Septin 9 methylation detection composition and use thereof

Abstract

The application provides a Septin9 methylation detection composition and application thereof, and the composition comprises a methylation-dependent restriction enzyme, a capture oligonucleotide, a universal primer and a Septin9 methylation-specific primer; the capture oligonucleotide comprises a first universal sequence, a folding sequence and a binding capture sequence from 5' end to 3' end in sequence; the folding sequence is at least partially identical to a 5' end sequence of a Septin9 methylation site after the methylation-dependent restriction enzyme is cut; and the binding capture sequence is specifically bound to a fragment region where the detected Septin9 methylation site is located. The application is based on a methylation-dependent restriction enzyme and a universal primer fluorescence quantitative PCR technology, does not need bisulfite conversion, and realizes accurate and specific Septin9 methylation detection.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a Septin9 methylation detection composition and its application. Background Technology

[0002] Colorectal cancer (CRC) is a common gastrointestinal malignancy. With changes in people's lifestyles, the incidence and mortality rates of colorectal cancer have increased significantly, seriously threatening human health. Early symptoms of colorectal cancer are not obvious. As the tumor grows, symptoms such as changes in bowel habits, rectal bleeding, diarrhea, alternating diarrhea and constipation, and localized abdominal pain may appear. In advanced stages, systemic symptoms such as anemia and weight loss may develop.

[0003] Currently, fecal occult blood test (FOBT) and colonoscopy are the main clinical methods for colorectal cancer screening. As routine screening methods, FOBT is easily affected by food, medication, and other factors, resulting in a high false-positive rate and poor stability. Colonoscopy is an invasive procedure requiring bowel preparation to ensure a good view of the large intestine. Furthermore, colonoscopy carries a series of complications, such as intestinal perforation and peritonitis at the biopsy site. Therefore, patient compliance with colonoscopy is poor. There is an urgent need for colorectal cancer detection methods that offer high compliance, convenient testing, and accurate results to improve screening accuracy.

[0004] DNA methylation refers to the modification of cytosine at the 5' end of a CpG island with a methylation group without altering the DNA sequence, resulting in DNA expression silencing. It is currently recognized as one of the mechanisms of tumorigenesis. Abnormal DNA methylation usually occurs earlier than cell carcinogenesis; therefore, timely detection of DNA methylation can provide early warning of malignant tumors and offer important evidence for early screening, early diagnosis, prognosis, and treatment evaluation of tumors.

[0005] The Septin9 gene is located on chromosome 17q25.3. The Septin family is a group of highly conserved GTP-binding proteins widely distributed in human cells, providing structural support during cell division. The target of early CRC diagnostic kits is the SEPT-V2 region. Abnormally methylated Septin9 genes are not only present in colorectal cancer tissues and peripheral blood of patients, but are also closely related to breast cancer, ovarian cancer, leukemia, and lymphoma. Grutzmann et al. conducted a systematic study on the methylation level of Septin9 gene in the plasma of patients with various tumors and non-tumor diseases, finding that the detection rate of Septin9 methylation in the plasma of CRC patients was significantly higher than that in patients with non-colorectal cancer, non-tumor diseases, and healthy individuals. This indicates that plasma Septin9 methylation has high sensitivity and specificity for detecting CRC, showing significant differences compared to patients with non-colorectal cancer, non-tumor diseases, and healthy individuals. This provides clinical evidence for Septin9 methylation as a specific diagnostic marker for CRC.

[0006] Although Septin9 methylation can serve as an effective biomarker for early screening of CRC, the proportion of abnormal Septin9 methylation is extremely low compared to wild-type genes with normal methylation, typically ranging from only 0.01% to 10% depending on the tumor stage. The biggest challenge in Septin9 methylation detection lies in how to detect trace amounts of abnormally methylated genes against a background of high wild-type gene density.

[0007] Bisulfite conversion is the most commonly used method for methylation detection. The principle is that DNA is treated with bisulfite, converting cytosine residues into uracil, while the methylated cytosine residues remain unaffected. Therefore, bisulfite-treated DNA fragments retain only methylated cytosine. Based on this principle, bisulfite can reveal the methylation status of DNA at the single nucleotide level. Several detection methods exist for analyzing bisulfite-treated DNA sequences; the practical problem in analysis is understanding the differences caused by bisulfite altering the base sequence from C to U and ultimately to T.

