A method for producing polyphosphate kinase 1 mutant by fermentation

Abstract

The present invention discloses a method for producing polyphosphate kinase 1 mutant by fermentation, comprising the following steps: (1) inoculating the seed liquid of polyphosphate kinase 1 mutant producing bacteria into a fermentation medium for fermentation culture, and fermenting the culture medium until the OD value after the fermentation liquid is diluted 100 times is 600 When the value is 0.40-0.60, the temperature is lowered to 21-23°C, IPTG is added to the system for induction culture, and the induction culture is carried out for 20-24 hours; the residual sugar content of the system is monitored during the culture process, and when the residual sugar content of the system is ≤1.0g / L, feed is added, and the residual sugar concentration in the system is maintained at 0.5-1.0g / L by feeding; (2) the culture after the induction culture is subjected to a bacteriostasis treatment, and the supernatant is separated and collected, that is, a culture solution containing a polyphosphate kinase 1 mutant is produced. The present invention improves the enzyme activity of polyphosphate kinase 1 by performing a mutation treatment on polyphosphate kinase 1; and a fermentation production system for polyphosphate kinase 1 mutant is constructed, thereby realizing the industrial production of polyphosphate kinase 1 mutant.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a method for producing a polyphosphate kinase 1 mutant by fermentation. Background Art

[0002] Polyphosphate (poly P) is a widely existing linear polymer, which is formed by the polymerization of several to hundreds of phosphate residues through high-energy phosphate bonds similar to the phosphate anhydride bonds of ATP. Studies in recent years have found that poly P is not only an indispensable bioenergy and phosphate group storage reservoir in organisms, a biological macromolecule with high negative charge density, but also participates in regulating gene expression, regulating bacterial ion channels and DNA uptake and metabolism in microorganisms, and is closely related to physiological processes such as transient potential regulation, mitochondrial metabolism, and cell calcification in mammals.

[0003] Polyphosphate kinase 1 (PPK1) is a key enzyme in poly P anabolism. PPK1 forms polyphosphate by catalyzing the reversible reaction of transferring the phosphate group at the end of ATP to phosphate, thereby aggregating phosphate to form polyphosphate. In addition, PPK1 is also an enzyme used in the production of adenine nucleotide (AMP), guanine nucleotide (GMP), cytosine nucleotide (CMP), uracil nucleotide (UMP), thymine nucleotide (TMP) and other products. Therefore, PPK1 has broad application prospects and a large market demand.

[0004] However, the current PPK1 enzyme activity is generally around 650U / mg, which still needs to be further improved; and PPK1 has a relatively strict control on pH. When producing 5'-monophosphate nucleotides (especially adenosine monophosphate), PPK1 and adenosine kinase have different optimal pH values ​​but need to be mixed, which further affects the performance of PPK1 enzyme activity in practical applications. In addition, there are few reports on the industrial fermentation production of PPK1. Summary of the invention

[0005] In view of the above-mentioned prior art, the purpose of the present invention is to provide a method for fermenting and producing a polyphosphate kinase 1 mutant. The present invention obtains a polyphosphate kinase 1 mutant by subjecting polyphosphate kinase 1 to mutation treatment, thereby improving the enzymatic activity of polyphosphate kinase 1; and constructs a fermentation production system for the polyphosphate kinase 1 mutant, thereby realizing the industrial production of the polyphosphate kinase 1 mutant.

[0006] To achieve the above object, the present invention adopts the following technical solution:

[0007] A method for producing a polyphosphate kinase 1 mutant by fermentation, comprising the following steps:

[0008] (1) Inoculating the seed liquid of the polyphosphate kinase 1 mutant producing bacteria into a fermentation medium for fermentation culture at a temperature of 32-34° C., a pH of 6.8-7.2, and a dissolved oxygen (DO) of 20-40%; and fermenting the culture until the OD value of the fermentation liquid after dilution 100 times reaches 0.04. 600 When the value is 0.40-0.60, cool down to 21-23°C, add IPTG to the system for induction culture, and induction culture for 20-24h;

[0009] During the culture process, the residual sugar content of the system was monitored. When the residual sugar content of the system was ≤1.0 g / L, feed was added. The residual sugar concentration in the system was maintained at 0.5-1.0 g / L by feeding.

[0010] (2) The culture after induction culture is subjected to a bacteriolytic treatment, and the supernatant is separated and collected, thereby producing a culture fluid containing the polyphosphate kinase 1 mutant.

[0011] Preferably, in step (1), the polyphosphate kinase 1 mutant producing bacteria is constructed by the following method:

[0012] The pQE-60 plasmid was double-digested with BspEⅠ and AflⅢ, and then the fragment with the sequence shown in SEQ ID NO.5 was connected to construct a plasmid pQE-N, and the nucleotide sequence of the plasmid pQE-N is shown in SEQ ID NO.6; the plasmid pQE-N was double-digested with AccⅢ and SphⅠ, and then the gene encoding the polyphosphate kinase 1 mutant was connected to the digested plasmid to obtain a recombinant expression vector pQE-ppk1, and the nucleotide sequence of the recombinant expression vector pQE-ppk1 is shown in SEQ ID NO.7;

[0013] The obtained recombinant expression vector pQE-ppk1 was introduced into Escherichia coli to construct a polyphosphate kinase 1 mutant production bacterium.

[0014] Preferably, in step (1), the amount of seed liquid of the polyphosphate kinase 1 mutant producing bacteria inoculated is 4-8% by weight of the fermentation medium.

[0015] Preferably, in step (1), the fermentation medium is composed of: 2.5 g / L peptone, 20 g / L defatted soy flour, 5 g / L glucose, 5 g / L beet molasses, 8 g / L yeast extract, 3 g / L sodium chloride, 2.5 g / L ammonium sulfate, 4 g / L dipotassium hydrogen phosphate trihydrate, 0.3 g / L ammonium ferric citrate, 2.1 g / L citric acid, 0.5 g / L magnesium sulfate heptahydrate, and 100 ppm ampicillin.

[0016] Preferably, in step (1), IPTG is added so that the final concentration of IPTG in the system is 0.2 mmol / L.

[0017] Preferably, in step (1), the composition of the feed is: 200 g / L glucose, 200 g / L beet molasses, 80 g / L yeast extract, and 60 g / L defatted soy flour.

[0018] Preferably, in step (2), a homogenizer is used for sterilization treatment, and the homogenization conditions are: homogenization pressure 12,000PSI, homogenization flow rate 200-300L / Hr.

[0019] Preferably, in step (2), the amino acid sequence of the polyphosphate kinase 1 mutant is as shown in SEQ ID NO.3.

[0020] Beneficial effects of the present invention:

[0021] (1) The present invention firstly performs mutation modification on Escherichia coli polyphosphate kinase 1, mutates the L at position 246 to P, and the M at position 247 to V in the wild-type polyphosphate kinase 1, and obtains a polyphosphate kinase 1 mutant. The polyphosphate kinase 1 mutant of the present invention has the following outstanding advantages:

[0022] ① The enzyme activity of the polyphosphate kinase 1 mutant of the present invention reaches 800-850 U / mg, which is 23%-33% higher than that of the wild-type polyphosphate kinase 1.

