A method for increasing panicle type and / or yield in rice
By overexpressing the cystathionine β-lyase gene OsCBL in rice plants and transferring it into a recombinant vector using Agrobacterium-mediated transformation, the problems of insufficient main panicle length, number of secondary branches in the main panicle, and number of grains in rice were solved, resulting in a significant increase in rice yield.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SOUTH CHINA AGRICULTURAL UNIVERSITY
- Filing Date
- 2022-07-25
- Publication Date
- 2026-04-28
AI Technical Summary
Existing technologies are insufficient to effectively increase the length of the main panicle, the number of secondary branches on the main panicle, and the number of grains on the main panicle, thus limiting the increase in rice yield.
By overexpressing the cystathionine β-lyase gene OsCBL, the recombinant vector was transferred into rice plants using Agrobacterium-mediated transformation, thereby increasing the length of the main panicle, the number of secondary branches on the main panicle, and the number of grains on the main panicle.
It significantly increased the number of grains per panicle and the yield per plant in rice, providing new genetic resources and ideas for rice yield-increasing breeding.
Smart Images

Figure CN116286959B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, specifically to a method for increasing the length of the main panicle of rice, the number of secondary branches of the main panicle, the number of grains on the main panicle of rice, and / or increasing rice yield. Background Technology
[0002] Rice (Oryza sativa L.) is an annual grass plant, an important economic crop and a major food crop in Asia, so increasing rice yield is of great significance.
[0003] Rice yield is influenced by both intrinsic factors such as genetics and extrinsic factors such as climate and management practices. Among these factors, genetics is one of the key determinants of rice yield. The panicle type and grain development of rice are regulated by multiple genes, determining yield. Larger panicles produce more primary and secondary branches, resulting in more seeds and increased yield. Identifying the genes involved in rice panicle type and grain development is of great significance and can provide new ideas and methods for breeding. Summary of the Invention
[0004] The purpose of this invention is to overcome the above-mentioned deficiencies of the prior art and provide a method for increasing the length of the main panicle of rice, the number of secondary branches of the main panicle, the number of grains on the main panicle of rice, and / or increasing rice yield.
[0005] The first objective of this invention is to provide a method for increasing the length of the main panicle of rice, the number of secondary branches of the main panicle, the number of grains on the main panicle of rice, and / or increasing rice yield.
[0006] A second objective of this invention is to provide the application of the CDS coding sequence of the cystathionine β-lyase gene OsCBL with a nucleotide sequence as shown in SEQ ID NO: 2 and / or the amino acid sequence of the cystathionine β-lyase OsCBL as shown in SEQ ID NO: 3.
[0007] A third objective of this invention is to provide an application of a recombinant vector and / or recombinant strain in increasing the length of the main panicle, the number of secondary branches of the main panicle, the number of grains on the main panicle, and / or improving rice yield.
[0008] To achieve the above objectives, the present invention is implemented through the following solution:
[0009] This invention seeks to protect the application of the CDS coding sequence of the cystathionine β-lyase gene OsCBL with nucleotide sequences as shown in SEQ ID NO: 2 and / or the amino acid sequence of cystathionine β-lyase OsCBL with nucleotide sequences as shown in SEQ ID NO: 3 in increasing the length of the main panicle in rice.
[0010] This invention seeks to protect the application of the CDS coding sequence of the cystathionine β-lyase gene OsCBL with nucleotide sequences as shown in SEQ ID NO: 2 and / or the amino acid sequence of cystathionine β-lyase OsCBL with amino acid sequences as shown in SEQ ID NO: 3 in increasing the number of secondary branches in the main panicle of rice.
[0011] This invention seeks to protect the application of the CDS coding sequence of the cystathionine β-lyase gene OsCBL with nucleotide sequences as shown in SEQ ID NO: 2 and / or the amino acid sequence of cystathionine β-lyase OsCBL with amino acid sequences as shown in SEQ ID NO: 3 in increasing the number of grains on the main panicle of rice.