[0008] However, the bisulfite conversion method also has many shortcomings: (1) Bisulfite sequencing requires that the bisulfite conversion reaction be complete, that is, every unmethylated cytosine is converted into uracil. If the conversion reaction is incomplete, false positive results will occur; (2) Since only single-stranded DNA cytosine can be attacked by bisulfite, DNA needs to be denatured and stranded before conversion. Temperature, salt concentration and other factors must be strictly controlled, otherwise the conversion will fail or be incomplete; (3) DNA may be degraded during the conversion reaction. If the incubation time is too long, the temperature and bisulfite concentration are too high, up to 90% of the DNA may be degraded. The degraded DNA depurinates and forms random breaks, which may lead to PCR amplification failure or a small number of DNA samples, resulting in low accuracy and false negatives; (4) Bisulfite treatment will significantly reduce the complexity of the sample, making it more difficult to design multiplex PCR primers and increasing the error.

[0009] Therefore, developing a highly sensitive DNA methylation detection method that does not require bisulfite treatment or a control reaction has become an urgent problem to be solved. Summary of the Invention

[0010] To address the shortcomings of existing technologies and practical needs, this invention provides a Septin9 methylation detection composition and its application. Based on methylation-dependent restriction endonucleases and universal primers, and using real-time quantitative PCR technology, it detects the methylation status at specific sites of the Septin9 gene that are closely related to colorectal cancer. It has the advantages of not requiring bisulfite conversion, simple operation, high accuracy, and strong specificity.

[0011] To achieve this objective, the present invention adopts the following technical solution:

[0012] In a first aspect, the present invention provides a Septin9 methylation detection composition, the composition comprising a methylation-dependent restriction endonuclease, a capture oligonucleotide, and a universal primer;

[0013] The capturing oligonucleotide comprises, from the 5' end to the 3' end, a first universal sequence, a folded sequence, and a binding capture sequence;

[0014] The folded sequence is at least partially identical to the 5' end sequence of the Septin9 methylation site after digestion with a methylation-dependent restriction endonuclease;

[0015] The binding capture sequence can specifically bind to the fragment region containing the detected Septin9 methylation site.

[0016] Preferably, the composition further includes a Septin9 methylation-specific primer.

[0017] Preferably, the capturing oligonucleotide further includes a second universal sequence.

[0018] Preferably, the second universal sequence is located at the 5' end of the combined capture sequence.

[0019] In this invention, the Septin9 methylation detection composition mainly comprises two parts: a methylation-dependent restriction endonuclease and a quantitative real-time PCR detection reagent based on universal primers. The methylation-dependent restriction endonuclease digests the methylation site of the Septin9 methylation template to form an intermediate product with a well-defined 5' end sequence. The capture oligonucleotide uses the binding capture sequence to capture this intermediate product and uses it as a template for extension. A nucleotide complementary to the Septin9 methylation gene is added to the 3' end of the capture oligonucleotide to form an extended capture oligonucleotide. The extended capture oligonucleotide pairs with its own internal folding sequence through complete or incomplete matching to form a half-hairpin structure product. The half-hairpin structure product undergoes another extension reaction, and a nucleotide complementary to the first universal sequence within the molecule is added to the 3' end to form a complete hairpin structure product. The hairpin structure product is amplified by PCR using universal primers and / or specific primers, and combined with a detection probe, quantitative real-time PCR detection of the Septin9 methylation site is achieved.

[0020] Preferably, the capturing oligonucleotide further includes nucleic acid elongation blocking modification.

[0021] Preferably, the nucleic acid extension blocking modification has any one or a combination of at least two of the following: a spacer, a thio group, or a uracil base.

[0022] Preferably, the folded sequence is modified with a nucleic acid analog.

[0023] Preferably, the nucleic acid analogues include any one or a combination of at least two of peptide nucleic acids, locked nucleic acids, transposed bases, 2'-O,4'-C-methylenebridge RNA, 2'-O-Methyl RNA, or 2'-Fluoro RNA.

[0024] Preferably, the nucleic acid sequence of the universal primer is the same as or partially the same as the first universal sequence of the capturing oligonucleotide.