[0023] ② The polyphosphate kinase 1 mutant of the present invention has a wide adaptability to pH and can maintain high enzyme activity between pH 5.0 and pH 9.3, making it more suitable for industrial production.

[0024] ③ The hydrophilicity of the polyphosphate kinase 1 mutant of the present invention is increased, and the solubility of the enzyme is increased, which is more conducive to the industrial application of the enzyme.

[0025] (2) The present invention also optimizes the fermentation medium, fermentation culture conditions and induction culture conditions of the polyphosphate kinase 1 mutant. Among them, the fermentation medium of the present invention selects molasses as one of the carbon sources, which has the following advantages:

[0026] ①Contains high concentrations of decomposed organic matter, humic acid, biochemical fulvic acid, amino acids, and highly absorbable NPK;

[0027] ②Contains UGF produced during the fermentation process;

[0028] ③ Reduce the pulverization rate of dust and granular materials, reducing losses;

[0029] ④ Promote bacterial growth and improve some production performance;

[0030] ⑤ Reduce costs. Molasses is about half the price of glucose.

[0031] Adding a small amount of citric acid can reduce the lag period of the bacteria; adding defatted soy powder and yeast extract can reduce costs.

[0032] In summary, the present invention realizes the large-scale and industrial production of polyphosphate kinase 1 mutants through the construction of production bacteria and the optimization of fermentation process, and significantly improves the enzyme activity of polyphosphate kinase 1. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 : The hydrophilicity of wild-type polyphosphate kinase 1 was analyzed by molecular dynamics simulation software.

[0034] Figure 2 : Analysis of the hydrophilicity of polyphosphate kinase 1 mutants by molecular dynamics simulation software.

[0035] Figure 3 : Schematic diagram of the structure of plasmid pQE-N.

[0036] Figure 4 : Schematic diagram of the structure of the recombinant expression vector pQE-ppk1.

[0037] Figure 5 : Agarose gel electrophoresis verification diagram; Lane M: Marker; Lane 1: pQE-N; Lane 2: pQE-ppk1 double restriction enzyme digestion.

[0038] Figure 6 : SDS-PAGE detection results of proteins after induced expression; in the figure, M: Marker; Lane 1: no inducer IPTG was added; Lanes 2-7: detection results of induced expression for 6h, 8h, 10h, 12h, 14h, and 16h, respectively.

[0039] Figure 7 : Western blot detection results of purified protein.

[0040] Figure 8 : Relationship between the enzyme activity of polyphosphate kinase 1 mutant and wild-type polyphosphate kinase 1 and pH; in the figure, 1 is the polyphosphate kinase 1 mutant, and 2 is the wild-type polyphosphate kinase 1. DETAILED DESCRIPTION

[0041] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0042] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in conjunction with specific embodiments.

[0043] The test materials used in the examples and comparative examples of the present invention are all conventional test materials in the art and can be purchased through commercial channels unless otherwise specified.

[0044] The Escherichia coli used in the present embodiment and the comparative example is a strain named E. coli K-12 (ATCC25404).

[0045] Primary seed culture medium: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, ampicillin 100 ppm.

[0046] Secondary seed culture medium: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, ampicillin 100 ppm.

[0047] Fermentation medium: peptone 2.5g / L, defatted soy flour 20g / L, glucose 5g / L, beet molasses 5g / L, yeast extract 8g / L, sodium chloride 3g / L, ammonium sulfate 2.5g / L, dipotassium hydrogen phosphate trihydrate 4g / L, ammonium ferric citrate 0.3g / L, citric acid 2.1g / L, magnesium sulfate heptahydrate 0.5g / L, ampicillin 100ppm.

[0048] Feed: glucose 200g / L, beet molasses 200g / L, yeast extract 80g / L, defatted soy flour 60g / L.

[0049] The raw materials used in the above culture medium are all commercially available products, among which the "defatted soybean powder" used is low-temperature defatted soybean powder purchased from Shandong Wandefu Biotechnology Co., Ltd.

[0050] Example 1: Polyphosphate kinase 1 mutation treatment

[0051] The inventors obtained the wild-type polyphosphate kinase 1 amino acid sequence from the existing database as shown in SEQ ID NO.1; the nucleotide sequence of the coding gene is shown in SEQ ID NO.2. The topology was analyzed, a box was constructed, energy was minimized under the charmm force field, and then NVT equilibrium and NPT equilibrium were performed. The finished product was simulated for 1ns of MD, and finally the L at position 246 of the wild-type polyphosphate kinase 1 was mutated to P, and the M at position 247 was mutated to V; the amino acid sequence of the mutant polyphosphate kinase 1 after mutation is shown in SEQ ID NO.3.

[0052] The hydrophilicity of polyphosphate kinase 1 before and after mutation was analyzed by molecular dynamics simulation software. The results are as follows: Figure 1 and Figure 2 The results showed that the hydrophilicity of the mutant polyphosphate kinase 1 was improved.

[0053] Example 2: Construction of polyphosphate kinase 1 mutant producing bacteria

[0054] (1) The pQE-60 plasmid was double-digested with BspEⅠ and AflⅢ, and then the 124 bp fragment with the following sequence was ligated

[0055] TCCGGACTCGAGAAATCATAAAAAATTTATTTGCTTTGTGAGCGGATAACAATTATAATAGATTCAATTGTGAGCGGATAACAATTTCACACAGAATTCATTAAAGAGGAGAAATTAAGCATGC; (SEQ ID NO. 5)

[0056] The plasmid pQE-N was constructed (the schematic diagram is shown in Figure 3 ), and its nucleotide sequence is shown in SEQ ID NO.6.

[0057] (2) The plasmid pQE-N was double-digested with AccⅢ and SphⅠ, and the optimized ppk1 gene encoding the polyphosphate kinase 1 mutant (nucleotide sequence as shown in SEQ ID NO.4) was ligated to the digested plasmid to obtain the recombinant expression vector pQE-ppk1 (schematic diagram as shown in Figure 4 ), and its nucleotide sequence is shown in SEQ ID NO.7.

[0058] The constructed recombinant expression vector pQE-ppk1 was digested with AccⅢ and SphⅠ to verify the results. Figure 5 The results showed that the ppk1 gene (shown in SEQ ID NO.4) had been successfully integrated into the plasmid pQE-N.

[0059] (3) The constructed recombinant expression vector pQE-ppk1 was introduced into E. coli to obtain transformants. The transformants were spread on LB plates containing 100 μg / ml ampicillin (Amp), and single colonies that could grow were picked out as positive transformants.

[0060] The positive transformants were inoculated into LB liquid medium containing 100 μg / ml ampicillin and cultured at 33°C until OD 600 =0.6, slowly cool to 22°C, add IPTG (to make the final concentration of IPTG 0.2mmol / L), and induce culture for 16h. After the induction culture, ultrasonically break the bacteria, centrifuge, separate the supernatant, and perform SDS-PAGE verification. The results are as follows Figure 6 As shown, there is an expression band at 80.3KDa, which is consistent with the theoretically calculated molecular weight of the protein expressed by the exogenously inserted target gene ppk1.