[0012] This invention seeks to protect the application of the CDS coding sequence of the cystathionine β-lyase gene OsCBL with nucleotide sequences as shown in SEQ ID NO: 2 and / or the amino acid sequence of cystathionine β-lyase OsCBL with SEQ ID NO: 3 in increasing rice yield.
[0013] A method for increasing the length of the main panicle, the number of secondary branches of the main panicle, the number of grains on the main panicle, and / or increasing rice yield, wherein the method is to overexpress the cystathionine β-lyase gene OsCBL.
[0014] Preferably, the specific method for overexpressing the cystathionine β-lyase gene OsCBL is to ligate the CDS coding sequence of the cystathionine β-lyase gene OsCBL, whose nucleotide sequence is shown in SEQ ID NO: 2, into a pOX vector to obtain a recombinant vector, and to transfer the recombinant vector into rice plants using Agrobacterium-mediated transformation to obtain transgenic plants. The pOX vector is obtained by replacing the Camv35S promoter of the pCAMBIA1300 vector with the polyubiquitin (GI: 248336) promoter (1993bp), and the multiple cloning site sequence of this vector is shown in SEQ ID NO: 11.
[0015] The specific nucleotide sequence is shown below:
[0016] SEQ ID NO 11:
[0017] GTTTGGTGTTACTTCTGCAGGGTACCGGCGCGCCAAGATTACTAGTACGCGTTATGGATCCTATCA.
[0018] More preferably, the specific method for transferring the recombinant vector into rice plants using Agrobacterium-mediated transformation to overexpress the cystathionine β-lyase gene OsCBL is as follows: the recombinant plasmid is transferred into Escherichia coli for amplification and propagation to obtain positive recombinant bacteria, and the recombinant plasmid is extracted, transferred into Agrobacterium, and the recombinant strain is obtained. The recombinant strain is then used to infect the callus tissue of rice plants for co-culture, screened on a selection medium containing hygromycin, and transferred to pre-differentiation medium and differentiation medium for culture.
[0019] More preferably, the Escherichia coli is Escherichia coli strain DH5α.
[0020] More preferably, the Agrobacterium is Agrobacterium strain EHA105.
[0021] More preferably, qRT-PCR is used to screen transgenic plants.
[0022] More preferably, qRT-PCR detection is performed using detection primers with nucleotide sequences as shown in SEQ ID NO: 7 and SEQ ID NO: 8.
[0023] In another preferred step, qRT-PCR detection is performed using internal reference primers with nucleotide sequences as shown in SEQ ID NO: 9 and SEQ ID NO: 10.
[0024] The specific nucleotide sequence is shown below:
[0025] OsCBL-OX-qPCRF (SEQ ID NO: 7):
[0026] 5'-TGGCACCATTTGATTGCTGG-3';
[0027] OsCBL-OX-qPCRR (SEQ ID NO: 8):
[0028] 5'-GCTCCCTTTGCCTGGGAATA-3';
[0029] UBQ1-qF (SEQ ID NO: 9):
[0030] 5'-TGAAGACCCTGACTGGGAAG-3';
[0031] UBQ1-qR (SEQ ID NO: 10):
[0032] 5'-CACGGTTCAACAACATCCAG-3'.
[0033] Compared with the prior art, the present invention has the following beneficial effects:
[0034] This invention provides a method for increasing the length of the main panicle, the number of secondary branches on the main panicle, the number of grains on the main panicle, and / or improving rice yield. The method involves overexpressing the cystathionine β-lyase gene OsCBL in rice using a recombinant vector containing the CDS coding sequence of the cystathionine β-lyase gene OsCBL (nucleotide sequence as shown in SEQ ID NO: 2) via Agrobacterium-mediated transformation, thereby obtaining transgenic plants. Compared to normal plants, the transgenic plants obtained by this method show an increased number of grains per panicle and a significantly increased yield per plant. Using this method to treat rice plants can increase rice yield, providing new genetic resources and ideas for rice yield-increasing breeding. Attached Figure Description
[0035] Figure 1 Map of the recombinant vector pOX-OsCBL that overexpresses the cystathionine β-lyase gene OsCBL;
[0036] Figure 2 Figure 1 shows the qRT-PCR results of OsCBL in the leaves of different rice strains.