[0025] Preferably, the methylation-dependent restriction endonuclease includes any one or a combination of at least two of GlaI, FspEI, MspJI, LpnPI, AspBHI, or MseI.

[0026] In this invention, when MspJI is selected as the methylation-dependent restriction endonuclease, MspJI has a large number of cleavage sites, resulting in small fragments of the target molecule that cannot be amplified. Before the cleavage step, this invention adds an artificial complementary strand specific to the methylation site of Septin9 to the sample. This strand binds complementaryly to the methylation site to form a local double strand. By utilizing the double-strand specificity of this enzyme, it can not only cleave specific regions but also prevent the problem of the target molecule being fragmented and unable to be amplified due to too many cleavage sites.

[0027] Preferably, the composition further includes a detection probe.

[0028] Preferably, the detection probe is labeled with a fluorescent group and / or a quenching group.

[0029] Preferably, the fluorescent group is labeled on the 5' end of the detection probe.

[0030] Preferably, the quenching group is labeled on the 3' end of the detection probe.

[0031] Preferably, the fluorescent group includes any one of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LCRED460.

[0032] Preferably, the quenching group includes any one of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra.

[0033] Preferably, the captured oligonucleotide comprises the nucleic acid sequence shown in SEQ ID NO:1, SEQ ID NO:6, SEQ ID NO:11, SEQ ID NO:12 or SEQ ID NO:13.

[0034] Preferably, the universal primer comprises the nucleic acid sequence shown in SEQ ID NO:2 or SEQ ID NO:14.

[0035] Preferably, the Septin9 methylation-specific primer includes the nucleic acid sequence shown in SEQ ID NO:3 or SEQ ID NO:7.

[0036] Preferably, the detection probe comprises the nucleic acid sequence shown in SEQ ID NO:4 or SEQ ID NO:8.

[0037] Preferably, the Septin9 methylation-specific complementary strand comprises the nucleic acid sequence shown in SEQ ID NO:9.

[0038] In a second aspect, the present invention provides a Septin9 methylation detection kit, the kit comprising the composition described in the first aspect.

[0039] Preferably, the kit further includes DNA polymerase, dNTPs, or Mg. 2+ Any one or at least two of them.

[0040] Preferably, the kit further includes an enzyme digestion buffer and / or a PCR buffer.

[0041] Thirdly, the present invention provides a Septin9 methylation detection system, the system comprising 1-20 nM capture oligonucleotides, 100-400 nM universal primers, 100-300 nM detection probes, 1-2 U / μL Taq polymerase, 100-300 μM dNTPs, 1-5 mM MgCl2 and PCR buffer.

[0042] Preferably, the system further includes 100–300 nM Septin9 methylation-specific primers.

[0043] Fourthly, the present invention provides a method for detecting Septin9 methylation, the method comprising:

[0044] The methylation-dependent restriction endonuclease was used to digest the methylated template of Septin9 to be tested. The digested product was added to the system described in the third aspect for real-time PCR.

[0045] Preferably, the temperature of the enzymatic digestion treatment is 30-40°C, for example, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C or 40°C, preferably 37°C.

[0046] Preferably, the enzyme digestion treatment time is 0.5 to 2 hours, for example, it can be 0.5 hours, 1 hour, 1.5 hours or 2 hours, preferably 1 hour.

[0047] Preferably, the program for the real-time PCR is as follows: pre-denaturation at 92–95°C for 2–5 min; denaturation at 92–95°C for 10–20 s, annealing at 65–70°C for 80–100 s, for 10–15 cycles; denaturation at 92–95°C for 10–20 s, annealing at 65–70°C for 20–30 s, for 30–50 cycles.

[0048] Preferably, before the method uses a methylation-dependent restriction endonuclease to digest the methylated template of Septin9 to be tested, it further includes a step of adding a Septin9 methylation-specific complementary strand for complementary binding.

[0049] Preferably, the complementary bonding conditions are: denaturation at 92–95°C for 10–15 min and annealing at 60–65°C for 1–2 min.

[0050] Fifthly, the present invention provides a Septin9 methylation detection device, the device comprising:

[0051] Complementary binding unit: used to add a Septin9 methylation-specific complementary chain to bind complementaryly to the Septin9 methylation template to be tested;

[0052] Enzyme digestion unit: The methylation-dependent restriction endonuclease was used to digest the methylated template of Septin9 to obtain a pretreated product with a well-defined 5' end sequence.

