so on. Particularly preferably, it is methylene, ethane-1,2-diyl, ethane-1,1-diyl, propane-1,3-diyl, propane-2,2-diyl, and butane-2,2-diyl. Most preferably, it is methylene and ethane-1,2-diyl.

[0157] Preferred substituted alkanediyl groups are hydroxy-substituted alkanediyl groups (e.g., hydroxy-substituted ethanediyl), oxo-substituted alkanediyl groups (e.g., oxo-substituted methylene or ethanediyl) (which form a carbonyl or acyl group (acetyl)), halogen-substituted alkanediyl groups (e.g., alkanediyl groups substituted by one or two halogen atoms selected from F and Cl, preferably 2,2-difluoro-ethanediyl), or alkanediyl groups substituted by an oxo group and an amino group (forming an aminocarbonyl group, e.g., preferably the group [–(C=O)-NH-]).

[0158] According to the present invention, the substituents R 1 and R 2 or the single group -[CQ] n -, where Q is a C1-C4-alkyl group, may together with the nitrogen atom to which they are bonded form an optionally substituted 3- to 6-membered ring, which may optionally contain further heteroatoms. Among them, R 1 and R 2 (or the group -[CQ] n -, where Q is a C1-C4-alkyl group) may preferably together with the nitrogen atom to which they are bonded form a 5- or 6-membered ring, which may contain further heteroatoms, preferably one further heteroatom selected from N and O. Among them, most preferably, R 1 and R 2 (or the group -[CQ] n -, where Q is a C1-C4-alkyl group) together with the further nitrogen atom to which they are bonded form a 6-membered ring without further heteroatoms (forming an N-piperidyl ring) or a 6-membered ring containing one further heteroatom O (forming an N-morpholinyl ring). In particular, such an N-piperidyl ring may be substituted by an aryl or heteroaryl group as defined above, preferably by a phenyl or piperidyl group, thus forming a bicyclic ring according to the following formula

[0159]

[0160] According to the present invention, it is further possible that A 1 (having the meaning of a straight-chain or branched alkanediyl group as defined above) and R 3 (having the meaning of an optionally substituted alkyl group as defined above), together with the nitrogen atom to which they are bonded, form an optionally substituted 4- to 6-membered aliphatic mono- or bicyclic ring, which may be substituted by 1 to 3 substituents as defined above. For example, by way of example, according to the following formula

[0161] and (where X is N, O or S, preferably S), where is preferred.

[0162] In the context of the present invention, it is further possible that R 3 and A 2 together with the nitrogen atom to which they are bonded form an optionally substituted 4- to 7-membered ring, wherein the optional substituents are preferably selected from heteroaryl and oxo groups as defined above. The heteroaryl substituent may then further form a fused ring containing a 4- to 7-membered ring formed by R 3 and A 2 together with the nitrogen atom to which they are bonded. Examples include residues according to the following formulas:

[0163]

[0164] On the other hand, the present invention relates to new compounds of general formula (I)

[0165]

[0166] wherein

[0167] R 1 and R 2 are the same or different and independently selected from the group consisting of

[0168] - hydrogen,

[0169] - optionally substituted alkyl,

[0170] - optionally substituted aryl,

[0171] - optionally substituted heteroaryl,

[0172] - optionally substituted heterocyclic group, or

[0173] - R 1 and R 2 together with the nitrogen atom to which they are bonded form

[0174] an optionally substituted 3- to 6-membered ring which may optionally contain further heteroatoms;

[0175] X 1 is O or S,

[0176] Y 1 is hydrogen, optionally substituted alkyl or halogen,

[0177] preferably hydrogen or C1-C3-alkyl, preferably hydrogen or methyl;

[0178] A 1 is optionally substituted alkanediyl;

[0179] A 2 is

[0180] - optionally substituted alkanediyl,

[0181] - a direct bond, or

[0182] - sulfonyl (-SO2-);

[0183] R 3 is

[0184] - hydrogen, or

[0185] - optionally substituted alkyl; or

[0186] A 1 and R 3 together with the nitrogen atom to which it is attached form an optionally substituted 4- to 6-membered mono- or bicyclic ring; or

[0187] R 3 and A 2 together with the nitrogen atom to which they are attached form an optionally substituted 4- to 7-membered ring; and

[0188] Ar is

[0189] - optionally substituted aryl,

[0190] - optionally substituted monocyclic heteroaryl, or

[0191] - optionally substituted bicyclic heteroaryl, which may be fused to the ring formed by R 3 and A 2 together with the nitrogen atom to which they are attached;

[0192] or a pharmaceutically acceptable salt thereof.

[0193] Particularly preferred is that the substituents in the above formula (I) have the following meanings:

[0194] R 1 and R 2 are the same or different and independently selected from the group consisting of

[0195] - hydrogen,

[0196] - optionally substituted alkyl, or

[0197] - R 1 and R 2 together with the nitrogen atom to which they are attached form an optionally substituted 3- to 6-membered ring which may optionally contain further heteroatoms;

[0198] X 1 is O or S;

[0199] Y 1 is hydrogen or C1-C3-alkyl, for example preferably hydrogen or methyl;

[0200] A 1 is optionally substituted alkanediyl;

[0201] A 2 is

[0202] - optionally substituted alkanediyl, or

[0203] - a direct bond;

[0204] R 3 is

[0205] - hydrogen, or

[0206] - C1-C3-alkyl; or

[0207] A 1 and R 3 together with the nitrogen atom to which they are attached form an optionally substituted 4-membered monocyclic ring; or

[0208] R 3 and A 2 together with the nitrogen atom to which they are attached form an optionally substituted 4- to 7-membered ring; and

[0209] Ar is an optionally substituted bicyclic heteroaryl.

[0210] Preferred embodiments:

[0211] Embodiment A-2:

[0212] A further preferred embodiment of the present invention relates to a new compound according to formula (A-II)

[0213]

[0214] wherein Cycl, Q, R 1 , X 1 , X 2 , X 3 , X 4 , R 3 , A 1 , A 2 , R 4 and n have the meanings defined in formula (A-I) above; or a pharmaceutically acceptable salt thereof.

[0215] Embodiment A-3:

[0216] A further preferred embodiment of the present invention relates to new compounds according to formulas (A-I) and (A-II) as defined above, wherein Cycl is a substituted or unsubstituted heteroaryl as defined above. Among them, the heteroaryl may be substituted by 1 to 4, preferably 1 to 3, more preferably 1 or 2 substituents R 5is replaced, as defined above and as defined in the context below, by any one of the compounds according to formulas (A-IIIa), (A-IIIb), (A-IVa), (A-IVb), (A-IVc) and (A-IVd).

[0217] Embodiments A-3a and A-3b:

[0218] A further preferred embodiment of the present invention relates to new compounds defined according to formulas (A-I) and (A-II) above, wherein Cycl is a substituted or unsubstituted heteroaryl selected from substituted or unsubstituted pyridyl groups, to form a compound according to formula (A-IIIa) or (A-IIIb), respectively:

[0219]

[0220] wherein Q, R 1 , X 1 , X 2 , X 3 , X 4 , R 3 , A 1 , A 2 , Y 2 , R 4 and n have the meanings defined in formula (A-I) or (A-II) above, and wherein

[0221] R 5 represents 1 to 4, preferably 1 to 3, more preferably 1 or 2 optional substituents independently selected from the group consisting of

[0222] -halogen, preferably F and Cl,

[0223] -optionally substituted alkyl, preferably methyl, trifluoromethyl, hydroxymethyl,

[0224] -hydroxy,

[0225] -alkoxy, preferably methoxy,

[0226] -oxo group (=O) to form a substituted pyridyl group of the following formula

[0227]

[0228] -amino, such as –NH2, mono- or dialkylamino, preferably dialkylamino

[0229] -aminocarbonyl, preferably NH2-(C=O)-,

[0230] -cyano, and

[0231] -heterocyclic group, preferably morpholinyl,

[0232] or a pharmaceutically acceptable salt thereof.

[0233] Embodiments A-4a and A-4b:

[0234] Further preferred embodiments of the present invention relate to new compounds according to formulae (A-IVa) and (A-IVb):

[0235]

[0236]

[0237] wherein Q, R 1 , X 1 , X 2 , X 3 , X 4 , R 3 , A 1 , A 2 , Y 2 , R 4 and n have the meanings as defined in formulae (A-I), (A-II) or (A-IIIa) and (A-IIIb) above and wherein

[0238] R 5 has the meanings as defined in formulae (A-IIIa) and (A-IIIb) respectively above;

[0239] or a pharmaceutically acceptable salt thereof.

[0240] Particularly preferably, in any one of formulae (A-IIIa), (A-IIIb), (A-IVa) or (A-IVb), R 5 represents 1 to 3, more preferably 1 or 2 substituents, even more preferably 1 substituent, which may independently have the meanings as defined above.

[0241] Embodiments A-4c and A-4d:

[0242] Further preferred embodiments of the present invention relate to new compounds according to formulae (A-IIIa), (A-IIIb), (A-IVa) or (A-IVb), wherein R 5 represents 1 substituent to form compounds according to formulae (A-IVc) and (A-IVd) respectively:

[0243]

[0244] wherein Q, R 1 , X 1 , X 2 , X 3 , X4 , R 3 , A 1 , A 2 , Y 2 , R 4 and n have the meanings defined in formulas (A-I), (A-II), (A-IIIa), (A-IIIb), (A-IVa) and (A-IVb) above and wherein

[0245] R 5 has the meanings defined in formulas (A-IIIa), (A-IIIb), (A-IVa) and (A-IVb) above respectively;

[0246] or a pharmaceutically acceptable salt thereof.

[0247] Preferably, in any of the foregoing embodiments, the one or more substituents R 5 are independently selected from the group consisting of

[0248] - halogen, preferably F and Cl,

[0249] - optionally substituted alkyl, preferably methyl, trifluoromethyl, hydroxymethyl,

[0250] - hydroxy, and

[0251] - alkoxy, preferably methoxy.

[0252] More preferably, in any of the foregoing embodiments, the one or more substituents R 5 are independently selected from the group consisting of

[0253] - halogen, preferably F and Cl, and

[0254] - optionally substituted alkyl, preferably methyl, trifluoromethyl, hydroxymethyl.

[0255] Even more preferably, in any of the foregoing embodiments, the one or more substituents R 5 are independently selected from the group consisting of

[0256] - halogen, preferably F and Cl, most preferably F.

[0257] Embodiment A-5:

[0258] A further preferred embodiment of the present invention relates to new compounds according to formulas (A-I) and (A-II) defined above, wherein Cycl is a substituted aryl as defined above, which is substituted by 1 to 3, preferably 1 or 2 substituents selected from the group consisting of

[0259] - hydroxy,

[0260] - halogen, preferably F and Cl, preferably F,

[0261] -cyano,

[0262] - optionally substituted alkyl,

[0263] - optionally substituted amino, for example (-NH2) or mono- or dialkylamino, preferably dimethylamino,

[0264] - optionally substituted acyl,

[0265] - optionally substituted alkoxy, preferably methoxy, di-fluoromethoxy and trifluoromethoxy,

[0266] - optionally substituted aryloxy,

[0267] - optionally substituted heterocyclic oxy group,

[0268] - optionally substituted aryl, and

[0269] - optionally substituted heterocyclyl, preferably optionally substituted pyrrolidinyl, morpholinyl, and piperazinyl,

[0270] - optionally substituted sulfonyl, for example preferably heterocyclic substituted sulfonyl, preferably of the formula

[0271]

[0272] For example, it preferably contains 1 to 3 (preferably 1 or 2) substituents R 6 , which is as defined above and hereinbefore defined below according to any one of formulae (A-Va) and (A-Vb);

[0273] or a pharmaceutically acceptable salt thereof.

[0274] Embodiments A-5a and A-5b:

[0275] A further preferred embodiment of the present invention relates to novel compounds according to formula (AI) and (A-II) as defined above, wherein Cycl is a substituted aryl group selected from substituted phenyl groups, to form compounds according to formula (A-Va) or (A-Vb), respectively:

[0276]

[0277] Among them, Q, R 1 、X 1 、X 2 、X 3 、X 4 、R 3 、A 1 、A 2 、Y 2, R 4 and n have the meanings defined in Formulas (A-I) and (A-II) above, and wherein

[0278] R 6 has the meaning defined above, and in particular represents 1 to 3, preferably 1 or 2, more preferably 1 substituent selected from the group consisting of

[0279] -hydroxy,

[0280] -halogen, preferably F and Cl, more preferably F,

[0281] -cyano,

[0282] -optionally substituted alkyl,

[0283] -optionally substituted amino, such as (-NH2) or mono- or dialkylamino, preferably dimethylamino,

[0284] -optionally substituted acyl,

[0285] -optionally substituted alkoxy, preferably methoxy, difluoromethoxy and trifluoromethoxy,

[0286] -optionally substituted aryloxy,

[0287] -optionally substituted heteroepoxy,

[0288] -optionally substituted aryl, and

[0289] -optionally substituted heterocyclic group, preferably optionally substituted pyrrolidinyl, morpholinyl, and piperazinyl,

[0290] -optionally substituted sulfonyl, such as preferably heterocyclic group-substituted sulfonyl, preferably of the following formula

[0291]

[0292] -or a pharmaceutically acceptable salt thereof.

[0293] More preferably, R 6 has the meaning of 1 or 2 substituents, preferably R 6 represents 1 substituent selected from the group consisting of

[0294] -hydroxy,

[0295] -halogen, preferably F and Cl, more preferably F,

[0296] -cyano,

[0297] -optionally substituted alkyl,

[0298] - Optionally substituted amino group, such as (-NH2) or mono- or dialkylamino group, preferably dimethylamino group,

[0299] - Optionally substituted alkoxy group, preferably methoxy group, difluoromethoxy group and trifluoromethoxy group,

[0300] - Optionally substituted heterocyclic group, preferably optionally substituted pyrrolidinyl group, morpholinyl group, and piperazinyl group, and

[0301] - Optionally substituted sulfonyl group, such as preferably heterocyclic group-substituted sulfonyl group, preferably having the following formula

[0302]

[0303] Even more preferably, R 6 represents one substituent selected from the group consisting of

[0304] - Halogen, preferably F and Cl, preferably F,

[0305] - Cyano group,

[0306] - Optionally substituted amino group, such as (-NH2) or mono- or dialkylamino group, preferably dimethylamino group,

[0307] - Optionally substituted alkoxy group, preferably methoxy group, difluoromethoxy group and trifluoromethoxy group,

[0308] - Optionally substituted heterocyclic group, preferably optionally substituted pyrrolidinyl group, morpholinyl group, and piperazinyl group, and

[0309] - Optionally substituted sulfonyl group, such as preferably heterocyclic group-substituted sulfonyl group, preferably having the following formula

[0310]

[0311] Further embodiment A-6:

[0312] A further preferred embodiment of the present invention relates to a new compound according to any one of the foregoing embodiments or according to any one of the formulas (A-I), (A-II), (A-IIIa), (A-IIIb), (A-IVa), (A-IVb), (A-IVc), (A-IVd), (A-Va) and (A-Vb) as defined above, or a pharmaceutically acceptable salt thereof, wherein

[0313] Embodiment (A-6a):

[0314] X 1 is N

[0315] and wherein there is one or two further heteroatoms X (X 2 , X3 , X 4 ), and among them

[0316] X 2 is C or N;

[0317] X 3 is C, N, S or O; and

[0318] X 4 is C or N,

[0319] to form a group

[0320]

[0321] where * represents the binding site attached to the aminocarbonyl group and ** represents the binding site attached to the A 1 group;

[0322] provided that in the case of two further heteroatoms both are selected from N or one is N and one (X 2 excluded) is O;

[0323] and among them X 3 and X 4 , when having the meaning of C or N, may carry further substituents, such as preferably hydrogen (X 4 = C) or the substituents substituting the heteroaryl as defined above.

[0324] Embodiment (A-6b):

[0325] X 1 is N,

[0326] X 2 is N and

[0327] X 3 is O; and

[0328] X4 is C or N,

[0329] to form a group

[0330]

[0331] such as preferably the group

[0332] (Embodiment (A-6b-1)

[0333] or the group

[0334] (Embodiment (A-6b-2)

[0335] where * represents the binding site attached to the aminocarbonyl group and ** represents the binding site attached to the A 1 group; and where

[0336] X 4 (being C or N) may carry further substituents, such as preferably hydrogen (with X 4 =C) or the substituents as defined above for substituting heteroaryl.

[0337] Embodiment (A-6c):

[0338] X 1 is N,

[0339] X 2 is N and

[0340] X 3 is S; and

[0341] X4 is C or N, preferably C,

[0342] to form the group

[0343]

[0344] where * represents the binding site attached to the aminocarbonyl group and ** represents the binding site attached to the A 1 group;

[0345] and where

[0346] X 4 may carry further substituents, such as preferably hydrogen (with X 4 =C) or the substituents as defined above for substituting heteroaryl.

[0347] Embodiment (A-6d):

[0348] X 2 and X 3 are both N,

[0349] to form the group

[0350]

[0351] where * represents the binding site attached to the aminocarbonyl group and ** represents the binding site attached to the A 1 group; and where

[0352] X 1 and X 4 are C;

[0353] and where X 1 and / or X 4Independently, it can carry hydrogen or further substituents, such as preferably the substituents defined above for substituting heteroaryl.

[0354] Embodiment (A-6e):

[0355] X 1 is C, and

[0356] X 2 、X 3 and X 4 are N,

[0357] to form the group

[0358]

[0359] where * represents the binding site attached to the aminocarbonyl group and ** represents the binding site attached to the A 1 group; and where

[0360] X 1 can carry hydrogen or further substituents, such as preferably the substituents defined above for substituting heteroaryl.

[0361] Embodiment (A-6f):

[0362] X 1 、X 2 and X 4 are N, and

[0363] X 3 is C,

[0364] to form the group

[0365]

[0366] where * represents the binding site attached to the aminocarbonyl group and ** represents the binding site attached to the A 1 group; and where

[0367] X 3 can carry hydrogen or further substituents, such as the substituents defined above for substituting heteroaryl.

[0368] Embodiment (A-6g):

[0369] X 1 is O,

[0370] X 2 is C,

[0371] X 3 is N, and

[0372] X 4 is C,

[0373] to form a group

[0374]

[0375] wherein

[0376] Y 1 represents

[0377] - hydrogen or

[0378] - an optional substituent attached to X 4 ; and

[0379] * represents the binding site attached to the aminocarbonyl group and ** represents the binding site attached to the A 1 group;

[0380] Embodiment (A-6h):

[0381] X 1 is S,

[0382] X 2 is C,

[0383] X 3 is N, and

[0384] X 4 is C,

[0385] to form a group

[0386]

[0387] wherein

[0388] Y 1 represents

[0389] - hydrogen or

[0390] - an optional substituent attached to X 4 ; and

[0391] * represents the binding site attached to the aminocarbonyl group and ** represents the binding site attached to the A 1 group;

[0392] Particularly preferably, in any of the embodiments described herein, any further optional substituents of X 1 , X 3 and X 4 are also represented as Y 1 or a substituent equivalent to substituent Y 1 , and are selected from the group consisting of

[0393] - a halogen, preferably Cl and F, more preferably Cl, and

[0394] - Optionally substituted alkyl, such as straight-chain or branched C1-C3 alkyl, which may be substituted by 1 to 3 halogens or by methylene groups; for example, preferably methyl group, isopropyl group, CF3 group or ethyl group substituted by methylene group Where * represents the binding site.

[0395] Further preferred embodiments based on the foregoing embodiments A-6g and A-6h:

[0396] Further preferred embodiment 2a:

[0397] A further preferred embodiment of the present invention relates to a new compound according to the foregoing embodiment A-6g and formula (I) as defined above, wherein X is O to form a compound according to formula (IIa):

[0398]

[0399] Wherein R 1 、R 2 、Y 1 、R 3 、A 1 、A 2 and Ar have the meanings as defined above; or a pharmaceutically acceptable salt thereof.

[0400] Another embodiment 2b:

[0401] A further preferred embodiment of the present invention relates to a new compound according to the foregoing embodiment A-6h and formula (I) as defined above, wherein X is S to form a compound according to formula (IIb):

[0402]

[0403] Wherein R 1 、R 2 、Y 1 、R 3 、A 1 、A 2 and Ar have the meanings as defined in formula (I) above and as defined in the context of any of the embodiments described herein; or a pharmaceutically acceptable salt thereof.

[0404] Another embodiment 3:

[0405] A further preferred embodiment of the present invention relates to any compound as defined in the foregoing embodiments A-6g and A-6h, embodiment 2a and embodiment 2b, wherein R 1 and R 2At least one of which is a linear alkyl group as defined above, which is substituted by a cyclic group "Cycl" and named as R 2* ; to form a compound according to formula (III):

[0406]

[0407] wherein "Cycl" is selected from

[0408] - Optionally substituted aryl as defined above,

[0409] - Optionally substituted heteroaryl as defined above, and

[0410] - Optionally substituted heterocyclic group as defined above,

[0411] Preferably an optionally substituted aryl or heteroaryl as defined above;

[0412] n is an integer from 1 to 8, preferably from 1 to 4, preferably from 1 to 3, such as 1, 2 or 3, more preferably 1; and

[0413] The remaining R 1 or R 2 (Named as R 1* ) is selected from

[0414] - Hydrogen,

[0415] - Optionally substituted alkyl as defined above,

[0416] Preferably hydrogen and optionally substituted alkyl as defined above; and

[0417] X 1 、Y 1 、R 3 、A 1 、A 2 and Ar have the meanings defined in formula (I) and the meanings defined in the context of any embodiment described in this case; or a pharmaceutically acceptable salt thereof.

[0418] Embodiment 3a:

[0419] Another particularly preferred embodiment (3a) of the present invention relates to the compounds defined in embodiments A-6g and A-6h, embodiment 2a, embodiment 2b and embodiment 3 of this case and particularly to the compounds according to the above formula (III), wherein at least one of R 1 and R 2 is a linear alkyl group as defined above, which is substituted by a cyclic group "Cycl" and named as R 2* ; which is selected from optionally substituted aryl as defined above, such as especially optionally substituted phenyl to form a compound according to formula (IIIa)

[0420] wherein n is an integer from 1 to 8, preferably from 1 to 4, more preferably from 1 to 3, such as 1, 2 or 3, still more preferably 1; and the phenyl ring may optionally be substituted with 1 to 3, preferably 1 or 2, more preferably 1 substituent as defined above, and preferably the substituent of the phenyl ring is selected from halogen and hydroxyl; and the remaining R 1 or R 2 (designated as R 1* ) has the meaning as defined above, in particular as defined in formula (I) and as defined in the context of Embodiment 3 above; and

[0421] X 1 、Y 1 、R 3 、A 1 、A 2 and Ar have the meaning as defined in formula (I) and the meaning as defined in the context of any of the embodiments described herein; or a pharmaceutically acceptable salt thereof.

[0422] Embodiment 3b:

[0423] Another preferred embodiment (3b) of the present invention relates to the compounds defined in Embodiments A-6g and A-6h, Embodiment 2a, Embodiment 2b, Embodiment 3 and Embodiment 3a of the present case and in particular to the compounds according to formula (III) above, wherein at least one of R 1 and R 2 is a straight-chain alkyl as defined above, which is substituted by a cyclic group "Cycl" which is an optionally substituted heterocyclic group "Het-1" as defined above to form a compound according to formula (IIIb)

[0424] and Het-1 is selected from

[0425] - an optionally substituted optionally fused 5- to 6-membered heteroaryl, as defined above, or

[0426] - an optionally substituted 5- or 6-membered aliphatic heterocyclic group, preferably a 6-membered aliphatic heterocyclic group, as defined above respectively,

[0427] wherein the Het-1 group contains 1 or 2 identical or different heteroatoms, which are selected from N, O and S, preferably from N and O, still more preferably N; and

[0428] The Het-1 group may carry 1 to 3, preferably 1 or 2, more preferably 1 substituent as defined above, preferably selected from halogen, cyano, optionally substituted alkyl as defined above, optionally substituted alkoxy, hydroxy (-OH), oxo group (=O), carboxyl [-(C=O)-OH], heterocyclic group as defined above, aminocarbonyl, optionally substituted amino;

[0429] n is an integer from 1 to 8, preferably from 1 to 4, more preferably from 1 to 3, such as 1, 2 or 3, even more preferably 1; and

[0430] The remaining R 1 or R 2 (designated as R 1* ) has the meaning as defined above, in particular as defined in formula (I) and as defined in the context of Embodiment 3 above and

[0431] X 1 、Y 1 、R 3 、A 1 、A 2 and Ar have the meaning as defined in formula (I) and the meaning as defined in the context of any of the embodiments described herein; or a pharmaceutically acceptable salt thereof.

[0432] Embodiment 3b-a:

[0433] Another preferred embodiment (3b-a) of the present invention relates to a compound according to Embodiment 3b and according to the above formula (IIIb), wherein Het-1 is selected from optionally substituted 5-membered heteroaryl as defined above, preferably optionally substituted pyrazolyl, to form, for example, a compound according to formula (IIIb-a)

[0434]

[0435] wherein R 5 is hydrogen or alkyl as defined above, preferably C1-C3-alkyl,

[0436] n is an integer from 1 to 8, preferably from 1 to 4, more preferably from 1 to 3, such as 1, 2 or 3, even more preferably 1; and

[0437] The remaining R 1 or R 2 (designated as R 1* ) has the meaning as defined above, in particular as defined in formula (I) and as defined in the context of Embodiments 3 and 3b above, and wherein the pyrazolyl ring may carry 1 or 2 further substituents as defined above; and

[0438] X 1 、Y1 , R 3 , A 1 , A 2 and Ar have the meanings defined in formula (I) and in the context of any of the embodiments described herein; or a pharmaceutically acceptable salt thereof.

[0439] Embodiment 3b-b:

[0440] Another preferred embodiment (3b-b) of the present invention relates to a compound according to embodiment 3b and according to the above formula (IIIb), wherein Het-1 is selected from optionally substituted 5-membered heteroaryl as defined above, preferably optionally substituted imidazolyl, to form, for example, a compound according to formula (IIIb-b)

[0441]

[0442] wherein R 4 is hydrogen or alkyl as defined above, preferably C1-C3-alkyl,

[0443] n is an integer from 1 to 8, preferably from 1 to 4, preferably from 1 to 3, such as 1, 2 or 3, more preferably 1; and

[0444] the remaining R 1 or R 2 (designated as R 1* ) has the meaning defined above, in particular as defined in formula (I) and in the context of embodiments 3 and 3b above, and wherein the imidazolyl ring may carry 1 or 2 further substituents as defined above; and

[0445] X 1 , Y 1 , R 3 , A 1 , A 2 and Ar have the meanings defined in formula (I) and in the context of any of the embodiments described herein; or a pharmaceutically acceptable salt thereof.

[0446] Embodiment 3b-c:

[0447] Another preferred embodiment (3b-c) of the present invention relates to a compound according to embodiment 3b and according to the above formula (IIIb), wherein Het-1 is selected from optionally substituted 6-membered heteroaryl as defined above, preferably optionally substituted pyrimidinyl, to form, for example, a compound according to formula (IIIb-c)

[0448]

[0449] where n is an integer from 1 to 8, preferably from 1 to 4, more preferably from 1 to 3, such as 1, 2 or 3, even more preferably 1; and the remaining R 1 or R 2 (referred to as R 1* ) has the meaning as defined above, in particular as defined by formula (I) and as defined in the context of Embodiments 3 and 3b above, and wherein the pyrimidine ring may carry 1 to 3, preferably 1 or 2 further substituents as defined above; and

[0450] X 1 、Y 1 、R 3 、A 1 、A 2 and Ar have the meaning as defined by formula (I) and as defined in the context of any of the embodiments described herein; or a pharmaceutically acceptable salt thereof.

[0451] Embodiments 3b-d:

[0452] Another preferred embodiment (3b-d) of the present invention relates to compounds according to Embodiment 3b and according to the above formula (IIIb), wherein Het-1 is selected from optionally substituted 6-membered heteroaryl as defined above, preferably optionally substituted pyridazinyl, to form, for example, compounds according to formula (IIIb-d)

[0453]

[0454] where n is an integer from 1 to 8, preferably from 1 to 4, more preferably from 1 to 3, such as 1, 2 or 3, even more preferably 1; and the remaining R 1 or R 2 (referred to as R 1* ) has the meaning as defined above, in particular as defined by formula (I) and as defined in the context of Embodiments 3 and 3b above, and wherein the pyridazine ring may carry 1 to 3, preferably 1 or 2 further substituents as defined above; and

[0455] X 1 、Y 1 、R 3 、A 1 、A 2 and Ar have the meaning as defined by formula (I) and as defined in the context of any of the embodiments described herein; or a pharmaceutically acceptable salt thereof.

[0456] Embodiments 3b-e:

[0457] Another particularly preferred embodiment (3b-e) of the present invention relates to a compound according to embodiment 3b and according to the above formula (IIIb), wherein Het-1 is selected from optionally substituted 6-membered heteroaryl as defined above, preferably optionally substituted pyridyl, to form, for example, a compound according to formula (IIIb-e).

[0458]

[0459] wherein n is an integer from 1 to 8, preferably from 1 to 4, preferably from 1 to 3, such as 1, 2 or 3, more preferably 1; and the remaining R 1 or R 2 (designated as R 1* ) has the meaning as defined above, in particular as defined in formula (I) and as defined in the context of embodiments 3 and 3b above, and wherein the pyridyl ring may carry 1 to 3, preferably 1 or 2 further substituents as defined above; and

[0460] X 1 、Y 1 、R 3 、A 1 、A 2 and Ar have the meaning as defined in formula (I) and as defined in the context of any of the embodiments described herein; or a pharmaceutically acceptable salt thereof.

[0461] Embodiment 3b-f:

[0462] Another particularly preferred embodiment (3b-f) of the present invention relates to a compound according to embodiment 3b and according to the above formula (IIIb), wherein Het-1 is selected from substituted pyridyl to form a compound according to formula (IIIb-f).

[0463]

[0464] wherein n is an integer from 1 to 8, preferably from 1 to 4, preferably from 1 to 3, such as 1, 2 or 3, more preferably 1; and the remaining R 1 or R 2 (designated as R 1* ) has the meaning as defined above, in particular as defined in formula (I) and as defined in the context of embodiments 3 and 3b above, and

[0465] wherein R 5 represents 1 to 4, preferably 1 to 3, preferably 1 or 2, more preferably 1 optional substituent(s), which may independently be selected from

[0466] - hydrogen

[0467] - halogen, preferably Cl or F, more preferably F,

[0468] - Optionally substituted alkyl, preferably C1-C3-alkyl, such as preferably methyl, or trifluoromethyl

[0469] - Hydroxy, and

[0470] - Alkoxy, preferably methoxy;

[0471] More preferably, R 5 represents 1 to 3, preferably 1 or 2, more preferably 1 substituent(s) which may be independently selected from

[0472] - Hydrogen,

[0473] - Halogen, preferably Cl or F, more preferably F, and

[0474] - Optionally substituted alkyl, preferably C1-C3-alkyl, such as preferably methyl, or trifluoromethyl; and

[0475] X 1 、Y 1 、R 3 、A 1 、A 2 and Ar have the meanings as defined in formula (I) and as defined in the context of any embodiment described herein; or a pharmaceutically acceptable salt thereof.

[0476] Embodiments 3b-g:

[0477] Another particularly preferred embodiment (3b-g) of the present invention relates to compounds according to embodiment 3b and according to formula (IIIb), in particular according to embodiments 3b-f and formula (IIIb-f), to form a compound according to formula (IIIb-g)

[0478]

[0479] wherein n, the remaining R 1 or R 2 (referred to as R 1* ) has the meaning defined in embodiments 3b-f, and wherein R 5 is selected from

[0480] - Halogen, preferably Cl or F, more preferably F,

[0481] - Optionally substituted alkyl, preferably C1-C3-alkyl, such as preferably methyl, or trifluoromethyl

[0482] - Hydroxy,

[0483] - Alkoxy, preferably methoxy;

[0484] More preferably, R5 Selected from

[0485] - a halogen, preferably Cl or F, more preferably F, and

[0486] - a C1-C3-alkyl, such as preferably methyl, or trifluoromethyl; and

[0487] X 1 , Y 1 , R 3 , A 1 , A 2 and Ar have the meanings defined in the context of formula (I) and any of the embodiments described in the present case, in particular the above embodiments (IIIb-f);

[0488] or a pharmaceutically acceptable salt thereof.

