Curculigo orcinol synthase gene CoORS1 and its application in the preparation of orcinol
By identifying the gene CoORS1 of the celestialis synthase, recombinant plasmids and transgenic engineered bacteria were constructed, and the efficient synthesis of the celestialis phenol was solved, and the problems of complex and high cost in the existing technology were solved, supporting the biosynthesis regulation of the celestialis breeding and the celestialis glucoside.
Patent Information
- Application Number
- CN202210420041.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-04-21
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2042-04-21
AI Technical Summary
The prior art is difficult to efficiently synthesize pyrol, and its content in medicinal materials is small, the extraction and separation process is complex, and the cost is high, which limits the application of pyrol glucoside.
By identifying the gene CoORS1 of the celestialis, recombinant plasmids and transgenic engineering bacteria were constructed, and acetyl-CoA and malonyl-CoA were used as raw materials to catalyze the synthesis of celestialis in vitro.
The targeted production of moss-black phenol has been realized, the synthesis path is simplified, the cost is reduced, and the basis is provided for a large amount of synthetic moss-black phenol glucosides, supporting the research on moss-black breeding.
Smart Images

Figure CN114717248B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and particularly relates to a curculigo orcinol synthase gene CoORS1 and its application in preparing orcinol. Background Art
[0002] Curculigo orchioides Gaertn is a perennial herbaceous plant in the Amaryllidaceae family. Orcinol glucoside is an effective phenolic glycoside extracted from the rhizomes of Curculigo, with a content of 0.1795% to 0.6239%. Current research suggests that orcinol glucoside exhibits multiple pharmacological activities, including antioxidant, anti-osteoporosis, antidepressant, anxiolytic, and immunomodulatory activities. As a natural product, orcinol is generally extracted and isolated directly from the traditional Chinese medicine Curculigo. However, its content in the herb is extremely low, and the extraction and separation process is complex and costly. (Excerpt from Wang Bo et al., "Synthesis of Orcinol," Journal of Ningxia Medical University, 20201030)
[0003] The biosynthetic precursor of orcinol glucoside is orcinol. The hydroxyl group at the C3 or C5 position of orcinol undergoes a glycosylation under the catalysis of glycosyltransferase to generate orcinol glucoside, while orcinol is condensed with acetyl-CoA and malonyl-CoA as precursor substances.
[0004] For high-value-added natural products, the efficient production of pharmaceutically active ingredients using modern biotechnology, either homologous or heterologous expression systems, is widely considered a key technological approach to addressing future shortages of pharmaceutical resources. However, to investigate the biosynthetic pathways of these active ingredients, it is essential to identify key genes involved in these pathways. Discovering these catalytic enzyme genes is a crucial step in studying the biosynthetic pathways of plant metabolites. Currently, there are no reports of orcinol synthase from Curculigo orchioides. Therefore, the biosynthetic precursor orcinol is of great significance for studying the regulation of orcinol glucoside biosynthesis. Summary of the Invention
[0005] The present invention provides a curculigo orcinol synthase gene CoORS1 and application thereof in the preparation of orcinol. The curculigo orcinol synthase gene CoORS1 can be used as a biosynthesis regulatory gene for orcinol.
[0006] In a first aspect, the present invention provides a Curculigo orcinol synthase gene CoORS1, whose nucleotide sequence is shown in SEQ ID NO: 1, with a total length of 1170 bp. The gene has the activity of catalyzing the synthesis of orcinol from one molecule of acetyl-CoA and three molecules of malonyl-CoA.
[0007] In a second aspect, the present invention provides a protein encoded by the Curculigo orcinol synthase gene CoORS1, which encodes 389 amino acid residues. The amino acid sequence is shown in SEQ ID NO: 2. The gene has the activity of catalyzing the synthesis of orcinol from one molecule of acetyl-CoA and three molecules of malonyl-CoA.
[0008] The third aspect of the present invention further provides a recombinant plasmid containing the Curculigo phenol synthase gene CoORS1.
[0009] Preferably, the recombinant plasmid is obtained by homologous recombination of the Curculigo orchioides phenol synthase gene CoORS1 with the pQE-80L vector, and is named pQE-80L-CoORS1.