[0053] The real-time PCR unit utilizes a real-time PCR system containing capture oligonucleotides, universal primers, Septin9 methylation-specific primers, and detection probes to perform real-time PCR detection on pretreated products.

[0054] Preferably, the complementary bonding conditions are: denaturation at 92–95°C for 10–15 min and annealing at 60–65°C for 1–2 min.

[0055] Preferably, the enzyme digestion unit provides an enzyme digestion temperature of 30-40°C, for example, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C or 40°C, preferably 37°C.

[0056] Preferably, the enzyme digestion unit provides an enzyme digestion time of 0.5 to 2 hours, for example, 0.5 hours, 1 hour, 1.5 hours or 2 hours, preferably 1 hour.

[0057] Preferably, the real-time PCR program provided by the real-time PCR unit is as follows: pre-denaturation at 92-95℃ for 2-5 min; denaturation at 92-95℃ for 10-20 s, annealing at 65-70℃ for 80-100 s, for 10-15 cycles; denaturation at 92-95℃ for 10-20 s, annealing at 65-70℃ for 20-30 s, for 30-50 cycles.

[0058] In a sixth aspect, the present invention provides the use of the composition described in the first aspect, the kit described in the second aspect, the system described in the third aspect, or the device described in the fifth aspect in the preparation of reagents and / or devices for early diagnosis of diseases.

[0059] Preferably, the disease includes a tumor.

[0060] Preferably, the tumor includes any one or a combination of at least two of colorectal cancer, gastric cancer, or esophageal cancer.

[0061] Compared with the prior art, the present invention has the following beneficial effects:

[0062] (1) The Septin9 methylation detection composition of the present invention mainly includes two parts: a methylation-dependent restriction endonuclease and a fluorescence quantitative PCR detection reagent based on universal primers. It does not require additional steps such as ligation reaction or chemical treatment of methylated samples. It only requires pretreatment of the sample before PCR detection to obtain a sample with a clear 5' end sequence. Combined with the amplification technology based on universal primers, it realizes high specificity and high sensitivity of multiplex detection of nucleic acids.

[0063] (2) In the Septin9 methylation detection composition of the present invention, the capturing oligonucleotide and the universal primer are specially designed and work together. In the presence of the target molecule, the target molecule triggers the extension reaction mediated by the capturing oligonucleotide to form a hairpin structure product, which is used as a template for the universal primer amplification reaction. Since the amplification reaction is based on the enzyme digestion product determined by the 5' sequence, the false positive problem is effectively avoided.

[0064] (3) In this invention, the 3' extension sequence of the captured oligonucleotide and the folding sequence can form a complementary pair, which can trigger the self-folding of the captured oligonucleotide to form a hairpin structure, effectively ensuring the specificity of the reaction;

[0065] (4) When the Septin9 methylation detection kit of the present invention is used to detect different target molecules, it is only necessary to design the folding sequence and binding capture sequence of the capture oligonucleotide according to the target molecule, while keeping the first universal sequence unchanged, which greatly reduces the interference between multiple primers in multiple target amplification and improves the sensitivity of amplification.

[0066] (5) The Septin9 methylation detection kit of the present invention achieves signal amplification through an exponential amplification process, which not only meets the sensitivity requirements of DNA / RNA detection, but also the exponential amplification process is completed using only extended capture oligonucleotides and universal primers, which can achieve equivalent amplification of multiple target molecules while keeping the number and concentration of universal primers unchanged, thus avoiding the deviation of amplification efficiency caused by sequence differences.