[0489] Even more particularly preferably, in the compounds defined in formula (A-I) and (I) and in embodiments A-2, A-3, A-3a, A-3b, A-4a, A-4b, A-4c, A-4d, A-5, A-5a, A-5b, A-6 and A-6a to A-6h and in embodiments 3, 3a, 3b, 3b-a, 3b-b, 3b-c, 3b-d, 3b-e, 3b-f and 3b-g, R 1 and R 2 at least one is a straight-chain, branched-chain or cycloalkyl group substituted by a cyclic group "Cycl". Such a straight-chain, branched-chain or cycloalkyl group means a straight-chain or branched-chain alkyl–[CQ] n - containing Q = H or C1-C4-alkyl, which is substituted by a cyclic group "Cycl". In particular, when one of R 1 and R 2 is a branched-chain alkyl–[CQ] n - containing Q = C_{1}-C_{4}-alkyl, it is possible and preferred that the Q alkyl group and the cyclic group "Cycl" form a cycloalkyl residue in the form of a fused ring. Accordingly, the "straight-chain, branched-chain or cycloalkyl residue (substituted by a cyclic group "Cycl")" is selected from

[0490] - an optionally substituted straight-chain or branched-chain alkanediyl as defined above, which is preferably selected from

[0491] - methylene,

[0492] - ethane-1,2-diyl,

[0493] - ethane-1,1-diyl,

[0494] - propane-1,3-diyl,

[0495] - propane-1,1-diyl,

[0496] -propane-1,2-diyl, and

[0497] -propane-2,2-diyl; or

[0498] -(especially when Q is C1-C4-alkyl to form) an optionally substituted cycloalkyl group as defined above, which is preferably selected from

[0499] -cyclopropane and

[0500] -cyclohexane;

[0501] In a further preferred embodiment, together with Cycl which is a group of Het-1, it may preferably form a fused bicyclic ring which is a 6-membered heteroaryl as defined above.

[0502] More preferably, it is an optionally substituted straight-chain or branched-chain alkanediyl residue as defined above. Even more preferably, such an optionally substituted alkanediyl residue is selected from the group consisting of: methylene, ethane-1,2-diyl, ethane-1,1-diyl and propane-2,2-diyl; more preferably methylene or ethane-1,2-diyl; most preferably methylene.

[0503] In each of the above-mentioned embodiments A-2, A-3, A-3a, A-3b, A-4a, A-4b, A-4c, A-4d, A-5, A-5a, A-5b, A-6 and A-6a to A-6h and embodiments 3, 3a, 3b, 3b-a, 3b-b, 3b-c, 3b-d, 3b-e, 3b-f and 3b-g, the remaining R 1 or R 2 , named as R 1* , X 1 , Y 1 , R 3 , A 1 , A 2 and Ar may have the meanings defined by formula (A-I) or (I) and as defined in the context of any of the embodiments described in this case, especially in the context of the above-mentioned embodiment 2 and the following embodiments 4, 4a, 4b, 4c and 4d.

[0504] Further embodiment 4:

[0505] A further embodiment of the present invention relates to any of the compounds as defined above, for example especially the compounds of embodiments A-6g and A-6h as defined above and additional embodiments based thereon, wherein Ar is an optionally substituted mono- or bicyclic heteroaryl "Het-2" as defined above to form a compound according to formula (IV)

[0506]

[0507] and Het-2 is selected from

[0508] - an optionally substituted 5- or 6-membered monocyclic heteroaryl as defined above, and

[0509] - an optionally substituted bicyclic heteroaryl as defined above, which may be fused to a ring formed jointly by R 3 and A 2 and the nitrogen atom to which it is bonded;

[0510] or a pharmaceutically acceptable salt thereof.

[0511] Embodiment 4a:

[0512] Another embodiment (4a) relates to a compound as defined in the present case, for example in particular to compounds of embodiments A-6g and A-6h as defined above and further embodiments based thereon and in particular to compounds according to formula (IV) above, in which Ar is an optionally substituted mono- or bicyclic heteroaryl "Het-2" selected from an optionally substituted 5-membered monocyclic heteroaryl as defined above, to form, for example, a compound according to formula (IVa)

[0513]

[0514] wherein X 5 is S or N-R 7 and R 7 has the meaning of R 5 , in particular R 5 as defined in embodiments 3b-a and 3b-b, and wherein the 5-membered heteroaryl ring of Het-2 may carry 1 to 3 further substituents, preferably 1 or 2 additional substituents, more preferably 1 additional substituent, as defined above; or a pharmaceutically acceptable salt thereof.

[0515] Embodiment 4b:

[0516] Another embodiment (4b) relates to a compound as defined in the present case, for example in particular to compounds of embodiments A-6g and A-6h as defined above and other embodiments based thereon and in particular to compounds according to formula (IV) above, in which Ar is an optionally substituted mono- or bicyclic heteroaryl "Het-2" selected from an optionally substituted 6-membered monocyclic heteroaryl as defined above, to form, for example, a compound according to formula (IVb)

[0517]

[0518] wherein Y 3is C or N, and wherein the 6-membered heteroaryl ring of Het-2 may carry from 1 to 3 substituents as defined above, preferably 1 or 2 substituents, more preferably 1 substituent; or a pharmaceutically acceptable salt thereof.

[0519] Embodiment 4c:

[0520] Another embodiment (4c) relates to a compound as defined in the present case, for example in particular to compounds of embodiment A-6g and A-6h as defined above and other embodiments based thereon and in particular to compounds according to formula (IV) above, wherein Ar is an optionally substituted mono- or bicyclic heteroaryl "Het-2", which is selected from optionally substituted bicyclic heteroaryls as defined above, thus forming, for example, a compound according to formula (IVc)

[0521]

[0522] containing

[0523] - two Y's that are C 2 or

[0524] - one Y 2 is N and one Y 2 is C, and

[0525] wherein the bicyclic heteroaryl ring of Het-2 may carry from 1 to 3 substituents as defined above, preferably 1 or 2 substituents, more preferably 1 substituent, and wherein the optionally substituted bicyclic heteroaryl ring of Het-2 may be fused to a ring formed by R 3 and A 2 and the nitrogen atom to which it is bonded; or a pharmaceutically acceptable salt thereof.

[0526] Embodiment 4d:

[0527] Another embodiment (4d) relates to a compound as defined in the present case, for example in particular to compounds of embodiment A-6g and A-6h as defined above and further embodiments based thereon and in particular to compounds according to formula (IV) and (IVc) above, wherein Ar is an optionally substituted mono- or bicyclic heteroaryl "Het-2", which is selected from optionally substituted bicyclic heteroaryls, which are selected from benzimidazolyl groups as defined above, thus forming a compound according to formula (IVd)

[0528]

[0529] wherein the benzimidazolyl ring of Het-2 may carry from 1 to 3 substituents, preferably 1 or 2 substituents, more preferably 1 substituent, as defined above, and

[0530] wherein the benzimidazolyl ring of Het-2 may be fused to a ring formed by R3 and A 2 is fused to a ring formed jointly with the nitrogen atom to which it is bonded;

[0531] or a pharmaceutically acceptable salt thereof.

[0532] In each of the above-mentioned embodiments 4, 4a, 4b, 4c and 4d, the remaining substituents R 1 , R 2 , X 1 , Y 1 , R 3 , A 1 and A 2 may have the meanings as defined in formula (I) and as defined in the context of any of the embodiments described herein, in particular as defined in formula (I) and in the context of embodiment 2 above, and as defined in embodiments 3, 3a, 3b, 3b-a, 3b-b, 3b-c, 3b-d, 3b-e, 3b-f and 3b-g above.

[0533] Other embodiments:

[0534] Further embodiment B-2a:

[0535] Particularly preferred embodiment (B-2a) relates to a compound of formula (B-IIa)

[0536]

[0537] in which there are 1 to 3 heteroatoms X (X 1 , X 2 , X 3 and / or X 4 ), where X 1 to X 4 may be the same or different and are independently selected from the group consisting of C, N, S and O. Preferably, in formula (B-IIa), there are 1 to 3 heteroatoms X, where

[0538] X 1 is C, N, S or O;

[0539] X 2 is C or N;

[0540] X 3 is C, N, S or O; and

[0541] X 4 is C, N, S or O, preferably X 4 is C, N or S,

[0542] and where X 1 , X 3 and X4 may carry further substituents.

[0543] Embodiment B-2a-a:

[0544] Another particularly preferred embodiment (B-2a-a) relates to a compound according to formula (B-IIa) wherein X 1 is N, thus forming a compound of formula (B-IIa-a)

[0545]

[0546] in which there is one or two further heteroatoms X (X 2 , X 3 , X 4 ), and wherein

[0547] X 2 is C or N;

[0548] X 3 is C, N, S or O; and

[0549] X 4 is C or N;

[0550] provided that in the case of two further heteroatoms, both are selected as N or one is N and one (other than X 2 ) is O; and

[0551] wherein X 3 and X 4 in the sense of C or N may carry further substituents, for example preferably hydrogen or a substituent for substituting a heteroaryl as defined above.

[0552] Embodiment B-2a-b:

[0553] Another particularly preferred embodiment (B-2a-b) relates to a compound according to formula (B-IIa) wherein X 2 and X 3 are both N, thus forming a compound of formula (B-IIa-b)

[0554]

[0555] wherein X 1 and X 4 are C; and wherein X 1 and / or X 4 may carry hydrogen or further substituents, for example preferably a substituent for substituting a heteroaryl as defined above.

[0556] Embodiment B-2a-c:

[0557] Another particularly preferred embodiment (B-2a-c) relates to a compound according to formula (B-IIa) or (B-IIa-a), wherein X 1 is N, X 2 is C and X 3 is S, thus forming a compound of formula (B-IIa-c)

[0558]

[0559] wherein X 4 is C or N, preferably C, which may carry further substituents, for example preferably hydrogen or a substituent for substituting a heteroaryl as defined above.

[0560] Embodiment B-2a-d:

[0561] Another particularly preferred embodiment (B-2a-d) relates to a compound according to formula (B-IIa) or (B-IIa-a), wherein X 1 is N, X 2 is C and X 3 is O, thus forming a compound of formula (B-IIa-d)

[0562]

[0563] wherein X 4 is C or N, and it may carry further substituents, for example preferably hydrogen or a substituent for substituting a heteroaryl as defined above, thus forming a compound according to formula (B-IIa-d-1)

[0564]

[0565] wherein X 4 is C, which may preferably carry hydrogen or further substituents; or

[0566] forming a compound according to formula (B-IIa-d-2)

[0567]

[0568] wherein X 4 is N, which may carry further substituents.

[0569] Embodiment B-3b-e:

[0570] Another particularly preferred embodiment (B-3b-e) of the present invention relates to a compound according to formula (B-IIIb-e)

[0571]

[0572] where n is an integer from 1 to 8, preferably from 1 to 4, more preferably from 1 to 3, such as 1, 2 or 3, even more preferably 1; and the remaining R 1 or R 2 (designated as R 1* ) has the meaning defined in the above embodiments, in particular the meaning defined by formula (I), where the pyridyl ring may carry 1 to 3, preferably 1 or 2 further substituents as defined above, and

[0573] R 3 、A 1 、A 2 and Ar may have the meaning defined in the context of any of the embodiments described herein, and where Z has the meaning defined by formula (A-I), and as defined in any one of embodiments A-6a, A-6b, A-6b-1, A-6b-2, A-6c, A-6d, A-6e, A-6f, A-6g and A-6h, preferably the meaning of the heterocyclic 5-membered ring defined by formula (A-I) and embodiments A-6a, A-6b, A-6b-1, A-6b-2, A-6c, A-6d.

[0574]

[0575] Embodiment B-3b-f:

[0576] Another particularly preferred embodiment (B-3b-f) of the present invention relates to a compound according to formula (B-IIIb-f)

[0577]

[0578] where n is an integer from 1 to 8, preferably from 1 to 4, more preferably from 1 to 3, such as 1, 2 or 3, even more preferably 1; and the remaining R 1 or R 2 (designated as R 1* ) has the meaning defined in the above embodiments, in particular the meaning defined by formula (I), and

[0579] where R 5 represents 1 to 4, preferably 1 to 3, more preferably 1 or 2, even more preferably 1 optional substituents, which may be independently selected from

[0580] -halogen, preferably Cl or F, more preferably F,

[0581] -optionally substituted alkyl, preferably C1-C3-alkyl, such as preferably methyl, or trifluoromethyl

[0582] -hydroxy,

[0583] -alkoxy, preferably methoxy;

[0584] Preferably, R 5 is selected from

[0585] -halogen, preferably Cl or F, more preferably F, and

[0586] -C1-C3-alkyl, for example preferably methyl, or trifluoromethyl; and

[0587] R 3 , A 1 , A 2 and Ar may have the meanings defined in the context of any of the embodiments described herein, and wherein Z has the meaning defined by formula (A-I), and as defined by any one of embodiments A-6a, A-6b, A-6b-1, A-6b-2, A-6c, A-6d, A-6e, A-6f, A-6g and A-6h, preferably the heterocyclic 5-membered ring meanings defined by formula (A-I) and embodiments A-6a, A-6b, A-6b-1, A-6b-2, A-6c, A-6d.

[0588]

[0589] Embodiment B-3b-g:

[0590] Another highly preferred embodiment (B-3b-g) of the present invention relates to a compound according to formula (B-IIIb-g)

[0591]

[0592] wherein n and the remaining R 1 or R 2 (designated as R 1* ) have the meanings defined for embodiment B-3b-f, and wherein R 5 is selected from

[0593] -halogen, preferably Cl or F, more preferably F,

[0594] -optionally substituted alkyl, preferably C1-C3-alkyl, for example preferably methyl, or trifluoromethyl

[0595] -hydroxy,

[0596] -alkoxy, preferably methoxy;

[0597] More preferably, R 5 is selected from

[0598] -halogen, preferably Cl or F, more preferably F, and

[0599] -C1-C3-alkyl, such as preferably methyl, or trifluoromethyl; and

[0600] R 3 , A 1 , A 2 and Ar may have the meanings defined in the context of any of the embodiments described herein, and wherein Z has the meaning defined by formula (A-I) and as defined in any one of embodiments A-6a, A-6b, A-6b-1, A-6b-2, A-6c, A-6d, A-6e, A-6f, A-6g and A-6h, preferably the meaning of a heterocyclic 5-membered ring defined by formula (A-I) and embodiments A-6a, A-6b, A-6b-1, A-6b-2, A-6c, A-6d.

[0601]

[0602] Even more particularly preferably, in the compounds defined according to formula (A-I) and in embodiments A-2, A-3, A-3a, A-3b, A-4a, A-4b, A-4c, A-4d, A-5, A-5a, A-5b, A-6 and A-6a to A-6h and in embodiments B-3b-e, B-3b-f and B-3b-g, at least one of R 1 and R 2 is a straight-chain, branched-chain or cycloalkyl group substituted by the cyclic group "Cycl", including the group –[CQ] n -, where Q = H or C1-C4-alkyl, and the resulting alkyl residue is

[0603] - an optionally substituted straight-chain or branched-chain alkanediyl as defined above, which is preferably selected from

[0604] -methylene,

[0605] -ethane-1,2-diyl,

[0606] -ethane-1,1-diyl,

[0607] -propane-1,3-diyl,

[0608] -propane-1,1-diyl,

[0609] -propane-1,2-diyl, and

[0610] -propane-2,2-diyl; or

[0611] -(especially where Q is C1-C4-alkyl, thus forming) an optionally substituted cycloalkyl as defined above, which is preferably selected from

[0612] -cyclopropane and

[0613] - cyclohexane;

[0614] In a further preferred embodiment, it may preferably form a fused bicyclic ring with Cycl which is a 6 - membered heteroaryl as defined above.

[0615] More preferably, it is an optionally substituted alkanediyl residue as defined above. Even more preferably, such an optionally substituted alkanediyl residue is selected from the group consisting of methylene, ethane - 1,2 - diyl, ethane - 1,1 - diyl and propane - 2,2 - diyl; more preferably methylene or ethane - 1,2 - diyl; most preferably methylene.

[0616] In each of the above - mentioned embodiments B - 3b - e, B - 3b - f and B - 3b - g, the remaining R 1 or R 2 (referred to as R 1* ), Z, R 3 , A 1 , A 2 and Ar may have the meanings defined in the context of any of the embodiments described herein.

[0617] Embodiment B - 4c:

[0618] Another particularly preferred embodiment (B - 4c) relates to the compounds defined herein and particularly to the compounds according to formula (B - IVc)

[0619]

[0620] containing

[0621] - two Y 2 being C or

[0622] - one Y 2 being N and one Y 2 being C, and

[0623] wherein the bicyclic heteroaryl ring may carry 1 to 3 substituents, preferably 1 or 2 substituents, more preferably 1 substituent, as defined above (such as the definition of R 4 above), and wherein the optionally substituted bicyclic heteroaryl ring may be fused to a ring formed jointly by R 3 and A 2 and the nitrogen atom to which it is bonded.

[0624] Z has the meaning of a heterocyclic 5-membered ring as defined by formula (A-I) and as defined by any one of Embodiments A-6a, A-6b, A-6b-1, A-6b-2, A-6c, A-6d, A-6e, A-6f, A-6g and A-6h, preferably as defined by formula (A-I) and Embodiments A-6a, A-6b, A-6b-1, A-6b-2, A-6c, A-6d.

[0625]

[0626] Embodiment B-4d:

[0627] Another highly preferred embodiment (B-4d) relates to the compounds defined in this case and particularly to compounds according to formula (B-IVc) containing an optionally substituted bicyclic heteroaryl group which is a benzimidazolyl group as defined above, thus forming a compound according to formula (B-IVd)

[0628]

[0629] wherein the benzimidazolyl ring may carry from 1 to 3 substituents, preferably 1 or 2 substituents, more preferably 1 substituent, as defined above (such as the definition of R 4 above), and

[0630] wherein the benzimidazolyl ring may be fused to the ring formed jointly by R 3 and A 2 and the nitrogen atom to which it is bonded, and

[0631] Z has the meaning of a heterocyclic 5-membered ring as defined by formula (A-I) and as defined by any one of Embodiments A-6a, A-6b, A-6b-1, A-6b-2, A-6c, A-6d, A-6e, A-6f, A-6g and A-6h, preferably as defined by formula (A-I) and Embodiments A-6a, A-6b, A-6b-1, A-6b-2, A-6c, A-6d.

[0632]

[0633] In each of the above-mentioned Embodiments B-4c and B-4d, the remaining substituents R 1 、R 2 、Z、R 3 、A 1 and A 2may have the meaning defined in the context of any of the embodiments described herein, in particular the meaning defined in the context of the following embodiments B-2a, B-2a-a, B-2a-b, B-2a-c and B-2a-d, and B-3b-e, B-3b-f and B-3b-g.

[0634] Furthermore, it is highly particularly preferred that, in the compounds according to the invention, for example, in particular in the compounds of formula (A-I) and (I) and in the above embodiments A-2, A-3, A-3a, A-3b, A-4a, A-4b, A-4c, A-4d, A-5, A-5a, A-5b, A-6 and A-6a to A-6h and embodiments 2, 3, 3a, 3b, 3b-a, 3b-b, 3b-c, 3b-d, 3b-e, 3b-f, 3b-g and 4, 4a, 4b, 4c and 4d and B-2a, B-2a-a, B-2a-b, B-2a-c, B-2a-d, B-3b-e, B-3b-f, B-3b-g, B-4c and B-4d, A 1 and A 2 are each an optionally substituted alkanediyl as defined above, and are the same or different and are independently selected from optionally substituted

[0635] -methylene and

[0636] -ethane-1,2-diyl, or

[0637] -A 1 and R 3 together with the nitrogen atom to which they are attached form an optionally substituted 4- to 6-membered mono- or bicyclic ring, preferably a 4- or 6-membered mono- or bicyclic ring, more preferably a 4-membered ring, as defined above. Among them, more preferably

[0638] -A 1 and A 2 are the same and are methylene,

[0639] -A 1 and A 2 are the same and are ethane-1,2-diyl,

[0640] -A 1 is methylene and A 2 is ethane-1,2-diyl,

[0641] -A 1 is ethane-1,2-diyl and A 2 is methylene,

[0642] -A 1 and R 3Together with the nitrogen atom to which it is bonded, form an optionally substituted 4- to 6-membered aliphatic mono- or bicyclic ring, preferably a 4-membered ring, and A 2 is methylene, or

[0643] -A 1 and R 3 Together with the nitrogen atom to which it is bonded, form an optionally substituted 4- to 6-membered aliphatic mono- or bicyclic ring, preferably a 4-membered ring, and A 2 is ethane-1,2-diyl; more preferably

[0644] -A 1 and A 2 are the same and are ethane-1,2-diyl,

[0645] -A 1 is ethane-1,2-diyl and A 2 is methylene or

[0646] -A 1 and R 3 Together with the nitrogen atom to which it is bonded, form an optionally substituted 4-membered monocyclic ring, and A 2 is ethane-1,2-diyl; even more preferably

[0647] -A 1 and A 2 are the same and are ethane-1,2-diyl, or

[0648] -A 1 is ethane-1,2-diyl and A 2 is methylene.

[0649] In a further preferred embodiment of the compounds according to the invention, in each case, the individual substituents have the following definitions:

[0650] 1.a) X 1 has the meaning of O, X 3 has the meaning of N and X 2 and X 4 have the meaning of C and / or

[0651] b) X 1 has the meaning of N, X 3 has the meaning of O and X 2 and X 4 have the meaning of C and / or

[0652] c) X 1 has the meaning of N, X 3 has the meaning of S and X 2 and X 4 have the meaning of C and / or

[0653] d) X 2 and X 4 has the meaning of N, X 1 and X 3 one of which has the meaning of N and the rest have the meaning of C and / or

[0654] e) X 1 and X 4 has the meaning of N, X 2 has the meaning of C and X 3 has the meaning of O;

[0655] Particularly preferably, it is a heterocyclic 5-membered ring selected from oxazolyl, thiazolyl, pyrazolyl, triazolyl, oxadiazolyl, isoxazolyl and isothiazolyl as defined in Embodiments A-6b, A-6b-1, A-6b-2, A-6c, A-6d, A-6e, A-6f, A-6g and A-6h.

[0656] 2. Y 1 has hydrogen, an optionally substituted alkyl as defined above, preferably has C1, C2 or C3-alkyl as defined above, and more preferably has the meaning of methyl.

[0657] 3. n is 1

[0658] 4. Q is H

[0659] 5. Cycl is a group of the following formula

[0660] where * represents the binding site.

[0661] 6. R 1 and R 2 one of which is named R 1* and is hydrogen, and R 1 or R 2 one of which is named R 2* and is selected from hydrogen and an optionally substituted alkyl as defined above, preferably aryl-substituted alkyl and heteroaryl-substituted alkyl, where the aryl and heteroaryl substituents may each carry 1 to 3 substituents as defined above. Particularly preferably, at least one of R 1 or R 2 is named R 2* which is optionally substituted arylmethyl or optionally substituted heteroarylmethyl, most preferably optionally substituted heteroarylmethyl and substituted phenyl.

[0662] 7. A 1 and A 2 are optionally substituted alkanediyl, and are the same or different and independently selected from

[0663] -A 1 and A2 are identical and are methylene,

[0664] -A 1 and A 2 are identical and are ethane-1,2-diyl,

[0665] -A 1 is methylene while A 2 is ethane-1,2-diyl,

[0666] -A 1 is ethane-1,2-diyl while A 2 is methylene,

[0667] -A 1 and R 3 together with the nitrogen atom to which it is attached form an optionally substituted 4-membered monocyclic ring, and A 2 is methylene, or

[0668] -A 1 and R 3 together with the nitrogen atom to which it is attached form an optionally substituted 4-membered monocyclic ring, and A 2 is ethane-1,2-diyl.

[0669] Particularly preferably, A 1 is methylene or ethane-1,2-diyl while A 2 is ethane-1,2-diyl, or A 1 and R 3 together with the nitrogen atom to which it is attached form an optionally substituted 4-membered monocyclic ring while A 2 is ethane-1,2-diyl.

[0670] 8. R 3 is hydrogen or an optionally substituted alkyl group as defined above, or A 1 and R 3 together with the nitrogen atom to which it is attached form an optionally substituted 4-membered monocyclic ring, preferably hydrogen.

[0671] 9. Ar can be Het-1 as defined above, preferably an optionally substituted mono- or bicyclic heteroaryl group as defined above, preferably an optionally substituted benzimidazolyl group as defined above.

[0672] In a further preferred embodiment, R 1 and R 2 are different, one being hydrogen and the other being an optionally substituted alkyl group. More preferably, one of R 1 and R 2 is hydrogen and the other is an alkyl residue which

[0673] - substituted by an optionally substituted aryl as defined above, preferably substituted by an optionally substituted phenyl as defined above, or

[0674] - substituted by an optionally substituted heteroaryl as defined above, preferably substituted by the following groups

[0675] - an optionally substituted pyridyl,

[0676] - an optionally substituted pyridazinyl,

[0677] - an optionally substituted pyrimidinyl,

[0678] - an optionally substituted pyrazolyl,

[0679] - an optionally substituted imidazolyl.

[0680] Even more preferably, one of R 1 and R 2 is hydrogen and the other is an alkyl residue substituted by the following groups

[0681] - an optionally substituted phenyl,

[0682] - an optionally substituted pyridyl,

[0683] - an optionally substituted pyridazinyl,

[0684] - an optionally substituted pyrimidinyl,

[0685] Even more preferably, one of R 1 and R 2 is hydrogen and the other is an alkyl residue substituted by the following groups

[0686] - an optionally substituted phenyl, preferably a substituted phenyl as defined above, or

[0687] - an optionally substituted pyridyl,

[0688] wherein the optionally substituted pyridyl as a substituent of the alkyl residue of one of R 1 and R 2 is most preferred.

[0689] More preferably, a halogen-substituted pyridyl is selected, such as especially a pyridyl substituted by a fluorine substituent, such as especially a group according to the following formula

[0690]

[0691] Even further preferably, in the embodiments defined above, Ar has the meaning of a bicyclic heteroaryl, such as especially benzimidazole, especially benzimidazol-2-yl according to the following formula

[0692]

[0693] More preferably, in the present case, A 1 and A 2 are each an optionally substituted alkanediyl as defined above. For example, excellently, A 1 and A 2 are the same and are methylene, or A 1 and A 2 are the same and are ethane-1,2-diyl, or A 1 is methylene and A 2 is ethane-1,2-diyl, or A 1 is ethane-1,2-diyl and A 2 is methylene. More preferably, A 1 and A 2 are the same and are ethane-1,2-diyl, or A 1 is ethane-1,2-diyl and A 2 is methylene, or in which A 1 and R 3 together with the nitrogen atom to which they are attached form an optionally substituted 4-membered monocyclic ring, and A 2 is ethane-1,2-diyl.

[0694] Particularly preferably, the compounds according to the invention are compounds selected from the following:

[0695]

[0696]

[0697]

[0698]

[0699]

[0700]

[0701]

[0702]

[0703]

[0704]

[0705]

[0706]

[0707]

[0708]

[0709]

[0710]

[0711]

[0712]

[0713]

[0714]

[0715]

[0716]

[0717]

[0718]

[0719]

[0720]

[0721]

[0722]

[0723]

[0724]

[0725]

[0726]

[0727]

[0728]

[0729]

[0730]

[0731] or a pharmaceutically acceptable salt thereof.

[0732] More preferably, compounds according to formula (A-II), wherein Cycl is an optionally substituted, optionally fused heteroaryl, for example, Example Nos.:

[0733] 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 35, 36, 37, 38, 39, 40, 42, 43, 44, 45, 46, 47, 48, 49, 54, 55, 56, 57, 58, 59, 60, 61, 64, 76, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 108, 109, 110, 111, 112, 113, 114, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 131, 132, 134, 135, 136, 137, 138, 141, 142, 144, 145, 148, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 169, 170, 171, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 186, 187, 188, 189, 191, 192, 193, 194, 195, 196, 198, 199, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 218, 219, 220, 223, 226, 227, 228, 230, 231, 233, 236, 239, 242, 243, 244, 247, 249, 250, 251, 252, 253, 255, 256, 257, 258, 261, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279 and 280.

[0734] More preferably, compounds according to formula (A-II), wherein Cycl is an optionally substituted, optionally fused 6-membered heteroaryl, for example, Example Nos.:

[0735] 1, 2, 3, 4, 5, 6, 7, 8, 12, 35, 36, 37, 38, 39, 40, 42, 43, 44, 45, 46, 47, 48, 49, 54, 55, 56, 57, 58, 59, 61, 76, 79, 80, 81, 82, 83, 87, 89, 90, 92, 93, 94, 96, 97, 98, 99, 101, 102, 103, 104, 105, 106, 108, 109, 110, 111, 112, 113, 114, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 131, 132, 134, 135, 136, 137, 138, 141, 142, 144, 145, 148, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 169, 170, 171, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 186, 187, 188, 189, 191, 192, 193, 194, 195, 196, 198, 199, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 218, 219, 220, 223, 226, 227, 228, 230, 231, 233, 236, 239, 242, 243, 244, 247, 249, 250, 251, 252, 253, 255, 256, 257, 258, 261, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279 and 280.

[0736] Preferably a compound according to formula (A-II), wherein Cycl is an optionally substituted, optionally fused pyridyl group, for example Example No.:

[0737] 1, 2, 3, 4, 5, 6, 7, 8, 12, 35, 36, 37, 38, 39, 40, 42, 43, 45, 47, 48, 49, 54, 55, 56, 57, 58, 59, 76, 79, 80, 81, 82, 83, 89, 90, 92, 94, 96, 97, 98, 99, 101, 102, 103, 104, 105, 106, 108, 109, 110, 111, 112, 113, 114, 116, 117, 118, 119, 120, 121, 123, 124, 125, 126, 127, 128, 131, 132, 134, 135, 136, 137, 138, 141, 142, 144, 145, 148, 150, 151, 152, 153, 154, 156, 157, 158, 159, 160, 162, 163, 164, 165, 166, 167, 169, 170, 171, 173, 176, 177, 179, 180, 181, 184, 186, 187, 189, 191, 192, 193, 194, 195, 196, 198, 199, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 218, 219, 220, 223, 226, 227, 228, 230, 231, 233, 236, 239, 242, 243, 247, 249, 250, 251, 252, 253, 255, 256, 257, 258, 264, 265, 266, 267, 268, 269, 272, 273, 274, 275, 276, 277, 278, 279 and 280.

[0738] Preferably a compound according to formula (A-II), wherein Cycl is an optionally substituted, optionally fused pyridyl group having a 5-membered heterocycle according to (A-6-b), thereby forming an oxazolyl ring, for example Example numbers: 126, 127, 128, 137, 141, 171, 173, 206, 207, 208, 223, 226, 227, 228, 230, 233, 236, 239, 247, 249, 250, 251, 252, 253, 255, 256, 257, 258, 264, 265, 266, 267, 268, 269, 272, 273;

[0740] and / or having a 5-membered heterocycle according to (A-6-c), forming a thiazolyl ring, for example Example numbers: 12, 35, 36, 37, 38, 39, 40, 42, 43, 45, 47, 54, 55, 56, 57, 58, 59, 76, 79, 80, 81, 82, 83, 89, 90, 94, 96, 97, 98, 99, 101, 102, 103, 104, 105, 106, 108, 110, 112, 113, 114, 116, 118, 119, 120, 121, 123, 124, 125, 134, 135, 148, 151, 152, 154, 157, 158, 159, 160, 163, 164, 165, 166, 176, 177, 179, 180, 184, 186, 189, 193, 194, 195, 196, 199, 209, 211, 212, 213, 214, 215, 218, 231, 242, 243, 274, 275, 276;

[0742] and / or having a 5-membered heterocycle according to (A-6-g) and / or (A-6-h), thereby forming an isoxazolyl or isothiazolyl ring, for example, Example Nos.:

[0743] 1, 2, 3, 4, 5, 6, 7, 8 and 280;

[0744] and / or having a 5-membered heterocycle according to (A-6-e) and / or (A-6-f), forming a triazolyl ring, for example, Example Nos.:

[0745] 169, 170, 181, 277.

[0746] Furthermore, R 1 / R 2 one of the compounds having a fluorine-substituted pyridyl group is preferred, for example, Example Nos.:

[0747] 1, 2, 3, 4, 5, 6, 7, 8, 40, 94, 112, 113, 114, 118, 119, 120, 121, 125, 126, 127, 128, 134, 135, 148, 151, 152, 154, 157, 163, 164, 165, 166, 169, 176, 177, 179, 180, 181, 186, 193, 196, 199, 206, 208, 209, 211, 212, 213, 214, 218, 223, 226, 227, 228, 230, 231, 233, 239, 242, 243, 247, 249, 250, 251, 253, 255, 256, 257, 264, 265, 266, 267, 268, 269, 272, 273, 274, 275, 276, 277, 279 and 280.