[0010] In a fourth aspect, the present invention provides a transgenic engineered bacterium, wherein the transgenic engineered bacterium contains the above-mentioned recombinant plasmid, or the exogenous curculigo phenol synthase gene CoORS1 is integrated into the genome of the genetically engineered bacterium.
[0011] Preferably, the genetically modified bacteria is Escherichia coli M15 strain.
[0012] In a fifth aspect, the present invention further provides the use of the curculigo orcinol synthase gene CoORS1 in the preparation of orcinol.
[0013] Preferably, in the application of the curculigo orcinol synthase gene CoORS1 in the preparation of orcinol, acetyl-CoA and malonyl-CoA are used as raw materials, and orcinol is produced under the catalysis of the protein encoded by the curculigo orcinol synthase gene CoORS1, and the amino acid sequence is shown in SEQ ID NO: 2.
[0014] The Curculigo orchioides phenol synthase gene CoORS1 described in the present invention was identified from the rhizome of Curculigo orchioides through transcriptome sequencing and bioinformatics technology, and after screening after a large number of experiments. The RNA of the rhizome of Curculigo orchioides was extracted using an RNA reagent, and the RNA was reverse transcribed into cDNA and then amplified by PCR.
[0015] Compared with the prior art, the beneficial effects of the present invention are embodied in:
[0016] (1) The rapid development of sequencing technology has greatly advanced the discovery of key enzyme genes in the orcinol biosynthesis pathway. The present invention identifies and successfully validates the orcinol biosynthesis regulatory gene, Curculigo orcinol synthase gene CoORS1, for the first time, opening up a new method for producing orcinol. This invention utilizes heterologous expression and in vitro enzymatic catalysis to obtain the target product for targeted production, offering advantages such as convenience and rapidity.
[0017] (2) The present invention provides a recombinant plasmid, genetically engineered bacteria, and recombinant protein containing the Curculigo orcinol synthase gene CoORS1, which lays a foundation for the large-scale synthesis of orcinol by bioengineering methods, further facilitating the study of the regulation of orcinol glucoside biosynthesis, and can also reduce the difficulties of chemical synthesis and the complexity of the synthesis pathway. The Curculigo orcinol synthase gene CoORS1, as a key gene for the biosynthesis of orcinol glucoside, can also be used in plant breeding research such as Curculigo.
[0018] (3) The orcinol synthase gene CoORS1 isolated and identified from Curculigo in the present invention can be used as an important marker gene for molecular-assisted breeding of Curculigo, and can also be used as an important candidate gene for producing orcinol in the construction of yeast chassis cells. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 Schematic diagram of the biosynthesis pathway of orcinol.
[0020] Figure 2 Schematic diagram of agarose gel electrophoresis of the CoORS1 fragment of the Curculigo orchioides phenol synthase gene; wherein M is a nucleic acid marker; lanes 1 and 2 are the detection results of the CoORS1 fragment of the Curculigo orchioides phenol synthase gene.
[0021] Figure 3 Schematic diagram of the recombinant plasmid pQE-80L-CoORS1.
[0022] Figure 4 This is the SDS-PAGE protein electrophoresis detection diagram of Curculigo phenol synthase CoORS1; wherein, M is the protein molecular weight standard; lane 1 is the protein in the 200mM imidazole eluate before concentration; lane 2 is the protein in the 200mM imidazole eluate after concentration.
[0023] Figure 5 This is a schematic diagram of the HPLC spectrum of the enzymatic activity reaction of the Curculigo phenol synthase gene CoORS1.
[0024] Figure 6 Schematic diagram of the mass spectrometry analysis of the standard substance roquefortol; theoretical molecular weight 123.
[0025] Figure 7 Schematic diagram of mass spectrometry analysis of the reaction products of the experimental group; theoretical molecular weight 123. DETAILED DESCRIPTION
[0026] The present invention is described in further detail below with reference to the embodiments.