[0067] (6) The Septin9 methylation detection method of the present invention is simple to operate. Attached Figure Description

[0068] Figure 1 To detect the amplification curves of the methylated Septin9 gene in methylated and unmethylated samples at different concentrations using qPCR;

[0069] Figure 2 Amplification curves for qPCR detection of DNA templates with different proportions of methylation;

[0070] Figure 3To detect amplification products of DNA templates with different proportions of methylation by agarose gel electrophoresis;

[0071] Figure 4 To detect the copy number of Septin9 gene in samples with different concentrations of methylation using ddPCR;

[0072] Figure 5 This is the result of a specific complementary strand enzyme digestion experiment;

[0073] Figure 6A For the detection specificity of common capture oligonucleotides, Figure 6B The detection specificity results for LNA-modified captured oligonucleotides;

[0074] Figure 7 The results are for the detection of human DNA methylation based on a dual universal primer amplification model. Detailed Implementation

[0075] To further illustrate the technical means and effects of this invention, the following description, in conjunction with embodiments and accompanying drawings, provides a further explanation of the invention. It is understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit it.

[0076] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0077] Example 1: Detection of methylated DNA in the human Septin9 gene

[0078] This embodiment detects methylated DNA of the human Septin9 gene, and the steps are as follows:

[0079] (1) Genomic DNA was extracted from the Jurkat cell line and the Hela cell line respectively, and the methylation status of the Septin9 gene was identified by sequencing.

[0080] (2) The methylation-dependent restriction endonuclease GlaI was used to digest the genomic DNA of Jurkat cell line, Hela cell line and negative control NC. The reaction system was 2 μL of 10× digestion buffer, 5 U GlaI, and different concentrations of genomic DNA (or negative control NC), with a total system volume of 20 μL. The reaction conditions were incubation at 37℃ for 1 hour. After the digestion reaction was completed, the system was heated to 85℃ and incubated for 10 minutes to heat inactivate GlaI.

[0081] (3) Septin9 gene capture oligonucleotides, universal primers, specific primers, and detection probes were added to the above enzyme digestion reaction system respectively. The methylation status of Septin9 gene was detected by PCR. The PCR amplification system included enzyme-digested DNA template, 10 nM capture oligonucleotides, 200 nM universal primers, 200 nM specific primers, 200 nM detection probes, 1 U / μL Taq polymerase, 200 μM dNTPs, 4.5 mM MgCl2, and 2× PCR buffer, with a final volume of 20 μL. The PCR reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 10 s, 66℃ annealing for 90 s, 10 cycles; 94℃ denaturation for 10 s, 65℃ annealing for 20 s, 40 cycles. Real-time PCR was performed on a ROCHE instrument (480), and the corresponding fluorescence values ​​were collected.

[0082] Capture oligonucleotides (SEQ ID NO:1):

[0083] 5-TGTCAGCCAACGGTATTCATCGTTGACCGCGGGCTCGCCGCTGCCCTCCGC;

[0084] Universal primer (SEQ ID NO:2):

[0085] 5-GCCTGTCAGCCAACGGTATTCATC;

[0086] Septin9 specific primer (SEQ ID NO:3):

[0087] 5-CGACCCGCTGCCCACCAG;

[0088] Detection probe (SEQ ID NO:4):

[0089] 5-VIC-CCATCATGTCGGACCC-MGB;

[0090] The human Septin9 gene is shown in SEQ ID NO:5, where the underlined areas indicate methylation sites and / / indicates restriction enzyme sites.

[0091] 5-GCG C / / G TTGACCGCGGGGTCCGACATGATGGCTGGTGGGCAGCGGGTCGCGCGGAGGGCAGCGGCGAGGAA.

[0092] Sequencing analysis revealed that the Septin9 gene in the Jurkat cell line genome was unmethylated, while the Septin9 gene in the Hela cell line genome was methylated. qPCR was used to detect the methylation status of the Septin9 gene in methylated and unmethylated samples at different concentrations. Figure 1 As shown, 140 copies and 28 copies are the amplification curves of Septin9 methylated samples, representing 140 copies / reaction and 28 copies / reaction of Septin9 methylated gene samples, respectively. 16,000 copies are the amplification curves of unmethylated samples, and NC is the amplification curve of ddH2O.

[0093] This demonstrates that the present invention can sensitively and specifically detect methylated DNA in the Septin9 gene.

[0094] Example 2: Detection of DNA with different methylation ratios in the human Septin9 gene

[0095] Based on the sequencing and identification results of Example 1, this example uses Jurkat cell line DNA as a Septin9 methylation-negative sample and Hela cell line DNA as a Septin9 methylation-positive sample to detect human Septin9 gene DNA with different methylation ratios. The steps are as follows:

[0096] (1) Using 10,000 copies of Jurkat cell line DNA as background, 1,000 copies, 100 copies, and 10 copies of HeLa cell line DNA were added to construct mixed samples with methylation ratios of 10%, 1%, 0.1%, and 0%, respectively.