[0748] Pharmaceutically acceptable salts of the compounds according to the invention include, for example, salts containing anions such as carboxylates, sulfonates, sulfates, chlorides, bromides, iodides, phosphates, tartrates, methanesulfonates, hydroxyethanesulfonates, glycine salts, maleates, propionates, fumarates, toluenesulfonates, benzenesulfonates, trifluoroacetates, naphthalenedisulfonates-1,5, salicylates, benzoates, lactates, malates, addition salts of 3-hydroxy-2-naphthoic acid-2, citrates and acetates.

[0749] Pharmaceutically acceptable salts of the compounds according to the invention further include, for example, addition salts with suitable pharmaceutically acceptable bases, such as, for example, addition salts of hydroxides of alkali metals or alkaline earth metals: for example, NaOH, KOH, Ca(OH)2, Mg(OH)2, etc., amine compounds such as ethylamine, diethylamine, triethylamine, ethyldiisopropylamine, ethanolamine, diethanolamine, triethanolamine, methylglucamine, dicyclohexylamine, dimethylaminoethanol, procaine, dibenzylamine, N-methylmorpholine, arginine, lysine, ethylenediamine, N-methylpiperidine, 2-amino-2-methyl-propanol-(1), 2-amino-2-methyl-propanediol-(1,3), 2-amino-2-hydroxymethyl-propanediol-(1,3) (TRIS), etc.

[0750] Depending on their structure, in the presence of asymmetric carbon atoms, the compounds according to the invention can occur in stereoisomeric forms (enantiomers, diastereoisomers). The invention thus includes the use of enantiomers or diastereoisomers and their respective mixtures. The pure enantiomeric forms can optionally be obtained by conventional optical resolution methods, such as fractional crystallization from their diastereoisomers by reaction with an optically active compound. Since the compounds according to the invention can exist in tautomeric forms, the invention encompasses the use of all tautomeric forms.

[0751] The compounds provided by the invention can exist as mixtures of various possible isomeric forms, especially stereoisomers, such as, for example, E- and Z-, syn and anti, and optical isomers. What is claimed are the E-isomers and Z-isomers, as well as the optical isomers and any mixtures of these isomers.

[0752] The new compounds of the invention can exist in amorphous, crystalline or partially crystalline form or they can also exist in the form of hydrates.

[0753] It has unexpectedly been found that the novel compounds according to formula (A-I) as defined above and further embodiments thereof have the effect of being a ferroportin inhibitor and are thus suitable for use as medicaments, in particular as ferroportin inhibitors.

[0754] As already explained above, ferroportin is an iron transport protein which is responsible for absorbing the iron released by intestinal absorption and transporting it into the blood circulation, thereby delivering the iron to the appropriate tissues and organs. Inactivation or inhibition of ferroportin prevents the output of iron, thereby reducing iron absorption in the intestine. Inhibition of ferroportin thus includes, in the context of the present invention, inhibiting the transport of iron from cells into the blood circulation and inhibiting iron absorption in the intestine. Among them, the inhibition of iron transport and / or iron recycling can be affected by different mechanisms, including, for example, inhibiting the iron transport activity of ferroportin and thus inhibiting iron recycling, stimulating the internalization, degradation and / or reduction of ferroportin, administering hepcidin agonists (i.e., compounds that compete with hepcidin or inhibit the binding of hepcidin to ferroportin).

[0755] Inhibition of ferroportin can be determined by measuring the inhibition of ferroportin-mediated iron transport activity in an iron response assay (BLAzer assay), as described in detail in the following examples. Furthermore, inhibition of ferroportin can be determined by measuring the internalization and / or degradation of ferroportin in an internalization and degradation assay of ferroportin (FACS) or by examining the ubiquitination and degradation of ferroportin, as described in detail in the following examples. Furthermore, inhibition of ferroportin can be determined by measuring the activity as a hepcidin agonist, for example, by determining the ability of hepcidin to bind to ferroportin in a hepcidin internalization assay (J774), as described in detail in the following examples. Furthermore, inhibition of ferroportin can be determined by, for example, confirming the inhibition of hepcidin binding to ferroportin in a biophysical ferroportin-hepcidin binding assay (Hep Bind FP), as described in detail in the following examples. Furthermore, inhibition of ferroportin can be determined by measuring the activity of the compound in terms of its ability to block iron output by ferroportin, for example, by measuring the inhibition of iron efflux, as described in detail in the following examples.

[0756] Inhibition of ferroportin can thus be defined, in the context of the present invention, in particular by demonstrating an inhibitory activity of ferroportin in at least one of the aforementioned test methods, in particular as shown by:

[0757] In the iron response assay (Blazer assay), inhibition of ferroportin-mediated iron transport activity: IC 50The value [μm] is not more than 100 (≤100), preferably not more than 50 (≤50), more preferably less than 50 (<50).

[0758] Internalization and degradation assay of ferroportin (FACS): EC 50 The value [μm] is not higher than 100 (≤100), preferably not more than 50 (≤50), more preferably less than 50 (<50).

[0759] Ubiquitination and degradation of ferroportin: Visual detection effect of Western blot, + compared to hepcidin, "effect of intermediate is +", and "effect of stronger intermediate is + / + / −", preferably the effect "+" or "+ / + / −", and most preferably the effect "+".

[0760] Hepcidin internalization assay (J774): IC 50 The value is not higher than 100 (≤100), preferably not more than 50 (≤50), more preferably less than 50 (<50).

[0761] Biophysical ferroportin - hepcidin binding assay: IC 50 The value is not more than 100 (≤100), preferably not more than 50 (≤50), more preferably less than 50 (<50).

[0762] Inhibition of iron efflux: IC 50 The value is not more than 100 (≤100), preferably not more than 50 (≤50), more preferably less than 50 (<50).

[0763] The inhibition of ferroportin can be further determined in in - vivo models, as described in more detail in the following examples. Suitable in - vivo models can include, for example, examination of hypoferremia in naive mice by measuring the decrease in serum iron; prevention of iron absorption in anemic rats by measuring the inhibition of serum iron; correction of hyperferremia in β2 - microglobulin - deficient mice by measuring the decrease in serum iron; prevention of iron overload in β2 - microglobulin - deficient mice by measuring the total iron in the spleen or liver; examination of the improvement of anemia, ineffective erythropoiesis and iron overload in β - thalassemia intermedia mouse models.

[0764] The activity of the compounds of the present invention as ferroportin inhibitors can be determined especially by the methods described in the following examples.

[0765] As further described above, ferroportin inhibition can, for example, be affected by hepcidin, which is thus a key regulator of iron uptake, inhibition of ferroportin, and thus blocking of iron transport from cells to the bloodstream and iron uptake. Additionally, it has unexpectedly been found that several of the compounds defined herein act as hepcidin mimetics or hepcidin agonists, which in the context of the present invention also include inhibition of ferroportin.

[0766] Accordingly, the compounds defined in the present invention are also suitable for inhibiting the transport of iron from cells to the bloodstream and for inhibiting iron uptake in the intestine, and are also suitable as hepcidin mimetics or hepcidin agonists.

[0767] Due to the activity of the compounds defined herein as ferroportin inhibitors, the compounds of the present invention are further particularly suitable for inhibiting ferroportin-mediated iron transport and are thus suitable for preventing and / or treating iron metabolism disorders leading to increased iron levels, diseases associated with increased iron levels, increased iron uptake or iron overload, especially tissue iron overload, or diseases caused by increased iron levels, increased iron uptake or iron overload, especially tissue iron overload, diseases associated with ineffective erythropoiesis, or diseases caused by reduced hepcidin levels. Furthermore, the compounds of the present invention are suitable for adjuvant therapy by restricting the amount of iron available to pathogenic microorganisms, such as Vibrio vulnificus, and thereby preventing or treating infections caused by such pathogenic microorganisms.

[0768] Among them, diseases associated with, related to, caused by, or leading to increased iron levels, increased iron uptake, iron overload (such as tissue iron overload) or ineffective erythropoiesis include thalassemia, hemoglobinopathies, such as hemoglobin E disease (HbE), hemoglobin H disease (HbH), hemochromatosis, hemolytic anemias, such as sickle cell anemia (sickle cell disease) and congenital dyserythropoietic anemia.

[0769] Diseases associated with, related to, caused by, or leading to increased iron levels, increased iron uptake, iron overload (such as tissue iron overload) further include neurodegenerative diseases, such as, for example, Alzheimer's disease and Parkinson's disease, in which the compound is thought to act by restricting iron deposition or increasing in tissues or cells.

[0770] The compounds of the present invention are further applicable to the prevention and / or treatment of the formation of free radicals, reactive oxygen species (ROS) and oxidative stress due to iron excess or iron overload, and are also applicable to the prevention and / or treatment of cardiac, hepatic and endocrine damage caused by iron excess or iron overload, and further applicable to the prevention and / or treatment of inflammation triggered by iron excess or iron overload.

[0771] Diseases associated with ineffective erythropoiesis particularly include myelodysplastic syndromes (MDS, myelodysplasia) and polycythemia vera, as well as congenital dyserythropoietic anemia.

[0772] Further diseases, disorders and / or morbid conditions include iron overload caused by mutations in genes involved in sensing systemic iron stores, such as hepcidin (Hamp1), hemochromatosis protein (HFE), hepcidin regulatory protein (HJV) and transferrin receptor 2 (TFR2), such as in particular diseases associated with HFE and HJV gene mutations, chronic hemolysis-related diseases, sickle cell diseases, erythrocyte membrane disorders, glucose-6-phosphate dehydrogenase deficiency (G6PD deficiency), erythropoietic porphyria, Refsum's ataxia, and iron overload subgroups such as transfusion iron overload, iron poisoning, pulmonary hemosiderosis, osteopenia, insulin resistance, African iron overload, Hallervorden-Spatz disease, hyperferritinemia, aceruloplasminemia, neonatal hemochromatosis and erythrocyte disorders (including thalassemia, including alpha-thalassemia, beta-thalassemia and delta-thalassemia, intermediate thalassemia, sickle cell diseases and myelodysplastic syndromes).

[0773] Further diseases and / or disorders and / or morbid conditions associated with elevated iron levels include, but are not limited to, diseases with elevated iron levels, including ataxia, Refsum's ataxia, age-related macular degeneration, age-related cataract, age-related retinal diseases and neurodegenerative diseases such as pantothenate kinase-associated neurodegeneration, restless legs syndrome and Huntington's disease.

[0774] The compounds of the present invention are further applicable to the prevention and treatment of diseases caused by hepcidin deficiency.

[0775] In view of this, a further object of the present invention relates to a pharmaceutical product comprising one or more of the compounds as defined above, such as in particular a pharmaceutical product for the prevention and treatment of any indication, state, disorder or disease as defined above.

[0776] A further object of the present invention relates to pharmaceutical compositions and medicaments which comprise one or more of the compounds according to the invention as defined above, and optionally one or more pharmaceutically acceptable carriers and / or adjuvants and / or solvents. A further object of the present invention relates to pharmaceutical compositions and medicaments which comprise one or more of the compounds according to the invention as defined above, and optionally one or more further pharmaceutically active compounds. The pharmaceutical composition comprises, for example, up to 99% by weight or up to 90% by weight or up to 80% by weight or up to 70% by weight of the compound of the present invention, the remainder being formed respectively by pharmaceutically acceptable carriers and / or adjuvants and / or solvents and / or optionally further pharmaceutically active compounds.

[0777] Among them, the pharmaceutically acceptable carrier, adjuvant or solvent is a common pharmaceutical carrier, adjuvant or solvent, including various organic or inorganic carriers and / or auxiliary materials commonly used for pharmaceutical purposes, especially for solid pharmaceutical preparations. Examples include excipients such as sucrose, starch, mannitol, sorbitol, lactose, glucose, cellulose, talc, calcium phosphate, calcium carbonate; binders such as cellulose, methylcellulose, hydroxypropylcellulose, polypropylpyrrolidone, gelatin, gum arabic, polyethylene glycol, sucrose, starch; disintegrants such as starch, hydrolyzed starch, carboxymethylcellulose, calcium salt of carboxymethylcellulose, hydroxypropyl starch, sodium glycol starch, sodium bicarbonate, calcium phosphate, calcium citrate; lubricants such as magnesium stearate, talc, sodium dodecylbenzenesulfonate; edible flavors such as citric acid, menthol, glycine, orange powder; preservatives such as sodium benzoate, sodium bisulfite, parabens (for example, methyl paraben, ethyl paraben, propyl paraben, butyl paraben); stabilizers such as citric acid, sodium citrate, acetic acid and polycarboxylic acids from the titriplex series, for example, for example, diethylenetriaminepentaacetic acid (DTPA); suspending agents such as methylcellulose, polyvinylpyrrolidone, aluminum stearate; dispersants; diluents such as water, organic solvents; waxes, fats and oils such as beeswax, cocoa butter; polyethylene glycol; white petrolatum; and so on.

[0778] Liquid pharmaceutical preparations, such as solutions, suspensions and gels, usually contain a liquid carrier, such as water and / or a pharmaceutically acceptable organic solvent. Moreover, such liquid preparations may also contain pH-adjusting agents, emulsifying or dispersing agents, buffers, preservatives, wetting agents, gelling agents (for example, methylcellulose), dyes and / or flavoring agents, as defined above. The compositions are isotonic, i.e., they may have the same osmotic pressure as blood. The isotonicity of the compositions can be adjusted by using sodium chloride and other pharmaceutically acceptable reagents, for example, glucose, maltose, boric acid, sodium tartrate, propylene glycol and other inorganic or organic soluble substances. The viscosity of the liquid compositions can be adjusted by a pharmaceutically acceptable thickening agent, such as methylcellulose. Other suitable thickening agents include, for example, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, carbomer, and the like. The preferred concentration of the thickening agent will depend on the reagent selected.

[0779] Pharmaceutically acceptable preservatives can be used to increase the shelf life of the liquid compositions. Benzyl alcohol is suitable, even though a variety of preservatives including, for example, parabens, thimerosal, chlorobutanol and benzalkonium chloride can also be used.

[0780] The pharmaceutical compositions mentioned above are suitable for, for example, intravenous, intraperitoneal, intramuscular, vaginal, oral, percutaneous, subcutaneous, mucocutaneous, oral, rectal, transdermal, topical, intradermal, intragasteral or intracutaneous administration and, for example, are provided in the form of pills, tablets (enteric-coated tablets), film tablets, layered tablets, sustained-release preparations for oral, subcutaneous or skin administration (especially as plasters), long-acting preparations, dragees, suppositories, gels, ointments, syrups, granules, suppositories, emulsions, dispersions, microcapsules, micro-formulations, nano-formulations, liposomal formulations, capsules, enteric-coated capsules, powders, inhalable powders, microcrystalline formulations, inhalable sprays, epipastics, drops, nasal drops, nasal sprays, aerosols, ampoules, solutions, fruit juices, suspensions, infusion solutions or injection solutions, etc.

[0781] A further object of the present invention relates to a pharmaceutical or combination preparation which contains one or more compounds as defined above and at least one further pharmaceutically active compound (e.g., especially a compound for preventing and treating iron overload and related symptoms, preferably an iron chelating compound, or a compound for preventing and treating any of the states, disorders or diseases defined above, e.g., especially a pharmaceutically active compound for preventing and treating thalassemia, hemochromatosis, neurodegenerative diseases (such as Alzheimer's disease or Parkinson's disease) and related symptoms).

[0782] A further object of the present invention relates to the use of a compound as defined above per se and one or two other active ingredients (drugs) in combination therapy (a combination of fixed doses or free doses for sequential use). Such combination therapy involves co-administering the compound of the present invention and at least one additional pharmaceutically active compound (drug). In combination therapy with fixed doses, the combination therapy involves co-administering the compound of the present invention and at least one additional pharmaceutically active compound in the form of a preparation with fixed doses. In combination therapy with free doses, the combination therapy involves co-administering the compound of the present invention and at least one additional pharmaceutically active compound with free doses of the respective compounds by simultaneous administration of a single compound or by sequential use of a single compound over a distributed period of time. The at least one additional pharmaceutically active compound (drug) especially includes drugs for reducing iron overload (such as Tmprss6-ASO) or iron chelators, especially curcumin, SSP-004184, Deferitrin, deferasirox, deferoxamine and / or deferiprone; or antioxidants, such as n-acetylcysteine, anti-diabetic drugs such as GLP-1 receptor agonists, antibiotics such as Vancomycin (Van) or tobramycin, drugs for treating malaria, anti-cancer agents, anti-fungal drugs, drugs for treating neurodegenerative diseases, such as Alzheimer's disease and Parkinson's disease (such as dopamine agonists, such as Levodopa), antiviral drugs such as interferon-α or ribavirin, or immunosuppressants (cyclosporin A or derivatives of cyclosporin A), iron supplements, vitamin supplements, erythropoiesis-stimulating agents, anti-inflammatory biologics, anti-thrombolytics, statins, pressor drugs and inotropic compounds.

[0783] A further object of the present invention relates to the use of the above-mentioned combination medication for preventing and / or treating diseases or iron metabolism disorders caused by the lack of hepcidin, such as especially iron overload states, such as especially thalassemia and hemochromatosis and other disorders described in the present application.

[0784] A further object of the present invention relates to the use of the compounds defined in the present case, or the combination therapies described above in the present case, in combination with blood transfusion.

[0785] The compounds, medicaments and / or combination preparations according to the invention can be administered orally, parenterally and intravenously.

[0786] For this purpose, the compounds according to the invention are preferably provided as pills, tablets (e.g. enteric-coated tablets), film tablets and multi-layer tablets, sustained-release preparations, long-acting preparations, dragees, granules, emulsions, dispersions, microcapsules, micro-formulations, nano-formulations, liposomal formulations, capsules (e.g. enteric-coated capsules), powders, microcrystalline formulations, dusting powders, drops, ampoules, solutions, suspensions, infusion solutions or injection solutions or in the form of preparations suitable for inhalation for the medicament or pharmaceutical composition.

[0787] In a preferred embodiment of the present invention, the compound is administered in the form of a tablet or capsule as defined above. These can, for example, be in an acid-resistant form or with a pH-dependent coating.

[0788] The compounds according to the invention as active substances can, for example, be administered in unit doses of 0.001 mg / kg to 500 mg / kg body weight, for example 1 to 4 times a day. However, this dose can be increased or decreased depending on the age, weight, state of health, severity of the disease or type of medicament administered to the patient.

[0789] Accordingly, a further object of the present invention relates to the use of the compounds, medicaments, compositions and combination preparations as defined above for the preparation of medicaments, in particular for the prevention and treatment of any indication, condition, disorder or disease as defined above, in particular for oral or parenteral administration.

[0790] A further object of the present invention relates to a method for preventing and treating as defined above by administering to a patient (human or animal) in need thereof the compounds, medicaments, compositions or combination preparations as defined above, for example in particular for the prevention and / or treatment of iron metabolism disorders, increased iron levels or iron overload, diseases related to or leading to increased iron levels and in particular iron overload, iron storage diseases related to or leading to increased iron levels, and diseases related to ineffective erythropoiesis.

[0791] Among them, diseases related to, associated with, caused by, or leading to increased iron levels or iron overload are defined as above.

[0792] A further object of the present invention relates to the use of a compound as defined above for the preparation of a medicament, in particular for prophylaxis and treatment, and to the use of a compound as defined above for any indication, condition, disorder or disease as defined above.

[0793] The compounds of general formulae (A-I) and (I) according to the invention can be obtained substantially by the following methods and the general processes (general schemes) shown. Accordingly, a further object of the present invention is a method for preparing a compound of general formula (A-I) as described herein, the method comprising:

[0794] a) reacting a compound of formula (a)

[0795]

[0796] with a compound of formula (b) NH-R 1 R 2 to obtain a compound of formula (c)

[0797]

[0798] and

[0799] b) further reacting the compound (c) with a compound of formula (d)

[0800] wherein n = 0 to 7, preferably 0 to 5, preferably 0 to 1 or 2,

[0801] to obtain a compound of formula (A-I);

[0802] wherein R 1 、R 2 、Z、A 1 、R 3 and Ar have the meanings as defined above. In principle, the order of the reaction steps is optional. It is further possible to start with the reaction of compound (a) with compound (d), followed by reaction with compound (b) to obtain a compound of formula (A-I). Further intermediate steps are possible and several intermediate compounds are obtained as detailed in the following examples. Several intermediate compounds are also new compounds and should be covered by the present invention. <00>

[0803] A further object of the present invention is a method for producing a compound of general formula (I) as described herein, the method comprising:

[0804] a) reacting a compound of formula (a)

[0805]

[0806] with a compound of formula (b) NH-R 1 R2 Reaction

[0807] to obtain the compound of formula (c)

[0808] and

[0809] b) Then reacting the compound (c) with a compound of formula (d)

[0810] where n = 0 to 7, preferably 0 to 5, more preferably 0 to 1 or 2,

[0811] to obtain the compound of formula (I);

[0812] wherein X 1 , Y 1 , R 1 , R 2 , Z, A 1 , R 3 and Ar have the meanings as defined in the present case. In principle, the order of the reaction steps is optional. Further, it is possible to start with the reaction of compound (a) with compound (d), followed by reaction with compound (b) to obtain the compound of formula (I). Several further intermediate steps are possible and several intermediate compounds as detailed in the following examples are obtained. Several intermediate compounds are also new compounds and should be covered by the present invention.

[0813]

[0814]

[0815]

[0816]

[0817]

[0818]

[0819]

[0820]

[0821]

[0822]

[0823]

[0824]

[0825]

[0826]

[0827]

[0828]

[0829]

[0830]

[0831]

[0832]

[0833]

[0834]

[0835] Example

[0836] The present invention is described in more detail by the following examples. These examples are for illustration only, and those skilled in the art can extend the specific examples to further compounds to be protected.

[0837] Pharmacological tests

[0838] 1. Hepcidin internalization test (J774)

[0839] This cellular assay allows quantification of hepcidin binding to ferroportin (Fpn) by microscopically detecting the internalization of fluorescently labeled hepcidin into J774 cells. J774 is a mouse macrophage cell line that has been shown to endogenously express Fpn when incubated with iron (Knutson et al., 2005). Hepcidin bound to Fpn triggers the internalization and degradation of both hepcidin and Fpn. However, after degradation of the hepcidin peptide backbone, the TMR (6-carboxytetramethylrhodamine) fluorophore bound to hepcidin remains associated with the cells. Therefore, microscopic detection of cell-associated TMR fluorescence is a measure of hepcidin binding to Fpn and internalization of both. If TMR-hepcidin binding to Fpn is blocked, cellular TMR fluorescence remains low (Dürrenberger et al., 2013). As described below, the in vitro effects of low-molecular-weight Fpn inhibitor compounds were evaluated in this assay.

[0840] J774 cells cultured at about 80% confluence were collected and plated at 8 × 10 5Cells were seeded at a density of 50 cells / ml in 100 μl per well of complete medium (DMEM, 10% FBS, 1% penicillin-streptomycin) containing 200 μM Fe(III)NTA (nitrilotriacetic acid) in 96-well MicroClear plates (Greiner; Cat. 655090) and grown at 37 °C in 5% CO2. After overnight incubation, the cells were washed three times with pre-warmed DMEM w / o phenol red. After the final wash, 30 μl of DMEM w / o phenol red was added per well and 10 μl of serially diluted test compound was added in triplicate per well. J774 cells were pre-incubated with the test compound for 15 min at 37 °C in 5% CO2, followed by the addition of holo-ferritin at a final concentration of 25 nM. The cells were incubated for 2 h at 37 °C in 5% CO2 in a total volume of 50 μl, after which Hoechst 33342 dye was added to a final concentration of 0.5 μg / ml to stain the nuclei and the cells were incubated for 10 min at 37 °C in 5% CO2. The cells were washed three times with PBS and fixed in 100 μl of 4% paraformaldehyde in PBS for 15 min at room temperature. After removal of the paraformaldehyde solution, the cells were washed three times with PBS, leaving 100 μl per well, and the plates were sealed with aluminum foil. Fluorescence images of TMR (530 - 550 nm excitation / 575 - 625 nm emission / 400 ms exposure time) and Hoechst 33342 (360 - 370 nm excitation / 420 - 460 nm emission / 10 ms exposure time) were acquired using a ScanR plate imager (Olympus) with a 20× high NA objective. Four pictures were taken per well and the fluorescence channels covered approximately 1500 cells per well. The acquired image data were analyzed using ScanR image analysis software. Image analysis included detection of nuclei (Hoechst 33342 fluorescence), identification of cell-associated regions, application of a virtual channel, and thresholding to reduce rolling ball type background, followed by application of a sum (mean) algorithm to measure cell-associated TMR fluorescence as a quantitative measure of internalized holo-ferritin. The IC 50 values were calculated by fitting a "log(inhibitor) vs response" curve to the sum (mean) raw data using Prism5 software (GraphPad Software Inc., version 5.02). For each data set, the fit of the "log(inhibitor) vs response (three parameter)" model was compared to the fit of the "log(inhibitor) vs response - variable slope (four parameter)" model and the IC 50 data using the preferred model were used. The IC 50 data for Fpn inhibitors determined in the holo-ferritin internalization assay are listed in Table 1. The IC

[0841] for unlabeled holo-ferritin in this assay was 0.015 ± 0.011 μM.Table 1 Mean (AVE) IC of Fpn inhibitors measured in the hepcidin internalization assay 50 Data are shown as multiple measurements.

[0842] Table 1

[0843]

[0844]

[0845] 2. Biophysical membrane ferroportin - hepcidin binding assay

[0846] Biophysical assays were used to more directly confirm the inhibition of hepcidin binding to ferroportin (Fpn). TMR - hepcidin was incubated with human Fpn purified from Pichia pastoris yeast cells expressing human Fpn with a C - terminal FLAG affinity tag (Bonaccorsi di Patti, 2014), resulting in an increase in the fluorescence polarization (FP) of the TMR - hepcidin ligand. Small - molecular - weight Fpn inhibitors were used to test the inhibition of TMR - hepcidin binding to Fpn, which was determined by a dose - dependent decrease in the TMRFP signal, as detailed below.

[0847] A mixture of 1.3 μM human Fpn and 30 nM TMR - hepcidin in FP assay buffer containing 50 mM Tris - HCl pH 7.3, 200 mM NaCl, 0.02% DDM, 0.1% BSA was added at 16 μl per well to a 384 - well black low - volume round bottom plate (Corning, Cat. 3677). 8 μl of serial dilutions of the test compound were added in duplicate to achieve final Fpn and TMR - hepcidin concentrations of 1 μM and 20 nM, respectively. The plate was incubated at room temperature for 90 minutes, and parallel (S) and perpendicular (P) fluorescence were measured in a Synergy H1 fluorescence reader (BioTek). FP values were calculated in mP according to the formula below.

[0848]

[0849] IC 50 values were determined as the calculated mP values, as described in the hepcidin internalization assay, and are listed in Table 2. The IC 50 of unlabeled hepcidin in this assay was 0.37 ± 0.067 μM.

[0850] Table 2 Mean (AVE) IC of Fpn inhibitors tested in the biophysical hepcidin - membrane ferroportin binding assay 50 Data are shown as multiple measurements.

[0851] Table 2

[0852] Compound number of the example FPIC50 (μM) 1 0.016 2 0.017 3 0.071 5 0.0511 7 0.18 8 0.282

[0853] Table 2 - continued

[0854]

[0855]

[0856] 3. Inhibition of ferroportin - mediated iron export activity in the iron response assay

[0857] In this assay, intracellular iron levels were indirectly measured by monitoring the activity of a β - lactamase (BLA) reporter gene fused to the human ferritin promoter and an iron - regulatory element (IRE) containing the 5' untranslated region of ferritin mRNA. Expression of ferroportin (Fpn) in such cell lines results in iron efflux and lower iron levels, which are reflected by lower activity of the reporter gene. On the other hand, inhibition of Fpn - mediated iron efflux leads to increased cellular iron levels, which are detected by an increase in reporter gene activity. As described below, the dose - dependent effects of small - molecular - weight Fpn inhibitor compounds were measured in this in vitro iron response assay.

[0858] The HEK - 293 cell line #354 was generated by (i) insertion of a human Fpn - GFP fusion construct into a derivative of the doxycycline - inducible pTRE - Tight - BI plasmid (Clontech, Cat. 631068) and (ii) stable integration of a human ferritin promoter - BLA reporter gene into a derivative of the HEK - 293Tet - ON Advanced cell line (Clontech). To generate the ferritin - BLA reporter gene construct, a 1.4 kb fragment of the human ferritin H promoter was amplified by PCR from human genomic DNA (upstream primer 5’ - CAGGTTTGTGAGCATCCTGAA - 3’; downstream primer 5’ - GGCGGCGACTAAGGAGAGG - 3’) and inserted in front of the BLA gene present in the pcDNA TM 6.2cGeneBLAzer TM -DEST plasmid (Invitrogen, Cat. 12578 - 043), thereby replacing the original CMV promoter and positioned at the IRE that regulates ferritin gene translation, approximately 170 bp upstream of the start codon of the reporter gene. Cells #354 were harvested from a confluent culture of approximately 80% and seeded at 1.8×10 5 cells / ml in DMEM / F12 GlutaMAX TMIn the medium (Invitrogen, Cat. 31331-028), which contains 10% FBS (Clontech, Cat. 631106), 1% penicillin-streptomycin, 200 μg / ml hygromycin B (Invitrogen, Cat. 10687-010), 5 μg / ml blasticidin (Invitrogen, Cat. R210-01), and 4 μg / ml doxycycline (Clontech, Cat. 631311), 50 μl per well was added to a 384-well PDL-coated plate and grown at 37 °C and 5% CO2. After overnight incubation, 10 μl / well of serial dilutions of the test compound were added in quadruplicate and the plate was incubated overnight again at 37 °C and 5% CO2. The cells were washed 3 times with HBSS and 25 μl was left in each well. BLA activity was detected by adding 5 μl / well of the GeneBlazer reagent CCF4-AM (Invitrogen, Cat. K1085) to the cells. After incubation in the dark at 18 °C for 60 min, the blue and green fluorescence signals were measured by a Safire2 fluorescence plate reader (Tecan), excited at 410 nm and emitted at 458 nm (blue) and 522 nm (green). The ratio of blue / green fluorescence, which is a measure of BLA activity, was calculated, and the EC 50 values were determined from the calculated ratio of blue / green fluorescence as described in the hepcidin internalization assay. The EC 50 data for the Fpn inhibitors tested are shown in Table 3. In this assay, the EC 50 of hepcidin was 0.096 ± 0.063 μM (n = 37).

[0859] Table 3 Mean (AVE) EC of Fpn inhibitors tested in the iron response assay 50 Data are shown as multiple measurements.

[0860] Table 3

[0861]

[0862] Table 3 - continued

[0863]

[0864]

[0865] 4. Ferroportin internalization and degradation assay

[0866] The ability of compounds to induce ferroportin (Fpn) internalization and degradation was measured by fluorescence-activated cell sorting (FACS) using the HEK-293 cell line #354 (described in Example 3). HEK-293 #354 cells were grown in medium containing doxycycline to induce the expression of human Fpn-GFP fusion protein on the cell surface. Data from 10 independent experiments showed that culturing HEK #354 cells in the presence of 4 μg / ml doxycycline for 48 h induced an average of 42.6% ± 6.4% of Fpn-GFP positive cells. The dose-dependent effect of small molecular weight Fpn inhibitor compounds was tested by the mean fluorescence intensity (MFI) of Fpn-GFP on the HEK-293 cell line #354, as described below.