[0027] Those skilled in the art will understand that the following examples are intended to illustrate the present invention only and should not be construed as limiting the scope of the present invention. Where specific techniques or conditions are not specified in the examples, the techniques or conditions described in the literature in the art or in the product specifications were used. Materials or equipment used without manufacturer identification are commercially available conventional products. Example 1
[0028] Based on the Unigene functional annotation information of the Curculigo transcriptome and sequencing annotation results, candidate ORS genes were screened. Local BLAST analysis of the sequences was performed, followed by analysis of the screening results, and four potential candidate genes were initially identified. After a series of steps including cloning, homologous recombination, prokaryotic expression, in vitro enzymatic reactions, high-performance liquid chromatography (HPLC), and LC / MC characterization, a target gene was identified that catalyzes the production of orcinol from the substrates acetyl-CoA and malonyl-CoA. This target gene was named Curculigo orcinol synthase CoORS1, and its nucleotide sequence is shown in SEQ ID NO:1.
[0029] The following steps are used for the following operations: reagents, raw materials, instruments and equipment are all commercially available:
[0030] (1) Preparation of cDNA template
[0031] Fresh samples of Curculigo rhizomes were collected and quickly frozen in liquid nitrogen for total RNA extraction. RNA was extracted using the HiPure Plant RNA Mini Kit from Magen, Guangzhou Meiji Biotechnology Co., Ltd., following the kit's protocol. After RNA passed testing, it was reverse-transcribed into cDNA using the TAKARA reverse transcription kit according to the manufacturer's instructions and stored at -80°C until ready for use.
[0032] (2) Target gene cloning
[0033] Using the primer design software CE Design v1.04, primers ORS1-F and ORS1-R were designed to amplify the Curculigo phenol synthase gene CoORS1. Using cDNA as a template, according to the instructions of the high-fidelity KOD enzyme, the primer pair ORS1-F / ORS1-R was used to amplify the Curculigo phenol synthase gene CoORS1 fragment. High-fidelity KOD enzyme was used to clone the Curculigo phenol synthase gene CoORS1. The PCR program was: 94℃, 5min, 94℃, 30S, 58℃, 50S, 72℃, 90s, 35 cycles; 72℃, 7min. After the PCR was completed, gel running was performed for verification. Figure 2After confirming successful amplification, the EasyPure Quick Gel Extraction Kit was used to recover the target band. The recovered band concentration was measured on a NanoReady ultraviolet-visible spectrophotometer and stored in a -20°C refrigerator for later use.
[0034] The primer sequences are as follows:
[0035] ORS1-F:TCGCATCACCATCACCATCACGGATCCATGGGTTCGCTGGGCGATGTGA
[0036] ORS1-R:ACTGTTGTGCTTCGCTGCCCTTAAGGGTCGACCTGCAGCCAAGCTTA
[0037] (3) Construction of recombinant plasmid vector
[0038] E. coli pQE-80L was double-digested with BamHI and SalI to linearize the vector, which was then recovered using the EasyPure Quick Gel Extraction Kit. For homologous recombination, assembly was performed according to the instructions for the homologous recombination enzymes. The dosage of each component was calculated based on the insert and vector concentrations. Finally, all components were added to a PCR reaction tube on ice. The orcinol synthase gene CoORS1 was homologously recombined with the pQE-80L vector to generate a recombinant plasmid. The recombinant expression plasmid was then transformed into competent E. coli M15 cells. After assembly, the cells were plated using LB solid medium supplemented with 100 µg / mL ampicillin and incubated in the dark at 37°C for 12-15 hours. Single colonies were then selected for colony amplification and gel running. Positive clones were then sent to a sequencing company for final confirmation. After successful assembly, the bacteria were maintained to obtain the recombinant expression vector of Curculigo orchioides phenol synthase gene CoORS1, named pQE-80L-CoORS1. Figure 3 .