[0097] (2) The enzyme digestion reaction system of Example 1 and the fluorescence quantitative PCR system based on universal primers were used to detect DNA samples with different methylation ratios;

[0098] (3) The amplification products were detected by agarose gel electrophoresis. Weigh 0.6g of agarose powder, add 20mL of 1×TEA solution and heat to dissolve. Pour into a mold and solidify. Prepare a mixed loading solution according to the ratio of sample:loading buffer = 5:1. Add the mixture to the sample well of the agarose gel and electrophoresis at 150mV for 30min. Observe the amplification products by gel imaging.

[0099] qPCR test results as follows Figure 2As shown, the amplification curves for 10%, 1%, 0.1%, and 0% correspond to different proportions of methylated DNA template. The negative control is the amplification curve for ddH2O. Samples with methylation ratios of 10%, 1%, and 0.1% can be stably amplified, while 0% shows no amplification, indicating that the system has excellent sensitivity and specificity. Agarose gel electrophoresis results are shown below. Figure 3 As shown, the 10%, 1%, and 0.1% groups showed clear target bands in gel electrophoresis, while the 0% group showed no bands, indicating that the amplification results were correct.

[0100] Example 3: ddPCR detection of Septin9 gene methylation

[0101] Using the same reaction conditions as in Example 1, the methylation of the Septin9 gene was detected on a STILLA Naica™ crystal digital PCR instrument.

[0102] like Figure 4 The chart shows the copy number of the Septin9 gene in samples with different concentrations of methylation. The left side is a scatter plot of 100 copies / reaction, and the right side is a scatter plot of 10 copies / reaction. Points above the dashed line represent positive droplets, and points below the dashed line represent negative droplets.

[0103] Therefore, this invention can achieve highly sensitive detection of methylated DNA in the Septin9 gene on a digital PCR instrument.

[0104] Example 4 Site-Specific Complementary Stratum Digestion Experiment

[0105] To achieve site-specific methylation detection, this embodiment selected the methylation-dependent restriction endonuclease MspJI, which has abundant cleavage sites. However, due to the large number of cleavage sites, the target molecule is fragmented and cannot be amplified. Utilizing the double-strand specificity of this enzyme, high-temperature denaturation was performed, followed by the addition of artificial complementary sequences to specific methylation sites, forming specific local double strands. This allows for cleavage of a specific region while preventing the problem of excessive cleavage sites leading to fragmented target molecules that cannot be amplified.

[0106] The steps are as follows:

[0107] (1) Genomic DNA was extracted from the Jurkat cell line and the Hela cell line respectively, and the methylation status of the Septin9 gene was identified by sequencing.

[0108] (2) Before enzyme digestion, the template is denatured and complementary. The final concentration of buffer is 1×, the final concentration of artificial complementary strand is 100nM, denatured at 95℃ for 10min, annealed at 60℃ for 2min, and stored at 4℃.

[0109] (3) Add 1 μL MspJI and 1 μL 30×Enzyme Activator Solution to the enzyme digestion system, digest at 37℃ for 30 min, and inactivate at 65℃.

[0110] (4) Add a portion of the enzyme digestion product to the PCR system. The PCR amplification system includes enzyme-digested DNA template, 450 nM capture oligonucleotides, 450 nM universal primers, 450 nM specific primers, 225 nM detection probe, 1 U / μL Taq polymerase, 200 μM dNTP, 4.5 mM MgCl2 and 2× PCR buffer, with a final volume of 20 μL. The PCR reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 10 s, 66℃ annealing for 90 s, 10 cycles; 94℃ denaturation for 10 s, 65℃ annealing for 20 s, 40 cycles. Real-time PCR is performed on a ROCHE instrument (480), and the corresponding fluorescence is collected.