[0867] HEK #354 cells were harvested from approximately 80% confluent cultures and seeded at 0.6 × 10 6 cells / ml in DMEM / F12 GlutaMAX TM medium (Invitrogen, Cat. 31331-028), which contained 10% FBS (Clontech, Cat. 631106), 1% penicillin-streptomycin (Invitrogen, Cat. 15140-122), 200 μg / ml hygromycin B (Invitrogen, Cat. 10687-010), 5 μg / ml blasticidin (Invitrogen, Cat. R210-01), 4 μg / ml doxycycline (Clontech, Cat. 631311), in 50 μl per well in a 384-well PDL-coated plate (Greiner; Cat. 781091) and grown at 37 °C and 5% CO2. After overnight incubation, 10 μl / well of serial dilutions of the test compounds were added in quadruplicate and the plate was incubated again at 37 °C and 5% CO2 overnight. The cells were washed once with FACS buffer (PBS containing 1% FBS, 2 mM EDTA and 0.05% NaN3), harvested in FACS buffer containing 0.5 μg / ml propidium iodide (SigmA, Cat. P4864) and analyzed on a flow cytometer (CANTO tmII, BD Biosciences). Live HEK #354 cells were gated as the propidium iodide-negative population and used for analysis of Fpn-GFP expression. The MFI of Fpn-GFP of >2000 live cells for each compound dilution was calculated using FlowJo (TreeStar's, Oregon), and the potency of Fpn-inhibitor-induced Fpn-GFP internalization and degradation was calculated as described in the hepcidin internalization assay. The EC 50 Data are listed in Table 4. In this assay, the mean EC 50 value of hepcidin was 0.004 ± 0.002 μM.

[0868] Table 4 Mean (AVE) EC of Fpn inhibitors tested in the ferroportin internalization and degradation assay 50 Data are shown as multiple measurements.

[0869] Table 4

[0870]

[0871] Table 4 - Continued

[0872]

[0873] 5. Ferroportin ubiquitination and degradation

[0874] Exposure of cells known to express the ferroportin (Fpn) has been shown to trigger Fpn ubiquitination and subsequent internalization and degradation (Qiao, 2012). The potential of Fpn inhibitors to induce Fpn ubiquitination and degradation was investigated using an immunoprecipitation assay with J774 mouse macrophage cell line expressing Fpn treated with iron.

[0875] J774 cells (DSMZ, Cat. ACC170) were seeded at 0.8 × 10 6Cells / ml were seeded in 15 ml of medium (DMEM Gibco Cat.11971-025, 10% heat-inactivated FBS Gibco Cat.10500-064, 1% penicillin-streptomycin Gibco Cat.15140-122) in a 10 cm tissue culture dish (Greiner Cat.664160), where the medium contained 200 μM Fe(III)-NTA, and grown overnight at 37 °C and 5% CO2. The cells were incubated with synthetic human hepcidin (Bachem, Cat.H-5926) or Fpn inhibitor compound for 10 min or 120 min. The cells were washed and lysed with ice-cold lysis buffer (Pierce, Life Technoligies, Cat.87787) containing 1× HALT protease inhibitor mixture (Life technologies, Cat.78429) and 10 mM iodoacetamide (SigmA, Cat.I6125) to stabilize ubiquitinated proteins. Immunoprecipitation was performed using the Pierce Classic IP kit (Life Technologies, Cat.26146) according to the manufacturer's manual. Briefly, 2 mg of protein in 1.25 ml of IP lysis buffer and control agarose beads were incubated at 4 °C for 1 h to pre-clear the lysate and reduce non-specific signals. Subsequently, the unbound lysate was incubated overnight with 12 μg of affinity-purified anti-Fpn antibody F308 antibody per reaction, where the antibody was a GST fusion protein against mouse Fpn amino acids 224-308. The immune complexes were captured by removing 14 μl of settled Pierce protein A / G Plus agarose beads (Life Technologies, Cat.20423) per reaction, and the slurry was incubated at 4 °C for 1.5 h with gentle inversion and mixing. The beads were washed, and the immune complexes were directly eluted with 75 μl of SDS NuPAGE LDS sample buffer (LifeTechnologies, Cat.NP0007) containing DTT (Life Technologies, Cat.NP0009).

[0876] After immunoprecipitation, samples were analyzed by Western blotting to detect ferroportin and ubiquitin using rabbit anti-mouse MTP1 antiserum (AlphaDiagnostic International, Cat. MTP11-A) and mouse monoclonal and polyubiquitinated complex monoclonal antibody (Enzo Lifesciences, Cat. BML-PW8810), respectively. Mouse monoclonal anti-rabbit IgG light chain (Abcam, Cat. ab99697) and anti-mouse IgG H&L (Abcam, Cat. ab6789) HRP conjugates were used as secondary antibodies.

[0877] Eleven Fpn inhibitors were selected and tested in this assay and compared with hepcidin. As Figure 1 and shown in Table 5, cells treated with Fpn inhibitors resulted in rapid ubiquitination of Fpn within 10 minutes ( Figure 1 above) and degradation after 2 hours ( Figure 1 below). The degree of Fpn degradation by Fpn inhibitors was comparable to the effect of hepcidin. However, compared to Fpn inhibitor treatment, hepcidin treatment led to Fpn with higher molecular weight ubiquitination, indicating polyubiquitination and monoubiquitination caused by hepcidin and Fpn inhibitors, respectively.

[0878] Table 5 Summary of Fpn inhibitors tested in the Fpn ubiquitination and degradation assay. The effects of treatment with Fpn inhibitors on Fpn degradation and Fpn ubiquitination were scored by visual observation of Western blots (+ comparable to hepcidin; - no effect; + / - intermediate effect).

[0879] Table 5

[0880]

[0881] Figure 1 Fpn inhibitors trigger ubiquitination and degradation of expressed Fpn in a mouse macrophage cell line. The J774 cell line was incubated overnight with Fe(III)-NTA to induce Fpn expression. Subsequently, the cells were treated with hepcidin (hepcidin, 150 nM) or Fpn inhibitor Example Compound No. 208 (210 nM), Example Compound No. 167 (1.5 μM), Example Compound No. 127 (120 nM), Example Compound No. 152 (40 nM) at IC 50 concentrations for 10 or 120 min, after which they were harvested and immunoprecipitated with anti-Fpn antibody F308. Mock-treated cells were harvested after 120 min (control group).

[0882] Immunoblotting of immunoprecipitation with the anti-Fpn antibody MTP1 revealed that ferroportin disappeared 120 min after treatment with the Fpn inhibitor, to a similar extent as in the samples treated with hepcidin (above). Rapid ubiquitination of Fpn was observed 10 min after treatment of cells with the Fpn inhibitor and hepcidin. Protein molecular weight standards are indicated in kD on the left.

[0883] 6. Inhibition of iron efflux by ferroportin inhibitors

[0884] Hepcidin activity and ferroportin inhibitor compounds with regard to the ability to block iron export via ferroportin were determined in T47D cells (ECACC, Cat. 85102201) as described below.

[0885] Cells were seeded at 350,000 cells / well in a 24-well plate (Greiner, Cat. 662160) and placed in growth medium containing 500 μM L-ascorbic acid (Sigma Aldrich, Cat. 795437) and 100 μM 58 Fe sulfate ( 58 Fe(II), Vifor Pharma lot number ROR3085) and incubated overnight. Cells were washed once with 500 μl of iron uptake buffer (IUB; PIPES 40 mM, Cat. P1851, glucose monohydrate 10 mM, Cat. 49158, sodium chloride 260 mM, Cat. 71379, potassium chloride 20 mM, Cat. P9541, magnesium sulfate 2 mM, Cat. 63138, Sigma Aldrich), then once with stripping buffer (incubated for 2 min, BPDS 100 μM, Cat. 11890 and Na2S2O4 500 μM, Cat. 157953, Sigma Aldrich, in IUB), and twice more with IUB. Serial dilutions of hepcidin (Bachem) or ferroportin inhibitor (4 μM - 0.0064 μM, 5-fold dilutions) were added at a total volume of 0.6 ml per well. Cells were incubated at 37 °C and 5% CO2 for 20 h. Supernatants were collected and Fe was measured using inductively coupled plasma mass spectrometry (ICP-MS, Thermo Scientific, Element 2). 58 Fe was measured. Pellets were collected for protein concentration measurement. Results were plotted as ng 58 Fe in the supernatant per mg of protein in the cell lysate. Example compound number 127 inhibited iron efflux with a similar potency as the endogenous Fpn ligand hepcidin ( Figure 2 ).

[0886] Figure 2 Hepcidin (IC50 : 0.086 μM) and Example Compound No. 127 (IC 50 : 0.080 μM) representative ferroportin inhibition.

[0887] 7. Hypoferremia in naive mice

[0888] Injecting synthetic hepcidin into wild-type (WT) naive mice results in a decrease in serum iron levels (40 - 50% different from the vehicle control group) and reaches the maximum effect 3 - 4 hours after treatment (RiverA, 2005; Figure 3A ). This data indicates that the injected hepcidin binds to ferroportin on duodenal enterocytes and splenocytes and triggers ferroportin (Fpn) internalization, leading to a sharp drop in serum iron. Similarly, oral administration of a small molecular weight Fpn inhibitor decreases the serum iron levels in WT C57BL / 6 mice in a dose-dependent manner ( Figure 3B ), with an efficacy similar to that of hepcidin. This data validates the use of WT mice as a simple and reliable model for testing the in vivo acute efficacy of Fpn inhibitors.

[0889] Nine-week-old female C57BL / 6 mice (Janvier, France) were fed a standard diet (Harlan Provimi Kliba 3436) and orally (p.o.) treated with a compound or the corresponding amount of vehicle at a volume of 10 ml / kg body weight. The Fpn inhibitor was formulated in 0.5% methylcellulose / water or 20% polyoxyethylene castor oil EL / water and administered orally to the mice at doses of 10, 30, or 100 mg / kg body weight. Three hours later, the mice were pre-anesthetized in an isoflurane chamber and blood was collected by orbital bleeding. The mice were sacrificed by cervical dislocation and the spleen, liver, and duodenum were collected for biomarker analysis. All experiments were conducted in accordance with a license approved by the competent veterinary authority. Serum was separated from the blood by centrifugation into micro containers containing gel and serum iron was measured by the MULTIGENT iron assay (Abbott Diagnostics, 6K95). Using eight mice per group, a one-way ANOVA and Bonferroni multiple comparison test were performed to analyze the statistical differences between the experimental groups. The efficacy of the selected Fpn inhibitors in WT C57BL / 6 mice is shown in Table 6.

[0890] Figure 3 Serum iron reduction induced by hepcidin and the ferroportin inhibitor according to Example Compound 94 (Example Compound No. 94).

[0891] A Serum iron kinetics in naive C57BL / 6 mice at specified times after intraperitoneal (i.p.) injection of synthetic hepcidin (5 mg / kg). * - *** - indicate a statistically significant decrease in serum iron compared to PBS-treated mice.

[0892] Serum iron levels in naïve C57BL / 6 mice treated with a specified amount of hepcidin (i.p.) or Example Compound 94 (Example Compound No. 94) (p.o.) for 3 h.

[0893] Table 6 Testing the efficacy of Fpn inhibitors in a naïve mouse hypoferremia model.

[0894] Serum iron reduction induced by oral administration of selected ferroportin inhibitors at doses of 10, 30, and 100 mg / kg to naïve WT C57BL / 6 mice. The relative serum iron reduction 3 h after dosing was calculated by subtracting the mean serum iron of animals dosed with the Fpn inhibitor from the mean serum iron of vehicle-treated animals. Subsequently, the difference in mean serum iron between the vehicle and compound-treated groups was divided by the mean serum iron of the vehicle control group and presented as a percentage.

[0895] Table 6

[0896]

[0897]

[0898] 8. Prevention of iron absorption in anemic rats

[0899] To evaluate the in vivo efficacy of ferroportin (Fpn) inhibitors in blocking iron absorption, a series of Fpn inhibitors were tested for iron absorption in an anemic rat model. Vistar rats (3 - 4 weeks old, n = 5, Janvier Labs) were fed a low-iron diet (Provimi-KlibA, Cat. 2039) until their heme (Hb) values reached 7 - 8 g / dl on the day before administration of the Fpn inhibitor compound. One hour before oral administration of 0.5 mg / kg ferrous sulfate, the test compounds formulated in methylcellulose or Cremophor were orally dosed quantitatively. Blood samples were collected by tail vein puncture one hour before iron administration (-1 h), immediately after quantitative administration of the Fpn inhibitor (0 h), and one hour (1 h), three hours (3 h), and occasionally up to six hours (6 h) after administration of the test compound. Serum iron levels were measured (Abbott Diagnostics, Cat. 6K95) and the inhibition of serum iron elevation three hours after administration of the test compound was calculated as a measure of the efficacy of the Fpn inhibitor in blocking iron absorption (Table 7). As Figure 4As shown, three hours after the quantitative administration of iron, compared to the serum iron level of the vehicle control group animals before the quantitative administration of iron and corrected for the baseline serum iron level of the vehicle control group animals that did not receive an iron dose, oral administration of 3 mg / kg, 10 mg / kg, or 30 mg / kg of the Fpn inhibitor Example Compound No. 55 decreased the serum iron levels by 54%, 72%, and 89%, respectively.

[0900] Table 7 Fpn inhibitors tested in anemic rat models for iron absorption inhibition. Relative inhibition values (%) of serum iron levels are shown, which are corrected for the mean baseline serum iron level of the control group that did not receive an oral iron dose and are compared to the control group treated with vehicle before the quantitative administration of iron. Mean values of groups (n = 5) treated with the indicated dose of Fpn inhibitor are shown. Statistically significant (2-factor ANOVA and Bonferroni post-test) differences were observed between the compound-treated group and the vehicle-treated group (***p < 0.001; **p < 0.01, *p < 0.05).

[0901] Figure 4 Dose-dependent blockade of iron absorption by Fpn inhibitor Example Compound No. 55 in anemic rats. One hour before the oral administration of a single dose of ferrous sulfate (0.5 mg / kg), 3 mg / kg (light blue line), 10 mg / kg (green line), or 30 mg / kg (dark blue line) of Example Compound No. 55 was orally administered. Quantitative administration of Example Compound No. 55 resulted in a statistically significant (p < 0.001) and dose-dependent inhibition of the increase in serum iron observed in vehicle-treated animals three hours after the quantitative administration of iron (red line). The baseline serum iron level of the vehicle-treated group that did not receive an iron dose is also shown (black line). Means with standard deviations are plotted for each treatment group and time point.

[0902] Table 7

[0903]

[0904] 9. Correcting hyperferremia in β2-microglobulin-deficient mice

[0905] Mutations in genes involved in sensing systemic iron stores, such as hepcidin (Hamp1), hemochromatosis protein (HFE), hepcidin regulator (HJV), and transferrin receptor 2 (TFR2), result in iron overload in mice and humans. The HFE, HJV, and TFR2 molecules on hepatocytes are essential with respect to signals for appropriate hepcidin production and their deficiency results in pathophysiologically low hepcidin levels and excessive iron absorption. HFE mutations are the most common cause of hereditary hemochromatosis (HH) in white adult humans. HFE is an MHC class I-like membrane molecule associated with β2-microglobulin and is involved in the transcriptional regulation of hepcidin through the bone morphogenetic protein receptor (BMPR) pathway. HFE− / − mice have reduced hepcidin levels, develop hyperferremia and high liver iron levels, making them a suitable animal model for studying human iron overload (Zhou, 1998). Mice lacking β2-microglobulin (b2m− / −) develop hyperferremia and hemochromatosis similar to HFE− / − animals because β2-microglobulin is essential for the cell surface expression and function of HFE (Rothenberg and Voland, 1996). Since HFE− / − mice are not available, b2m− / − mice are used as a model of iron overload. Preliminary studies have confirmed that HFE− / − and b2m− / − mice have similar iron metabolism-related parameters.

[0906] Six- to seven-week-old female and male homozygous b2m - / - mice were supplied by The Jackson Laboratory (B6.129P2-B2mtm1Unc / J, Stock Number: 002087) and fed a standard diet ad libitum (Harlan Provimi Kliba 3436). Age- and sex-matched wild-type C57BL / 6 mice were supplied by Charles River. To study the acute effects of ferroportin (Fpn) inhibitors in iron overload, b2m - / - mice were treated with the compound or an equivalent amount of vehicle at a volume of 10 ml / kg body weight. The Fpn inhibitor compound was formulated in 0.5% methylcellulose / water or 20% polyoxyl castor oil EL / water and administered orally to the mice at a dose of 50 mg / kg body weight. The wild-type control group received only the vehicle. Three hours later, the mice were pre-anesthetized in an isoflurane chamber and blood was collected by orbital bleeding. The mice were sacrificed by cervical dislocation and the spleen, liver, and duodenum were collected for biomarker analysis. All experiments were conducted in accordance with a license approved by the competent veterinary authority. Serum was separated from the blood by centrifugation into micro containers containing gel (BD Biosciences) and serum iron was measured by the MULTIGENT Iron Assay (Abbott Diagnostics, Cat. 6K95). Using four to nine mice per group, one-way ANOVA and Bonferroni multiple comparison tests were applied to analyze the statistical differences between the experimental groups.

[0907] To investigate the effects of Fpn inhibitor Example Compound No. 40 and Example Compound No. 94 in iron overload conditions, b2m - / - mice or wild-type control groups were dosed with the Fpn inhibitor or vehicle for 3 h. Due to their gene deletion, b2m - / - mice treated with the vehicle showed significantly higher serum iron levels compared to wild-type mice ( Figure 5 , the group mean of A was 60 μM and B was 56 μM). Treatment of b2m - / - mice with 50 mg / kg of Example Compound No. 40 or Example Compound No. 94 for 3 h corrected the elevated serum iron to the levels observed in the wild-type control group. These data confirm the acute efficacy of small-molecule ferroportin inhibitors in a disease-relevant model. The serum iron correction observed in further studies is summarized in Table 8.

[0908] Figure 5 Treatment of b2m - / - mice with ferroportin inhibitor Example Compound No. 40 / methylcellulose (A.) and Example Compound No. 94 / polyoxyl castor oil EL (B.) for 3 h completely corrected the elevated serum iron levels.

[0909] Table 8 Testing of Fpn inhibitors in a β2-microglobulin-deficient mouse model to reduce elevated serum iron levels.

[0910] Blood was collected 1(#) or 3(##) hours after oral administration of the indicated dose of Fpn inhibitor to β2-microglobulin-deficient mice, and serum iron concentration was measured. The relative decrease (%) in serum iron level was shown, which was calculated by subtracting the mean of serum iron in vehicle-treated animals from the mean of serum iron in animals dosed with Fpn inhibitor quantitatively. Subsequently, the difference between the mean of serum iron between the vehicle and compound-treated groups was divided by the mean of serum iron in the vehicle control group and presented as a percentage. Values for female (♀) and male (♂) animals were listed separately because a significant gender-dependent difference in efficacy was noted. Statistically significant (2-factor ANOVA and Bonferroni post-test) differences (***p < 0.001; **p < 0.01, *p < 0.05) were observed between the compound-treated and vehicle-treated groups.

[0911] Table 8

[0912]

[0913] 10. Prevention of iron overload in β2-microglobulin-deficient mice

[0914] Due to decreased hepcidin levels and increased iron absorption, β2-microglobulin-deficient (b2m- / -) mice on a standard diet have excessive iron accumulation in the liver, heart, and pancreas. Preliminary studies showed that liver iron loading in b2m- / - starts at 3 - 4 weeks of age, and at 6 weeks of age, the iron level in the liver reaches up to 4 times that of wild-type (WT) mice. Additionally, feeding 3-week-old b2m- / - mice a low-iron content (LID) diet immediately after weaning prevented liver iron loading by 6 - 7 weeks of age. The efficacy of Fpn inhibitor in preventing liver iron accumulation was investigated in b2m- / - mice. Three-week-old b2- / - mice on LID were dosed quantitatively with Fpn inhibitor or vehicle (methylcellulose; 10 ml / kg). Mice drank water supplemented with 1 mM 58 Fe(II)-sulfate and 10 mM ascorbic acid. Quantitative dosing of Fpn inhibitor or vehicle was followed by exposure to iron-supplemented water for 14 days. Mice were euthanized, and iron content in the liver and spleen was analyzed by ICP-OES (all iron isotopes), and Fe concentration in liver tissue (ICP-MS) was also analyzed. Data collated in Table 9 showed that two weeks of oral administration of Fpn inhibitor in b2m- / - mice prevented liver iron loading and increased spleen iron concentration, indicating inhibition of ferroportin in both the intestine and spleen. 58 These data confirmed the efficacy of small molecular weight ferroportin inhibitors in preventing liver iron loading in b2- / - mice, which provided proof of concept in a disease-related model.

[0915]

[0916] ​Table 9 Testing Fpn inhibitors to inhibit hepatic iron overload in β2-microglobulin-deficient mouse models.

[0917] The livers and spleens of β2-microglobulin-deficient mice were collected 14 days after treatment with the indicated doses of Fpn inhibitor (p.o.; b.i.d.). Total hepatic and splenic tissue iron concentrations were measured using ICP-OES, 58 and hepatic Fe concentration was determined by ICP-MS. The relative change (%) in tissue iron levels was shown, which was calculated by the difference criterion of the mean tissue iron of animals administered Fpn inhibitor quantitatively and the mean tissue iron of vehicle-treated animals in the vehicle control group. Values for female (♀) and male (♂) animals were listed separately because significant gender-dependent differences in efficacy were noted. Statistically significant (2-factor ANOVA and Bonferroni post-test) differences observed between the compound-treated group and the vehicle-treated group were shown (***p < 0.001; **p < 0.01, *p < 0.05). nd, not determined; nA, not applicable.

[0918] Table 9

[0919]

[0920] 11. Improving anemia, ineffective erythropoiesis, and iron overload in β-thalassemia intermedia mouse models

[0921] β-Thalassemia is a hereditary anemia caused by mutations in the β-globin gene of heme, resulting in abnormal cells with a shortened lifespan. The most severe form, thalassemia major, requires blood transfusions, which can lead to secondary iron overload. Patients with thalassemia intermedia have moderate transfusion-dependent anemia but still develop iron overload due to ineffective erythropoiesis and chronic suppression of hepcidin production.

[0922] As shown in previous embodiments, in vitro, oral administration of a hepcidin-like ferroportin (Fpn) inhibitor can block Fpn-mediated cellular iron efflux, and quantitative administration in wild-type mice transiently reduces serum iron. Based on these findings and published studies (Schmidt PJ, et al, Blood 2013, Guo S, et al, JCI, 2013 and Casu C, et al, Blood, 2016), the ability of Fpn inhibitors to prevent iron loading and improve erythropoiesis by restricting iron absorption and recycling from senescent red blood cells was examined in intermediate thalassemia. The efficacy of Fpn inhibitors was investigated using a murine model of β-thalassemia not associated with transfusion. Heterozygous mice with a knockout of the β1 and β2 globin genes (referred to as Hbb th3 / + mice) develop transfusion-independent anemia, ineffective erythropoiesis, splenomegaly, and secondary iron overload in the spleen, liver, and kidneys. Heterozygous Hbb th3 / + mice aged 8 - 18 weeks were obtained from the Jackson Laboratory (B6; 129P-Hbb-b 1tm1Unc Hbb-b2tm 1Unc / J, stock number: 002683) and fed a freely available low-iron diet (Harlan Provimi Kliba 2039, 13.4 ppm Fe) during the experiment. Hbb th3 / + mice were dosed twice daily with 20 or 60 mg / kg of the compound or with methylcellulose (10 ml / kg, Sigma, Cat. 274429) as a vehicle. Between the two doses, the mice drank drinking water supplemented with 1 mM 58 Fe(II)-sulfate (Vifor Pharma, lot number ROR3096) and 10 mM ascorbic acid (Sigma, Cat. 795437) for 6 h. The concentration of 58 Fe(II)-sulfate supplemented in the drinking water was adjusted to substitute for the iron content of 250 ppm contained in the standard rodent diet. For the remaining 18 h, water without 58 Fe(II)-sulfate and ascorbic acid was provided. In a separate experiment, Fpn inhibitor or vehicle was administered quantitatively, followed by exposure to iron-containing water for 20 to 46 days.

[0923] As previously shown in wild-type and b2m- / - mice, quantitative administration of an Fpn inhibitor in Hbb th3 / + mice for 3 h also effectively reduced serum iron levels in this mouse strain (Table 10), confirming the ability of these small molecules to cause iron restriction.

[0924] Hbb th3 / + mice are anemic mice with a heme level in the range of 70 - 80 g / L. Oral administration of the Fpn inhibitor to Hbb th3 / + mice for two weeks significantly increased the heme level compared to vehicle-treated mice (Table 10). At the end of the study, the change in the heme level of the compound administered quantitatively reached 19 - 22 g / L compared to the vehicle-treated group. Additional blood parameters of the final blood were measured using an automated hematology analyzer. Hbb th3 / + mice treated with the Fpn inhibitor had increased red blood cell count, hematocrit, and decreased reticulocyte concentration and red blood cell distribution width (RDW), indicating improved erythropoiesis. In addition, compared to the vehicle group, Hbb th3 / + mice receiving the Fpn inhibitor had significantly lower white blood cell counts in the blood, further confirming the beneficial effect of the Fpn inhibitor in correcting the pathological change parameters in this disease model. Therefore, in the intermediate thalassemia mouse model, the Fpn inhibitor significantly improved anemia and corrected the blood composition.

[0925] Ineffective erythropoiesis in Hbb th3 / + mice leads to excessive proliferation of erythroid precursors in the spleen, resulting in splenomegaly. Treatment of Hbb th3 / + mice with the Fpn inhibitor led to a significant reduction in spleen weight, thus highlighting the potential of the Fpn inhibitor to reverse splenomegaly (Table 10).

[0926] The effect of the Fpn inhibitor on erythropoiesis was investigated by analyzing the percentage of erythroid precursors in the bone marrow and spleen using flow cytometry and markers Ter119 (eBioscience, Cat. 17 - 5921) and CD44 (BioLegend, Cat. 103028). Compared to vehicle-treated Hbb th3 / + mice, bone marrow or spleen cells isolated from Hbb th3 / + mice treated with the Fpn inhibitor contained a significantly lower percentage of primitive erythrocytes, basophilic erythroblasts, and polychromatic erythroblasts, which are early erythroid precursors, and a higher percentage of mature erythrocytes (Table 10). These data confirmed that the Fpn inhibitor could improve ineffective erythropoiesis in Hbb th3 / + mice and were consistent with the improved blood parameters in the blood.

[0927] Due to the feedback on anemia, hypoxia, and ineffective erythropoiesis, the serum erythropoietin levels in Hbb th3 / + mice and in patients with thalassemia are upregulated (Guo et al. JCI, 2013). Compared to the vehicle group, Hbb th3 / + mice treated with the Fpn inhibitor produced significantly less serum erythropoietin (DuoSet ELISA R&D Systems, Cat. DY959), most likely as a result of partially corrected anemia and improved erythropoiesis (Table 10).

[0928] Elevated erythropoietin levels in Hbb th3 / + mice can induce overexpression of erythroferrone (an erythroid regulatory hormone known to inhibit hepcidin) (Kautz L. et al, Nat. Genet., 2014). Consistent with the decrease in serum erythropoietin, the expression of erythroferrone mRNA was significantly decreased in the spleen of Fpn inhibitor-treated Hbb th3 / + mice compared to mice treated with vehicle alone (Table 10). Erythroferrone is produced by erythroid precursors that proliferate abundantly in the spleen of Hbb th3 / + mice, which is a result of extramedullary erythropoiesis. Thus, the effect of Fpn inhibitors on erythroferrone expression in the spleen is mediated by improved erythropoiesis.

[0929] Patients with thalassemia have increased iron requirements due to ineffective erythropoiesis and chronically low hepcidin levels, leading to organ iron loading and associated disorders such as hepatocellular carcinoma and heart failure (Rivella S., Haematologica, 2015). As a result of insufficiently low hepcidin levels relative to the high iron content in the liver, spleen, and kidney and increased membrane iron transporter expression in the duodenum, Hbb th3 / + mice absorb excessive iron (Gardenghi S., Blood, 2007). The total liver iron and the content of 58 Fe in organs of Hbb th3 / + mice treated with vehicle or Fpn inhibitor were analyzed by inductively coupled plasma optical emission spectrometry (ICP-OES) and inductively coupled plasma mass spectrometry (ICP-MS), respectively. The concentration of 58 Fe in the liver and spleen of Hbb th3 / + mice treated with a quantitative dose of Fpn inhibitor was significantly lower compared to vehicle-treated mice, indicating that Fpn inhibitors can prevent organ iron accumulation (Table 10).

[0930] Since Fpn inhibitors are systemically available, they can block iron export from all membrane iron transporter-expressing tissues, including the duodenum, spleen, and liver. Accordingly, Fpn inhibitors were expected to prevent iron absorption from the duodenum; however, they were unable to remove pre-existing iron in the liver and spleen. Indeed, the total liver iron in mice treated with Fpn inhibitor or vehicle remained unchanged (not shown). Importantly, Fpn inhibitors significantly decreased the concentration of 58 Fe in the spleen and liver of Hbb th3 / + mice, confirming the ability of these small molecules to prevent iron loading.

[0931] Furthermore, reactive oxygen species (ROS) were detected in bone marrow cells using the fluorescent indicator CM-H2DCFDA (Thermo Fisher Scientific, Cat. C6827). Flow cytometry analysis showed that compared to vehicle-treated Hbb th3 / + mice, the Fpn inhibitor significantly reduced ROS in mature erythroid-like cells (Table 10).

[0932] These data confirm the disease-modifying ability of orally administered small-molecule ferroportin inhibitors in improving anemia and ineffective erythropoiesis, reducing splenomegaly, and preventing further hepatic and splenic iron loading in a β-thalassemia intermedia disease model.

[0933] Table 10

[0934]

[0935]

[0936] Table 10. Efficacy of ferroportin inhibitors in a murine model of thalassemia intermedia (Hbb th3 / + mice). The indicated Fpn inhibitors were dosed twice daily for 20 days (Example Compounds 1 and 2), 27 days (Example Compound 127), or 46 days (Example Compound 40). Data are presented as differences from vehicle control for heme and as % change from vehicle control for all other parameters shown.

[0937] Preparation of Example Compounds

[0938] General Experimental Details

[0939] Commercially available reagents and solvents (HPLC grade) were used without further purification. 1 1H NMR spectra were recorded in deuterated solvents on a Bruker DRX 500 MHz spectrometer, a Bruker DPX 250 MHz spectrometer, or a Bruker Avance spectrometer at 400 MHz. Chemical shifts (δ) are reported in parts per million.

[0940] Compounds were purified by flash column chromatography on normal-phase silica gel using appropriate SNAP cartridges and gradients on a Biotage Isolera system. Alternatively, compounds were purified on reverse phase using a Biotage Isolera system and appropriate C18 SNAP cartridges with reverse-phase eluents or by preparative HPLC on reverse phase (unless otherwise noted).

[0941] Analytical HPLC-MS

[0942] Method A (MET / CR / 1673)

[0943]

[0944] Method B (MET / CR / 1600)

[0945]

[0946] Method C (MET / CR / 1416)

[0947]

[0948]

[0949] Method D–(MET / uPLC / AB101)

[0950]

[0951] Method E-(MET / CR / 1278)

[0952]

[0953]

[0954] Method F-MET / CR / 0990

[0955]

[0956] Method G-MET / CR / 2044

[0957]

[0958] Method H-METUPLCMS-A-004

[0959]

[0960]

[0961] Method I-METUPLCMS-A-006

[0962]

[0963] [[ID=6s2]]Method J-METUPLCMS-A-007

[0964]

[0965]

[0966] Method K–MET / UPLCMS-A / 013 It should be noted that there may be a typo in "Method J-METUPLCMS-A-007 " where "6s2" is likely a mistake. I translated it as "Method J-METUPLCMS-A-007" based on the context.