[0037] Figure 3 The following are the statistical results of the phenotypic analysis: a: Statistical chart of the length of the main spike of ZH11, OX1, and OX11; b: Statistical chart of the number of branches on the main spike of ZH11, OX1, and OX11; c: Statistical chart of the number of grains on the main spike of ZH11, OX1, and OX11; d: Statistical chart of the yield per plant of ZH11, OX1, and OX11. Detailed Implementation
[0038] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.
[0039] Example 1: Construction, transformation, and extraction of recombinant vectors and recombinant plasmids
[0040] 1. Experimental Methods
[0041] Upstream and downstream primers were designed based on the mRNA reference sequence (XM_015785911.2) of the cystathionine β-lyase gene OsCBL in NCBI.
[0042] The nucleotide sequence of the cystathionine β-lyase gene OsCBL is shown in SEQ ID NO: 1;
[0043] The nucleotide sequence of the CDS encoding sequence of the cystathionine β-lyase gene OsCBL is shown in SEQ ID NO: 2;
[0044] The amino acid sequence of cystathionine β-lyase OsCBL is shown in SEQ ID NO: 3.
[0045] The specific nucleotide sequences of the upstream and downstream primers are shown below:
[0046] Upstream primer OsCBL-OXF (SEQ ID NO: 4):
[0047] 5'-AAAAGGTACCACAAAATCCACTCCCGCTTC-3';
[0048] Downstream primer OsCBL-OXR (SEQ ID NO: 5):
[0049] 5'-AAAAGGATCCTTATTCCCTCGATGACACAGC-3'.
[0050] The DNA fragment encoding the CDS sequence of the cystathionine β-lyase gene OsCBL was amplified by PCR, and the pOX-OsCBL recombinant vector was constructed by enzyme digestion and ligation. The specific steps are as follows:
[0051] (1) Amplification of DNA fragments
[0052] mRNA was extracted from the japonica rice variety Zhonghua 11 (Oryza Sativa L.subsp. Japonica zhonghua 11, ZH11) and reverse transcribed into cDNA to obtain the cDNA of ZH11.
[0053] The DNA fragment of the CDS coding sequence (SEQ ID NO: 2) of the cystathionine β-lyase gene OsCBL was amplified using the high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase (catalog number: P505-d1) from Novizan. The upstream primer for PCR was OsCBL-OXF (SEQ ID NO: 4), and the downstream primer was OsCBL-OXR (SEQ ID NO: 5). The specific nucleotide sequences are shown below.
[0054] Upstream primer OsCBL-OXF (SEQ ID NO: 4):
[0055] 5'-AAAAGGTACCACAAAATCCACTCCCGCTTC-3';
[0056] Downstream primer OsCBL-OXR (SEQ ID NO: 5):
[0057] 5'-AAAAGGATCCTTATTCCCTCGATGACACAGC-3'.
[0058] The PCR reaction system is shown in Table 1.
[0059] Table 1. Reaction system for amplifying the DNA fragment encoding the CDS coding sequence of the cystathionine β-lyase gene OsCBL.
[0060]
[0061] PCR reaction procedure: pre-denaturation (95℃, 3 min); denaturation (95℃, 15 s), annealing (56-60℃, 15 s), extension (72℃, 90 s); 35 cycles, followed by complete extension (72℃, 5 min), and then hold at 16℃.
[0062] The PCR product is the amplification product containing the CDS coding sequence of the cystathionine β-lyase gene OsCBL.
[0063] (2) Purification of amplification products
[0064] The amplification product obtained from the PCR amplification in step (1) was purified using Magen's DNA Purification and Recovery Kit (catalog number: D2110-03). The specific steps are as follows:
[0065] Prepare an agarose gel with a concentration of 0.8% to 1%, and separate DNA fragments by electrophoresis. After the DNA fragments are separated, place the gel under a UV lamp and cut off the gel containing the target DNA fragment.