[0061] The target protein was separated and purified using a His-nickel affinity chromatography column to obtain a purified protein. The purified protein was tested by western blot, and the results were as follows: Figure 7 shown.

[0062] Depend on Figure 7 It can be seen that the polyphosphate kinase 1 mutant can be successfully expressed by using the polyphosphate kinase 1 mutant production bacteria of the present invention.

[0063] This proves that: this example has successfully constructed a polyphosphate kinase 1 mutant production bacterium.

[0064] Example 3: Fermentation production of polyphosphate kinase 1 mutants

[0065] (1) Bacteria activation:

[0066] The polyphosphate kinase 1 mutant production bacteria constructed in Example 2 were streaked onto LB plates containing 100 μg / ml ampicillin and cultured at 33° C. for 12 h.

[0067] (2) Primary seed culture:

[0068] One inoculation loop of bacteria was streaked from the plate and inoculated into the primary seed culture medium, and cultured at 33°C, pH 7.0 for 16 h.

[0069] (3) Secondary seed culture:

[0070] The first-level seed solution was inoculated into the second-level seed culture medium at 1% (volume fraction) at 33°C and 30-40% dissolved oxygen (DO) until OD 600nm Value 0.3 (diluted 100 times).

[0071] (4) Fermentation culture:

[0072] The secondary seed liquid of the polyphosphate kinase 1 mutant producing bacteria was inoculated into a fermenter (10t fermenter) at a 4% inoculation amount (i.e., the inoculation amount of the secondary seed liquid was 4% of the weight of the fermentation medium) for fermentation culture. The fermentation culture temperature was 33° C., the pH was 6.8-7.2, and the dissolved oxygen (DO) was 20-40%. The fermentation culture was carried out until the OD after the fermentation liquid was diluted 100 times was 600 When the value was 0.5, the temperature was lowered to 22°C, and IPTG was added to the system to a final concentration of 0.2 mmol / L for induction culture, and the induction culture was carried out for 22 h;

[0073] During the culture process, the residual sugar content of the system was monitored. When the residual sugar content of the system was ≤1.0 g / L, feed was added. The residual sugar concentration in the system was maintained at 0.5-1.0 g / L by flow addition.

[0074] (5) After the induction culture is completed, the fermentation liquid is released from the tank and the fermentation liquid is subjected to a homogenizer to break the bacteria. The homogenization conditions are: homogenization pressure 12,000PSI, homogenization flow rate 300L / Hr; after the homogenization, the liquid is centrifuged to separate the supernatant, thereby producing a culture liquid containing the polyphosphate kinase 1 mutant.

[0075] In the above fermentation production process, dissolved oxygen (DO) is measured by a dissolved oxygen electrode, and the dissolved oxygen level of the dissolved oxygen electrode in the air is set as 100%, and the dissolved oxygen in a saturated sodium sulfite solution is set as 0. 600 The pH value was measured by sampling.

[0076] Comparative Example 1:

[0077] The ppk1 gene shown in SEQ ID NO.2 was integrated into the plasmid pQE-N by conventional genetic engineering means to construct a recombinant expression vector; then the constructed recombinant expression vector was introduced into Escherichia coli to obtain transformants, and positive transformants were screened and verified to construct a production strain A.

[0078] The constructed production bacteria A was cultured according to the fermentation production conditions of Example 3. To save costs, the volume of the fermenter was adjusted to 10 L, and the amount of fermentation medium added to the fermenter was adjusted accordingly to produce culture solution A.

[0079] Comparative Example 2:

[0080] The optimized ppk1 gene encoding the polyphosphate kinase 1 mutant (nucleotide sequence as shown in SEQ ID NO.4) was integrated into the plasmid pQE-60 by conventional genetic engineering means to construct a recombinant expression vector; the constructed recombinant expression vector was then introduced into Escherichia coli to obtain transformants, and positive transformants were screened and verified according to the method of Example 3 to construct the production strain B.

[0081] The constructed production bacteria B was cultured according to the fermentation production conditions of Example 3. To save costs, the volume of the fermenter was adjusted to 10 L, and the amount of fermentation medium added to the fermenter was adjusted accordingly to produce culture fluid B.

[0082] Comparative Example 3:

[0083] The composition of the fermentation medium in Example 3 was adjusted to:

[0084] Peptone 12g / L, glucose 10g / L, yeast extract 8g / L, sodium chloride 3g / L, ammonium sulfate 2.5g / L, dipotassium hydrogen phosphate trihydrate 4g / L, ammonium ferric citrate 0.3g / L, magnesium sulfate heptahydrate 0.5g / L, ampicillin 100ppm.

[0085] The composition of the feed was adjusted to: 40 g / L glucose, 30 g / L peptone, and 100 g / L yeast extract.

[0086] The volume of the fermentation tank was adjusted to 10 L, and the amount of fermentation medium added to the fermentation tank was adjusted accordingly.

[0087] The glucose content of the system was monitored during the cultivation process.

[0088] The conditions are the same as those in Example 3 to produce culture fluid C.

[0089] Test Example 1:

[0090] The proteins in the culture fluid obtained in Example 3 and the culture fluids A to C obtained in Comparative Examples 1 to 3 were purified. The expression level of the target protein was calculated and the enzyme activity of the target protein was detected.

[0091] The purification method of the target protein is as follows:

[0092] The sample was added to a His-nickel affinity chromatography column pre-equilibrated with a binding buffer (20mmol / L Na2HPO4, 500mmol / L NaCl, 20mmol / L imidazole, 8mol / L urea, pH7.4). Contaminants were eluted with wash buffer A (20mmol / L Na2HPO4, 500mmol / L NaCl, 20mmol / L imidazole, 8mol / L urea, pH7.4) and wash buffer B (20mmol / L Na2HPO4, 500mmol / L NaCl, 30mmol / L imidazole, 8mol / L urea, pH7.4), and the target protein was eluted with an elution buffer (20mmol / L Na2HPO4, 500mmol / L NaCl, 500mmol / L imidazole, 8mol / L urea, pH7.4). The eluate was collected to obtain a purified protein.

[0093] The method for detecting the enzyme activity of the target protein is as follows:

[0094] The enzymatic activity of polyphosphate kinase 1 in the supernatant obtained after different production bacteria were cultured under the same conditions was detected according to the method of "Prokaryotic Expression, Purification and Enzyme Activity Determination of Polyphosphate Kinase" (China Journal of Biological Products, Vol. 33, No. 5, May 2020). The specific detection method is as follows:

[0095] According to the DAPI staining method, the fluorescence of the DAPI-polyP complex was detected at a wavelength of 415 nm under excitation at 550 nm to determine the content of polyP generated by PPK catalysis, thereby calculating the PPK enzyme activity concentration.