[0967]

[0968] Method L–MET-THERMOMS-B-015

[0969]

[0970] Method M-MET / CR / 1410

[0971]

[0972]

[0973] Preparative HPLC – Neutral pH Method

[0974]

[0975] Preparative HPLC – Low pH Preparative Method (Acids)

[0976]

[0977] Preparative HPLC – High pH Preparative Methods (Basic)

[0978]

[0979] abbreviation

[0980] AcOH acetic acid

[0981] AIBN 2,2′-azobis(2-methylpropionitrile)

[0982] BH3 Borane

[0983] Boc2O Di-tert-butyl dicarbonate

[0984] CaCO3 calcium carbonate

[0985] CBz benzyloxycarbamate

[0986] CDI 1,1'-Carbonyldiimidazole

[0987] CHCl3 chloroform

[0988] d day

[0989] DAST N-ethyl-N-(trifluoro-λ-4-sulfanyl)ethylamine

[0990] DBU 1,8-diazabicycloundec-7-ene

[0991] DCC N,N'-dicyclohexylcarbodiimide

[0992] DCE 1,2 - Dichloroethane

[0993] DCM Dichloromethane

[0994] DIAD Diisopropyl azodicarboxylate

[0995] DIPEA N,N - Diisopropylethylamine

[0996] DMAP N,N - Dimethylpyridin - 4 - amine

[0997] DMF N,N - Dimethylformamide

[0998] Et2O Diethyl ether

[0999] EtOAc Ethyl acetate

[1000] EtOH Ethanol

[1001] h hour

[1002] HATU 1 - [Bis(dimethylamino)methylene]-1H - 1,2,3 - triazolo[4,5 - b]pyridinium - 3 - oxide hexafluorophosphate

[1003] HCl Hydrochloric acid

[1004] HPLC High - performance liquid chromatography

[1005] IPA Isopropyl alcohol

[1006] K2CO3 Potassium carbonate

[1007] KO t KOtBu Potassium tert - butoxide

[1008] KHMDS Potassium hexamethyldisilazide

[1009] KHSO4 Potassium hydrogen sulfate

[1010] LiAlH4 Lithium aluminum hydride

[1011] LiCl Lithium chloride

[1012] LiOH Lithium hydroxide

[1013] MeCN Acetonitrile

[1014] MeI Methyl iodide

[1015] MeOH Methanol

[1016] min minute

[1017] MW Molecular weight

[1018] NaBH4 Sodium borohydride

[1019] NaHCO3 Sodium bicarbonate

[1020] NaH Sodium hydride (60%, in mineral oil)

[1021] NaOH Sodium hydroxide

[1022] NBS N-Bromosuccinimide

[1023] NCS N-Chlorosuccinimide

[1024] NH4Cl Ammonium chloride

[1025] Pd / C Palladium on carbon

[1026] PdCl2(dppf) Dichloro[1,1′bis(diphenylphosphino)ferrocene]palladium(II)

[1027] Pd2dba3 Tris(dibenzylideneacetone)dipalladium(0)

[1028] PPh3 Triphenylphosphine

[1029] PTSA p-Toluenesulfonic acid

[1030] TBME tert-Butyl methyl ether

[1031] TBSCl tert-Butyldimethylchlorosilane

[1032] TEA Triethylamine

[1033] TFA Trifluoroacetic acid

[1034] TMOF Trimethyl orthoformate

[1035] Xantphos 4,5-Bis(diphenylphosphino)-9,9-dimethyloxanthene

[1036] Intermediate

[1037] The above Scheme A:

[1038] tert-Butyl N-[(3-fluoropyridin-2-yl)methyl]carbamate (A1)

[1039]

[1040] A suspension of 3-fluoropyridine-2-carbonitrile (8.0 g, 6.55 mmol), di-tert-butyl dicarbonate (15.7 g, 72.07 mmol), and TEA (10.05 ml, 72.07 mmol) in EtOH (300 ml) was purged with N2. Pd / C (10% wt., 0.7 g, 6.55 mmol) was added and the reaction mixture was stirred under a hydrogen atmosphere for 16 h. The reaction mixture was filtered through celite, rinsed with MeOH (100 ml), and the filtrate was removed under vacuum to give the crude product. Purification by flash column chromatography (0 - 70% EtOAc / heptane gradient elution) gave the title compound as an off-white solid (11.3 g, 72%).

[1041] 1H-NMR (DMSO-d6, 250 MHz): δ [ppm] = 8.41 - 8.31 (m, 1H), 7.65 (ddd, J = 10.1, 8.3, 1.3 Hz, 1H), 7.38 (dt, J = 8.5, 4.4 Hz, 1H), 7.18 (s, 1H), 4.30 (d, J = 5.4 Hz, 2H), 1.37 (s, 9H)

[1042] HPLCMS (Method A): [m / z]: 226.9 [M+H] +

[1043] (3-Fluoropyridin-2-yl)methanamine dihydrochloride (A2)

[1044]

[1045] In a similar manner to General Procedure 2, tert-butyl N-[(3-fluoropyridin-2-yl)methyl]carbamate (A1) (11.3 g, 47.45 mmol) in MeOH (150 ml) and 12 M HCl (59.3 ml, 711.72 mmol) were heated at 40 °C for 2 h to give the title compound as an off-white solid (9.7 g, 100%).

[1046] 1H-NMR (methanol-d4, 500 MHz): δ [ppm] = 8.48 (dt, J = 4.7, 1.3 Hz, 1H), 7.69 (ddd, J = 9.7, 8.5, 1.2 Hz, 1H), 7.50 (dt, J = 8.8, 4.5 Hz, 1H), 4.37 (s, 2H)

[1047] HPLCMS (Method A): [m / z]: 126.9 [M+H] +

[1048] The above Scheme B:

[1049] (4,6-Dimethylpyridin-3-yl)methanamine hydrochloride (B1)

[1050]

[1051] 4,6-Dimethylpyridine-3-carbonitrile (0.15 g, 1.135 mmol) placed in MeOH (150 ml) was injected into an H-Cube containing 10% palladium on carbon at 50 bar and room temperature using H2 at a flow rate of 1 ml / min and added to a 1 M HCl (1 ml) solution. The solvent was evaporated under vacuum to give the title compound as a white solid (190 mg, 64%). Used without purification.

[1052] 1H-NMR (DMSO-d6, 500 MHz): δ [ppm] = 8.74 - 8.66 (m, 1H), 8.62 - 8.42 (m, 3H), 7.76 - 7.64 (m, 1H), 4.23 - 4.13 (m, 2H), 2.66 - 2.63 (m, 3H), 2.58 - 2.54 (m, 3H)

[1053] HPLCMS (method E): [m / z]: 136.9 [M + H] +

[1054] Scheme C above:

[1055] 2-(Hydroxymethyl)benzonitrile (C1)

[1056]

[1057] 1 M BH3 in THF (1.51 ml) was added to a THF (5 ml) ice-cold (0 °C) solution of 3-formylpyridine-2-carbonitrile (200 mg, 1.51 mmol). The reaction was heated to room temperature and stirred for 15 h. The reaction was poured into ice / water (25 ml). The aqueous layer was extracted with EtOAc (3 × 20 ml). The combined organic layers were dried (Na2SO4), filtered and the solvent was evaporated to give a brown oil. Purification by flash column chromatography (gradient elution with 20 - 100% EtOAc / heptane) gave the title compound as a yellow solid (45.5 mg, 22.4%).

[1058] 1H-NMR (CDCl3, 500 MHz): δ [ppm] = 8.55 (dd, J = 4.7, 1.4 Hz, 1H), 8.01 - 7.95 (m, 1H), 7.49 (dd, J = 8.0, 4.7 Hz, 1H), 4.89 (s, 2H)

[1059] HPLCMS (method A): [m / z]: 134.85 [M + H]+

[1060] 2-{[(tert-Butyldimethylsilyl)oxy]methyl}benzonitrile (C2)

[1061]

[1062] 1M TBSCl in DCM (0.369 ml, 0.369 mmol) was added dropwise to a solution of 3-(hydroxymethyl)pyridine-2-carbonitrile (C1) (45 mg, 0.335 mmol) and imidazole (46 mg, 0.671 mmol) in DMF (2 ml). The reaction was stirred at room temperature for 15 h. The solvent was evaporated and the crude product was purified by flash column chromatography (eluting with a gradient of 0 - 50% EtOAc - heptane) to give the title compound as a yellow oil (44 mg, 52.8%).

[1063] 1H-NMR (CDCl3, 500 MHz): δ [ppm] = 8.60 - 8.58 (m, 1H), 8.10 - 7.96 (m, 1H), 7.53 (dd, J = 8.0, 4.7 Hz, 1H), 4.94 (s, 2H), 0.95 (s, 9H), 0.15 (s, 6H)

[1064] HPLCMS (Method A): [m / z]: 249.00 [M+H] +

[1065] (3-{[(tert-Butyldimethylsilyl)oxy]methyl}pyridin-2-yl)methanamine (C3)

[1066]

[1067] 2M LiAlH4 in THF (0.09 ml) was added dropwise to a solution of 3-{[(tert-Butyldimethylsilyl)oxy]methyl}pyridine-2-carbonitrile (C2) (44 mg, 0.18 mmol) in THF (3 ml) at 0 °C. The reaction was heated to room temperature and stirred for 2 h. Diethyl ether (5 ml) was added, followed by H2O (1 ml), then 20% w / w NaOH (1 ml) and water (3 ml). Layer separation was carried out. The aqueous layer was extracted with EtOAc (3 × 10 ml). The combined organic layers were dried (Na2SO4), filtered, and the solvent was evaporated. The crude product was purified by flash column chromatography (eluting with a gradient of 0 - 100% EtOAc / heptane) to give the title compound as a yellow oil (10 mg, 22.4%).

[1068] HPLCMS (Method A): [m / z]: 252.95 [M+H] +

[1069] N-(2-Nitrophenyl)prop-2-enamide (D)

[1070]

[1071] At room temperature, a suspension of 2-nitroaniline (5.0 g, 36.2 mmol) and K2CO3 (15.01 g, 108.6 mmol) in acetone (100 ml) was added to acryloyl chloride (11.8 ml, 145 mmol), and the mixture was stirred for 16 h. The reaction mixture was filtered and concentrated in vacuo to give the crude product. Purification by flash column chromatography (eluting with a gradient of 10 - 15% EtOAc / heptane) gave the title compound as a yellow solid (6.95 g, 78%).

[1072] 1H-NMR (CDCl3, 250 MHz): δ [ppm] = 10.59 (s, 1H), 8.90 (dd, J = 8.6, 1.3 Hz, 1H), 8.25 (dd, J = 8.5, 1.6 Hz, 1H), 7.68 (ddd, J = 8.5, 7.3, 1.4 Hz, 1H), 7.21 (ddd, J = 8.6, 7.3, 1.4 Hz, 1H), 6.54–6.28 (m, 2H), 5.89 (dd, J = 9.9, 1.3 Hz, 1H)

[1073] HPLCMS (Method A): [m / z]: 192.9 [M+H] +

[1074] 2-(Chloromethyl)-5-(trifluoromethyl)-1H-1,3-benzodiazole (E)

[1075]

[1076] 12 M HCl (1 ml, 12 mmol) was added to a mixture of 4-(trifluoromethyl)benzene-1,2-diamine (1 g, 5.68 mmol) and chloroacetic acid (0.590 g, 6.25 mmol) in water (20 ml), and the mixture was heated at 100 °C for 2 h. A further 12 M HCl (4 ml, 48 mmol) was added and the reaction mixture was heated at 120 °C for 3 h. The mixture was then cooled to room temperature and quenched by adding 7 M aqueous ammonia in MeOH until basic, extracted with EtOAc (3 × 20 ml), the combined organic layers were washed with brine (20 ml), dried (MgSO4), filtered and evaporated in vacuo. Flash column chromatography (eluting with a gradient of 5 - 50% EtOAc / heptane) gave the crude title compound as a purple solid (0.571 g, 24%, 56% purity), which was used without further purification.

[1077] HPLCMS (Method E): [m / z]: 234.85 [M+H] +

[1078] tert-Butyl 2-(chloromethyl)methyl-1H-1,3-benzodiazole-1-carboxylate (F)

[1079]

[1080] To a solution of 2-(chloromethyl)-6-methyl-1H-1,3-benzodiazole (1 g, 6 mmol) in DMF (20 ml) was added DIPEA (1.4 g, 11 mmol), followed by di-tert-butyl dicarbonate (1.8 g, 8 mmol). The reaction was stirred for 18 h. Water was added to the reaction and it was extracted with ethyl acetate. The organic phase was dried over Na2SO4 and concentrated in vacuo to give a crude product, which was purified by flash column chromatography using n-hexane-ethyl acetate / n-hexane (5:95)-hexane to afford the desired product as a yellow oil (0.7 g, 22%). The desired product was obtained as a mixture that was not separated and used in the next step.

[1081] 1H-NMR (CDCl3, 400 MHz): δ [ppm] = 7.84 (d, J = 8.7 Hz, 2H), 7.62 (d, J = 8.2 Hz, 1H), 7.53 (s, 1H), 7.20 (dd, J = 13.0, 4.6 Hz, 2H), 5.05 (s, 2H), 5.04 (s, 2H), 2.50 (s, 3H), 2.47 (s, 3H), 1.74 (s, 9H), 1.73 (s, 9H),

[1082] N-(3-Fluoro-2-nitrophenyl)prop-2-enamide (G)

[1083]

[1084] To a suspension of 3-fluoro-2-nitroaniline (500 mg, 3.20 mmol) and K2CO3 (1.33 g, 9.61 mmol) in acetone (10 ml) purged with N2 was added dropwise prop-2-enoyl chloride (1.0 ml, 12.8 mmol). The reaction mixture was stirred at room temperature for 16 h. The reaction was filtered, concentrated in vacuo and purified by flash column chromatography (eluting with a gradient of 0-70% EtOAc / heptane) to afford the title compound as a yellow solid (604 mg, 87%).

[1085] 1H-NMR (DMSO-d6, 250 MHz): δ [ppm] = 10.58 (s, 1H), 7.69 (m, 1H), 7.46–7.33 (m, 2H), 6.43 (dd, J = 17.0, 9.8 Hz, 1H), 6.27 (dd, J = 17.0, 2.1 Hz, 1H), 5.85 (dd, J = 9.8, 2.1 Hz, 1H)

[1086] HPLCMS (Method A): [m / z]: 210.95 [M+H] +

[1087] N-(3-chloro-2-nitrophenyl)prop-2-enamide (H)

[1088]

[1089] Acryloyl chloride (1.03 ml, 12.67 mmol) was slowly added to a suspension of 3-chloro-2-nitroaniline (0.729 g, 4.22 mmol) and K2CO3 (2.34 g, 16.9 mmol) in acetone (20 ml). The reaction mixture was stirred at room temperature for 4 h, filtered, and the residue was washed with acetone. The combined filtrates were evaporated in vacuo. Purification by flash column chromatography (eluting with a gradient of 0 - 60% EtOAc / heptane) gave the title compound as a yellow solid (0.52 g, 47%).

[1090] 1H-NMR (CDCl3, 500 MHz): δ [ppm] = 8.36 (dd, J = 8.3, 1.1 Hz, 1H), 8.28 (s, 1H), 7.49 (dd, J = 8.3, 8.3 Hz, 1H), 7.32 (dd, J = 8.3, 1.1 Hz, 1H), 6.47 (dd, J = 16.9, 0.8 Hz, 1H), 6.25 (dd, J = 16.9, 10.3 Hz, 1H), 5.90 (dd, J = 10.3, 0.8 Hz, 1H)

[1091] HPLCMS (Method M): [m / z]: 227.00 [M+H] +

[1092] N-(2-methoxy-6-nitrophenyl)prop-2-enamide (I)

[1093]

[1094] To a stirred suspension of 2-methoxy-6-nitroaniline (0.52 g, 3.09 mmol) and K2CO3 (1.71 g, 12.4 mmol) in acetone (30 ml) purified with N2 was added acryloyl chloride (0.754 ml, 9.28 mmol) dropwise. The reaction mixture was stirred at room temperature for 16 h. The mixture was filtered, concentrated, diluted with EtOAc, washed with water, dried (MgSO4), filtered and concentrated to give the crude product. Purification by flash column chromatography (eluting with a gradient of 0 - 100% EtOAc / heptane, followed by 0 - 2% MeOH / EtOAc) gave the title compound as an orange solid (0.674 g, 96%).

[1095] 1H-NMR (CDCl3, 250 MHz): δ [ppm] = 7.82 (s, 1H), 7.57 (dd, J = 8.2, 1.3 Hz, 1H), 7.31 (t, J = 8.3 Hz, 1H), 7.19 (dd, J = 8.3, 1.3 Hz, 1H), 6.47 (dd, J = 17.0, 1.7 Hz, 1H), 6.33 (dd, J = 17.0, 9.8 Hz, 1H), 5.85 (dd, J = 9.8, 1.7 Hz, 1H), 3.97 (s, 3H)

[1096] HPLCMS (method M): [m / z]: 223.05 [M+H] +

[1097] N-(5-Fluoro-2-nitrophenyl)prop-2-enamide (J)

[1098]

[1099] Acryloyl chloride (3.8 ml, 46.5 mmol) was slowly added to a suspension of 5-fluoro-2-nitroaniline (2.4 g, 15.5 mmol) and K2CO3 (8.57 g, 62 mmol) in acetone (100 ml). The mixture was stirred at room temperature for 3 d and then at reflux for 6 h. Further acryloyl chloride (3.8 ml, 46.5 mmol) and DMAP (0.95 g, 7.75 mmol) were added and the mixture was heated at reflux for a further 2 h. The reaction mixture was cooled to room temperature and filtered. The residue was washed with acetone and the combined filtrates were evaporated in vacuo. The resulting residue was redissolved in Et2O (350 ml) and saturated aqueous NaHCO3 (200 ml). The mixture was stirred vigorously for 15 min. The phases were separated and the organic phase was washed with a further portion of saturated aqueous NaHCO3 (100 ml) and brine (100 ml), dried (sodium sulfate) and evaporated in vacuo. Purification by flash silica column chromatography (eluting with a gradient of 0 - 4% Et2O / heptane) gave the title compound as a pale yellow solid (1.04 g, 32%).

[1100] 1H-NMR (CDCl3, 250 MHz): δ [ppm] = 10.83 (s, 1H), 8.79 (dd, J = 11.2, 2.5 Hz, 1H), 8.34 (dd, J = 9.2, 5.7 Hz, 1H), 6.99 - 6.82 (m, 1H), 6.53 (d, J = 16.9 Hz, 1H), 6.35 (dd, J = 17.1, 9.9 Hz, 1H), 5.95 (d, J = 10.1 Hz, 1H)

[1101] HPLCMS (method M): [m / z]: 211.15 [M + H] +

[1102] General procedure K-I above:

[1103] N-(2-chloro-5-fluorophenyl)prop-2-enamide (K1)

[1104]

[1105] At room temperature, prop-2-enoyl chloride (5.0 ml, 61.8 mmol) was added dropwise to a suspension of 2-chloro-5-fluoroaniline (3.0 g, 20.6 mmol) and K2CO3 (11.4 g, 82.4 mmol) in acetone (80 ml) purged with N2 and the mixture was stirred for 16 h. The reaction mixture was filtered, concentrated in vacuo and purified by flash column chromatography (eluting with a gradient of 0 - 35% EtOAc / heptane) to give the title compound as a white solid (3.99 g, 84%).

[1106] 1H-NMR (CDCl3, 250 MHz): δ [ppm] = 8.40 (dd, J = 10.9, 3.0 Hz, 1H), 7.79 (s, 1H), 7.35 (dd, J = 8.9, 5.6 Hz, 1H), 6.81 (ddd, J = 8.9, 7.6, 3.0 Hz, 1H), 6.50 (dd, J = 16.9, 1.2 Hz, 1H), 6.32 (dd, J = 16.9, 10.0 Hz, 1H), 5.88 (dd, J = 10.0, 1.2 Hz, 1H)

[1107] HPLCMS (Method A): [m / z]: 200.10 [M+H] +

[1108] N-(6-chloro-3-fluoro-2-nitrophenyl)prop-2-enamide (K2)

[1109]

[1110] At 0 °C, red fuming HNO3 (1.8 ml, 38.3 mmol) was added dropwise to a solution of N-(2-chloro-5-fluorophenyl)prop-2-enamide (K1) (3.99 g, 17.4 mmol), concentrated H2SO4 (15 ml) and AcOH (6 ml) purged with N2, and the reaction was stirred for 2 h. The reaction mixture was poured onto ice water and extracted with DCM (4 × 40 ml). The combined organic extracts were dried (MgSO4), filtered, concentrated in vacuo and purified by flash column chromatography (eluting with a gradient of 0 - 70% EtOAc / heptane) to give the title compound as a white solid (1.08 g, 20%).

[1111] 1H-NMR (CDCl3, 250 MHz): δ [ppm] = 7.64 (dd, J = 9.1, 5.0 Hz, 1H), 7.51 (s, 1H), 7.19 (m, 1H), 6.52 (dd, J = 16.9, 1.1 Hz, 1H), 6.32 (dd, J = 16.9, 10.2 Hz, 1H), 5.94 (dd, J = 10.1, 1.1 Hz, 1H)

[1112] HPLCMS (Method A): [m / z]: 244.95 [M+H]+

[1113] N-(2,4-difluorophenyl)prop-2-enamide (K3)

[1114]

[1115] At room temperature, prop-2-enoyl chloride (3.7 ml, 46.5 mmol) was added dropwise to a suspension of 2,4-difluoroaniline (2 g, 1.49 mmol) and K2CO3 (8.56 g, 61.7 mmol) in acetone (60 ml) purged with N2. The reaction mixture was stirred for 16 h. The reaction was filtered, concentrated, purified by flash column chromatography (eluting with a gradient of 0 - 30% EtOAc / heptane) and triturated with heptane to give the title compound as a white solid (2.9 g, 100%).

[1116] 1H-NMR (CDCl3, 250 MHz): δ [ppm] = 8.49 - 8.29 (m, 1H), 7.33 (s, 1H), 6.99 - 6.84 (m, 2H), 6.48 (dd, J = 16.9, 1.4 Hz, 1H), 6.29 (dd, J = 16.8, 10.1 Hz, 1H), 5.85 (dd, J = 10.1, 1.4 Hz, 1H)

[1117] HPLCMS (method A): [m / z]: 183.95 [M+H] +

[1118] N-(2,4-Difluoro-6-nitrophenyl)prop-2-enamide (K4)

[1119]

[1120] At 0 °C, fuming nitric acid (1.6 ml) was added dropwise to a solution of N-(2,4-difluorophenyl)prop-2-enamide (K3) (2.9 g, 15.4 mmol), AcOH (5 ml) and concentrated H2SO4 (13 ml) purged with N2. The reaction mixture was stirred for 2 h. The reaction was poured onto ice water and the resulting solution was extracted with DCM (4 × 40 ml). The combined organic extracts were washed with brine, dried (MgSO4), filtered, concentrated in vacuo and triturated with heptane to give the crude product as a beige solid (3.23 g). Purification by flash column chromatography (eluting with a gradient of 0 - 40% EtOAc / heptane) gave the title compound as a white solid (1.25 g, 35.5%).

[1121] 1H-NMR (CDCl3, 250 MHz): δ [ppm] = 8.17 (s, 1H), 7.67 (dt, J = 7.9, 2.4 Hz, 1H), 7.34 - 7.28 (m, 1H), 6.51 (dd, J = 17.0, 1.4 Hz, 1H), 6.35 (dd, J = 17.0, 9.9 Hz, 1H), 5.92 (dd, J = 9.9, 1.3 Hz, 1H)

[1122] HPLCMS (Method A): [m / z]: 229.05 [M+H]+

[1123] N-(2,5-difluorophenyl)prop-2-enamide (K5)

[1124]

[1125] At room temperature, prop-2-enoyl chloride (5.0 ml, 61.96 mmol) was added dropwise to a solution of 2,5-difluoroaniline (1.5 ml, 15.5 mmol) and K2CO3 (6.42 g, 46.5 mmol) in acetone (60 ml) which was stirred and purged with N2. The reaction mixture was stirred at room temperature for 2 h. The reaction was filtered and the filtrate was concentrated to give a white solid which was triturated with heptane to give the title compound as a white solid (2.91 g, quantitative).

[1126] 1H-NMR (CDCl3, 250 MHz): δ [ppm] = 8.30 (m, 1H), 7.50 (s, 1H), 7.07 (m, 1H), 6.85 - 6.70 (m, 1H), 6.50 (dd, J = 16.8, 1.2 Hz, 1H), 6.30 (dd, J = 16.9, 10.1 Hz, 1H), 5.87 (dd, J = 10.1, 1.2 Hz, 1H)

[1127] HPLCMS (Method A): [m / z]: 183.95 [M+H] +

[1128] N-(3,6-difluoro-2-nitrophenyl)prop-2-enamide (K6)

[1129]

[1130] At 0 °C, red fuming HNO3 (1.6 ml, 34.0 mmol) was added dropwise to a solution of N-(2,5-difluorophenyl)prop-2-enamide (K5) (2.91 g, 15.9 mmol), AcOH (5 ml) and concentrated H2SO4 (13 ml) which was stirred and purged with N2. The reaction mixture was stirred for 2 h. The reaction was poured onto ice water and the resulting solution was extracted with DCM (4 × 40 ml). The combined organic extracts were washed with brine, dried (MgSO4), filtered and concentrated in vacuo. Purification by flash column chromatography (eluting with a gradient of 0 - 60% EtOAc / heptane), followed by flash column chromatography (eluting with a gradient of 20% EtOAc / heptane) gave the title compound as a white solid (0.316 g, 8%).

[1131] 1H-NMR(CDCl3,500MHz): δ [ppm] = 7.64(s,1H), 7.39(m,1H), 7.19(m,1H), 6.51(dd,J = 17.0,0.7Hz,1H), 6.32(dd,J = 17.0,10.4Hz,1H), 5.93(dd,J = 10.4,0.7Hz,1H)

[1132] HPLCMS (Method A): [m / z]: 228.95 [M+H] +

[1133] N-[2-(Trifluoromethyl)phenyl]prop-2-enamide (K7)

[1134]

[1135] At room temperature, prop-2-enoyl chloride (8.0 ml, 99.30 mmol) was added dropwise to a suspension of 2-(trifluoromethyl)aniline (3.1 ml, 24.83 mmol) and K2CO3 (10.3 g, 74.48 mmol) in acetone (90 ml) purged with N2. The reaction mixture was stirred at room temperature for 3 h. The reaction was filtered, concentrated in vacuo and triturated with heptane to give the title compound as a white solid (4.74 g, 86%).

[1136] 1H-NMR(CDCl3,250MHz): δ [ppm] = 8.34(d,J = 8.2Hz,1H), 7.70 - 7.45(m,3H), 7.28 - 7.22(m,1H), 6.46(dd,J = 16.9,1.3Hz,1H), 6.29(dd,J = 16.9,10.0Hz,1H), 5.86(dd,J = 10.0,1.3Hz,1H)

[1137] HPLCMS (Method A): [m / z]: 215.90 [M+H] +

[1138] N-[2-Nitro-6-(trifluoromethyl)phenyl]prop-2-enamide (K8)

[1139]

[1140] At 0 °C, fuming red HNO3 (1.6 ml, 34.05 mmol) was added dropwise to a solution of N-[2-(trifluoromethyl)phenyl]prop-2-enamide (K7) (4.64 g, 20.91 mmol), AcOH (5 ml) and concentrated H2SO4 (13 ml) purified with N2. The reaction mixture was stirred at room temperature for 16 h. The reaction was poured onto ice water and then extracted with DCM (4 × 40 ml). The combined organic extracts were dried (MgSO4), filtered and concentrated in vacuo. Purification by flash column chromatography (eluting with a gradient of 0 - 20% EtOAc / heptane) gave the title compound as a beige solid (0.829 g, 12%).

[1141] HPLCMS (method A): [m / z]: 260.95 [M+H] +

[1142] N-(2,3-difluorophenyl)prop-2-enamide (K9)<o:p>< / o:p> [[ID=P]]<o:p>< / o:p>

[1143]

[1144] At room temperature, prop-2-enoyl chloride (10 ml, 124 mmol) was added dropwise to a solution of 2,3-difluoroaniline (3 ml, 31 mmol) and K2CO3 (12.9 g, 92.9 mmol) in acetone (120 ml) purified with N2. The reaction mixture was stirred for 16 h. The reaction was filtered and the filtrate was concentrated to give a white solid, which was triturated with heptane to give the title compound as a white solid (4.97 g, 87%).

[1145] 1H-NMR (CDCl3, 250 MHz): δ [ppm] = 8.29 - 8.12 (m, 1H), 7.46 (s, 1H), 7.18 - 7.04 (m, 1H), 7.02 - 6.85 (m, 1H), 6.50 (dd, J = 16.8, 1.3 Hz, 1H), 6.31 (dd, J = 16.9, 10.1 Hz, 1H), 5.87 (dd, J = 10.1, 1.3 Hz, 1H)

[1146] HPLCMS (method A): [m / z]: 184.2 [M+H] +

[1147] N-(2,3-difluoro-6-nitrophenyl)prop-2-enamide (K10)

[1148]

[1149] At 0 °C, nitric acid (1.6 ml) was added dropwise to a solution of N-(2,3-difluorophenyl)prop-2-enamide (K9) (4.9 g, 26.8 mmol), AcOH (5 ml) and concentrated H2SO4 (13 ml) purified with N2. The reaction mixture was stirred for 2 h. The reaction was poured onto ice / water and the solution was extracted with DCM (5 × 30 ml). The combined organic extracts were washed with brine (50 ml), dried over MgSO4, filtered and concentrated to give the crude product. It was triturated with heptane (100 ml). The suspension was filtered and the residue was collected to give a mixture of para / ortho nitrated regioisomers (6 g) as a beige solid. Purification by acidic prep-HPLC gave the title compound (4.2 g) as a white solid.

[1150] HPLCMS (Method A): [m / z]: 228.95 [M+H] +

[1151] The above general protocol K-II:

[1152] N-(4-cyanophenyl)prop-2-enamide (K11)

[1153]

[1154] Acryloyl chloride (0.69 ml, 8.46 mmol) was added to a cold suspension of 4-aminobenzonitrile (250 mg, 2.12 mmol) and K2CO3 (880 mg, 6.35 mmol) in acetone (5 ml). The mixture was stirred for 18 h while warming to room temperature. The reaction mixture was filtered and the residue was rinsed with acetone (5 ml). The combined filtrates were evaporated in vacuo and crudely purified by flash column chromatography using an elution gradient of 0 - 80% EtOAc / heptane to give the title compound (353 mg, 96%) as a white solid.

[1155] 1H-NMR (CDCl3, 250 MHz): δ [ppm] = 7.73 (d, J = 8.8 Hz, 2H), 7.68 - 7.58 (m, 2H), 7.37 (s, 1H), 6.49 (dd, J = 16.8, 1.0 Hz, 1H), 6.25 (dd, J = 16.8, 10.2 Hz, 1H), 5.86 (dd, J = 10.2, 1.0 Hz, 1H)

[1156] HPLCMS (Method M): [m / z]: 173.45 [M+H] +

[1157] N-(4-cyano-2-nitrophenyl)prop-2-enamide (K12)

[1158]

[1159] Nitric acid (0.6 ml) was added dropwise to a cold solution of N-(4-cyanophenyl)prop-2-enamide (K11) (1.03 g, 5.75 mmol) in acetic acid (2 ml) and sulfuric acid (4.75 ml). The reaction mixture was stirred for 3 h and then poured into ice-cold water, and the mixture was extracted with DCM (4 × 20 ml). The combined organic extracts were dried (MgSO4) and evaporated in vacuo. Purification by flash column chromatography using an elution gradient of 0-90% EtOAc / heptane gave the title compound as a yellow solid (1.2 g, 93%).

[1160] 1H-NMR (CDCl3, 250 MHz): δ [ppm] = 10.77 (s, 1H), 9.14 (d, J = 8.9 Hz, 1H), 8.58 (d, J = 2.0 Hz, 1H), 7.90 (dd, J = 8.9, 1.7 Hz, 1H), 6.54 (dd, J = 17.0, 0.9 Hz, 1H), 6.35 (dd, J = 17.0, 10.1 Hz, 1H), 5.98 (dd, J = 10.1, 0.9 Hz, 1H)

[1161] tert-Butyl 2-(chloromethyl)-1H-1,3-benzodiazole-1-carboxylate (L)

[1162]

[1163] A mixture of 2-(chloromethyl)-1H-1,3-benzodiazole (10 g, 0.06 mol), BOC2O (18 ml, 0.06 mol) and TEA (6.07 g, 0.06 mol) in DCM (304 ml) was cooled to 0 °C. A catalytic amount of DMAP (0.73 g, 0.006 mol) was added, and the reaction mixture was stirred at room temperature for 2 h. The mixture was diluted with EtOAc (150 ml), washed with saturated NaHCO3 (150 ml), brine (150 ml), dried (Na2SO4), filtered and concentrated to give the crude product. Purification by flash column chromatography (eluting with a gradient of 5-10% EtOAc / heptane) gave the title compound as an off-white oil (7 g, 44%).

[1164] HPLCMS (method H): [m / z]: 167.2 [M - Boc + H] +

[1165] The above general protocol I-1:

[1166] Ethyl 2-(2-{[(tert-butoxy)carbonyl]amino}ethyl)-4-methyl-1,3-thiazole-5-carboxylate (208)

[1167]

[1168] In a similar manner to General Procedure 1, a suspension of tert-butyl (3-amino-3-oxopropyl)carbamate (1.0 g, 5.34 mmol), CaCO3 (0.29 g, 2.93 mmol), and ethyl 2-chloro-3-oxobutanoate (0.81 mL, 5.86 mmol) in EtOH (15 mL) was heated at 60 °C for 18 h. The reaction mixture was cooled to room temperature and concentrated in vacuo. The residue was partitioned between EtOAc and water, and then phase separation was carried out. The aqueous phase was extracted with EtOAc (2 × 80 mL), and the combined organic extracts were washed with brine (80 mL). The organic phase was dried (Na2SO4), filtered, and evaporated to dryness in vacuo. Purification by flash column chromatography (eluting with a gradient of 5 - 50% EtOAc / heptane) gave the title compound as a white solid (1.57 g, 94%).