[0066] Weigh the gel and transfer it to a centrifuge tube. Calculate the gel ratio as 1 mg gel = 1 μL gel. Add Buffer GDP to the centrifuge tube at a ratio of gel:Buffer GDP = 1:2 (v / v). Incubate the centrifuge tube in a water bath at 50–55°C until the gel is completely dissolved. Centrifuge the tube and collect the droplets on the tube wall to obtain the sol solution.
[0067] Insert the DNA purification column into a 2 mL centrifuge tube, transfer the sol solution into the DNA purification column, centrifuge the tube at 8000×g for 30–60 s, discard the filtrate to obtain the remaining sol solution, insert the DNA purification column back into the 2 mL centrifuge tube, transfer the remaining sol solution into the DNA purification column, and centrifuge the tube at 8000×g for 30–60 s.
[0068] After centrifugation, discard the filtrate, reattach the DNA purification column to the 2mL centrifuge tube, add 500μL of Buffer DW2 to the DNA purification column (HiPureDNAMicro Column), centrifuge at 8000×g for 30–60 seconds, and discard the filtrate. Repeat this step once.
[0069] Reinsert the DNA purification column into a 2 mL centrifuge tube, centrifuge at 10000×g for 2 min, discard the filtrate, insert the DNA purification column into a 1.5 mL centrifuge tube, and add Elution Buffer to the center of the DNA purification column membrane.
[0070] After allowing the DNA purification column to stand for 2 minutes, centrifuge at 10000×g for 1 minute, discard the filtrate, and obtain the purified amplification product. Store at -20℃ for later use.
[0071] (3) Extraction of pOX vector
[0072] The pOX vector was extracted using a Magen plasmid extraction kit (catalog number: P1001-03). The pOX vector was created by replacing the Camv35S promoter of the pCAMBIA1300 vector with a polyubiquitin (GI: 248336) promoter (1993 bp). The multiple cloning site sequence of this vector is shown in SEQ ID NO: 11. The specific nucleotide sequence is shown below:
[0073] SEQ ID NO 11:
[0074] GTTTGGTGTTACTTCTGCAGGGTACCGGCGCGCCAAGATTACTAGTACGCGTTATGGATCCTATCA.
[0075] The specific steps are as follows:
[0076] Centrifuge the bacterial culture containing pOX vector activation at 10000×g for 1 min, discard the culture medium, and pat the culture onto absorbent paper to remove any remaining liquid. Add 250 μL of a mixture of Buffer P1 and RNase A to the bacterial cells, vortex to resuspend the bacteria, add 250 μL of Buffer P2 to the resuspended culture, invert to mix, then add another 250 μL of Buffer P2 and invert to mix.
[0077] When the solution becomes viscous and clear, add 350 μL of Buffer P3 to the solution, mix by inversion, and centrifuge at 13000–16000 × g for 2 min. Place the DNA purification column (Hipure DNA Mini Column II) in the collection tube, transfer the supernatant after centrifugation to the DNA purification column, and centrifuge at 13000 × g for 30–60 s.
[0078] Discard the filtrate, reattach the DNA purification column to the collection tube, add 600 μL of Buffer PW2 to the DNA purification column, centrifuge at 13000×g for 30–60 s, and discard the filtrate. Repeat this step once.
[0079] Replace the DNA purification column back into the collection tube and centrifuge at 13000×g for 3 min.
[0080] After centrifugation, remove the DNA purification column and place it in a sterile 1.5 mL centrifuge tube. Add Elution Buffer to the center of the DNA purification column membrane.
[0081] After allowing the DNA purification column to stand for 2 minutes, centrifuge at 13000×g for 1 minute, discard the filtrate, and obtain the pOX vector, which is stored at -20℃ for later use.