[0039] Table 1 Candidate gene recombination reaction system
[0040]
[0041] Where X = (0.02 × pQE-80L base pairs) ng / linearized pQE-80L concentration ng / µL; Y = (0.02 × pQE-80L base pairs) ng / recovery concentration of Curculigo phenol synthase gene CoORS1 ng / µL;
[0042] (4) Protein expression and purification
[0043] After a small-scale protein expression test, the induction conditions for the Curculigo phenol synthase gene CoORS1 were determined to be: 16°C, 0.1mM IPTG, 210 rpm, and induction for 14 hours. The recombinant expression strain was then shaken vigorously. When the OD value reached between 0.6 and 0.8, IPTG was added to a final concentration of 0.1mM. The mixture was then shaken in an incubator at 16°C, 210 rpm, and induced for 14 hours. The cells were then harvested by centrifugation at 5000 rpm for 15 minutes at 4°C. The centrifuged bacteria were fully resuspended in Tris-HCl buffer (pH: 8.0, 50mM Tris, 200mM NaCl) and then disrupted using a cell disruptor. The disrupted bacteria were centrifuged at 8000rpm for 30min at 4°C and the supernatant was taken. The supernatant was purified using nickel column Ni NTA beads. The nickel column was first balanced with two column volumes of Tris-HCl (pH: 8.0, 50mM Tris, 200mM NaCl), and then washed with Tris-HCl buffer (pH: 8.0, 50mM Tris, 200mM NaCl) containing 20mM, 40mM, 60mM, 80mM, and 100mM imidazole, respectively, to remove impurities. The beads were then washed with Tris-HCl (pH: 8.0, 50mM Tris, 200mM NaCl) containing 200mM imidazole. NaCl was used to elute the target protein, and after purification, the protein was concentrated using a Millipore ultrafiltration tube to obtain pure enzyme. Figure 4 .
[0044] (5) Enzyme activity verification
[0045] The enzymatic activity of the CoORS1 gene, a phenol synthase gene from Curculigo orcinol, was determined by synthesizing orcinol through a polyketide reaction in a 1.5 mL centrifuge tube in a total volume of 100 µL. In the experimental group, the reaction mixture contained 1 mM acetyl-CoA, 3 mM malonyl-CoA, and 10 µg of purified CoORS1 protein. Tris-HCl buffer (pH 8.0, 50 mM Tris, 200 mM NaCl) was added to a total volume of 100 µL. The mixture was incubated at 30°C for 2 hours, terminated with an equal volume of methanol, and centrifuged at 12,000 rpm for 2 minutes. The supernatant was collected and analyzed by HPLC and LC-MS.
[0046] The CK reaction system of the control group: 1mM acetyl-CoA, 3mM malonyl-CoA, 10µg inactivated purified curculigo phenol synthase CoORS1 protein, added with Tris-HCl buffer, pH: 8.0, 50mM Tris, 200mM NaCl, to a total volume of 100µL.
[0047] Orcinol standard: 50µL of 10mM orcinol standard.
[0048] (6) Product testing
[0049] The products were detected by HPLC and LC / MS respectively.
[0050] The HPLC detection method is as follows:
[0051] The liquid chromatography column was an Agilent ZORBAX SB-C18 column, 250 × 4.6 mm, 5.0 μm. The mobile phase consisted of 0.1% formic acid in water (A) and acetonitrile (B). The gradient elution program was as follows: 7% B (0–7 min); 17% B (17 min); 95% B (20 min); 7% B (25 min); and 7% B (30 min). Wavelength: 275 nm. Flow rate: 1 mL / min. Column temperature: 30°C. Sample injection volume: 10 μL. HPLC analysis results are shown in Table 1. Figure 5 , indicating that the samples in the experimental group produced orcinol under the catalysis of curculigo orcinol synthase CoORS1.
[0052] The LC / MS detection method is as follows:
[0053] In order to further confirm that the obtained product is orcinol, an Agilent Q-TOF 6540 liquid chromatography-mass spectrometer LC / MS was used for detection, and the detection method was as follows:
[0054] Mass spectrometry conditions: the ion source was in negative ion mode, voltage: 3500 V; fragmentor voltage: 175 V; cone voltage: 65 V; radio frequency voltage: 750 V; scanning range: 50-1700 m / z.
[0055] The liquid chromatography column was an Agilent ZORBAX SB-C18 column, 250 × 4.6 mm, 5.0 μm. The mobile phase consisted of 0.1% formic acid in water (A) and acetonitrile (B). The gradient elution program was as follows: 0–7 min, 7% B; 17 min, 17% B; 20 min, 95% B; 25 min, 7% B; 30 min, 7% B. Wavelength: 275 nm. Flow rate: 1 mL / min. Column temperature: 30°C. Sample injection volume: 10 μL. As shown in the test results, Figure 5-6 It can be seen that the characteristic fragment ions of the product are consistent with those of the standard orcinol, confirming that the reaction product is orcinol. Finally, it was concluded that the orcinol synthase gene CoORS1 in Curculigo orcinol has the ability to catalyze the production of orcinol.