[1169] 1H-NMR (CDCl3, 500 MHz): δ [ppm] = 5.01 (brs, 1H), 4.34 (q, J = 7.1 Hz, 2H), 3.57 (dt, J = 5.5, 5.5 Hz, 2H), 3.15 (t, J = 6.3 Hz, 2H), 2.73 (s, 3H), 1.47 (s, 9H), 1.38 (t, J = 7.1 Hz, 3H)

[1170] HPLCMS (Method A): [m / z]: 315.10 [M + H] +

[1171] Ethyl 2-(2-{[(tert-butoxy)carbonyl]amino}ethyl)-1,3-thiazole-5-carboxylate (209)

[1172]

[1173] In a similar manner to General Procedure 1, tert-butyl N-(2-thiocarbamoylethyl)carbamate (1 g, 4.89 mmol), calcium carbonate (0.27 g, 3 mmol) and ethyl 2-chloro-3-oxopropionate (0.81 g, 5 mmol) were combined in EtOH (15 ml) and the mixture was heated at 60 °C for 18 h. Additional 2-chloro-3-oxopropionate (0.81 g, 5 mmol) was added and the mixture was heated at 80 °C for a further 5 h. The reaction mixture was cooled to room temperature and concentrated in vacuo. The residue was partitioned between water and EtOAc and the mixture was extracted with EtOAc (3 x 80 ml). The combined organic extracts were washed with brine (80 ml), dried (Na2SO4), filtered and evaporated in vacuo. Purification by flash column chromatography (eluting with a gradient of 20 - 60% EtOAc / heptane) gave the crude title compound as a brown oil (743 mg) which was used in the next step without further purification.

[1174] HPLCMS (Method A): [m / z]: 301.05 [M+H] +

[1175] 2-(2-{[(tert-Butoxy)carbonyl]amino}ethyl)-4-methyl-1,3-thiazole-5-carboxylic acid (210)

[1176]

[1177] In a similar manner to General Procedure 5, ethyl 2-(2-{[(tert-butoxy)carbonyl]amino}ethyl)-4-methyl-1,3-thiazole-5-carboxylate (208) (1.57 g, 4.99 mmol) and LiOH (0.72 g, 30 mmol) in THF (30 ml) and water (15 ml) gave the title compound as a white solid (1.23 g, 86%).

[1178] 1H-NMR (DMSO-d6, 500 MHz): δ [ppm] = 6.99 (t, J = 5.3 Hz, 1H), 3.28 (m, 2H), 3.04 (t, J = 6.7 Hz, 2H), 2.58 (s, 3H), 1.37 (s, 9H)

[1179] HPLCMS (Method A): [m / z]: 287.05 [M+H] +

[1180] 2-(2-{[(tert-Butoxy)carbonyl]amino}ethyl)-1,3-thiazole-5-carboxylic acid (211)

[1181]

[1182] In a similar manner to General Procedure 5, crude ethyl 2-(2-{[(tert-butoxy)carbonyl]amino}ethyl)-1,3-thiazole-5-carboxylate (209) (743 mg, 2.47 mmol) and LiOH (300 mg, 12 mmol) in THF (20 ml) and water (10 ml) gave the crude title compound (500 mg) as a brown oil, which was used in the next step without further purification.

[1183] HPLCMS (Method A): [m / z]: 273.05 [M+H] +

[1184] tert-Butyl N-[2-(5-{[(3-fluoropyridin-2-yl)methyl]carbamoyl}-4-methyl-1,3-thiazol-2-yl)ethyl]carbamate (212)

[1185]

[1186] In a similar manner to General Procedure 6, 2-(2-{[(tert-butoxy)carbonyl]amino}ethyl)-4-methyl-1,3-thiazole-5-carboxylic acid (210) (0.457 g, 1.6 mmol), (3-fluoropyridin-2-yl)methanamine dihydrochloride (A2) (0.349 g, 1.76 mmol), DIPEA (0.92 ml, 5 mmol) and HATU (0.73 g, 2 mmol) in DCM (20 ml) gave the crude title compound (1.26 g) as a colorless oil.

[1187] HPLCMS (Method A): [m / z]: 395.1 [M+H] +

[1188] tert-Butyl N-[2-(5-{[(3-fluoropyridin-2-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (213)

[1189]

[1190] In a similar manner to General Procedure 6, crude 2-(2-{[(tert-butoxy)carbonyl]amino}ethyl)-1,3-thiazole-5-carboxylic acid (211) (500 mg), (3-fluoropyridin-2-yl)methanamine dihydrochloride (A2) (402 mg, 2.02 mmol), DIPEA (1.06 ml, 6 mmol) and HATU (840 mg, 2 mmol) were placed in DCM (30 ml). After partial purification by flash column chromatography (eluting with a gradient of 20 - 100% EtOAc / heptane followed by 0 - 10% MeOH / EtOAc), the crude title compound was obtained as a yellow residue (953 mg, 87% purity).

[1191] HPLCMS (Method A): [m / z]: 381.05 [M+H] +

[1192] 2-(2-Aminoethyl)-N-[(3-fluoropyridin-2-yl)methyl]-4-methyl-1,3-thiazole-5-carboxamide (214)

[1193]

[1194] In a similar manner to General Procedure 2, crude tert-butyl N-[2-(5-{[(3-fluoropyridin-2-yl)methyl]carbamoyl}-4-methyl-1,3-thiazol-2-yl)ethyl]carbamate (212) (1.26 g) and 12 M HCl (2 ml) were placed in MeOH (20 ml). After purification using an SCX-2 cartridge, eluting with DCM and MeOH followed by elution with 7N ammonia in MeOH, the free base of the title compound was obtained as a white solid (471 mg).

[1195] 1H-NMR (DMSO-d6, 500 MHz): δ [ppm] = 8.56 (t, J = 5.5 Hz, 1H), 8.39 (dt, J = 4.6, 1.3 Hz, 1H), 7.73 - 7.67 (m, 1H), 7.43 - 7.38 (m, 1H), 4.61 - 4.56 (m, 2H), 3.03 (t, J = 7.0 Hz, 2H), 2.95 (t, J = 6.5 Hz, 2H), 2.54 (s, 3H)

[1196] HPLCMS (Method A): [m / z]: 295.05 [M+H] +

[1197] 2-(2-Aminoethyl)-N-[(3-fluoropyridin-2-yl)methyl]-1,3-thiazole-5-carboxamide (215)

[1198]

[1199] In a similar manner to General Procedure 2, crude tert-butyl N-[2-(5-{[(3-fluoropyridin-2-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (213) (87%, 923 mg, 2.11 mmol) and 12 M HCl (2 ml) were placed in MeOH (20 ml). After purification using an SCX-2 cartridge, eluting with DCM and MeOH, and then eluting with 7 N ammonia in MeOH, the free base of the title compound as a yellow residue (389 mg) was obtained.

[1200] HPLCMS (Method A): [m / z]: 280.95 [M+H] +

[1201] 2-(2-{[2-(1H-1,3-benzodiazol-2-yl)ethyl]amino}ethyl)-N-[(3-fluoropyridin-2-yl)methyl]-4-methyl-1,3-thiazole-5-carboxamide (Example Compound No. 7)

[1202]

[1203] In a similar manner to General Procedure 8, 2-(2-aminoethyl)-N-[(3-fluoropyridin-2-yl)methyl]-4-methyl-1,3-thiazole-5-carboxamide (214) (471 mg, 1.6 mmol), N-(2-nitrophenyl)prop-2-enamide (D) (295 mg, 1.54 mmol), and DBU (0.26 ml, 2 mmol) gave a crude intermediate, which was further reacted with iron powder (280 mg, 5 mmol) in AcOH (5 ml). After purification by basic prep-HPLC, followed by flash column chromatography (eluting with a 0 - 30% MeOH / DCM gradient), the title compound as a white solid (115 mg, 20%) was obtained.

[1204] 1H-NMR (methanol-d4, 500 MHz): δ [ppm] = 8.38 (d, J = 4.7 Hz, 1H), 7.61 (t, J = 9.2 Hz, 1H), 7.52 - 7.46 (m, 2H), 7.43 - 7.38 (m, 1H), 7.22 - 7.15 (m, 2H), 4.73 (s, 2H), 3.22 - 3.14 (m, 4H), 3.14 - 3.05 (m, 4H), 2.51 (s, 3H)

[1205] HPLCMS (Method C): [m / z]: 439.1 [M+H] +

[1206] 2-(2-{[2-(1H-1,3-Benzodiazol-2-yl)ethyl]amino}ethyl)-N-[(3-fluoropyridin-2-yl)methyl]-1,3-thiazole-5-carboxamide (Example Compound No. 8)

[1207]

[1208] In a similar manner to General Procedure 8, 2-(2-aminoethyl)-N-[(3-fluoropyridin-2-yl)methyl]-1,3-thiazole-5-carboxamide (215) (389 mg, 1.39 mmol), N-(2-nitrophenyl)prop-2-enamide (D) (267 mg, 1.39 mmol) and DBU (0.25 ml, 2 mmol) in MeCN (15 ml) gave a crude intermediate, which was further reacted with iron powder (230 mg, 4 mmol) placed in AcOH (5 ml). After purification three times by basic prep-HPLC, the title compound as a white solid was obtained (49 mg, 11%).

[1209] 1H-NMR (methanol-d4, 500 MHz): δ [ppm] = 8.38 (dt, J = 4.9, 1.3 Hz, 1H), 8.14 (s, 1H), 7.65 - 7.59 (m, 1H), 7.52 - 7.47 (m, 2H), 7.44 - 7.39 (m, 1H), 7.21 - 7.17 (m, 2H), 4.75 (d, J = 1.6 Hz, 2H), 3.23 (t, J = 6.8 Hz, 2H), 3.15 - 3.07 (m, 6H)

[1210] HPLCMS (Method C): [m / z]: 425.1 [M + H] +

[1211] General Scheme 24 above:

[1212] Methyl 3-amino-2-hydroxypropionate hydrochloride (332)

[1213]

[1214] Thionyl chloride (1.8 ml, 20 mmol) was added to ice-cold MeOH (60 ml) and stirred for 5 min. 3-Amino-2-hydroxypropionic acid (1.04 g, 9.9 mmol) was added and the reaction mixture was stirred at room temperature for 18 h. The reaction mixture was evaporated strongly in vacuo to give the title compound as a yellow oil (1.54 g, quantitative yield).

[1215] 1H-NMR (DMSO-d6, 250 MHz): δ [ppm] = 8.12 (s, 3H), 6.36 (s, 1H), 4.39 (dt, J = 8.8, 4.6 Hz, 1H), 3.69 (s, 3H), 3.24 - 3.05 (m, 1H), 3.00 - 2.84 (m, 1H)

[1216] Methyl 3-(3-{[(tert-butoxy)carbonyl]amino}propanamido)-2-hydroxypropionate (333)

[1217]

[1218] In a similar manner to General Procedure 13, methyl 3-amino-2-hydroxypropionate hydrochloride (332) (4.35 g, 27.96 mmol), 3-{[(tert-butoxy)carbonyl]amino}propanoic acid (5.82 g, 30.76 mmol), TEA (4.68 ml, 34 mmol) and DCC (5.77 g, 28 mmol) were placed in DCM (80 ml). After purification by flash column chromatography (eluting with a gradient of 0 - 100% EtOAc / heptane), the title compound was obtained as a pale yellow oil (5.12 g, 63%).

[1219] 1H-NMR (CDCl3, 500 MHz): δ [ppm] = 6.06 (s, 1H), 5.18 (s, 1H), 4.32 (q, J = 4.9 Hz, 1H), 3.83 (s, 3H), 3.72 - 3.60 (m, 2H), 3.46 (d, J = 5.4 Hz, 1H), 3.45 - 3.38 (m, 2H), 2.47 - 2.36 (m, 2H), 1.46 (s, 9H)

[1220] HPLCMS (Method A): [m / z]: 313.00 [M+Na] +

[1221] Methyl 2-(2-{[(tert-butoxy)carbonyl]amino}ethyl)-4,5-dihydro-1,3-oxazole-5-carboxylate (334)

[1222]

[1223] In a similar manner to General Procedure 14, methyl 3-(3-{[(tert-butoxy)carbonyl]amino}propanamido)-2-hydroxypropionate (333) (3.63 g, 12.5 mmol), DAST (1.98 ml, 15 mmol), and K2CO3 (3.46 g, 25 mmol) were placed in DCM (100 ml). After purification by flash column chromatography (eluting with a gradient of 40 - 100% EtOAc / heptane), the title compound was obtained as a colorless oil (3.4 g, 99%).

[1224] 1H-NMR (CDCl3, 250 MHz): δ [ppm] = 4.96 (dd, J = 10.8, 6.5 Hz, 1H), 4.24 - 4.09 (m, 1H), 4.04 - 3.88 (m, 1H), 3.83 (s, 3H), 3.58 - 3.38 (m, 2H), 2.57 (d, J = 4.8 Hz, 2H), 1.47 (s, 9H)

[1225] HPLCMS (Method M): [m / z]: 272.95 [M+H] +

[1226] General Procedure 16: Methyl 2-(2-{[(tert-butoxy)carbonyl]amino}ethyl)-1,3-oxazole-5-carboxylate (335)

[1227]

[1228] A solution of methyl 2-(2-{[(tert-butoxy)carbonyl]amino}ethyl)-4,5-dihydro-1,3-oxazole-5-carboxylate (334) (3.2 g, 11.75 mmol), NBS (2.3 g, 12.93 mmol), and AIBN (0.19 g, 1.18 mmol) in DCE (30 ml) was heated at 80 °C for 1.5 h. The reaction mixture was cooled to room temperature, the reaction was terminated with saturated NaHCO3 (aqueous solution), and the mixture was extracted with DCM (3 × 80 ml). The combined organic extracts were dried (Na2SO4), filtered, and evaporated in vacuo. Purification by flash column chromatography (eluting with a gradient of 0 - 80% EtOAc / heptane) gave the crude title compound as an orange residue (1.25 g, 29%, 75% purity). The compound was used in the next step without further purification.

[1229] 1H-NMR (CDCl3, 250 MHz): δ [ppm] = 7.69 (s, 1H), 5.17 - 4.98 (m, 1H), 3.94 (s, 3H), 3.62 (q, J = 6.2 Hz, 2H), 3.05 (t, J = 6.2 Hz, 2H), 1.46 (s, 9H)

[1230] HPLCMS (Method M): [m / z]: 271.00 [M+H] +

[1231] 2-(2-{[(tert-Butoxy)carbonyl]amino}ethyl)-1,3-oxazole-5-carboxylic acid (336)

[1232]

[1233] In a similar manner to General Procedure 5, crude methyl 2-(2-{[(tert-Butoxy)carbonyl]amino}ethyl)-1,3-oxazole-5-carboxylate (335) (1.24 g, 3.44 mmol, 75% purity) and LiOH (0.329 mg, 13.76 mmol) in THF (20 ml) and water (20 ml) gave the title compound as a pale orange residue (0.51 g, 44%). The compound was used in the next step without further purification.

[1234] 1H-NMR (CDCl3, 250 MHz): δ [ppm] = 7.76 (s, 1H), 5.14 (s, 1H), 3.71 - 3.56 (m, 2H), 3.09 (t, J = 6.2 Hz, 2H), 1.46 (s, 9H)

[1235] HPLCMS (Method M): [m / z]: 256.95 [M+H] +

[1236] tert-Butyl N-[2-(5-{[(3-Fluoropyridin-2-yl)methyl]carbamoyl}-1,3-oxazol-2-yl)ethyl]carbamate (337)

[1237]

[1238] In a similar manner to General Procedure 6, 2-(2-{[(tert-Butoxy)carbonyl]amino}ethyl)-1,3-oxazole-5-carboxylic acid (336) (513 mg, 2 mmol), (3-Fluoropyridin-2-yl)methanamine dihydrochloride (A2) (479 mg, 2.4 mmol), DIPEA (1.15 ml, 6.61 mmol) and HATU (837 mg, 2.2 mmol) in DCM (20 ml) gave the crude title compound as a yellow residue (1.08 g, 74%, 50% purity). The compound was used in the next step without purification.

[1239] HPLCMS (Method M): [m / z]: 365.05 [M+H] +

[1240] 2-(2-Aminoethyl)-N-[(3-fluoropyridin-2-yl)methyl]-1,3-oxazole-5-carboxamide (338)

[1241]

[1242] In a similar manner to General Procedure 2, crude tert-butyl N-[2-(5-{[(3-fluoropyridin-2-yl)methyl]carbamoyl}-1,3-oxazol-2-yl)ethyl]carbamate (337) (1.08 g, 1.48 mmol) and 12 M HCl (1 ml) were placed in MeOH (10 ml). After free basification using an SCX-2 cartridge (10 g), elution with DCM and MeOH, and subsequent elution with 7 N ammonia in MeOH, the free base of the title compound as a pale yellow solid was obtained (444 mg, 57%).

[1243] 1H-NMR (DMSO-d6, 250 MHz): δ [ppm] = 8.99 (t, J = 5.7 Hz, 1H), 8.39 (dt, J = 4.6, 1.5 Hz, 1H), 7.78 - 7.64 (m, 2H), 7.48 - 7.36 (m, 1H), 4.61 (dd, J = 5.8, 1.6 Hz, 2H), 3.07 - 2.86 (m, 4H)

[1244] HPLCMS (Method M): [m / z]: 264.95 [M+H] +

[1245] 2-(2-{[2-(1H-1,3-Benzodiazol-2-yl)ethyl]amino}ethyl)-N-[(3-fluoropyridin-2-yl)methyl]-1,3-oxazole-5-carboxamide (Example Compound No. 1)

[1246]

[1247] In a similar manner to General Procedure 8, 2-(2-Aminoethyl)-N-[(3-fluoropyridin-2-yl)methyl]-1,3-oxazole-5-carboxamide (338) (444 mg, 1.68 mmol), N-(2-nitrophenyl)prop-2-enamide (D) (323 mg, 1.68 mmol), and DBU (301 μl, 2.02 mmol) were in MeCN (10 ml) to give a crude intermediate, which was further reacted with iron powder (343 mg, 6.13 mmol) and AcOH (10 ml). After purification by flash column chromatography (eluting with a gradient of 0 - 40% MeOH / DCM) and then by basic prep-HPLC, the title compound as a pale yellow solid was obtained (166 mg, 25%).

[1248] 1H-NMR (DMSO-d6, 500 MHz): δ [ppm] = 12.12 (s, 1H), 8.96 (t, J = 5.8 Hz, 1H), 8.38 (dt, J = 4.6, 1.4 Hz, 1H), 7.73 - 7.66 (m, 2H), 7.53 - 7.37 (m, 3H), 7.11 (dt, J = 6.0, 3.5 Hz, 2H), 4.61 (dd, J = 5.7, 1.4 Hz, 2H), 3.04 - 2.89 (m, 8H)

[1249] HPLCMS (Method B): [m / z]: 409.1 [M+H] +

[1250] 2-{2-[(1H-1,3-Benzodiazol-2-ylmethyl)amino]ethyl}-N-[(3-fluoropyridin-2-yl)methyl]-1,3-oxazole-5-carboxamide (Example Compound No. 4)

[1251]

[1252] In a similar manner to General Procedure 3, 2-(2-aminoethyl)-N-[(3-fluoropyridin-2-yl)methyl]-1,3-oxazole-5-carboxamide (338) (250 mg, 0.83 mmol, 88% purity), 1H-benzimidazole-2-carbaldehyde (170 mg, 1.17 mmol), DIPEA (0.44 ml, 2.5 mmol) and MgSO4 (150 mg, 1.25 mmol) in MeOH (10 ml) were stirred at room temperature for 16 h to give an intermediate, which was then reacted with NaBH4 (47 mg, 1.25 mmol). After purification by flash column chromatography [eluting with a gradient of 0 - 5% (7N NH3 in MeOH) / DCM] followed by basic prep-HPLC, the title compound was obtained as a white solid (156 mg, 48%).

[1253] 1H-NMR (DMSO-d6, 500 MHz): δ [ppm] = 12.17 (brs, 1H), 8.95 (t, J = 5.8 Hz, 1H), 8.39–8.34 (m, 1H), 7.72–7.65 (m, 2H), 7.54–7.46 (m, 1H), 7.46–7.36 (m, 2H), 7.17–7.06 (m, 2H), 4.63–4.56 (m, 2H), 3.93 (s, 2H), 3.02–2.94 (m, 4H), 2.57 (brs, 1H)

[1254] HPLCMS (Method D): [m / z]: 395.2 [M+H] +

[1255] General procedure 27 above:

[1256] tert-Butyl 3-[(2-hydroxy-3-methoxy-3-oxopropyl)carbamoyl]acridine-1-carboxylate (354)

[1257]

[1258] In a similar manner to General procedure 13, methyl 3-amino-2-hydroxypropionate hydrochloride (2.9 g, 18.64 mmol), 1-(tert-butoxycarbonyl)acridine-3-carboxylic acid (4.13 g, 20.5 mmol), TEA (5.45 ml, 39.14 mmol) and DCC (4.04 g, 19.57 mmol) were placed in DCM (80 ml). After purification by flash column chromatography (eluting with a gradient of 0 - 100% EtOAc / heptane, followed by 0 - 3% MeOH / EtOAc), the title compound was obtained as a viscous pale yellow oil (4.47 g, 79%).

[1259] 1H-NMR (CDCl3, 500 MHz): δ [ppm] = 5.92 (s, 1H), 4.32 (dd, J = 5.3, 4.3 Hz, 1H), 4.14 - 4.03 (m, 5H), 3.84 (s, 3H), 3.74 - 3.63 (m, 2H), 3.24 - 3.14 (m, 1H), 1.46 (s, 9H)

[1260] HPLCMS (method M): [m / z]: 325.00 [M+Na] +

[1261] Methyl 2-{1-[(tert-butoxy)carbonyl]acridin-3-yl}-4,5-dihydro-1,3-oxazole-5-carboxylate (355)

[1262]

[1263] In a similar manner to General procedure 14, tert-Butyl 3-[(2-hydroxy-3-methoxy-3-oxopropyl)carbamoyl]acridine-1-carboxylate (354) (4.47 g, 14.79 mmol) and DAST (2.15 ml, 16.26 mmol) were placed in DCM (100 ml). The reaction was then quenched with K2CO3 (4.09 g, 29.57 mmol). After purification by flash column chromatography (eluting with a gradient of 20 - 100% EtOAc / heptane, followed by 1% MeOH / EtOAc), the title compound was obtained as a pale yellow oil (1.61 g, 38%).

[1264] 1H-NMR(CDCl3, 250 MHz): δ [ppm] = 5.00 (dd, J = 10.8, 6.7 Hz, 1H), 4.27 - 4.08 (m, 5H), 4.00 (ddd, J = 14.7, 6.7, 1.0 Hz, 1H), 3.83 (s, 3H), 3.55 - 3.39 (m, 1H), 1.46 (s, 9H)

[1265] Methyl 2-{1-[(tert-butoxy)carbonyl]acridin-3-yl}-1,3-oxazole-5-carboxylate (356)

[1266]

[1267] In a similar manner to General Procedure 16, methyl 2-{1-[(tert-butoxy)carbonyl]acridin-3-yl}-4,5-dihydro-1,3-oxazole-5-carboxylate (355) (1.61 g, 5.66 mmol), NBS (1.11 g, 6.23 mmol) and AIBN (0.11 g, 0.57 mmol) in DCE (60 ml) were heated at 80 °C for 1.5 h. After purification by flash column chromatography (eluting with a gradient of 0 - 80% EtOAc / heptane), the title compound was obtained as a pale yellow oil (756 mg, 45%).

[1268] 1H-NMR(CDCl3, 250 MHz): δ [ppm] = 7.74 (s, 1H), 4.38 - 4.23 (m, 4H), 4.03 - 3.83 (m, 5H), 1.48 (s, 9H)

[1269] HPLCMS (Method M): [m / z]: 304.95 [M+Na] +

[1270] 2-{1-[(tert-butoxy)carbonyl]acridin-3-yl}-1,3-oxazole-5-carboxylic acid (357)

[1271]

[1272] In a similar manner to General Procedure 5, (20 ml / 20 ml) of methyl 2-{1-[(tert-butoxy)carbonyl]acridin-3-yl}-1,3-oxazole-5-carboxylate (356) (750 mg, 2.66 mmol) and LiOH (382 mg, 15.94 mmol) in THF / water gave the title compound as a pale yellow oil (710 mg, 99%). The title compound was used in the next step without purification.

[1273] 1H-NMR(CDCl3, 250 MHz): δ [ppm] = 7.83 (s, 1H), 4.40 - 4.25 (m, 4H), 4.04 - 3.94 (m, 1H), 1.48 (s, 9H)

[1274] HPLCMS (Method M): [m / z]: 290.90 [M + Na] +

[1275] tert-Butyl 3-(5-{[(3-fluoropyridin-2-yl)methyl]carbamoyl}-1,3-oxazol-2-yl)acridine-1-carboxylate (358)

[1276]

[1277] In a similar manner to General Procedure 6, 2-{1-[(tert-butoxy)carbonyl]acridin-3-yl}-1,3-oxazole-5-carboxylic acid (357) (0.74 g, 2.77 mmol), (3-fluoropyridin-2-yl)methanamine dihydrochloride (A2) (0.61 g, 3.04 mmol), DIPEA (1.59 ml, 9.13 mmol), and HATU (1.16 g, 3.04 mmol) were placed in DCM (30 ml). After purification by flash column chromatography (eluting with a gradient of 20 - 100% EtOAc / heptane, followed by 2 - 10% MeOH / EtOAc), the title compound was obtained as a pale yellow oil (2.26 g, 45% purity). This material was used in the next step without further purification.

[1278] 1H-NMR(CDCl3, 250 MHz): δ [ppm] = 8.44 (dt, J = 4.8, 1.3 Hz, 1H), 7.72 (s, 1H), 7.60 (s, 1H), 7.53 - 7.42 (m, 1H), 7.38 - 7.31 (m, 1H), 4.84 (dd, J = 4.8, 1.5 Hz, 2H), 4.42 - 4.24 (m, 4H), 4.06 - 3.91 (m, 1H), 1.49 (s, 9H)

[1279] HPLCMS (Method M): [m / z]: 377.05 [M + H] +

[1280] 2-(Acridin-3-yl)-N-[(3-fluoropyridin-2-yl)methyl]-1,3-oxazole-5-carboxamide (359)

[1281]

[1282] In a similar manner to General Procedure 2, tert-butyl 3-(5-{[(3-fluoropyridin-2-yl)methyl]carbamoyl}-1,3-oxazol-2-yl)acridine-1-carboxylate (358) (45%, 2.26 g, 2.7 mmol) and 12 M HCl (2 ml) were placed in MeOH (20 ml), free basified using an SCX-2 cartridge (10 g), rinsed with DCM and MeOH, and then eluted with 7 N ammonia in MeOH to give the title compound as a white solid (644 mg, 86%).

[1283] 1H-NMR (DMSO-d6, 500 MHz): δ [ppm] = 9.03 (t, J = 5.6 Hz, 1H), 8.39 (dt, J = 4.5, 1.3 Hz, 1H), 7.74 (s, 1H), 7.70 (ddd, J = 10.0, 8.4, 1.2 Hz, 1H), 7.41 (dt, J = 8.6, 4.4 Hz, 1H), 4.63 - 4.60 (m, 2H), 4.11 - 4.02 (m, 1H), 3.85 (t, J = 7.6 Hz, 2H), 3.78 (t, J = 8.2 Hz, 2H)

[1284] HPLCMS (Method M): [m / z]: 276.95 [M+H] +

[1285] 2-{1-[2-(1H-1,3-benzodiazol-2-yl)ethyl]acridin-3-yl}-N-[(3-fluoropyridin-2-yl)methyl]-1,3-oxazole-5-carboxamide (Example Compound No. 2)

[1286]

[1287] In a similar manner to General Procedure 8, 2-(acridin-3-yl)-N-[(3-fluoropyridin-2-yl)methyl]-1,3-oxazole-5-carboxamide (359) (255 mg, 0.92 mmol), N-(2-nitrophenyl)prop-2-enamide (D) (186 mg, 0.97 mmol) and DBU (145 μl, 0.97 mmol) in MeCN (10 ml) gave a crude intermediate, which was further reacted with iron powder (167 mg, 3 mmol) in AcOH (4 ml). After purification by basic prep-HPLC followed by flash column chromatography (eluting with a gradient of 0 - 40% MeOH / DCM), the title compound was obtained as a white solid (140 mg, 44%).

[1288] 1H-NMR (MeOD, 500 MHz): δ [ppm] = 8.36 (dt, J = 4.7, 1.2 Hz, 1H), 7.69 (s, 1H), 7.62 (ddd, J = 9.8, 8.4, 1.2 Hz, 1H), 7.52 (s, 2H), 7.41 (dt, J = 8.6, 4.4 Hz, 1H), 7.24 - 7.17 (m, 2H), 4.77 (d, J = 1.6 Hz, 2H), 3.96 - 3.87 (m, 1H), 3.76 (t, J = 7.9 Hz, 2H), 3.58 (t, J = 7.3 Hz, 2H), 3.08 - 3.02 (m, 2H), 3.01 - 2.95 (m, 2H)

[1289] HPLCMS (Method B): [m / z]: 421.1 [M + H] +

[1290] 2-{1-[2-(4-Fluoro-1H-1,3-benzodiazol-2-yl)ethyl]acridin-3-yl}-N-[(3-fluoropyridin-2-yl)methyl]-1,3-oxazole-5-carboxamide (Example Compound No. 3)

[1291]

[1292] In a similar manner to General Procedure 8, 2-(Acridin-3-yl)-N-[(3-fluoropyridin-2-yl)methyl]-1,3-oxazole-5-carboxamide (359) (400 mg, 1.45 mmol), N-(3-fluoro-2-nitrophenyl)prop-2-enamide (G) (335 mg, 1.59 mmol) and DBU (238 μl, 1.59 mmol) in MeCN (10 ml) gave a crude intermediate, which was purified by flash chromatography (eluting with a gradient of 0 - 20% MeOH / DCM). The intermediate was further reacted with iron powder (76 mg) placed in AcOH (3 ml), and after purification by flash column chromatography (eluting with a gradient of 0 - 35% MeOH / DCM), the title compound was obtained as a beige solid (52 mg, 34%).

[1293] 1H-NMR (MeOD, 500 MHz): δ [ppm] = 8.38 - 8.34 (m, 1H), 7.69 (s, 1H), 7.65 - 7.60 (m, 1H), 7.44 - 7.39 (m, 1H), 7.31 (d, J = 8.2 Hz, 1H), 7.21 - 7.15 (m, 1H), 6.98 - 6.92 (m, 1H), 4.77 (d, J = 1.6 Hz, 2H), 3.92 (p, J = 7.1 Hz, 1H), 3.77 (t, J = 8.0 Hz, 2H), 3.58 (t, J = 7.4 Hz, 2H), 3.08 - 3.02 (m, 2H), 3.02 - 2.96 (m, 2H)

[1294] HPLCMS (Method G): [m / z]: 439.2 [M + H] +

[1295] 2-{1-[2-(5-Fluoro-1H-1,3-benzodiazol-2-yl)ethyl]acridin-3-yl}-N-[(3-fluoropyridin-2-yl)methyl]-1,3-oxazole-5-carboxamide (Example Compound No. 5)

[1296]

[1297] In a similar manner to General Procedure 8, 2-(acridin-3-yl)-N-[(3-fluoropyridin-2-yl)methyl]-1,3-oxazole-5-carboxamide (359) (581 mg, 2.1 mmol), N-(5-fluoro-2-nitrophenyl)prop-2-enamide (J) (371 mg, 1.77 mmol) and DBU (346 μl, 2.31 mmol) in MeCN (30 ml) gave a crude intermediate, which was further reacted with iron powder (186 mg, 3.34 mmol) placed in AcOH (20 ml). After purification by basic prep-HPLC, the title compound was obtained as a white solid (205 mg, 56%).