[0111] Capture oligonucleotides (SEQ ID NO:6):

[0112] 5-TGTCAGCCAACGGTATTCATCGGGATCATTTCGGAGGGTCCTCTCCAGCACGTCC;

[0113] Universal primer (SEQ ID NO:2):

[0114] 5-GCCTGTCAGCCAACGGTATTCATC;

[0115] Septin9 specific primer (SEQ ID NO:7):

[0116] 5-CGGCCGCAGCAGCCAG;

[0117] Detection probe (SEQ ID NO:8):

[0118] 5-FAM-CAGCACCCACCTTCG-MGB;

[0119] Specific artificial complementary strand (SEQ ID NO:9):

[0120] 5-CGAAATGATCCCATCCAGCTGCGCGTTGACC-NH2;

[0121] The human Septin9 gene is shown in SEQ ID NO:10, where the underlined areas indicate methylation sites and / / indicates restriction enzyme sites.

[0122] A CGCGCAGCTGGAT / / GGGATCATTTCGGACTTCGAAGGTGGGTGCTGGGCTGGCTGCTGCGGCCGCGGACGTGCTGGAGAGGACCCTGC.

[0123] The Septin9 gene in the HeLa cell line genome was identified as methylated. Amplification was performed after treating the target molecule with different methods at the same positive genomic concentration, such as... Figure 5 As shown, the positive control amplified normally, while the negative control (ddH2O) showed no amplification, indicating the system was functioning normally. The groups with either high-temperature denaturation (500 copies of the genome after denaturation followed by enzyme digestion) or no digestion (500 copies of the original genome) showed no amplification. The group with direct digestion of 500 copies of the genome showed a signal, but the amplification efficiency of the 500-copy genome + complementary strand group was significantly higher than that of the directly digested group. Amplification revealed that undigested genomes could not initiate amplification, and target molecules, after high-temperature denaturation, could not be recognized and cleaved by restriction enzymes, thus preventing amplification. Direct digestion of target molecules leads to template fragmentation and a decrease in effective template concentration. The addition of an artificial complementary strand can form local double strands, allowing for specific site cleavage of the target molecule, thereby increasing the effective template quantity and improving sensitivity.

[0124] Example 5: Optimization of Specificity for Human Septin9 Gene Methylation Site Detection

[0125] In this embodiment, Jurkat DNA treated with methyltransferase was used as a positive standard for human Septin9 gene methylation, and Jurkat DNA was used as a negative standard for human Septin9 gene methylation. Nuclease-free water was used as a negative control. The samples were digested with the methylation-dependent restriction endonuclease GlaI, and amplification and detection were performed using common capture oligonucleotides or LNA-modified capture oligonucleotides, as well as universal primers, specific primers, and detection probes.

[0126] The enzyme digestion and amplification conditions, universal primers, specific primers, and detection probes used were the same as in Example 1. The capture oligonucleotides used included:

[0127] Commonly captured oligonucleotides (SEQ ID NO:11):

[0128] 5-TGTCAGCCAACGGTATTCATCGTTGACCGCGGGCTCGCCGCTGCCCTCCGC;

[0129] LNA-modified capture oligonucleotide (SEQ ID NO:12):

[0130] 5-TGTCAGCCAACGGTATTCATCGTTGACC+G+CGCTCGCCGCTGCCCTCCGC (The base following the + indicates that the base modifies the locked nucleic acid);

[0131] The human Septin9 gene is shown in SEQ ID NO:5.

[0132] The results are as follows Figure 6A and Figure 6B As shown, both capture oligonucleotides produced positive results in 120-copy and 12-copy positive templates. However, in the standard capture oligonucleotide system, when 100 ng of unmethylated genomic DNA (Jurkat DNA) was added, non-specific amplification occurred due to the binding and extension of synthetic byproducts of the capture oligonucleotides to the target molecule. After introducing LNA modification into the folded sequence of the capture oligonucleotides, amplification efficiency was maintained (detecting both 120-copy and 12-copy positives), and non-specific amplification was not triggered in high concentrations of unmethylated genomic DNA (100 ng). The mechanism for inhibiting non-specific amplification is that the introduction of nucleic acid analogs into the folded sequence inhibits the extension of primer synthetic byproducts while ensuring complementary base pairing in the folded region. Therefore, the results demonstrate that nucleic acid analog modification of the folded sequence improves the specificity of the detection system.