[0056] The basic principles, main features, and advantages of the present invention are shown and described above. Those skilled in the art should understand that the present invention is not limited to the foregoing embodiments. The foregoing embodiments and descriptions are merely illustrative of the principles of the present invention. Various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention. Such changes and modifications are intended to fall within the scope of the present invention. The scope of protection claimed in the present invention is defined by the appended claims and their equivalents. <110> Yunnan Agricultural University <120> Curculigo orcinol synthase gene CoORS1 and its application in the preparation of orcinol <130> 20220412 <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 1170 <212> DNA <213> Curculigo orchioides Gaertn <400> 1 atgggctctc tgggtgatgt cattccgcga caggagaagg ctgccggtat ggctgccgta 60 ttaggaatcg gtactgccac ccctccctat gtggtcgagc agtcgagttt ccccgactac 120 tactttcggg ttaccaatag cgagcacatg tctgagctta agcacaagtt catcagactg 180 tgtgacaagt ccaagatccg aaagcgtcat atgtgcctga cggaacagat gctggctgaa 240 aaccccagca tggccgccta cagagctcct tccttggacg cacggcaaga gctgctcgac 300 gttgaggtcc cccgactcgg tgctgaggct gcagaaaagg ccattgccga ctggggccgt 360 cccaagagcg atctcacaca tctgattttc tgctcctcag gaggcgcctc tatgcctggt 420 gccgattacg acctcatcaa gctgctggat ttgccgctat caatccgtcg attcatgctc 480 taccagcagg gctgtttcgg tggcggcaca gtcctgcgac tcgcgaagga cctggcggag 540 aacaactatg gagctcgaat actggtcatc tgctgtgagg tgacctccat cggattccga 600 ggtccctgcg aagaccacat tgagaatctg gtgggacaag ctctgtttgg agatggtgct 660 tcggccgtcg tggtgggggc tgaccccgtg gccgcagctg cagagcgacc tctatttgag 720 atcgtttctg cgagtcagaa cattcttcct ggctcagatg gagccattgt cgggaaactt 780 cgggaggtgg gtctcatgtt ttccctccag cccgagattc cccagcacgt gtcgagatct 840 gtcgaaaaac ttgtgggtga agccctgcgg ccagttggta tcaccgactg gaacgacgcc 900 ttctgggttg tccatccagg aggacgcgcc attgtcgatg aggttggcaa gaagctcggc 960 ttgagggacg agaaacttgc tgccactcgc gaagttttgt ctgagtacgg aaacatgtgg 1020 tccgcgtgcg ttctttttgt gatggaagtc atgcgacgac gctcggagga gagaggcatg 1080 gagacggccg gcgagggcct ccagtgggga gtgctgttcg gctttggccc tggactcacc 1140 gctgaaactg tggtgcttcg atgtccttga 1170 <210> 2 <211> 389 <212> PRT <213> Curculigo orchioides Gaertn <400> 2 Met Gly Ser Leu Gly Asp Val Ile Pro Arg Gln Glu Lys Ala Ala Gly 1 5 10 15 Met Ala Ala Val Leu Gly Ile Gly Thr Ala Thr Pro Pro Tyr Val Val 20 25 30 Glu Gln Ser Ser Phe Pro Asp Tyr Tyr Phe Arg Val Thr Asn Ser Glu 35 40 45 His Met Ser Glu Leu Lys His Lys Phe Ile Arg Leu Cys Asp Lys Ser 50 55 60 Lys Ile Arg Lys Arg His Met Cys Leu Thr Glu Gln Met Leu Ala Glu 65 70 75 80 Asn Pro Ser Met Ala Ala Tyr Arg Ala Pro Ser Leu Asp Ala Arg Gln 85 90 95 Glu Leu Leu Asp Val Glu Val Pro Arg Leu Gly Ala Glu Ala Ala Glu 100 105 110 Lys Ala Ile Ala Asp Trp Gly Arg Pro Lys Ser Asp Leu Thr His Leu 115 120 125 Ile Phe Cys Ser Ser Gly Gly Ala Ser Met Pro Gly Ala Asp Tyr Asp 130 135 140 Leu Ile Lys Leu Leu Asp Leu Pro Leu Ser Ile Arg Arg Phe Met Leu 145 150 155 160 Tyr