[0082] (4) Enzyme digestion and ligation of pOX vector and amplification product
[0083] The purified amplified product obtained in step (2) and the pOX vector obtained in step (3) were digested with restriction endonucleases (KpnI and BamHI). The digestion reaction system of the pOX vector is shown in Table 2, and the reaction system of the purified amplified product is shown in Table 3.
[0084] Table 2 Enzyme digestion reaction system
[0085]
[0086] The enzyme digestion conditions were: digestion at 37℃ for 4 hours. Electrophoresis was performed after the pOX vector digestion reaction was completed.
[0087] Table 3 Enzyme digestion reaction system
[0088]
[0089]
[0090] The enzyme digestion reaction conditions were: digestion at 37℃ for 4 hours.
[0091] The enzyme digestion products were recovered using Magen's DNA Purification and Recovery Kit (catalog number: D2110-03) to obtain linearized pOX vector and enzyme digestion products of purified amplified products.
[0092] (5) Ligation of the linearized pOX vector and the enzyme digestion products of the purified amplification product.
[0093] The linearized pOX vector obtained in step (4) and the enzyme digestion product of the purified amplification product were ligated using ligase (T4 DNA Ligase, catalog number: #M0202V). The ligation reaction system is shown in Table 4.
[0094] Table 4 Connection Reaction System
[0095]
[0096] The molar ratio of the purified amplified product to the enzyme digestion product and the linearized pOX vector was 1:3.
[0097] After mixing the substances in the ligation reaction system in Table 4, incubate at 16℃ for 30 min. After incubation, collect the reaction solution for later use. This yields the enzyme digestion product of the purified amplification product and the ligation product of the linearized pOX vector, namely the recombinant vector pOX-OsCBL.
[0098] (6) Transformation and identification of Escherichia coli
[0099] Transformation of E. coli:
[0100] Add the enzyme digestion product of the purified amplification product obtained in step (5) and the ligation product of the linearized pOX vector to competent E. coli cells, mix well, place on ice for 30 min, then heat shock in a 42℃ water bath for 90 s, after heat shock, transfer to an ice bath and let stand for 2 min.
[0101] Next, 500 μL of antibiotic-free sterile culture medium LB was added to the centrifuge tube, the bacterial solution was mixed, and the bacteria were revived at 37°C and 110 rpm for 1 hour to obtain the transformed Escherichia coli.
[0102] Identification of positive clones:
[0103] The revived bacterial culture was evenly spread on solid LB medium containing kanamycin, and the plates were inverted and incubated overnight at 37°C.
[0104] After overnight culture, single clones were selected and cultured in 500 μL of LB medium containing kanamycin at 37°C and 200 rpm for 3–5 h. The culture medium was used as a PCR template for PCR reaction. The upstream primer for PCR was POX-F (SEQ ID NO: 6), and the downstream primer was OsCBL-OXR (SEQ ID NO: 5). The specific nucleotide sequences are shown below.
[0105] Upstream primer POX-F (SEQ ID NO: 6):
[0106] 5'-GCTTGGTTGTGATGATGTGG-3';
[0107] Downstream primer OsCBL-OXR (SEQ ID NO: 5):
[0108] 5'-AAAAGGATCCTTATTCCCTCGATGACACAGC-3'.
[0109] The PCR reaction system (20 μL) for positive clone identification is shown in Table 5.
[0110] Table 5. PCR reaction system for identifying positive clones
[0111]
[0112] PCR reaction procedure: pre-denaturation (98℃, 3 min); denaturation (98℃, 10 s), annealing (56–72℃, 10 s), extension (72℃, 5–15 s / kb); 35 cycles, followed by complete extension (72℃, 2 min), and then hold at 16℃.
[0113] PCR product 1 was obtained and subjected to electrophoresis. PCR products with positive electrophoresis results were selected and sent to the Guangzhou branch of Beijing Qingke Xinyue Biotechnology Co., Ltd. for further sequencing verification. PCR product 1 with correct sequencing (consistent with CDS coding sequence SEQ ID NO: 2) was amplified and shaken to preserve the bacterial culture and extract plasmids to obtain the recombinant plasmid pOX-OsCBL.