[0096] Enzyme catalysis reaction system: 50mmol / L Hepes-KOH (pH 7.2), 40mmol / L ammonium sulfate, 4mmol / LMgCl, 22mmol / L creatine phosphate, 20μg / mL creatine kinase, 10μg PPK. Incubate at 37℃ for 15 or 30min, add 40mmol / LEDTA to terminate the reaction, use 10umol / L DAPI and purified protease in a 1:1 ratio, excite at 415nm and measure at 550nm. Each reaction was repeated 3 times. The maximum value obtained under different reaction conditions was the protease activity. Prepare polyP standards with concentrations of 1000, 500, 250, 125, 62.5, and 0ng / mL, and use DAPI staining to determine the polyP standard curve with the polyP standard concentration as the horizontal axis and the fluorescence intensity as the vertical axis. Calculate the concentration of polyP according to the polyP standard curve, take the average value, and calculate the enzyme activity according to the following formula. PPK enzyme activity (U / mg) was defined as the amount of enzyme that catalyzes the incorporation of 1 pmol of phosphate into poly P per minute under the assay conditions.

[0097] Enzyme activity (U / mg) = poly P (pmol / L) * V / (m*T)

[0098] Where V is the total reaction volume (L), m is the mass of the enzyme to be tested (mg), and T is the reaction time (min).

[0099] The results are shown in Table 1.

[0100] Table 1:

[0101] Group Expression of polyphosphate kinase 1 Enzyme activity of polyphosphate kinase 1 (U / mg) Example 3 32g / L 800-850 Comparative Example 1 30g / L 630-645 Comparative Example 2 15g / L 800-850 Comparative Example 3 13g / L 800-850

[0102] Test Example 2:

[0103] The purified proteins obtained in Experimental Example 1 (ie, polyphosphate kinase 1 mutant and wild-type polyphosphate kinase 1) were tested for their enzyme activities under different pH conditions. The enzyme activity determination method was referred to Experimental Example 1.

[0104] The results are as follows Figure 8 As shown, the results show that: compared with the wild-type polyphosphate kinase 1, the polyphosphate kinase 1 mutant of the present invention has a wide adaptability to pH, can maintain high enzyme activity between pH 5.0 and pH 9.3, and is more suitable for industrial production.