[1298] 1H-NMR (MeOD, 500 MHz): δ [ppm] = 8.37 (dt, J = 4.6, 1.2 Hz, 1H), 7.69 (s, 1H), 7.62 (ddd, J = 9.8, 8.4, 1.2 Hz, 1H), 7.51 - 7.45 (m, 1H), 7.41 (dt, J = 8.7, 4.4 Hz, 1H), 7.22 (dd, J = 9.1, 2.1 Hz, 1H), 7.03 - 6.96 (m, 1H), 4.77 (d, J = 1.6 Hz, 2H), 3.95 - 3.86 (m, 1H), 3.76 (t, J = 8.0 Hz, 2H), 3.57 (t, J = 7.4 Hz, 2H), 3.06 - 3.01 (m, 2H), 3.00 - 2.94 (m, 2H)

[1299] HPLCMS (Method B): [m / z]: 439.2 [M + H] +

[1300] The above general protocol 1:

[1301] General procedure 1: Ethyl 2-(2-{[(tert-butoxy)carbonyl]amino}ethyl)-1,3-thiazole-4-carboxylate (1)

[1302]

[1303] Calcium carbonate (5.3 g, 52.87 mmol) was added portionwise to a suspension of ethyl 3-bromo-2-oxopropionate (12.35 ml, 107.69 mmol) and tert-butyl (3-amino-3-thioxopropyl)carbamate (20 g, 97.9 mmol) in EtOH (200 ml), and the reaction mixture was stirred at room temperature for 12 h. The mixture was concentrated in vacuo, and the residue was partitioned between EtOAc (200 ml) and sat. NaHCO3 (100 ml). The organic layer was separated and washed with water (100 ml), brine (100 ml), dried (MgSO4), filtered and concentrated in vacuo to give the desired product. Purification by flash column chromatography (isocratic elution with 20% EtOAc / heptane) gave the title compound as a yellow solid (22 g, 69.6%).

[1304] 1H-NMR (methanol-d4, 250 MHz): δ [ppm] = 8.29 (s, 1H), 4.39 (q, J = 7.1 Hz, 2H), 3.47 (t, J = 6.5 Hz, 2H), 3.22 (t, J = 6.5 Hz, 2H), 1.41 (d, J = 6.2 Hz, 14H)

[1305] HPLCMS (Method A): [m / z]: 301.0 [M + H]+

[1306] Methyl 2-(2-{[(tert-butoxy)carbonyl]amino}ethyl)-1,3-thiazole-4-carboxylate (2)

[1307]

[1308] In a similar manner to General Procedure 1, tert-butyl (3-amino-3-oxopropyl)carbamate (10 g, 48.95 mmol), methyl 3-bromo-2-oxopropionate (5.73 ml, 53.85 mmol) and CaCO3 (0.9 ml, 26.43 mmol) were placed in EtOH (120 ml). After purification by flash chromatography (eluting with a gradient of 20 - 80% EtOAc / heptane), the title compound was obtained as a yellow solid (102 g, 60%, 83% purity).

[1309] HPLCMS (Method A): [m / z]: 286.9 [M+H] +

[1310] Methyl 2-(2-{[(tert-butoxy)carbonyl]amino}ethyl)-5-methyl-1,3-thiazole-4-carboxylate (3)

[1311]

[1312] In a similar manner to General Procedure 1, tert-butyl N-(2-thiocarbamoylethyl)carbamate (0.89 g, 4.35 mmol), methyl 3-bromo-2-oxobutyrate (0.93 g, 4.78 mmol) and CaCO3 (0.23 g, 2 mmol) were placed in EtOH (15 ml). After purification by flash column chromatography (eluting with a gradient of 10 - 60% EtOAc / heptane), the title compound was obtained as a yellow oil (0.769 g, 58%).

[1313] 1H-NMR (CDCl3, 250 MHz): δ [ppm] = 4.88 (s, 1H), 3.95 (s, 3H), 3.55 (q, J = 6.5 Hz, 2H), 3.17 (t, J = 6.5 Hz, 2H), 2.76 (s, 3H), 1.46 (s, 9H)

[1314] HPLCMS (Method A): [m / z]: 301.05 [M+H] +

[1315] Ethyl 2-(3-{[(tert-butoxy)carbonyl]amino}propyl)-1,3-thiazole-4-carboxylate (4)

[1316]

[1317] In a similar manner to General Procedure 1, tert-butyl N-(3-thiocarbamoylpropyl)carbamate (535 mg, 2.45 mmol), ethyl 3-bromo-2-oxopropionate (0.31 ml, 2.7 mmol), and CaCO3 (132 mg, 1.32 mmol) were placed in EtOH (10 ml). After purification by flash column chromatography (eluting with a gradient of 0 - 50% EtOAc / heptane), the title compound was obtained as a yellow oil (726 mg, 93%).

[1318] 1H-NMR (DMSO-d6, 500 MHz): δ [ppm] = 8.38 (s, 1H), 6.90 (s, 1H), 4.29 (q, J = 7.1 Hz, 2H), 3.15 - 2.90 (m, 4H), 1.83 (m, 2H), 1.38 (s, 9H), 1.30 (t, J = 7.1 Hz, 3H)

[1319] HPLCMS (Method A): [m / z]: 315 [M + H] +

[1320] General Procedure 2: Methyl 2-(2-aminoethyl)-1,3-thiazole-4-carboxylate (5)

[1321]

[1322] 4M HCl in dioxane (44 ml, 176 mmol) was added to a solution of methyl 2-(2-{[(tert-butoxy)carbonyl]amino}ethyl)-1,3-thiazole-4-carboxylate (2) (10.2 g, 35.62 mmol) in dioxane. The mixture was stirred at room temperature for 12 h and then at 40 °C for 24 h. The mixture was cooled to room temperature and evaporated in vacuo. The residue was dissolved in DCM (20 ml) and washed with saturated NaHCO3 (3 × 10 ml). The combined aqueous phases were extracted again with ether (3 × 100 ml). The combined organic phases were dried (MgSO4), filtered, and evaporated in vacuo to give the title compound as a brown solid (1.96 g, 30%).

[1323] HPLCMS (Method A): [m / z]: 186.9 [M + H] +

[1324] General Procedure 3: Methyl 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)amino]ethyl}-1,3-thiazole-4-carboxylate (6)

[1325]

[1326] A suspension of methyl 2-(2-aminoethyl)-1,3-thiazole-4-carboxylate (5) (1.96 g, 10.52 mmol), 1H-benzoimidazole-2-carbaldehyde (2.31 g, 15.79 mmol) and DIPEA (1.83 ml, 10.52 mmol) in MeOH (100 ml) was stirred at room temperature for 12 h. The reaction mixture was cooled to 0 °C, NaBH4 (0.597 g, 15.79 mmol) was added and the mixture was stirred at room temperature for 2 h. The reaction mixture was concentrated in vacuo and the residue was dissolved in EtOAc (100 ml), washed with saturated Na2CO3 (2 × 50 ml). The combined aqueous layers were extracted with EtOAc (3 × 50 ml) and the combined organic layers were dried (MgSO4), filtered and evaporated in vacuo. Purification by flash column chromatography (KP-NH, eluting with a gradient of 0-10% MeOH / DCM) gave the title compound as a brown solid (1.4 g, 38%, 90% purity).

[1327] 1H-NMR (methanol-d4, 250 MHz): δ [ppm] = 8.27 (s, 1H), 7.60–7.49 (m, 2H), 7.29–7.17 (m, 2H), 4.09 (s, 2H), 3.92 (s, 3H), 3.26 (t, J = 6.3 Hz, 2H), 3.10 (t, J = 6.8 Hz, 2H)

[1328] HPLCMS (method A): [m / z]: 317 [M+H] +

[1329] General procedure 4:

[1330] tert-Butyl 2-({[(tert-butoxy)carbonyl]({2-[4-(methoxycarbonyl)-1,3-thiazol-2-yl]ethyl})amino}methyl)-1H-1,3-benzodiazole-1-carboxylate (7)

[1331]

[1332] To a solution of methyl 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)amino]ethyl}-1,3-thiazole-4-carboxylate (6) (74%, 2.94 g, 6.88 mmol), Boc2O (3.75 g, 17.19 mmol) and TEA (2.38 ml, 17.19 mmol) in THF (60 ml) was added DMAP (168 mg, 1.38 mmol) and the reaction was stirred at room temperature for 16 h. The reaction was evaporated to dryness, diluted with EtOAc (100 ml) and washed with water (3 × 50 ml). The organic matter was dried over MgSO4, filtered and evaporated to dryness. The crude residue was purified by FCC eluting with 0 - 100% EtOAc in heptane to give 3.8 g of the desired product.

[1333] General procedure 5: 2-(2-{[(tert-Butoxy)carbonyl]({1-[(tert-butoxy)carbonyl]-1H-1,3-benzodiazol-2-yl}methyl)amino}ethyl)-1,3-thiazole-4-carboxylic acid (8)

[1334]

[1335] At 0 °C, lithium hydroxide (0.48 mg, 20.08 mmol) was added to a solution of tert-butyl 2-({[(tert-butoxy)carbonyl]({2-[4-(methoxycarbonyl)-1,3-thiazol-2-yl]ethyl})amino}methyl)-1H-1,3-benzodiazole-1-carboxylate (7) (3.8 g, 6.69 mmol) in THF / water (40 ml / 10 ml). The reaction mixture was stirred at room temperature for 48 h. The mixture was concentrated in vacuo and acidified to pH ~ 3 - 4 using AcOH. The reaction mixture was extracted with THF / EtOAc (3:1, 3 × 50 ml). The combined organic extracts were washed with brine (100 ml), dried (MgSO4), filtered, concentrated in vacuo and azeotroped with heptane (3 × 50 ml) to give the title compound as a yellow foam (2.4 g, 84.6%).

[1336] 1H-NMR (methanol-d4, 250 MHz): δ [ppm] = 8.15 (d, J = 17.0 Hz, 1H), 7.69 (s, 2H), 7.27 (dd, J = 6.1, 3.2 Hz, 2H), 4.79 (s, 2H), 3.87 - 3.74 (m, 2H), 3.40 - 3.33 (m, 3H), 1.38 - 1.01 (m, 10H)

[1337] HPLCMS (method A): [m / z]: 403 [M + H] +

[1338] General Procedure 6: tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-(2-{4-[(pyridin-2-ylmethyl)carbamoyl]-1,3-thiazol-2-yl}ethyl)carbamate (9)

[1339]

[1340] At room temperature, HATU (5.39 g, 14.16 mmol) was added to a stirred solution of 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (3 g, 7.08 mmol), 1-(pyridin-2-yl)methanamine (1.1 ml, 10.62 mmol), DIPEA (3.7 ml, 21.24 mmol) and DMF (50 ml). The reaction mixture was stirred at room temperature for 16 h.

[1341] The reaction was diluted with EtOAc (100 ml) and washed with sat. NaHCO3 (3 × 50 ml) and brine (3 × 50 ml). The organic layer was separated, dried (MgSO4), filtered and evaporated to dryness. The crude residue was purified by flash column chromatography (kp-NH, eluting with a gradient of 20-100% EtOAc in heptane) and then azeotroped with heptane to give the title compound as a yellow foam (2.2 g, 62%).

[1342] 1H-NMR (MeOD, 500 MHz): δ [ppm] = 8.49 (d, J = 4.4 Hz, 1H), 8.10 (s, 1H), 7.80 (td, J = 7.8, 1.7 Hz, 1H), 7.54 (s, 2H), 7.42 (d, J = 7.9 Hz, 1H), 7.31 (dd, J = 7.1, 5.2 Hz, 1H), 7.26 - 7.20 (m, 2H), 4.75 (d, J = 12.3 Hz, 2H), 4.70 (s, 2H), 3.92 - 3.79 (m, 2H), 3.36 (d, J = 8.1 Hz, 1H), 1.43 - 1.25 (m, 10H)

[1343] HPLCMS (Method D): [m / z]: 493.1 [M + H] +

[1344] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-(2-{4-[(cyclohexylmethyl)carbamoyl]-1,3-thiazol-2-yl}ethyl)carbamate (10)

[1345]

[1346] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (99.8 mg, 0.248 mmol), cyclohexylmethylamine (33.69 mg, 0.298 mmol), DIPEA (96.16 mg, 0.744 mmol) and HATU (113.16 mg, 0.298 mmol) were stirred in DMF (4 ml) at room temperature for 1 h. After purification by flash column chromatography (eluting with a gradient of 0 - 10% MeOH / DCM), the title compound was obtained as an off-white oil (116 mg, 47% purity). The title compound was used in the next step without further purification.

[1347] HPLCMS (Method H): [m / z]: 498.7 [M+H] +

[1348] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-{2-[4-(1,2,3,4-tetrahydroisoquinoline-2-carbonyl)-1,3-thiazol-2-yl]ethyl}carbamate (11)

[1349]

[1350] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (99.8 mg, 0.248 mmol), 1,2,3,4-tetrahydroisoquinoline (39.64 mg, 0.298 mmol), DIPEA (96.16 mg, 0.744 mmol) and HATU (113.16 mg, 0.298 mmol) were stirred in DMF (4 ml) at room temperature for 1 h. After purification by flash column chromatography (eluting with a gradient of 0 - 10% MeOH / DCM), the title compound was obtained as an off-white oil (124 mg, 59% purity). The title compound was used in the next step without further purification.

[1351] HPLCMS (Method H): [m / z]: 518.7 [M+H] +

[1352] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-(2-{4-[(thiophen-2-ylmethyl)carbamoyl]-1,3-thiazol-2-yl}ethyl)carbamate (12)

[1353]

[1354] At 0 °C, 1H-1,2,3-benzotriazol-1-ol (50 mg, 0.373 mmol) and EDC·HCl (71 mg, 0.373 mmol) were added to a solution of 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (150 mg, 0.373 mmol) in DMF (10 mL). The reaction mixture was stirred for 15 min, then TEA (38 mg, 0.373 mmol) was added, followed by thiophen-2-ylmethanamine (42 mg, 0.373 mmol). The reaction mixture was heated to room temperature and stirred overnight. After the work-up following General Procedure 6, the title compound (185 mg, 16% purity) was obtained. This was used in the next step without purification.

[1355] HPLCMS (Method H): [m / z]: 498.6 [M+H] +

[1356] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-(2-{4-[benzyl(methyl)carbamoyl]-1,3-thiazol-2-yl}ethyl)carbamate (13)

[1357]

[1358] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (99.8 mg, 0.248 mmol), benzyl(methyl)amine (36.06 mg, 0.298 mmol), DIPEA (96.16 mg, 0.744 mmol) and HATU (113.16 mg, 0.298 mmol) in DMF (4 mL) were stirred at room temperature for 1 h. After purification by flash column chromatography (eluting with a gradient of 0 - 10% MeOH / DCM), the title compound was obtained as an off-white oil (118 mg, 55% purity). The title compound was used in the next step without further purification.

[1359] HPLCMS (Method H): [m / z]: 506.7 [M+H] +

[1360] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-{2-[4-(morpholine-4-carbonyl)-1,3-thiazol-2-yl]ethyl}carbamate (14)

[1361]

[1362] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (99.8 mg, 0.248 mmol), morpholine (25.93 mg, 0.298 mmol), DIPEA (96.16 mg, 0.744 mmol) and HATU (113.16 mg, 0.298 mmol) were stirred in DMF (4 ml) at room temperature for 1 h. After purification by flash column chromatography (eluting with a gradient of 0 - 10% MeOH / DCM), the title compound (110 mg), obtained as an off-white oil, was used in the next step without further purification.

[1363] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-(2-{4-[methyl(phenyl)carbamoyl]-1,3-thiazol-2-yl}ethyl)carbamate (15)

[1364]

[1365] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (99.8 mg, 0.248 mmol), N-methylaniline (31.89 mg, 0.298 mmol), DIPEA (96.16 mg, 0.744 mmol) and HATU (113.16 mg, 0.298 mmol) were stirred in DMF (4 ml) at room temperature for 1 h. After purification by flash column chromatography (eluting with a gradient of 0 - 10% MeOH / DCM), the title compound (118 mg, 59% purity), obtained as an off-white oil, was used in the next step without further purification.

[1366] HPLCMS (Method H): [m / z]: 492.7 [M+H] +

[1367] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-{2-[4-({[2-(pyrrolidin-1-yl)phenyl]methyl}carbamoyl)-1,3-thiazol-2-yl]ethyl}carbamate (16)

[1368]

[1369] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (200 mg, 0.497 mmol), [3-(pyrrolidin-1-yl)phenyl]methanamine (105 mg, 0.596 mmol), DIPEA (193 mg, 1.491 mmol) and HATU (227 mg, 0.596 mmol) were stirred in DMF (5 ml) at room temperature for 1 h. After purification by flash column chromatography (eluting with a gradient of 0-10% MeOH / DCM), the title compound was obtained as an off-white oil (100 mg, 30%, 84% purity).

[1370] HPLCMS (Method H): [m / z]: 561.7 [M+H] +

[1371] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-{2-[4-(dimethylcarbamoyl)-1,3-thiazol-2-yl]ethyl}carbamate (17)

[1372]

[1373] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (100 mg, 0.248 mmol), dimethylamine (2 M solution in THF) (13 mg, 0.298 mmol), DIPEA (96 mg, 0.745 mmol) and HATU (113 mg, 0.298 mmol) were stirred in DMF (10 ml) at room temperature for 1 h. After purification by flash column chromatography (eluting with a gradient of 0-10% MeOH / DCM), the title compound was obtained as a white solid (90 mg, 67%, 80% purity).

[1374] HPLCMS (Method H): [m / z]: 430.6 [M+H] +

[1375] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-(2-{4-[cyclohexyl(prop-2-yl)carbamoyl]-1,3-thiazol-2-yl}ethyl)carbamate (18)

[1376]

[1377] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (99.8 mg, 0.248 mmol), N-(propan-2-yl)cyclohexanamine (42.04 mg, 0.298 mmol), DIPEA (96.16 mg, 0.744 mmol) and HATU (113.16 mg, 0.298 mmol) were stirred in DMF (4 ml) at room temperature for 1 h. After purification by flash column chromatography (eluting with a gradient of 0 - 10% MeOH / DCM), the title compound was obtained as an off-white oil (124 mg, 17% purity). The title compound was used in the next step without further purification.

[1378] HPLCMS (Method H): [m / z]: 526.8 [M+H] +

[1379] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-(2-{4-[(2-phenylpropan-2-yl)carbamoyl]-1,3-thiazol-2-yl}ethyl)carbamate (19)

[1380]

[1381] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (99.8 mg, 0.248 mmol), 2-phenylpropan-2-amine (40.24 mg, 0.298 mmol), DIPEA (96.16 mg, 0.744 mmol) and HATU (113.16 mg, 0.298 mmol) were stirred in DMF (4 ml) at room temperature for 1 h. After purification by flash column chromatography (eluting with a gradient of 0 - 10% MeOH / DCM), the title compound was obtained as an off-white oil (120 mg, 51% purity). The title compound was used in the next step without further purification.

[1382] HPLCMS (Method H): [m / z]: 520.7 [M+H] +

[1383] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-{2-[4-(benzylcarbamoyl)-1,3-thiazol-2-yl]ethyl}carbamate (20)

[1384]

[1385] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (350 mg, 0.87 mmol), phenylmethanamine (103 mg, 0.957 mmol), DIPEA (337 mg, 2.61 mmol) and HATU (397 mg, 1.04 mmol) were placed in DMF (10 ml). After purification by flash column chromatography (eluting with a gradient of 0 - 10% MeOH / DCM), the title compound as a white solid (390 mg, 89% purity) was obtained.

[1386] HPLCMS (Method H): [m / z]: 492.6 [M+H] +

[1387] tert-Butyl N-{2-[4-(benzylcarbamoyl)-1,3-thiazol-2-yl]ethyl}-N-[(1-methyl-1H-1,3-benzodiazol-2-yl)methyl]carbamate (21)

[1388]

[1389] Under an argon atmosphere, MeI (165 mg, 1.159 mmol) was added to a stirred solution of tert-butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-{2-[4-(benzylcarbamoyl)-1,3-thiazol-2-yl]ethyl}carbamate (20) (380 mg, 0.773 mmol) and TEA (78 mg, 0.773 mmol) in DCM (15 ml). The reaction mixture was stirred at room temperature overnight. The reaction mixture was evaporated in vacuo to give the title compound as an off-white solid (280 mg, 72% purity). The crude product was used in the next step without purification.

[1390] HPLCMS (Method H): [m / z]: 506.6 [M+H] +

[1391] tert-Butyl N-(1H-,-benzodiazol-2-ylmethyl)-N-(2-{4-[(pyridin-3-ylmethyl)carbamoyl]-1,3-thiazol-2-yl}ethyl)carbamate (22)

[1392]

[1393] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (199.6 mg, 0.496 mmol), pyridin-3-ylmethanamine (59 mg, 0.546 mmol), DIPEA (192.3 mg, 1.488 mmol) and HATU (226 mg, 0.595 mmol) were placed in DMF (8 ml). After purification by flash column chromatography (eluting with a gradient of 0-10% MeOH / DCM), the title compound as a white solid was obtained (184 mg, 75%).

[1394] 1H-NMR (CDCl3, 400 MHz): δ [ppm] = 8.61 (d, J = 1.6 Hz, 1H), 8.52 (d, J = 3.6 Hz, 1H), 7.96 (s, 1H), 7.81 (s, 1H), 7.73–7.67 (m, 1H), 7.55 (dd, J = 6.0, 3.2 Hz, 2H), 7.28 (s, 1H), 7.25 (dd, J = 6.1, 3.2 Hz, 2H), 4.63 (d, J = 6.6 Hz, 4H), 3.77 (t, J = 6.5 Hz, 2H), 3.22 (t, J = 6.3 Hz, 2H), 1.37 (s, 9H)

[1395] HPLCMS (Method H): [m / z]: 493.4 [M+H] +

[1396] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-(2-{4-[(pyridin-4-ylmethyl)carbamoyl]-1,3-thiazol-2-yl}ethyl)carbamate (23)

[1397]

[1398] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (199.6 mg, 0.496 mmol), pyridin-4-ylmethanamine (59 mg, 0.546 mmol), DIPEA (192.3 mg, 1.488 mmol) and HATU (226 mg, 0.595 mmol) were placed in DMF (8 ml). After purification by flash column chromatography (eluting with a gradient of 0-10% MeOH / DCM), the title compound as a white solid was obtained (140 mg, 57%).

[1399] 1H-NMR (CDCl3, 400 MHz): δ [ppm] = 8.56 (d, J = 5.9 Hz, 2H), 7.98 (s, 1H), 7.82 (s, 1H), 7.59–7.48 (m, 2H), 7.24 (dd, J = 6.0, 3.2 Hz, 4H), 4.62 (d, J = 6.6 Hz, 4H), 3.78 (t, J = 6.5 Hz, 2H), 3.25 (t, J = 6.4 Hz, 2H), 1.41 (d, J = 13.9 Hz, 9H)

[1400] HPLCMS (Method H): [m / z]: 493.4 [M+H] +

[1401] tert-Butyl N-(1H-1,3-benzodioxol-2-ylmethyl)-N-{2-[4-({[3-(trifluoromethyl)pyridin-2-yl]methyl}carbamoyl)-1,3-thiazol-2-yl]ethyl}carbamate (24)

[1402]

[1403] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodioxol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (80.09 mg, 0.199 mmol), [3-(trifluoromethyl)pyridin-2-yl]methanamine hydrochloride (46.54 mg, 0.219 mmol), and HATU (90.8 mg, 0.239 mmol) in the presence of DIPEA (102.9 mg, 0.796 mmol) were placed in DMF (2.5 ml). After purification by flash column chromatography (eluting with a gradient of 0 - 10% MeOH / DCM), the title compound as a white solid was obtained (85 mg, 76%, 98% purity).

[1404] HPLCMS (Method H): [m / z]: 561.5 [M+H] +

[1405] tert-Butyl N-(1H-1,3-benzodioxol-2-ylmethyl)-N-(2-{4-[(5,6,7,8-tetrahydroquinolin-8-yl)carbamoyl]-1,3-thiazol-2-yl}ethyl)carbamate (25)

[1406]

[1407] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (80.09 mg, 0.199 mmol), N-methyl-5,6,7,8-tetrahydroquinolin-8-amine dihydrochloride (48.4 mg, 0.219 mmol), DIPEA (102.9 mg, 0.796 mmol) and HATU (90.8 mg, 0.239 mmol) were placed in DMF (2.5 ml). After purification by flash column chromatography (eluting with a gradient of 0-10% MeOH / DCM), the title compound as a white solid was obtained (92 mg, 87%).

[1408] HPLCMS (Method H): [m / z]: 533.5 [M+H] +

[1409] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-{2-[4-({5H,6H,7H-cyclopenta[b]pyridin-7-yl}carbamoyl)-1,3-thiazol-2-yl]ethyl}carbamate (26)

[1410]

[1411] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (80.9 mg, 0.199 mmol), N-methyl-5H,6H,7H-cyclopenta[b]pyridin-7-amine hydrochloride (37.35 mg, 0.219 mmol), DIPEA (102.9 mg, 0.796 mmol) and HATU (90.8 mg, 0.239 mmol) were placed in DMF (2.5 ml). After purification by flash column chromatography (eluting with a gradient of 0-10% MeOH / DCM), the title compound as a white solid was obtained (90 mg, 87%).

[1412] HPLCMS (Method H): [m / z]: 519.5 [M+H] +

[1413] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(4-methylmorpholin-2-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (27)

[1414]

[1415] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (3 g, 7.545 mmol), (3-fluoropyridin-2-yl)methanamine dihydrochloride (A2) (2.26 g, 11.18 mmol), DIPEA (12.98 ml, 74.54 mmol) and HATU (4.251 g, 11.18 mmol) were placed in DMF (60 ml). After purification by flash column chromatography (kp-NH, eluting with a gradient of 20 - 100% EtOAc / heptane, followed by 0 - 20% MeOH / EtOAc), the title compound was obtained as a yellow oil (4.13 mg, 89%).

[1416] 1H-NMR (DMSO-d6, 500 MHz): δ [ppm] = 12.29 (s, 1H), 8.69 (s, 1H), 8.36 (s, 1H), 8.17 (s, 1H), 7.70 (t, J = 9.5 Hz, 1H), 7.48 (s, 2H), 7.40 (dt, J = 8.6, 4.4 Hz, 1H), 7.14 (s, 2H), 4.66 (d, J = 8.8 Hz, 4H), 3.73 (s, 2H), 2.52 (s, 2H), 1.99 (s, 4H), 1.26 (d, J = 44.9 Hz, 9H)

[1417] HPLCMS (Method A): [m / z]: 511.15 [M+H] +

[1418] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(4-methylmorpholin-2-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (28)

[1419]

[1420] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (99.8 mg, 0.248 mmol), (4-methylmorpholin-3-yl)methanamine (35.5 mg, 0.273 mmol), DIPEA (96.16 mg, 0.744 mmol) and T3P (189.4 mg, 0.298 mmol) were placed in DMF (4 ml). After purification by flash column chromatography (eluting with a gradient of 0 - 10% MeOH / DCM), the title compound was obtained as a white solid (90 mg, 70%).

[1421] 1H-NMR (CDCl3, 400 MHz): δ [ppm] = 7.90 (s, 1H), 7.59 (s, 3H), 7.28 (t, J = 3.6 Hz, 1H), 4.64 (s, 2H), 3.79 (td, J = 12.0, 4.7 Hz, 5H), 3.70 - 3.59 (m, 2H), 3.47 (ddd, J = 14.7, 10.3, 6.6 Hz, 4H), 3.22 (t, J = 6.4 Hz, 2H), 2.74 (d, J = 11.4 Hz, 1H), 2.49 - 2.32 (m, 6H), 1.40 (s, 9H)

[1422] tert-Butyl N-(1H-1,3-benzodioxol-2-ylmethyl)-N-[2-(4-{[(6-methylpyridin-2-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (29)

[1423]

[1424] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodioxol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid 6 (99.8 mg, 0.248 mmol), (6-methylpyridin-2-yl)methanamine (33.33 mg, 0.273 mmol), DIPEA (96.16 mg, 0.744 mmol) and T3P (189.4 mg, 0.298 mmol) were placed in DMF (4 ml). After purification by flash column chromatography (eluting with a gradient of 0 - 10% MeOH / DCM), the title compound as a white solid was obtained (95 mg, 75%).

[1425] 1H-NMR (CDCl3, 400 MHz): δ [ppm] = 8.14 (s, 1H), 7.90 (s, 1H), 7.55 (dd, J = 14.1, 6.6 Hz, 3H), 7.23 (dd, J = 6.0, 3.2 Hz, 2H), 7.14 (d, J = 7.7 Hz, 1H), 7.06 (d, J = 7.7 Hz, 1H), 4.71 (d, J = 5.5 Hz, 2H), 4.66 (s, 2H), 3.80 (t, J = 6.3 Hz, 2H), 3.22 (t, J = 6.4 Hz, 2H), 2.55 (s, 3H), 1.34 (s, 9H)

[1426] tert-Butyl N-(1H-1,3-benzodioxol-2-ylmethyl)-N-[2-(4-{[(5-fluoropyridin-2-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (30)

[1427]

[1428] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (99.8 mg, 0.248 mmol), (5-fluoropyridin-2-yl)methanamine (34.41 mg, 0.273 mmol), DIPEA (96.16 mg, 0.744 mmol) and T3P (189.4 mg, 0.298 mmol) were placed in DMF (4 ml). After purification by flash column chromatography (eluting with a gradient of 0 - 10% MeOH / DCM), the title compound as a white solid was obtained (89 mg, 70%).

[1429] 1H-NMR (CDCl3, 400 MHz): δ [ppm] = 8.44 (s, 1H), 8.12 (s, 1H), 7.92 (s, 1H), 7.56 (s, 2H), 7.44 - 7.30 (m, 2H), 7.25 (dd, J = 6.1, 3.2 Hz, 2H), 4.73 (d, J = 5.6 Hz, 2H), 4.66 (s, 2H), 3.79 (t, J = 6.3 Hz, 2H), 3.23 (t, J = 6.3 Hz, 2H), 3.04 (s, 1H), 1.34 (s, 9H)

[1430] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-(2-{4-[(pyrimidin-4-ylmethyl)carbamoyl]-1,3-thiazol-2-yl}ethyl)carbamate (31)

[1431]

[1432] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (150 mg, 0.373 mmol), pyrimidin-4-ylmethanamine (48.8 mg, 0.447 mmol), DIPEA (48.1 mg, 0.373 mmol) and HATU (141.7 mg, 0.373 mmol) in DMF (2 ml) were left overnight at room temperature. After purification by flash column chromatography (eluting with a gradient of 10% MeOH in DCM), the title compound as a yellow oil was obtained (80 mg, 60% purity).

[1433] HPLCMS (Method H): [m / z]: 494.6 [M + H] +

[1434] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(5-methoxypyridin-2-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (32)

[1435]

[1436] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (150 mg, 0.373 mmol), (5-methoxypyridin-2-yl)methanamine (48.17 mg, 0.447 mmol), DIPEA (48.1 mg, 0.373 mmol) and HATU (141.7 mg, 0.373 mmol) were stirred in DMF (2 ml) at room temperature overnight. After purification by flash column chromatography (eluting with a gradient of 10% MeOH in DCM), the title compound was obtained as a brown solid (80 mg, 41%).

[1437] HPLCMS (Method H): [m / z]: 523.6 [M+H] +

[1438] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-(2-{4-[(pyrazin-2-ylmethyl)carbamoyl]-1,3-thiazol-2-yl}ethyl)carbamate (33)

[1439]

[1440] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (150 mg, 0.373 mmol), pyrazin-2-ylmethanamine (48.8 mg, 0.447 mmol), DIPEA (192.68 mg, 1.491 mmol) and HATU (141.7 mg, 0.373 mmol) were stirred in DMF (2 ml) at room temperature overnight. After purification by flash column chromatography (eluting with a gradient of 10% MeOH in DCM), the title compound was obtained as a yellow solid (95 mg, 52%).

[1441] HPLCMS (Method H): [m / z]: 394.5 [M+H-Boc] +

[1442] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(6-oxo-1,6-dihydropyridin-2-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (34)

[1443]

[1444] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (150 mg, 0.373 mmol), 6-(aminomethyl)-1,2-dihydropyridin-2-one (55.52 mg, 0.447 mmol), DIPEA (48.17 mg, 0.373 mmol) and HATU (141.7 mg, 0.373 mmol) were stirred in DMF (2 ml) at room temperature overnight. After purification by flash column chromatography (eluting with a gradient of 10% MeOH / DCM), the title compound was obtained as a yellow solid (90 mg, 47%).