[0114] 2. Experimental Results
[0115] The map of the recombinant vector pOX-OsCBL overexpressing the cystathionine β-lyase gene OsCBL is shown below. Figure 1 As shown.
[0116] Example 2: Cultivation and Identification of Transgenic Rice Plants
[0117] 1. Experimental Methods
[0118] (1) Agrobacterium-mediated genetic transformation of rice plants
[0119] The recombinant plasmid pOX-OsCBL obtained in Example 1 was transformed into Agrobacterium strain EHA105. Then, callus tissue from wild-type rice ZH11 plants was infected with Agrobacterium strain EHA105 and co-cultured. Resistant callus tissue was screened on a hygromycin-containing selection medium and then transferred to pre-differentiation and differentiation media for cultivation until seedlings emerged. After seedling emergence, they were hardened off in a rooting and seedling strengthening medium and then planted in a net-covered greenhouse, resulting in 12 transgenic rice plant lines, numbered OX1–OX11 and OX14.
[0120] (2) Identification of transgenic rice plants
[0121] RNA was extracted from leaves of wild-type rice plant ZH11 and the transgenic plant obtained in step (1), and the expression level of OsCBL in rice plants was detected by qRT-PCR. The specific steps are as follows:
[0122] ① RNA extraction from wild-type rice plant ZH11 and the transgenic plant obtained in step (1)
[0123] For example, RNA extraction from wild-type rice plant ZH11: The plant leaf tissue of wild-type rice plant ZH11 was ground into a fine powder using liquid nitrogen. 50-300 mg of the powder was weighed into a 1.5 mL pre-cooled centrifuge tube. 800 μL of Buffer RL was added to the centrifuge tube. The tube was vortexed at high speed for 15-30 s and then allowed to stand at room temperature for 3 min.
[0124] Then, centrifuge at 14000×g for 5 min at room temperature, collect the supernatant, place the gDNA filter column in a 2 mL collection tube, transfer the supernatant after centrifugation to the gDNA filter column, centrifuge at 14000×g for 2 min, collect the filtrate, and discard the gDNA filter column.
[0125] Add 350 μL of anhydrous ethanol to the filtrate and pipette 3–5 times to obtain a mixture. Place a HiPure RNA Mini Column into a 2 mL collection tube, transfer 700 μL of the mixture to the RNA purification column, centrifuge at 12000 × g for 30–60 s, discard the filtrate, and reassemble the RNA purification column into the collection tube. Repeat this step once.
[0126] Then add 500 μL of Buffer RW1 to the RNA purification column, centrifuge at 10000×g for 30–60 s, discard the filtrate, and put the RNA purification column back into the collection tube.
[0127] Add 500 μL of Buffer RW2 to the RNA purification column, centrifuge at 12000×g for 30–60 s, and discard the filtrate. Repeat this step once.
[0128] Discard the filtrate, put the RNA purification column back into the collection tube, centrifuge at 12000×g for 2 min, and discard the filtrate.
[0129] Transfer the RNA purification column to a 1.5 mL centrifuge tube and add RNase-free water to the center of the membrane of the RNA purification column.
[0130] After allowing the RNA purification column to stand for 2 minutes, centrifuge at 12000×g for 1 minute, discard the filtrate, and obtain the RNA from wild-type rice plant ZH11. Store at -80℃ for later use.
[0131] RNA was extracted from 12 transgenic rice plant lines after they were treated in the same way.
[0132] ②Reverse transcription synthesis of cDNA
[0133] Taking the RNA from wild-type rice plant ZH11 obtained in step ① as an example: cDNA was synthesized by reverse transcription using the Nanjing Novizan Vazyme reverse transcription kit (catalog number: R212-02). The specific steps are as follows:
[0134] Prepare the mixtures shown in Table 6 in RNase-free centrifuge tubes.