[0105] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application. SEQUENCE LISTING <110> Xintai Jiahe Biotechnology Co., Ltd. <120> A method for producing polyphosphate kinase 1 mutant by fermentation <130> 2022 <160> 7 <170> PatentIn version 3.5 <210> 1 <211> 688 <212> PRT <213> Wild-type polyphosphate kinase 1 <400> 1 Met Gly Gln Glu Lys Leu Tyr Ile Glu Lys Glu Leu Ser Trp Leu Ser 1 5 10 15 Phe Asn Glu Arg Val Leu Gln Glu Ala Ala Asp Lys Ser Asn Pro Leu 20 25 30 Ile Glu Arg Met Arg Phe Leu Gly Ile Tyr Ser Asn Asn Leu Asp Glu 35 40 45 Phe Tyr Lys Val Arg Phe Ala Glu Leu Lys Arg Arg Ile Ile Ile Ser 50 55 60 Glu Glu Gln Gly Ser Asn Ser His Ser Arg His Leu Leu Gly Lys Ile 65 70 75 80 Gln Ser Arg Val Leu Lys Ala Asp Gln Glu Phe Asp Gly Leu Tyr Asn 85 90 95 Glu Leu Leu Leu Glu Met Ala Arg Asn Gln Ile Phe Leu Ile Asn Glu 100 105 110 Arg Gln Leu Ser Val Asn Gln Gln Asn Trp Leu Arg His Tyr Phe Lys 115 120 125 Gln Tyr Leu Arg Gln His Ile Thr Pro Ile Leu Ile Asn Pro Asp Thr 130 135 140 Asp Leu Val Gln Phe Leu Lys Asp Asp Tyr Thr Tyr Leu Ala Val Glu 145 150 155 160 Ile Ile Arg Gly Asp Thr Ile Arg Tyr Ala Leu Leu Glu Ile Pro Ser 165 170 175 Asp Lys Val Pro Arg Phe Val Asn Leu Pro Pro Glu Ala Pro Arg Arg 180 185 190 Arg Lys Pro Met Ile Leu Leu Asp Asn Ile Leu Arg Tyr Cys Leu Asp 195 200 205 Asp Ile Phe Lys Gly Phe Phe Asp Tyr Asp Ala Leu Asn Ala Tyr Ser 210 215 220 Met Lys Met Thr Arg Asp Ala Glu Tyr Asp Leu Val His Glu Met Glu 225 230 235 240 Ala Ser Leu Met Glu Leu Met Ser Ser Ser Leu Lys Gln Arg Leu Thr 245 250 255 Ala Glu Pro Val Arg Phe Val Tyr Gln Arg Asp Met Pro Asn Ala Leu 260 265 270 Val Glu Val Leu Arg Glu Lys Leu Thr Island Ser Arg Tyr Asp Ser Ile 275 280 285 Val Pro Gly Gly Arg Tyr His Asn Phe Lys Asp Phe Ile Asn Phe Pro 290,295,300 Asn Val Gly Lys Ala Asn Leu Val Asn Lys Pro Leu Pro Arg Leu Arg 305 310 315 320 His Ile Trp Phe Asp Lys Ala Gln Phe Arg Asn Gly Phe Asp Ala Ile 325 330 335 Arg Glu Arg Asp Val Leu Leu Tyr Tyr Pro Tyr His Thr Phe Glu His 340 345 350 Val Leu Glu Leu Leu Arg Gln Ala Ser Phe Asp Pro Ser Val Leu Wing 355 360 365 With Lys With Asn With Tyr Arg With Only Lys Asp Ser Arg With Asp 370 375 380 Ser Met Ile His Ala Ala His Asn Gly Lys Lys Val Thr Val Val Val 385 390 395 400 Glu Leu Gln Ala Arg Phe Asp Glu Glu Ala Asn With His Trp Ala Lys 405 410 415 Arg Leu Thr Glu Ala Gly Val His Val Ile Phe Ser Ala Pro Gly Leu 420 425 430 Lys Ile His Ala Lys Leu Phe Leu Ile Ser Arg Lys Glu Asn Gly Glu 435 440 445 Val Val Arg Tyr Ala His Ile Gly Thr Gly Asn Phe Asn Glu Lys Thr 450 455 460 Ala Arg Leu Tyr Thr Asp Tyr Ser Leu Leu Thr Ala Asp Ala Arg Ile 465 470 475 480 Thr Asn Glu Val Arg Arg Val Phe Asn Phe Ile Glu Asn Pro Tyr Arg 485 490 495 Pro Val Thr Phe Asp Tyr Leu Met Val Ser Pro Gln Asn Ser Arg Arg 500 505 510 Leu Leu Tyr Glu Met Val Asp Arg Glu Ile Ala Asn Ala Gln Gln Gly 515 520 525 Leu Pro Ser Gly Ile Thr Leu Lys Leu Asn Asn Leu Val Asp Lys Gly 530 535 540 Leu Val Asp Arg Leu Tyr Ala Ala Ser Ser Ser Gly Val Pro Val Asn 545 550 555 560 Leu Leu Val Arg Gly Met Cys Ser Leu Ile Pro Asn Leu Glu Gly Ile 565,570,575 Ser Asp Asn With Arg Ala Ser I Val Asp Arg Tyr Leu Glu His 580,585,590 Asp Arg Val Tyr Ile Phe Glu Asn Gly Gly Asp Lys Lys Val Tyr Leu 595,600,605 Ser On Only Asp Trp Met Thr Arg Asn With Asp Tyr Arg With Glu Val 610 615 620 Only Thr Pro Lew Asp Pro Arg Lew Lys Gln Arg Val Lew Asp Ile 625 630 635 640 With Asp With Leu Phe Serving Asp Thr Val Lys With Arg Tyr With Asp Lys 645,650,655 Glu Leu Ser Asn Arg Tyr Val Pro Arg Gly Asn Arg Lys Val Arg 660,665,670 Gln Only Tyr Only Asp Tyr Only Lys Ser On Only Glu Gln Pro Glu 675,680,685 <210> 2 <211> 2067 <212> DNA <213> Music Music Video1 <400> 2 atgggtcagg aaagctata catcgaaaaa gagctcagtt ggttatcgtt caatgaacgc 60 gtgcttcagg aagcggcgga caaatctaac ccgctgattg aaaggatgcg tttcctgggg 120 atctattcca ataaccttga tgagttctat aaagtccgct tcgctgaact gaagcgacgc 180 atcattatta gcgaagaaca aggctccaac tctcattccc gccatttact gggcaaaatt 240 cagtcccggg tgctgaaagc cgatcaggaa ttcgacggcc tctacaacga gctattgctg 300 gagatggcgc gcaaccagat cttcctgatt aatgaacgcc agctctccgt caatcaacaa 360 aactggctgc gtcattattt taagcagtat ctgcgtcagc acattacgcc gattttaatc 420 aatcctgaca ctgacttagt gcagttcctg aaagatgatt acacctatct ggcggtggaa 480 attatccgtg gcgataccat ccgttacgcg ctgctggaga tcccatcaga taaagtgccg 540 cgctttgtga atttaccgcc agaagcgccg cgtcgacgca agccgatgat tcttctggat 600 aacattctgc gttactgcct tgatgatatt ttcaaaggct tctttgatta tgacgcgctg 660 aatgcctatt caatgaagat gacccgcgat gccgaatacg atttagtgca tgagatggaa 720 gccagcctga tggagttgat gtcttccagt ctcaagcagc gtttaactgc tgagccggtg 780 cgttttgttt atcagcgcga tatgcccaat gcgctggttg aagtgttacg cgaaaaactg 840 actatttccc gctacgactc catcgtcccc ggcggtcgtt atcataattt taaagacttt 900 attaatttcc ccaatgtcgg caaagccaat ctggtgaaca aaccactgcc gcgtttacgc 960 catatttggt ttgataaagc ccagttccgc aatggttttg atgccattcg cgaacgcgat 1020 gtgttgctct attatcctta tcacaccttt gagcatgtgc tggaactgct gcgtcaggct 1080 tcgttcgacc cgagcgtact ggcgattaaa attaacattt accgcgtggc gaaagattca 1140 cgcatcatcg actcgatgat ccacgccgca cataacggta agaaagtcac cgtggtggtt 1200 gagttacagg cgcgtttcga cgaagaagcc aacattcact gggcgaagcg cctgaccgaa 1260 gcaggcgtgc acgttatctt ctctgcgccg gggctgaaaa ttcacgccaa actgttcctg 1320 atttcacgta aagaaaacgg tgaagtggtg cgttatgcac acatcgggac cgggaacttt 1380 aacgaaaaaa ccgcgcgtct ttatactgac tattcgttgc tgaccgccga tgcgcgcatc 1440 accaacgaag tacggcgggt atttaacttt attgaaaacc cataccgtcc ggtgacattt 1500 gattatttaa tggtatcgcc gcaaaactcc cgccgcctat tgtatgaaat ggtggaccgc 1560 gagatcgcca acgcgcagca agggctgccc agtggtatca ccctgaagct aaataacctt 1620 gtcgataaag gcctggttga tcgtctgtat gcggcctcca gctccggcgt accggttaat 1680 ctgctggttc gcggaatgtg ttcgctgatc cccaatctgg aaggcattag cgacaacatt 1740 cgtgccatca gtattgttga ccgttacctt gaacatgacc gggtttatat ttttgaaaat 1800 ggcggcgata aaaaggtcta cctttcttcc gccgactgga tgacgcgcaa tattgattat 1860 cgtattgaag tggcgacgcc gctgctcgat ccgcgcctga agcagcgggt actggacatc 1920 atcgacatat tgttcagcga tacggtcaaa gcacgttata tcgataaaga actcagtaat 1980 cgctacgttc cccgcggcaa tcgccgcaaa gtacgggcgc agttggcgat ttatgactac 2040 atcaaatcac tcgaacaacc tgaataa 2067 <210> 3 <211> 688 <212> PRT <213> The 100-year-old girl <400> 3 Put Gly Gln Glu Lys Leu Tyr Ile Glu Lys Glu Leu Ser Trp Leu Ser 1 5 10 15 Phe Asn Glu Arg Val Leu Gln Glu Ala Ala Asp Lys Ser Asn Pro Leu 20 25 30 Ile Glu Arg Met Arg Phe Leu Gly Ile Tyr Ser Asn Asn Leu Asp Glu 35 40 45 Phe Tyr Lys Val Arg Phe Ala Glu Leu Lys Arg Arg Ile Ile Ile Ser 50 55 60 Glu Glu Gln Gly Ser Asn Ser His Ser Arg His Leu Leu Gly Lys Ile 65 70 75 80 Gln Ser Arg Val Leu Lys Ala Asp Gln Glu Phe Asp Gly Leu Tyr Asn 85 90 95 Glu Leu Leu Leu Glu Met Ala Arg Asn Gln Ile Phe Leu Ile Asn Glu 100 105 110 Arg Gln Leu Ser Val Asn Gln Gln Asn Trp Leu Arg His Tyr Phe Lys 115 120 125 Gln Tyr Leu