[1445] HPLCMS (Method H): [m / z]: 509.6 [M+H] +

[1446] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(6-carbamoylpyridin-3-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (35) and

[1447] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(6-cyanopyridin-3-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (36)

[1448]

[1449] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (100 mg, 0.248 mmol), 5-(aminomethyl)pyridine-2-carbonitrile (33 mg, 0.248 mmol), HATU (189 mg, 0.497 mmol) and DIPEA (96 mg, 0.745 mmol) were stirred in DMF (1 ml) at room temperature for 18 h. After purification by flash column chromatography (DCM:MeOH, 9:1), a 2:1 ratio of boc amide and boc nitrile (8 cm) was obtained. The mixture was used in the next step without separation.

[1450] HPLCMS (Method H): [m / z]: 418.5 [M + H - boc] + versus 436.3 [M + H - boc] +

[1451] tert - Butyl N - (1H - 1,3 - benzodiazol - 2 - ylmethyl) - N - [2 - (4 - {[(3,5 - dimethylpyridin - 2 - yl)methyl]carbamoyl} - 1,3 - thiazol - 2 - yl)ethyl]carbamate (37)

[1452]

[1453] In a similar manner to General Procedure 6, 2 - {2 - [(1H - 1,3 - benzodiazol - 2 - ylmethyl)[(tert - butoxy)carbonyl]amino]ethyl} - 1,3 - thiazole - 4 - carboxylic acid (8) (0.3 g, 0.708 mmol), (3,5 - dimethylpyridin - 2 - yl)methanamine hydrochloride (0.183 g, 1.062 mmol), DIPEA (0.555 ml, 3.187 mmol) and HATU (0.404 g, 1.062 mmol) were stirred in DMF (6 ml) at room temperature for 4 h. After purification by flash column chromatography (kp - NH, gradient elution with EtOAc (30%) / heptane (70%) followed by 100% EtOAc), the title compound was obtained as a yellow oil (0.198 g, 51%).

[1454] 1H - NMR (DMSO - d6, 500 MHz): δ [ppm] = 12.29 (s, 1H), 8.75 (s, 1H), 8.19 (s, 2H), 7.56 (d, J = 7.6 Hz, 1H), 7.48 - 7.40 (m, 2H), 7.14 (p, J = 7.0 Hz, 2H), 4.66 (s, 2H), 4.53 (d, J = 4.8 Hz, 2H), 3.73 (s, 2H), 2.27 (s, 3H), 2.23 (s, 3H), 1.31 (s, 9H)

[1455] HPLCMS (Method A): [m / z]: 521.15 [M + H] +

[1456] tert - Butyl N - (1H - 1,3 - benzodiazol - 2 - ylmethyl) - N - (2 - {4 - [(pyrimidin - 2 - ylmethyl)carbamoyl] - 1,3 - thiazol - 2 - yl}ethyl)carbamate (38)

[1457]

[1458] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (100 mg, 0.20 mmol), 1-(pyrimidin-2-yl)methanamine (22 mg, 0.20 mmol), DIPEA (0.1 ml, 0.60 mmol) and HATU (113 mg, 0.30 mmol) were placed in DCM (5 ml). After purification by flash column chromatography (eluting with a gradient of 0 - 20% MeOH / EtOAc), the title compound was obtained as a brown residue (86 mg, 73%).

[1459] HPLCMS (Method A): [m / z]: 494.1 [M+H] +

[1460] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-{2-[4-({[2-(4-methylpiperazin-1-yl)phenyl]methyl}carbamoyl)-1,3-thiazol-2-yl]ethyl}carbamate (39)

[1461]

[1462] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (130 mg, 0.24 mmol, 75% purity), 1-[2-(4-methylpiperazin-1-yl)phenyl]methanamine (75 mg, 0.36 mmol), DIPEA (127 μl, 0.73 mmol) and HATU (138 mg, 0.36 mmol) were placed in DMF (2 ml). After purification by basic prep-HPLC, the title compound was obtained as a white solid (13 mg, 9%).

[1463] HPLCMS (Method D): [m / z]: 590.3 [M+H] +

[1464] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(2,6-difluorophenyl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (40)

[1465]

[1466] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (110 mg, 0.25 mmol, 90% purity), 1-(2,6-difluorophenyl)methanamine (53 mg, 0.37 mmol), DIPEA (0.13 ml, 0.74 mmol), and HATU (140 mg, 0.37 mmol) were placed in DMF (2 ml). After purification by flash column chromatography (kp-NH, eluting with a gradient of 2 - 100% EtOAc / heptane), the title compound was obtained as a yellow oil (90 mg, 68%).

[1467] HPLCMS (Method E): [m / z]: 528.3 [M+H] +

[1468] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-{2-[4-({[2-(dimethylamino)phenyl]methyl}carbamoyl)-1,3-thiazol-2-yl]ethyl}carbamate (41)

[1469]

[1470] In a similar manner to General Procedure 6, at 50 °C, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (109 mg, 0.22 mmol, 80% purity), 2-(aminomethyl)-N,N-dimethylaniline (66 mg, 0.44 mmol), DIPEA (226 μl, 1.30 mmol), and HATU (240 mg, 0.64 mmol) were placed in DMF (2 ml). After purification by flash column chromatography (kp-NH, eluting with a gradient of 5 - 100% EtOAc / heptane), the title compound was obtained as an orange oil (73 mg, 61%).

[1471] HPLCMS (Method D): [m / z]: 535.2 [M+H] +

[1472] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(2-cyanophenyl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (42)

[1473]

[1474] In a similar manner to General Procedure 6, at 50 °C, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (109 mg, 0.22 mmol, 80% purity), 2-(aminomethyl)benzonitrile hydrochloride (74 mg, 0.44 mmol), DIPEA (226 μl, 1.30 mmol), and HATU (240 mg, 0.64 mmol) were placed in DMF (2 ml). After purification by flash column chromatography (kp-NH, eluting with a gradient of 5 - 100% EtOAc / heptane), the crude title compound was obtained as an orange oil (54 mg, 30%, 63% purity).

[1475] HPLCMS (Method D): [m / z]: 517.2 [M+H] +

[1476] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-{2-[4-({[2-(trifluoromethoxy)phenyl]methyl}carbamoyl)-1,3-thiazol-2-yl]ethyl}carbamate (43)

[1477]

[1478] In a similar manner to General Procedure 6, at 50 °C, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (109 mg, 0.22 mmol, 80% purity), 1-[2-(trifluoromethoxy)phenyl]methanamine (103 mg, 0.54 mmol), DIPEA (283 μl, 1.63 mmol), and HATU (248 mg, 0.65 mmol) were placed in DMF (2 ml). After purification by flash column chromatography (kp-NH, eluting with a gradient of 8 - 100% EtOAc / heptane), the crude title compound was obtained as a yellow oil (110 mg, 78%, 88% purity).

[1479] HPLCMS (Method E): [m / z]: 576.2 [M+H] +

[1480] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-(2-{4-[(1-phenylethyl)carbamoyl]-1,3-thiazol-2-yl}ethyl)carbamate (44)

[1481]

[1482] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (0.11 g, 0.22 mmol, 80% purity), 1-phenylethylamine (0.07 ml, 0.54 mmol), DIPEA (0.303 ml, 1.63 mmol), and HATU (0.25 g, 0.64 mmol) were placed in DMF (2 ml). After purification by flash column chromatography (KP-NH, eluting with a gradient of 8 - 100% EtOAc / heptane), the crude title compound was obtained as a yellow oil (110 mg, 77%, 77% purity).

[1483] HPLCMS (Method E): [m / z]: 506.2 [M+H] +

[1484] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-{2-[4-({[2-(difluoromethoxy)phenyl]methyl}carbamoyl)-1,3-thiazol-2-yl]ethyl}carbamate (45)

[1485]

[1486] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (109 mg, 0.22 mmol, 80% purity), 1-[2-(difluoromethoxy)phenyl]methanamine (83 mg, 0.48 mmol), DIPEA (0.23 ml, 1.3 mmol), and HATU (250 mg, 0.65 mmol) were placed in DMF (2 ml). The crude title compound was obtained as an orange oil (470 mg), which was used in the next step without purification.

[1487] HPLCMS (Method A): [m / z]: 558.25 [M+H] +

[1488] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-{2-[4-({[2-(morpholine-4-sulfonyl)phenyl]methyl}carbamoyl)-1,3-thiazol-2-yl]ethyl}carbamate (46)

[1489]

[1490] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (109 mg, 0.217 mmol, 80% purity), 1-[2-(morpholine-4-ylsulfonyl)phenyl]methanamine hydrochloride (140 mg, 0.48 mmol), DIPEA (0.23 ml, 1.3 mmol), and HATU (247 mg, 0.65 mmol) were placed in DMF (2 ml). After direct evaporation of the reaction mixture in vacuo, the crude title compound (440 mg), obtained as an orange oil, was used without purification.

[1491] HPLCMS (Method A): [m / z]: 641.35 [M+H] +

[1492] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[2-(pyridin-2-yl)ethyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (47)

[1493]

[1494] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (100 mg, 0.2 mmol, 80% purity), 2-(pyridin-2-yl)ethylamine (49 mg, 0.4 mmol), DIPEA (104 μl, 0.6 mmol), and HATU (151 mg, 0.4 mmol) were placed in DMF (2 ml). After purification by flash column chromatography (KP-NH, eluting with a gradient of 5-100% EtOAc / heptane), the title compound (52 mg, 52%) was obtained as a cream solid.

[1495] HPLCMS (Method A): [m / z]: 507.15 [M+H] +

[1496] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-(2-{4-[(3-fluoropyridin-2-yl)carbamoyl]-1,3-thiazol-2-yl}ethyl)carbamate (48)

[1497]

[1498] In a similar manner to General Procedure 6, a solution of 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (80%, 150 mg, 0.3 mmol), 3-fluoropyridin-2-amine (100 mg, 0.89 mmol), DIPEA (312 μl, 1.78 mmol) and HATU (340 mg, 0.87 mmol) in DMF (2 ml) was heated at 100 °C for 16 h. The reaction mixture was concentrated in vacuo to give the crude title compound as a brown oil (705 mg), which was used in the next step without purification.

[1499] HPLCMS (Method A): [m / z]: 497.10 [M+H] +

[1500] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-(2-{4-[(2-phenylethyl)carbamoyl]-1,3-thiazol-2-yl}ethyl)carbamate (49)

[1501]

[1502] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (0.1 g, 0.25 mmol), 2-phenylethylamine (0.03 ml, 0.25 mmol), DIPEA (0.13 ml, 0.75 mmol) and HATU (0.14 g, 0.37 mmol) were placed in DMF (2 ml). After purification by flash column chromatography (eluting with a gradient of 2 - 100% EtOAc / heptane), the title compound was obtained as a yellow oil (71 mg, 56%).

[1503] HPLCMS (Method A): [m / z]: 506.2 [M+H] +

[1504] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(3-fluoro-6-methylpyridin-2-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (50)

[1505]

[1506] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (150 mg, 0.298 mmol, 80% purity), (3-fluoro-6-methylpyridin-2-yl)methanamine hydrochloride (79 mg, 0.447 mmol), DIPEA (156 μl, 0.894 mmol), and HATU (230 mg, 0.596 mmol) were placed in DMF (3 ml). After purification by flash column chromatography (kp-NH, eluting with a gradient of 0 - 100% EtOAc / heptane), the title compound was obtained as a pale yellow oil (76 mg, 48%).

[1507] HPLCMS (Method A): [m / z]: 525.40 [M+H] +

[1508] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[1-(pyridin-2-yl)ethyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (51)

[1509]

[1510] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (150 mg, 0.298 mmol, 80% purity), 1-(pyridin-2-yl)ethanamine (55 mg, 0.447 mmol), DIPEA (156 μl, 0.894 mmol), and HATU (227 mg, 0.596 mmol) were placed in DMF (3 ml). After purification by flash column chromatography (kp-NH, eluting with a gradient of 0 - 100% EtOAc / heptane), the title compound was obtained as a colorless oil (78 mg, 50%).

[1511] HPLCMS (Method A): [m / z]: 507.20 [M+H] +

[1512] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-{2-[4-({[6-(trifluoromethyl)pyridin-3-yl]methyl}carbamoyl)-1,3-thiazol-2-yl]ethyl}carbamate (52)

[1513]

[1514] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (150 mg, 0.298 mmol, 80% purity), 1-[6-(trifluoromethyl)pyridin-3-yl]methanamine (79 mg, 0.447 mmol), DIPEA (156 μl, 0.894 mmol), and HATU (227 mg, 0.596 mmol) were placed in DMF (3 ml). After purification by flash column chromatography (kp-NH, eluting with a gradient of 0-100% EtOAc / heptane), the title compound was obtained as a colorless oil (92 mg, 46%).

[1515] HPLCMS (Method A): [m / z]: 561.35 [M+H] +

[1516] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(3-chloropyridin-2-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (53)

[1517]

[1518] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (150 mg, 0.34 mmol, 92% purity), 1-(3-chloropyridin-2-yl)methanamine dihydrochloride (111 mg, 0.51 mmol), DIPEA (299 μl, 1.71 mmol), and HATU (196 mg, 0.51 mmol) were placed in DMF (2 ml). After purification by flash column chromatography (kp-NH, eluting with a gradient of 20-100% EtOAc / heptane), the title compound was obtained as a yellow oil (161 mg, 73% purity, 63%).

[1519] 1H-NMR (CDCl3, 500 MHz): δ [ppm] = 10.47 (s, 1H), 8.59 (s, 1H), 8.52 - 8.42 (m, 1H), 7.92 (s, 1H), 7.71 (d, J = 8.2 Hz, 2H), 7.32 (s, 1H), 7.25 - 7.16 (m, 3H), 4.85 (d, J = 4.8 Hz, 2H), 4.69 (s, 2H), 3.81 (s, 2H), 3.23 (t, J = 6.5 Hz, 2H), 1.35 (s, 9H)

[1520] HPLCMS (Method A): [m / z]: 527.35 [M+H] +

[1521] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-{2-[4-({[2-(tert-butoxy)pyridin-3-yl]methyl}carbamoyl)-1,3-thiazol-2-yl]ethyl}carbamate (54)

[1522]

[1523] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (150 mg, 0.34 mmol, 92% purity), 1-(2-tert-butoxypyridin-3-yl)methanamine (93 mg, 0.514 mmol), DIPEA (179 μl, 1.03 mmol) and HATU (196 mg, 0.51 mmol) were placed in DMF (2 ml). After purification by flash column chromatography (kp-NH, eluting with a gradient of 20 - 100% EtOAc / heptane), the title compound was obtained as a yellow oil (205 mg, 61%, 58% purity).

[1524] 1H-NMR (CDCl3, 500 MHz): δ [ppm] = 10.09 (s, 1H), 7.89 (d, J = 15.7 Hz, 2H), 7.71 (s, 1H), 7.54 - 7.45 (m, 2H), 7.40 (d, J = 4.9 Hz, 1H), 7.24 (s, 1H), 6.77 (td, J = 7.3, 5.0 Hz, 2H), 4.60 (s, 2H), 4.49 (d, J = 6.5 Hz, 2H), 3.77 (t, J = 6.5 Hz, 2H), 3.22 (s, 2H), 1.63 (s, 9H), 1.33 (s, 9H)

[1525] HPLCMS (Method A): [m / z]: 565.15 [M+H] +

[1526] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(1-methyl-1H-imidazol-5-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (55)

[1527]

[1528] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (150 mg, 0.37 mmol), (1-methyl-1H-imidazol-5-yl)methanamine (62 mg, 0.56 mmol), DIPEA (185 μl, 1.12 mmol) and HATU (213 mg, 0.56 mmol) were placed in DMF (2 ml). After purification by flash column chromatography (eluting with a gradient of 0 - 3% MeOH / DCM), the title compound was obtained as a yellow oil (175 mg, 95%).

[1529] 1H-NMR (methanol-d4, 500 MHz): δ [ppm] = 8.08 (s, 1H), 7.58 - 7.52 (m, 3H), 7.26 - 7.20 (m, 2H), 6.96 (s, 1H), 4.69 (d, J = 12.4 Hz, 2H), 4.60 (s, 2H), 3.95 - 3.75 (m, 2H), 3.70 (s, 3H), 3.39 - 3.24 (m, 2H), 1.44 - 1.26 (m, 9H)

[1530] HPLCMS (Method A): [m / z]: 496.05 [M + H] +

[1531] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-(2-{4-[(1,3-oxazol-2-ylmethyl)carbamoyl]-1,3-thiazol-2-yl}ethyl)carbamate (56)

[1532]

[1533] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (150 mg, 0.298 mmol, 80% purity), 1,3-oxazol-2-ylmethanamine dihydrochloride (102 mg, 0.596 mmol), DIPEA (312 μl, 1.79 mmol) and HATU (227 mg, 0.596 mmol) were placed in DMF (3 ml). After purification by flash column chromatography (kp-NH, eluting with a gradient of 0 - 100% EtOAc / heptane), the title compound was obtained as a brown oil (94 mg, 63%).

[1534] HPLCMS (Method A): [m / z]: 483.05 [M + H] +

[1535] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(1-methyl-1H-pyrazol-3-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (57)

[1536]

[1537] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (150 mg, 0.298 mmol, 80% purity), 1-(1-methyl-1H-pyrazol-3-yl)methanamine (50 mg, 0.45 mmol), DIPEA (156 μl, 0.894 mmol), and HATU (227 mg, 0.596 mmol) were placed in DMF (3 ml). After purification by flash column chromatography (kp-NH, eluting with a gradient of 0 - 100% EtOAc / heptane), the title compound was obtained as a brown oil (53 mg, 34%).

[1538] HPLCMS (Method A): [m / z]: 496.45 [M+H] +

[1539] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-(2-{4-[(pyridazin-3-ylmethyl)carbamoyl]-1,3-thiazol-2-yl}ethyl)carbamate (58)

[1540]

[1541] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (100 mg, 0.23 mmol, 92% purity), 1-(pyridazin-3-yl)methanamine (37 mg, 0.34 mmol), DIPEA (119 μl, 0.69 mmol), and HATU (130 mg, 0.34 mmol) were placed in DMF (2 ml). After purification by flash column chromatography (kp-NH, eluting with a gradient of 50 - 100% EtOAc / heptane, then 0 - 15% MeOH / EtOAc), the title compound was obtained as a pale yellow oil (101 mg, 88%).

[1542] HPLCMS (Method A): [m / z]: 494.1 [M+H] +

[1543] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(1-methyl-1H-pyrazol-5-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (59)

[1544]

[1545] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (100 mg, 0.23 mmol, 92% purity), 1-(1-methyl-1H-pyrazol-5-yl)methanamine (38 mg, 0.34 mmol), DIPEA (119 μl, 0.69 mmol) and HATU (130 mg, 0.34 mmol) were placed in DMF (2 ml). After purification by flash column chromatography (kp-NH, eluting with a gradient of 50 - 100% EtOAc / heptane, followed by 0 - 20% MeOH / EtOAc), the title compound was obtained as a pale yellow oil (51 mg, 45%).

[1546] HPLCMS (Method A): [m / z]: 496.3 [M+H] +

[1547] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(3-fluoropyridin-4-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (60)

[1548]

[1549] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (100 mg, 0.23 mmol, 92% purity), 1-(3-fluoropyridin-4-yl)methanamine (43 mg, 0.34 mmol), DIPEA (119 μl, 0.69 mmol) and HATU (130 mg, 0.34 mmol) in DMF (3 ml) were subjected to flash column chromatography (kp-NH, eluting with a gradient of 50 - 100% EtOAc / heptane). The title compound was obtained as a yellow oil (137 mg, 83%, 71% purity).

[1550] 1H-NMR (CDCl3, 500 MHz): δ [ppm] = 10.10 (s, 1H), 8.43 (d, J = 6.0 Hz, 1H), 8.37 (dd, J = 9.8, 4.9 Hz, 2H), 7.96 (s, 1H), 7.81 - 7.68 (m, 2H), 7.40 (d, J = 8.6 Hz, 1H), 7.35 - 7.27 (m, 1H), 7.25 - 7.22 (m, 1H), 4.68 (d, J = 6.0 Hz, 2H), 4.62 (s, 2H), 3.78 (t, J = 6.5 Hz, 2H), 3.27 - 3.23 (m, 2H), 1.37 (s, 9H)

[1551] HPLCMS (Method A): [m / z]: 511.15 [M + H] +

[1552] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(3-methylpyridin-4-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (61)

[1553]

[1554] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (700 mg, 1.65 mmol, 95% purity), (3-methylpyridin-4-yl)methanamine dihydrochloride (387 mg, 1.98 mmol), DIPEA (863 μl, 4.9 mmol) and HATU (1260 mg, 3.3 mmol) were placed in DMF (10 ml). After purification by flash chromatography (kp-NH, eluting with gradient 20 - 100% EtOAc / heptane), the title compound was obtained as a yellow oil (363 mg, 43%).

[1555] HPLCMS (Method A): [m / z]: 507.1 [M + H] +

[1556] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(1-methyl-1H-pyrazol-4-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (62)

[1557]

[1558] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (100 mg, 0.25 mmol), (1-methyl-1H-pyrazol-4-yl)methanamine (41 mg, 0.37 mmol), DIPEA (130 μl, 0.75 mmol) and HATU (142 mg, 0.37 mmol) were placed in DMF (2 ml). After purification by flash column chromatography (eluting with a gradient of 0 - 20% MeOH / EtOAc), the title compound was obtained as a yellow oil (125 mg, quantitative yield).

[1559] HPLCMS (Method A): [m / z]: 496.1 [M+H] +

[1560] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(6-methylpyridazin-3-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (63)

[1561]

[1562] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (100 mg, 0.23 mmol, 92% purity), (6-methylpyridazin-3-yl)methanamine (42 mg, 0.34 mmol), DIPEA (119 μl, 0.69 mmol) and HATU (130 mg, 0.34 mmol) were placed in DMF (3 ml). After flash column chromatography (kp-NH, eluting with a gradient of 70 - 100% EtOAc / heptane), the crude title compound was obtained (99 mg, 67%, 79% purity).

[1563] 1H-NMR (CDCl3, 500 MHz): δ [ppm] = 10.50 (s, 1H), 8.28 (s, 1H), 7.92 (s, 1H), 7.72 (s, 1H), 7.40 - 7.29 (m, 3H), 7.23 (dd, J = 6.4, 2.8 Hz, 2H), 4.68 (s, 2H), 3.82 (s, 2H), 3.24 (s, 2H), 2.73 (s, 2H), 2.71 (s, 3H), 1.36 (s, 9H)

[1564] HPLCMS (Method A): [m / z]: 508.10 [M+H] +

[1565] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-(2-{4-[(1H-imidazol-2-ylmethyl)carbamoyl]-1,3-thiazol-2-yl}ethyl)carbamate (64)

[1566]

[1567] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (100 mg, 0.25 mmol), 1-(1H-imidazol-2-yl)methanamine (42 mg, 0.25 mmol), DIPEA (164 μl, 0.99 mmol) and HATU (188 mg, 0.50 mmol) were placed in DMF (2 ml). After purification by flash column chromatography (kp-NH, eluting with a gradient of 0 - 5% MeOH / DCM), the title compound was obtained as a yellow oil (65 mg, 54%).

[1568] HPLCMS (Method A): [m / z]: 482.25 [M+H] +

[1569] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-{2-[4-({[2-(morpholin-4-yl)pyridin-4-yl]methyl}carbamoyl)-1,3-thiazol-2-yl]ethyl}carbamate (65)

[1570]

[1571] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (100 mg, 0.25 mmol), [3-(morpholin-4-yl)pyridin-4-yl]methanamine (48 mg, 0.25 mmol), DIPEA (164 μl, 0.99 mmol) and HATU (189 mg, 0.50 mmol) were placed in DMF (2 ml). After purification by flash column chromatography (kp-NH, eluting with a gradient of 50 - 100% EtOAc / heptane), the title compound was obtained as a yellow solid (112 mg, 78%).

[1572] HPLCMS (Method A): [m / z]: 578.10 [M+H] +

[1573] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(5-methylpyridin-2-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (66)

[1574]

[1575] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (100 mg, 0.20 mmol, 80% purity), 1-(5-methylpyridin-2-yl)methanamine (29 mg, 0.24 mmol), DIPEA (104 μl, 0.60 mmol), and HATU (151 mg, 0.40 mmol) were placed in DMF (2 ml). After purification by flash column chromatography (kp-NH, eluting with a gradient of 0 - 100% EtOAc / heptane), the title compound was obtained as a colorless oil (48 mg, 47%).

[1576] HPLCMS (Method A): [m / z]: 507.1 [M+H] +

[1577] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-{2-[4-({[6-(dimethylamino)pyridin-3-yl]methyl}carbamoyl)-1,3-thiazol-2-yl]ethyl}carbamate (67)

[1578]

[1579] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (100 mg, 0.20 mmol, 80% purity), 5-(aminomethyl)-N,N-dimethylpyridin-2-amine (30 mg, 0.20 mmol), DIPEA (104 μl, 0.60 mmol), and HATU (151 mg, 0.40 mmol) were placed in DMF (2 ml). After purification by flash column chromatography (kp-NH, eluting with a gradient of 0 - 100% EtOAc / heptane), the title compound was obtained as a colorless oil (36 mg, 34%).

[1580] HPLCMS (Method A): [m / z]: 536.35 [M+H] +

[1581] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(2-methylpyridin-4-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (68)

[1582]

[1583] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (100 mg, 0.20 mmol, 80% purity), 1-(2-methylpyridin-4-yl)methanamine (36 mg, 0.30 mmol), DIPEA (104 μl, 0.60 mmol) and HATU (151 mg, 0.40 mmol) were placed in DMF (2 ml). After purification by flash column chromatography (kp-NH, eluting with a gradient of 0-100% EtOAc / heptane), the title compound was obtained as a colorless oil (36 mg, 36%).

[1584] HPLCMS (Method A): [m / z]: 507.3 [M+H] +

[1585] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(1,5-dimethyl-1H-pyrazol-4-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (69)

[1586]

[1587] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (100 mg, 0.20 mmol, 80% purity), 1-(1,5-dimethyl-1H-pyrazol-4-yl)methanamine (37 mg, 0.30 mmol), DIPEA (104 μl, 0.60 mmol) and HATU (151 mg, 0.40 mmol) were placed in DMF (2 ml). After purification by flash column chromatography (kp-NH, eluting with a gradient of 0-100% EtOAc / heptane), the title compound was obtained as a colorless oil (74 mg, 73%).

[1588] HPLCMS (Method A): [m / z]: 510.15 [M+H] +

[1589] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-{2-[4-({[3-chloro-5-(trifluoromethyl)pyridin-2-yl]methyl}carbamoyl)-1,3-thiazol-2-yl]ethyl}carbamate (70)

[1590]

[1591] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (100 mg, 0.236 mmol), 1-[3-chloro-5-(trifluoromethyl)pyridin-2-yl]methanamine hydrochloride (87 mg, 0.354 mmol), DIPEA (0.21 ml, 1.18 mmol), and HATU (135 mg, 0.354 mmol) were placed in DMF (3 ml). After flash column chromatography (KP-NH, eluting with a gradient of 20 - 100% EtOAc / heptane), the title compound was obtained as a yellow oil (216 mg, 69%, 45% purity). The title compound was used in the next step without further purification.

[1592] HPLCMS (Method A): [m / z]: 595.1 [M+H] +

[1593] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(3-chloro-5-fluoropyridin-2-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (71)

[1594]

[1595] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (100 mg, 0.236 mmol), (3-chloro-5-fluoropyridin-2-yl)methanamine hydrochloride (70 mg, 0.354 mmol), DIPEA (0.21 ml, 1.18 mmol), and HATU (135 mg, 0.354 mmol) were placed in DMF (3 ml). After flash column chromatography (KP-NH, eluting with a gradient of 20 - 100% EtOAc / heptane), the title compound was obtained as a yellow oil (157 mg, 76%, 62% purity). The title compound was used in the next step without further purification.

[1596] HPLCMS (Method A): [m / z]: 545.15 [M+H] +

[1597] tert-Butyl N-(1H-1,3-benzodiazol-2-ylmethyl)-N-[2-(4-{[(2-fluoropyridin-3-yl)methyl]carbamoyl}-1,3-thiazol-2-yl)ethyl]carbamate (72)

[1598]

[1599] In a similar manner to General Procedure 6, 2-{2-[(1H-1,3-benzodiazol-2-ylmethyl)[(tert-butoxy)carbonyl]amino]ethyl}-1,3-thiazole-4-carboxylic acid (8) (100 mg, 0.236 mmol, 95% purity), 1-(2-fluoropyridin-3-yl)methanamine (47.01 mg, 0.373 mmol), DIPEA (0.13 ml, 0.745 mmol) and HATU ...

Claims

1. A pharmaceutical composition comprising the trihydrochloride of a compound having the following chemical formula, The pharmaceutical composition further comprises at least one selected from the following: (a) at least one pharmaceutically acceptable carrier, (b) at least one adjuvant substance, and (c) at least one solvent.

2. The pharmaceutical composition according to claim 1, wherein The pharmaceutical composition is in a formulation form for oral or parenteral administration.

3. The pharmaceutical composition according to claim 1 or 2, characterized in that, The pharmaceutical composition further comprises at least one additional pharmaceutically active compound.

4. The pharmaceutical composition according to claim 1 or 2, characterized in that, The pharmaceutical composition further comprises at least one additional pharmaceutically active compound selected from pharmaceutically active compounds for the prevention and treatment of iron overload and neurodegenerative diseases.

5. The pharmaceutical composition according to claim 1 or 2, characterized in that, The pharmaceutical composition further comprises at least one additional pharmaceutically active compound selected from pharmaceutically active compounds such as Tmprss6-ASO, iron chelators, curcumin, SSP-004184, deferoxamine, deferasirox, desferrioxamine, and / or deferiprone for reducing iron overload.

6. The pharmaceutical composition according to claim 1 or 2, characterized in that, The pharmaceutical composition further comprises at least one additional pharmaceutically active compound selected from antioxidants, antidiabetic drugs, antibiotics, antimalarial drugs, anticancer agents, antifungal drugs, antiviral drugs, immunosuppressants, iron supplements, vitamin supplements, erythropoiesis-stimulating agents, anti-inflammatory biologics, antithrombotic drugs, statins, pressor drugs, and inotropic compounds.

7. The pharmaceutical composition according to claim 1 or 2, characterized in that, The pharmaceutical composition further comprises at least one additional pharmaceutically active compound selected from N-acetylcysteine, GLP-1 receptor agonists, vancomycin or tobramycin, dopamine agonists, levodopa, interferon-α, ribavirin, and cyclosporin A or cyclosporin A derivatives.

8. The pharmaceutical composition according to claim 4, wherein At least one additional pharmaceutically active compound for the prevention and treatment of the iron overload is a pharmaceutically active compound for the prevention and treatment of thalassemia intermedia or hemochromatosis.

9. The pharmaceutical composition according to claim 4, wherein At least one additional pharmaceutically active compound for the prevention and treatment of the neurodegenerative disease is a pharmaceutically active compound for the prevention and treatment of Alzheimer's disease or Parkinson's disease.

10. Use of the pharmaceutical composition according to claim 1 or 2 in the preparation of a drug for the prevention and / or treatment of ineffective erythropoiesis in thalassemia intermedia.

11. Use of the pharmaceutical composition according to claim 1 or 2 in the preparation of a drug for the prevention and / or treatment of β-thalassemia unrelated to blood transfusion.

12. Use of the pharmaceutical composition according to claim 1 or 2 in the preparation of a drug for the prevention of hepatic iron loading in hyperferremia and hemochromatosis.

13. Use of the pharmaceutical composition according to claim 1 or 2 in the preparation of a drug for the combined treatment of iron metabolism disorders leading to increased iron levels, comprising co-administration of the compound as defined in claim 1 with at least one additional pharmaceutically active compound.

14. The use according to claim 13, characterized in that, The at least one additional pharmaceutically active compound is selected from pharmaceutically active compounds as defined in any one of claims 4 to 8; Wherein the pharmaceutical composition co-administers the compound as defined in claim 1 with at least one additional pharmaceutically active compound in a fixed-dose formulation in the form of a fixed-dose combination therapy composition; or co-administers the compound as defined in claim 1 with at least one additional pharmaceutically active compound in a single compound of free dose in the form of a free-dose combination therapy composition by simultaneous administration of a single compound or by continuous administration of a single compound distributed over a period of time.

Images