[0135] Table 6 Composition of the Mixture
[0136]
[0137]
[0138] Add the substances described in Table 6 to an RNase-free centrifuge tube, mix thoroughly with a pipette, and react at 42°C for 2 minutes to obtain a mixture.
[0139] Add 2 μL of 10×RT Mix and 2 μL of HiScript II Enzyme Mix to the mixture, mix well by pipetting, react at 50℃ for 15 min, and then react at 85℃ for 2 min. The reaction product is the cDNA of wild-type rice plant ZH11.
[0140] The RNA extracted from the 12 transgenic rice plant lines was treated in the same way to obtain the cDNA of the 12 transgenic rice plant lines.
[0141] ③ qPCR reaction of cDNA
[0142] Taking the cDNA of wild-type rice plant ZH11 obtained in step ② as an example: qRT-PCR was performed. The upstream primer for the qRT-PCR reaction of OsCBL was OsCBL-OX-qPCRF (SEQ ID NO: 7), and the downstream primer was OsCBL-OX-qPCRR (SEQ ID NO: 8). The upstream primer for the qRT-PCR reaction of the internal reference gene Ubiquitin was UBQ1-qF (SEQ ID NO: 9), and the downstream primer was UBQ1-qR (SEQ ID NO: 10).
[0143] The specific nucleotide sequences of the primers are shown below:
[0144] OsCBL-OX-qPCRF (SEQ ID NO: 7):
[0145] 5'-TGGCACCATTTGATTGCTGG-3';
[0146] OsCBL-OX-qPCRR (SEQ ID NO: 8):
[0147] 5'-GCTCCCTTTGCCTGGGAATA-3';
[0148] UBQ1-qF (SEQ ID NO: 9):
[0149] 5'-TGAAGACCCTGACTGGGAAG-3';
[0150] UBQ1-qR (SEQ ID NO: 10):
[0151] 5'-CACGGTTCAACAACATCCAG-3'.
[0152] The qRT-PCR reaction system for OsCBL is shown in Table 7.
[0153] Table 7. qRT-PCR reaction system for OsCBL
[0154]
[0155]
[0156] The qRT-PCR reaction system for the internal reference gene Ubiquitin is shown in Table 8.
[0157] Table 8. qRT-PCR reaction system for the internal reference gene Ubiquitin
[0158]
[0159] qRT-PCR reaction program: pre-denaturation (95℃, 5 min, 1 cycle); cyclic reaction (95℃, 10 s, 60℃, 30 s, 40 cycles); melting curve (95℃, 15 s, 60℃, 60 s, 95℃, 15 s, 1 cycle).
[0160] The cDNA of the 12 transgenic rice plant lines extracted in step ② was subjected to the same treatment to obtain the corresponding qRT-PCR results.
[0161] 2. Experimental Results
[0162] The qRT-PCR results of OsCBL are as follows: Figure 2 As shown, the results indicated that, compared with the wild-type rice plant ZH11, the expression of OsCBL was upregulated in all 12 transgenic rice plant lines, with a significant increase in expression level. Moreover, the OsCBL expression in the OX1 and OX11 lines was higher than that in other lines.
[0163] The results showed that the expression level of OsCBL was significantly increased in all 12 transgenic lines of OsCBL-OX.
[0164] Example 3: Observation of panicle phenotype and statistical analysis of single-plant yield of transgenic rice plants
[0165] 1. Experimental Methods
[0166] Plants OX1 and OX11 obtained in Example 2 were selected for propagation. OX1 and OX11 were sown on a medium supplemented with hygromycin and screened, and the segregation ratio (the segregation ratio between hygromycin-resistant and non-hygromycin-resistant plants) was counted. Seedlings of plants with hygromycin resistance were propagated, and lines with a segregation ratio of 3:1 were selected for phenotypic analysis.
[0167] The specific steps for phenotypic analysis and statistics are as follows:
[0168] During the vegetative growth stage of OX1 plants, the main stem was marked. When the rice panicles matured and were ready for harvest, the panicle length was measured, and the number of secondary branches and grains on the main panicle were calculated. Rice seeds produced by each plant were collected, dried, hulled, and weighed to determine the yield per plant. The phenotypes of 12 OX1 plants were analyzed, and the average value was taken as the experimental result.