Arg Gln His Ile Thr Pro Ile Leu Ile Asn Pro Asp Thr 130 135 140 Asp Leu Val Gln Phe Leu Lys Asp Asp Tyr Thr Tyr Leu Ala Val Glu 145 150 155 160 Ile Ile Arg Gly Asp Thr Ile Arg Tyr Ala Leu Leu Glu Ile Pro Ser 165 170 175 Asp Lys Val Pro Arg Phe Val Asn Leu Pro Pro Glu Ala Pro Arg Arg 180 185 190 Arg Lys Pro Met with Asp and Arg with Tyr Cys with Asp 195 200 205 Asp Ile Phe Lys Gly Phe Phe Asp Tyr Asp Ala Leu Asn Ala Tyr Ser 210 215 220 Met Lys Met Thr Arg Asp Ala Glu Tyr Asp Leu Val His Glu Met Glu 225 230 235 240 Only Ser Met Glu Pro Val Ser Ser Leu Lys Gln Arg Thr 245 250 255 Ala Glu Pro Val Arg Phe Val Tyr Gln Arg Asp Met Pro Asn Ala Leu 260 265 270 Val Glu Val Leu Arg Glu Lys Leu Thr Island Ser Arg Tyr Asp Ser Ile 275 280 285 Val Pro Gly Gly Arg Tyr His Asn Phe Lys Asp Phe Ile Asn Phe Pro 290,295,300 Asn Val Gly Lys Ala Asn Leu Val Asn Lys Pro Leu Pro Arg Leu Arg 305 310 315 320 His Ile Trp Phe Asp Lys Ala Gln Phe Arg Asn Gly Phe Asp Ala Ile 325 330 335 Arg Glu Arg Asp Val Leu Leu Tyr Tyr Pro Tyr His Thr Phe Glu His 340 345 350 Val Leu Glu Leu Leu Arg Gln Ala Ser Phe Asp Pro Ser Val Leu Ala 355 360 365 Ile Lys Ile Asn Ile Tyr Arg Val Ala Lys Asp Ser Arg Ile Ile Asp 370 375 380 Ser Met Ile His Ala Ala His Asn Gly Lys Lys Val Thr Val Val Val 385 390 395 400 Glu Leu Gln Ala Arg Phe Asp Glu Glu Ala Asn Ile His Trp Ala Lys 405 410 415 Arg Leu Thr Glu Ala Gly Val His Val Ile Phe Ser Ala Pro Gly Leu 420 425 430 Lys Ile His Ala Lys Leu Phe Leu Ile Ser Arg Lys Glu Asn Gly Glu 435 440 445 Val Val Arg Tyr Ala His Ile Gly Thr Gly Asn Phe Asn Glu Lys Thr 450 455 460 Ala Arg Leu Tyr Thr Asp Tyr Ser Leu Leu Thr Ala Asp Ala Arg Ile 465 470 475 480 Thr Asn Glu Val Arg Arg Val Phe Asn Phe Ile Glu Asn Pro Tyr Arg 485 490 495 Pro Val Thr Phe Asp Tyr Leu Met Val Ser Pro Gln Asn Ser Arg Arg 500 505 510 Leu Leu Tyr Glu Met Val Asp Arg Glu Ile Ala Asn Ala Gln Gln Gly 515 520 525 Leu Pro Ser Gly Ile Thr Leu Lys Leu Asn Asn Leu Val Asp Lys Gly 530 535 540 Leu Val Asp Arg Leu Tyr Ala Ala Ser Ser Ser Gly Val Pro Val Asn 545 550 555 560 Leu Leu Val Arg Gly Met Cys Ser Leu Ile Pro Asn Leu Glu Gly Ile 565 570 575 Ser Asp Asn Ile Arg Ala Ile Ser Ile Val Asp Arg Tyr Leu Glu His 580 585 590 Asp Arg Val Tyr Ile Phe Glu Asn Gly Gly Asp Lys Lys Val Tyr Leu 595 600 605 Ser Ser Ala Asp Trp Met Thr Arg Asn Ile Asp Tyr Arg Ile Glu Val 610 615 620 Ala Thr Pro Leu Leu Asp Pro Arg Leu Lys Gln Arg Val Leu Asp Ile 625 630 635 640 Ile Asp Ile Leu Phe Ser Asp Thr Val Lys Ala Arg Tyr Ile Asp Lys 645 650 655 Glu Leu Ser Asn Arg Tyr Val Pro Arg Gly Asn Arg Arg Lys Val Arg 660 665 670 Ala Gln Leu Ala Ile Tyr Asp Tyr Ile Lys Ser Leu Glu Gln Pro Glu 675 680 685 <210> 4 <211> 2074 <212> DNA <213> Polyphosphate kinase 1 mutant <400> 4 ccggaatggg tcaggaaaaa ctgtacatcg aaaaagaact gtcttggctg tctttcaacg 60 aacgtgttct gcaggaagct gctgacaaat ctaacccgct gatcgaacgt atgcgtttcc 120 tgggtatcta ctctaacaac ctggacgaat tctacaaagt tcgtttcgct gaactgaaac 180 gtcgtatcat catctctgaa gaacagggtt ctaactctca ctctcgtcac ctgctgggta 240 aaatccagtc tcgtgttctg aaagctgacc aggaattcga cggtctgtac aacgaactgc 300 tgctggaaat ggctcgtaac cagatcttcc tgatcaacga acgtcagctg tctgttaacc 360 agcagaactg gctgcgtcac tacttcaaac agtacctgcg tcagcacatc accccgatcc 420 tgatcaaccc ggacaccgac ctggttcagt tcctgaaaga cgactacacc tacctggctg 480 ttgaaatcat ccgtggtgac accatccgtt acgctctgct ggaaatcccg tctgacaaag 540 ttccgcgttt cgttaacctg ccgccggaag ctccgcgtcg tcgtaaaccg atgatcctgc 600 tggacaacat cctgcgttac tgcctggacg acatcttcaa aggtttcttc gactacgacg 660 ctctgaacgc ttactctatg aaaatgaccc gtgacgctga atacgacctg gttcacgaaa 720 tggaagcttc tccggttgaa ccggtttctt cttctctgaa acagcgtctg accgctgaac 780 cggttcgttt cgtttaccag cgtgacatgc cgaacgctct ggttgaagtt ctgcgtgaaa 840 aactgaccat ctctcgttac gactctatcg ttccgggtgg tcgttaccac aacttcaaag 900 acttcatcaa cttcccgaac gttggtaaag ctaacctggt taacaaaccg ctgccgcgtc 960 tgcgtcacat ctggttcgac aaagctcagt tccgtaacgg tttcgacgct atccgtgaac 1020 gtgacgttct gctgtactac ccgtaccaca ccttcgaaca cgttctggaa ctgctgcgtc 1080 aggcttcttt cgacccgtct gttctggcta tcaaaatcaa catctaccgt gttgctaaag 1140 actctcgtat catcgactct atgatccacg ctgctcacaa cggtaaaaaa gttaccgttg 1200 ttgttgaact gcaggctcgt ttcgacgaag aagctaacat ccactgggct aaacgtctga 1260 ccgaagctgg tgttcacgtt atcttctctg ctccgggtct gaaaatccac gctaaactgt 1320 tcctgatctc tcgtaaagaa aacggtgaag ttgttcgtta cgctcacatc ggtaccggta 1380 acttcaacga aaaaaccgct cgtctgtaca ccgactactc tctgctgacc gctgacgctc 1440 gtatcaccaa cgaagttcgt cgtgttttca acttcatcga aaacccgtac cgtccggtta 1500 ccttcgacta cctgatggtt tctccgcaga actctcgtcg tctgctgtac gaaatggttg 1560 accgtgaaat cgctaacgct cagcagggtc tgccgtctgg tatcaccctg aaactgaaca 1620 acctggttga caaaggtctg gttgaccgtc tgtacgctgc ttcttcttct ggtgttccgg 1680 ttaacctgct ggttcgtggt atgtgctctc tgatcccgaa cctggaaggt atctctgaca 1740 acatccgtgc tatctctatc gttgaccgtt acctggaaca cgaccgtgtt tacatcttcg 1800 aaaacggtgg tgacaaaaaa gtttacctgt cttctgctga ctggatgacc cgtaacatcg 1860 actaccgtat cgaagttgct accccgctgc tggacccgcg tctgaaacag cgtgttctgg 1920 acatcatcga catcctgttc tctgacaccg ttaaagctcg ttacatcgac aaagaactgt 1980 ctaaccgtta cgttccgcgt ggtaaccgtc gtaaagttcg tgctcagctg gctatctacg 2040 actacatcaa atctctggaa cagccgtaag catg 2074 <210> 5 <211> 124 <212> DNA <213> Artificial Sequence <400> 5 tccggactcg agaaatcata aaaaatttat ttgctttgtg agcggataac aattataata 60 gattcaattg tgagcggata acaatttcac acagaattca ttaaagagga gaaattaagc 120 atgc 124 <210> 6 <211> 2529 <212> DNA <213> Artificial Sequence <400> 6 ctcgagaaat cataaaaaat ttatttgctt tgtgagcgga taacaattat aatagattca 60 attgtgagcg gataacaatt tcacacagaa ttcattaaag aggagaaatt aaccatggga 120 ggatccagat cttaatagta attagctgag cttggactcc tgttgataga tccagtaatg 180 acctcagaac tccatctgga tttgttcaga acgctcggtt gccgccgggc gttttttatt 240 ggtgagaatc caagctagct tggcgagatt ttcaggagct aaggaagcta aaatggagaa 300 aaaaatcact ggatatacca ccgttgatat atcccaatgg catcgtaaag aacattttga 360 ggcatttcag tcagttgctc aatgtaccta taaccagacc gttcagctgg atattacggc 420 ctttttaaag accgtaaga aaataagca caagttttat ccggccttta ttcacattct 480 tgcccgcctg atgaatgctc atccggactc gagaaatcat aaaaaattta ttgctttgt 540 gagcggataa caattataat agatcatt gtgagcggat aacaatttca cacagaattc 600 attaaaggg agaattaag catgccggcc gtaatagtaa ttacatgtg agcaaaggc 660 cagcaaagg ccaggaaccg taaaaaggcc gcgttgctg cgttttcca taggctccgc 720 ccccctgacg agcatcaca aaatcgacgc tcagtcaga ggtggcgaaa cccgacagga 780 ctataaagat accagggtt tccccctgga agctccctcg tgcctctcc tgttccgacc 840 ctgccgctta ccggatacct gtccgccttt ctcctcgg gaagcgtggc gcttctcat 900 agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg 960 cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc 1020 aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga 1080 gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact 1140 agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt 1200 ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag 1260 cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg 1320 tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa 1380 aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata 1440 tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg 1500 atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat aactacgata 1560 cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg 1620 gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct 1680 gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt 1740 tcgccagtta atagtttgcg caacgttgtt gccattgcta caggcatcgt ggtgtcacgc 1800 tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga 1860 tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt 1920 aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc 1980 atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa 2040 tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca 2100 catagcagaa cttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaactctca 2160 aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct 2220 tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc 2280 gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa 2340 tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt 2400 tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc 2460 taagaaacca ttattatcat gacattaacc tataaaaata ggcgtatcac gaggcccttt 2520 cgtcttcac 2529 <210> 7 <211> 4481 <212> DNA <213> Artificial Sequence <400> 7 ctcgagaaat cataaaaaat ttatttgctt tgtgagcgga taacaattat aatagattca 60 attgtgagcg gataacaatt tcacacagaa ttcattaaag aggagaaatt aaccatggga 120 ggatccagat cttaatagta attagctgag cttggactcc tgttgataga tccagtaatg 180 acctcagaac tccatctgga tttgttcaga acgctcggtt gccgccgggc gttttttatt 240 ggtgagaatc caagctagct tggcgagatt ttcaggagct aaggaagcta aaatggagaa 300 aaaaatcact ggatatacca ccgttgatat atcccaatgg catcgtaaag aacattttga 360 ggcatttcag tcagttgctc aatgtaccta taaccagacc gttcagctgg atattacggc 420 ctttttaaag accgtaaaga aaaataagca caagttttat ccggccttta ttcacattct 480 tgcccgcctg atgaatgctc atccggaatg ggtcaggaaa aactgtacat cgaaaaagaa 540 ctgtcttggc tgtctttcaa cgaacgtgtt ctgcaggaag ctgctgacaa atctaacccg 600 ctgatcgaac gtatgcgttt cctgggtatc tactctaaca acctggacga attctacaaa 660 gttcgtttcg ctgaactgaa acgtcgtatc atcatctctg aagaacaggg ttctaactct 720 cactctcgtc acctgctggg taaaatccag tctcgtgttc tgaaagctga ccaggaattc 780 gacggtctgt acaacgaact gctgctggaa atggctcgta accagatctt cctgatcaac 840 gaacgtcagc tgtctgttaa ccagcagaac tggctgcgtc actacttcaa acagtacctg 900 cgtcagcaca tcaccccgat cctgatcaac ccggacaccg acctggttca gttcctgaaa 960 gacgactaca cctacctggc tgttgaaatc atccgtggtg acaccatccg ttacgctctg 1020 ctggaaatcc cgtctgacaa agttccgcgt ttcgttaacc tgccgccgga agctccgcgt 1080 cgtcgtaaac cgatgatcct gctggacaac atcctgcgtt actgcctgga cgacatcttc 1140 aaaggtttct tcgactacga cgctctgaac gcttactcta tgaaaatgac ccgtgacgct 1200 gaatacgacc tggttcacga aatggaagct tctccggttg aactgatgtc ttcttctctg 1260 aaacagcgtc tgaccgctga accggttcgt ttcgtttacc agcgtgacat gccgaacgct 1320 ctggttgaag ttctgcgtga aaaactgacc atctctcgtt acgactctat cgttccgggt 1380 ggtcgttacc acaacttcaa agacttcatc aacttcccga acgttggtaa agctaacctg 1440 gttaacaaac cgctgccgcg tctgcgtcac atctggttcg acaaagctca gttccgtaac 1500 ggtttcgacg ctatccgtga acgtgacgtt ctgctgtact acccgtacca caccttcgaa 1560 cacgttctgg aactgctgcg tcaggcttct ttcgacccgt ctgttctggc tatcaaaatc 1620 aacatctacc gtgttgctaa agactctcgt atcatcgact ctatgatcca cgctgctcac 1680 aacggtaaaa aagttaccgt tgttgttgaa ctgcaggctc gtttcgacga agaagctaac 1740 atccactggg ctaaacgtct gaccgaagct ggtgttcacg ttatcttctc tgctccgggt 1800 ctgaaaatcc acgctaaact gttcctgatc tctcgtaaag aaaacggtga agttgttcgt 1860 tacgctcaca tcggtaccgg taacttcaac gaaaaaaccg ctcgtctgta caccgactac 1920 tctctgctga ccgctgacgc tcgtatcacc aacgaagttc gtcgtgtttt caacttcatc 1980 gaaaacccgt accgtccggt taccttcgac tacctgatgg tttctccgca gaactctcgt 2040 cgtctgctgt acgaaatggt tgaccgtgaa atcgctaacg ctcagcaggg tctgccgtct 2100 ggtatcaccc tgaaactgaa caacctggtt gacaaaggtc tggttgaccg tctgtacgct 2160 gcttcttct ctggtgttc ggttaacctg ctggttcgtg gtatgtgctc tctgatcccg 2220 aacctggaag gtatctctga caacatccgt gctatctcta tcgttgaccg ttacctggaa 2280 cacgaccgtg tttacatctt cgaaaacggt ggtgacaaaa aagtttacct gtcttctgct 2340 gactggatga cccgtaacat cgactaccgt atcgaagttg ctaccccgct gctggacccg 2400 cgtctgaaac agcgtgttct ggacatcatc gacatcctgt tctctgacac cgttaaagct 2460 cgttacatcg acaaagaact gtctaaccgt tacgttccgc gtggtaaccg tcgtaaagtt 2520 cgtgctcagc tggctatcta cgactacatc aaatctctgg aacagccgta agcatgccgg 2580 ccgtaatagt aattaacatg tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg 2640 ccgcgttgct ggcgttttc cataggctcc gccccctga cgagcatcac aaaaatcgac 2700 gctcaagtca gaggtggcga aacccgacag gacttaaag ataccaggcg ttccccctg 2760 gaagctccct cgtgcgct cctgttccga ccctgccgct taccggatac ctgtccgcct 2820 ttctccctc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat ctcagttcgg 2880 tgtaggtcgt tcgctccaag ctgggctgtg tgcacgacc cccgttcag cccgaccgct 2940 gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac ttacgccac 3000 tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt 3060 tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt atctgcgctc 3120 tgctgaagcc agttaccttc ggaaaagag ttggtagctc ttgatccggc aaacaaacca 3180 cggctgtag cggtggtttt ttgttttgca agcagcagat tacgcgcaga aaaaaaggat 3240 ctcaagaga tcctttgatc tttttacgg ggtctgacgc tcagtggaac gaaaactcac 3300 gttaagggat ttggtcatg agattatca aaaggatctt cacctagatc cttttaaatt 3360 aaaaatgaag ttttaaatca atctaaagta tatatgagta aacttggtct gacagttacc 3420 aatgcttaat cagtgaggca cctatctcag cgatctgtct atttcgttca tccatagttg 3480 cctgactccc cgtcgtgtag ataactacga tacgggaggg cttaccatct ggccccagtg 3540 ctgcaatgat accgcgagac ccacgctcac cggctccaga tttatcagca ataaaccagc 3600 cagccggaag ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc atccagtcta 3660 ttaattgttg ccgggaagct agagtaagta gttcgccagt taatagtttg cgcaacgttg 3720 ttgccattgc tacaggcatc gtggtgtcac gctcgtcgtt tggtatggct tcattcagct 3780 ccggttccca acgatcaagg cgagttacat gatcccccat gttgtgcaaa aaagcggtta 3840 gctccttcgg tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg 3900 ttatggcagc actgcataat tctcttactg tcatgccatc cgtaagatgc ttttctgtga 3960 ctggtgagta ctcaaccaag tcattctgag aatagtgtat gcggcgaccg agttgctctt 4020 gcccggcgtc aatacgggat aataccgcgc cacatagcag aactttaaaa gtgctcatca 4080 ttggaaaacg ttcttcgggg cgaaaaactct caaggatctt accgctgttg agatccagtt 4140 cgatgtaacc cactcgtgca cccaactgat cttcagcatc ttttactttc accagcgttt 4200 ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga 4260 aatgttgaat actcatactc ttcctttttc aatattattg aagcatttat cagggttatt 4320 gtctcatgag cggatacata tttgaatgta tttagaaaaa taacaaata ggggttccgc 4380 gcacatttcc ccgaaaagtg ccacctgacg tctaagaaac cattattatc atgacattaa 4440 cctataaaaa taggcgtatc acgaggccct ttcgtcttca c 4481