Gln Gln Gly Cys Phe Gly Gly Gly Thr Val Leu Arg Leu Ala Lys 165 170 175 Asp Leu Ala Glu Asn Asn Tyr Gly Ala Arg Ile Leu Val Ile Cys Cys 180 185 190 Glu Val Thr Ser Ile Gly Phe Arg Gly Pro Cys Glu Asp His Ile Glu 195 200 205 Asn Leu Val Gly Gln Ala Leu Phe Gly Asp Gly Ala Ser Ala Val Val 210 215 220 Val Gly Ala Asp Pro Val Ala Ala Ala Ala Glu Arg Pro Leu Phe Glu 225 230 235 240 Ile Val Ser Ala Ser Gln Asn Ile Leu Pro Gly Ser Asp Gly Ala Ile 245 250 255 Val Gly Lys Leu Arg Glu Val Gly Leu Met Phe Ser Leu Gln Pro Glu 260 265 270 Ile Pro Gln His Val Ser Arg Ser Val Glu Lys Leu Val Gly Glu Ala 275 280 285 Leu Arg Pro Val Gly Ile Thr Asp Trp Asn Asp Ala Phe Trp Val Val 290 295 300 His Pro Gly Gly Arg Ala Ile Val Asp Glu Val Gly Lys Lys Leu Gly 305 310 315 320 Leu Arg Asp Glu Lys Leu Ala Ala Thr Arg Glu Val Leu Ser Glu Tyr 325 330 335 Gly Asn Met Trp Ser Ala Cys Val Leu Phe Val Met Glu Val Met Arg 340 345 350 Arg Arg Ser Glu Glu Arg Gly Met Glu Thr Ala Gly Glu Gly Leu Gln 355 360 365 Trp Gly Val Leu Phe Gly Phe Gly Pro Gly Leu Thr Ala Glu Thr Val 370 375 380 Val Leu Arg Cys Pro 385
Claims
1. A Curculigo phenol synthase gene CoORS1, characterized in that: The gene has a nucleotide sequence shown in SEQ ID NO:
1.
2. The protein encoded by the Curculigo phenol synthase gene CoORS1 according to claim 1, characterized in that: The encoded protein has the amino acid sequence shown in SEQ ID NO:
2.
3. The recombinant plasmid of Curculigo phenol synthase gene CoORS1 according to claim 1, characterized in that: The recombinant plasmid contains the gene.
4. The recombinant plasmid of Curculigo linalool synthase gene CoORS1 according to claim 3, characterized in that: The recombinant plasmid is obtained by homologous recombination of the Curculigo orchioides synthase gene CoORS1 and the pQE-80L vector and is named pQE-80L-CoORS1.
5. A transgenic engineered bacterium prepared by a recombinant plasmid of the Curculigo phenol synthase gene CoORS1 according to claim 3 or 4, characterized in that: The genetically modified engineered bacteria contains the recombinant plasmid according to claim 3 or 4.
6. The transgenic engineering bacteria prepared by the recombinant plasmid of the Curculigo phenol synthase gene CoORS1 according to claim 5, characterized in that: The exogenous Curculigo orchioides synthase gene CoORS1 according to claim 1 is integrated into the genome.
7. The transgenic bacteria prepared by the recombinant plasmid of the Curculigo phenol synthase gene CoORS1 according to claim 5, characterized in that: The genetically modified bacteria is Escherichia coli M15 strain.
8. The use of the protein encoded by the Curculigo phenol synthase gene CoORS1 according to claim 2, characterized in that: The encoded protein is used in the preparation of orcinol.
9. The use of the protein encoded by the Curculigo phenol synthase gene CoORS1 according to claim 8, characterized in that: Acetyl-CoA and malonyl-CoA are used as raw materials to produce orcinol under the catalysis of the protein encoded by the curculigo orcinol synthase gene CoORS1.