[0169] Phenotypic analysis and statistical analysis were performed on wild-type rice plants ZH11 and OX11 after applying the same treatment.
[0170] 2. Experimental Results
[0171] Phenotypic analysis statistical results are as follows: Figure 3As shown, the results indicate that compared with the wild-type rice plant ZH11, the main panicle length of both OX1 and OX11 plants increased ( Figure 3 a) The number of secondary branches on the main ear increases ( Figure 3 b) The number of grains on the main ear increases ( Figure 3 c), and the yield per plant increased significantly ( Figure 3 d).
[0172] The results show that overexpression of OsCBL can increase panicle length, secondary branching, and number of grains per panicle in rice plants, and significantly increase yield per plant.
[0173] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.
Claims
1. The application of the cystathionine β-lyase gene OsCBL with the nucleotide sequence as shown in SEQ ID NO: 2 and / or the cystathionine β-lyase OsCBL with the amino acid sequence as shown in SEQ ID NO: 3 in increasing the length of the main panicle in rice, characterized in that, Overexpression of the cystathionine β-lyase gene OsCBL increases the length of the main panicle in rice.
2. The application of the cystathionine β-lyase gene OsCBL with the nucleotide sequence as shown in SEQ ID NO: 2 and / or the cystathionine β-lyase OsCBL with the amino acid sequence as shown in SEQ ID NO: 3 in increasing the number of secondary branches in the main panicle of rice, characterized in that, Overexpression of the cystathionine β-lyase gene OsCBL increases the number of secondary branches in the main panicle of rice.
3. The application of the cystathionine β-lyase gene OsCBL with the nucleotide sequence as shown in SEQ ID NO: 2 and / or the cystathionine β-lyase OsCBL with the amino acid sequence as shown in SEQ ID NO: 3 in increasing the number of grains on the main panicle of rice, characterized in that, Overexpression of the cystathionine β-lyase gene OsCBL increases the number of grains on the main panicle of rice.
4. The application of the cystathionine β-lyase gene OsCBL with the nucleotide sequence as shown in SEQ ID NO: 2 and / or the cystathionine β-lyase OsCBL with the amino acid sequence as shown in SEQ ID NO: 3 in increasing rice yield, characterized in that... Rice yield can be increased by overexpressing the cystathionine β-lyase gene OsCBL.
5. A method for increasing the length of the main panicle of rice, the number of secondary branches of the main panicle, the number of grains on the main panicle of rice, and / or increasing rice yield, characterized in that, The method involves overexpressing the cystathionine β-lyase gene OsCBL. The nucleotide sequence of the cystathionine β-lyase gene OsCBL is shown in SEQ ID NO: 2, and the amino acid sequence of the cystathionine β-lyase gene OsCBL is shown in SEQ ID NO:
3.
6. The method according to claim 5, characterized in that, The specific method for overexpressing the cystathionine β-lyase gene OsCBL is as follows: the CDS coding sequence of the cystathionine β-lyase gene OsCBL, whose nucleotide sequence is shown in SEQ ID NO: 2, is ligated into a pOX vector to obtain a recombinant vector. The recombinant vector is then transferred into Agrobacterium and the transgenic plants are obtained by Agrobacterium-mediated transformation.
7. The method according to claim 6, characterized in that, The Agrobacterium is Agrobacterium EHA105.
8. The method according to claim 6, characterized in that, Transgenic plants were screened using qRT-PCR.
9. The method according to claim 8, characterized in that, qRT-PCR detection was performed using the detection primers with nucleotide sequences as shown in SEQ ID NO: 7 and SEQ ID NO:
8.
10. The method according to claim 9, characterized in that, qRT-PCR detection was also performed using internal reference primers with nucleotide sequences as shown in SEQ ID NO: 9 and SEQ ID NO: 10.