Claims

1. A method for producing a polyphosphate kinase 1 mutant by fermentation, characterized in that: The following steps are involved: (1) Inoculating the seed liquid of the polyphosphate kinase 1 mutant producing bacteria into a fermentation medium for fermentation culture at a temperature of 32-34° C., a pH of 6.8-7.2, and a dissolved oxygen of 20-40%; fermenting the culture until the OD value after the fermentation liquid is diluted 100 times is 600 When the value is 0.40-0.60, cool down to 21-23°C, add IPTG to the system for induction culture, and induction culture for 20-24h; During the culture process, the residual sugar content of the system was monitored. When the residual sugar content of the system was ≤1.0 g / L, feed was added. The residual sugar concentration in the system was maintained at 0.5-1.0 g / L by feeding. (2) breaking the culture after the induction culture, separating and collecting the supernatant, thereby producing a culture fluid containing the polyphosphate kinase 1 mutant; In step (1), the polyphosphate kinase 1 mutant production bacteria are constructed by the following method: The pQE-60 plasmid was double-digested with BspEⅠ and AflⅢ, and then the fragment with the sequence shown in SEQ ID NO.5 was connected to construct a plasmid pQE-N, and the nucleotide sequence of the plasmid pQE-N is shown in SEQ ID NO.6; the plasmid pQE-N was double-digested with AccⅢ and SphⅠ, and then the gene encoding the polyphosphate kinase 1 mutant shown in SEQ ID NO.4 was connected to the digested plasmid to obtain a recombinant expression vector pQE-ppk1, and the nucleotide sequence of the recombinant expression vector pQE-ppk1 is shown in SEQ ID NO.7; The obtained recombinant expression vector pQE-ppk1 was introduced into Escherichia coli to construct a polyphosphate kinase 1 mutant production bacterium.

2. The method according to claim 1, characterized in that In step (1), the amount of seed liquid of the polyphosphate kinase 1 mutant producing bacteria inoculated is 4-8% of the weight of the fermentation medium.

3. The method according to claim 1, characterized in that In step (1), the composition of the fermentation medium is: the composition of the fermentation medium is: peptone 2.5g / L, defatted soy flour 20g / L, glucose 5g / L, beet molasses 5g / L, yeast extract 8g / L, sodium chloride 3g / L, ammonium sulfate 2.5g / L, potassium dihydrogen phosphate trihydrate 4g / L, ammonium ferric citrate 0.3g / L, citric acid 2.1g / L, magnesium sulfate heptahydrate 0.5g / L, and ampicillin 100ppm.

4. The method according to claim 1, characterized in that: In step (1), IPTG is added so that the final concentration of IPTG in the system is 0.2 mmol / L.

5. The method according to claim 1, characterized in that In step (1), the composition of the feed is: 200 g / L glucose, 200 g / L beet molasses, 80 g / L yeast extract, and 60 g / L defatted soy flour.

Images