[0133] Example 6: Detection of human DNA methylation based on a dual universal primer amplification model

[0134] In the previous amplification model, one primer was a universal primer, and the other was a template-specific primer. The system was further improved by adding a universal primer sequence between the capture region and the folding region of the captured oligonucleotide. Amplification was initiated by extending the fold, resulting in the amplicon having universal primer sequences at both ends. This enabled the amplification of methylated templates using two universal primers.

[0135] Jurkat DNA treated with methyltransferase was used as a positive standard for human Septin9 gene methylation, with the CG site being 5mCG, for Septin9 gene methylation site detection. Nuclease-free water was used as a negative control. The steps are as follows:

[0136] (1) The positive standard (or negative control) was digested with the methylation-dependent restriction endonuclease GlaI. The reaction system consisted of 2 μL of 10× digestion buffer, 5 U GlaI, and genomic DNA of different concentrations, with a total system volume of 20 μL. The reaction conditions were incubation at 37°C for 1 hour. After the digestion reaction, the system was heated to 85°C and incubated for 10 minutes to heat-inactivate GlaI.

[0137] (2) Septin9 gene capture oligonucleotides, universal primers, and detection probes were added to the above enzyme digestion reaction system, respectively. The methylation status of Septin9 gene was detected by PCR. The PCR amplification system included enzyme-digested DNA template, 10 nM capture oligonucleotides, 200 nM first universal primer, 200 nM second universal primer, 200 nM detection probe, 1 U / μL Taq polymerase, 1 U / μL UDG enzyme, 300 μM dNTP, 1.5 mM MgCl2, and 2× PCR buffer, with a final volume of 20 μL. The PCR reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 10 s, 66℃ annealing for 90 s, 10 cycles; 94℃ denaturation for 10 s, 65℃ annealing for 20 s, 40 cycles. Real-time PCR was performed on a ROCHE instrument (480), and the corresponding fluorescence values ​​were collected.

[0138] Capture oligonucleotides (SEQ ID NO:13):

[0139] TGTCAGCCAACGGTATTCATCGTTGACCGCGGGGTCAGATGTGGCACTGACAAGCGACCAGCTGCCCACCA;

[0140] First universal primer (SEQ ID NO:2):

[0141] GCCTGTCAGCCAACGGTATTCATC;

[0142] Second universal primer (SEQ ID NO:14):

[0143] CGGCGTCAGATGTGGCACTGACAA;

[0144] Detection probe (SEQ ID NO:4):

[0145] 5-VIC-CCATCATGTCGGACCC-MGB.

[0146] like Figure 7 As shown, in the dual universal primer system, 1200 copies, 120 copies, 40 copies, and 12 copies of positive template were all amplified after enzyme digestion, exhibiting a clear concentration gradient. This indicates that the dual universal primer system can still achieve the amplification and detection of Septin9 methylation sites, and the system has high sensitivity.

[0147] In summary, this invention combines methylation-dependent restriction endonuclease with PCR amplification based on universal primers, eliminating the need for bisulfite treatment and control reactions. This enables precise quantitative detection of Septin9 methylated DNA, avoids amplification efficiency deviations caused by sequence differences, exhibits high specificity, and is suitable for widespread application.

[0148] The applicant declares that the detailed method of the present invention is illustrated by the above embodiments, but the present invention is not limited to the above detailed method, that is, it does not mean that the present invention must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention. sequence list <110> Shanghai Maijing Nanotechnology Co., Ltd.; Shanghai Jiao Tong University <120> A Septin9 methylation detection composition and its application <130> 20210105 <160> 14 <170> SIPOSequenceListing 1.0 <210> 1 <211> 51 <212> DNA <213> Artificial sequence() <400> 1 tgtcagccaa cggtattcat cgttgaccgc gggctcgccg ctgccctccg c 51 <210> 2 <211> twenty four <212> DNA <213> Artificial sequence() <400> 2 gcctgtcagc caacggtatt catc 24 <210> 3 <211> 18 <212> DNA <213> Artificial sequence() <400> 3 cgacccgctg cccaccag 18 <210> 4 <211> 16 <212> DNA <213> Artificial sequence() <400> 4 ccatcatgtc ggaccc 16 <210> 5 <211> 70 <212> DNA <213> Artificial sequence() <400> 5 gcgcgttgac cgcggggtcc gacatgatgg ctggtgggca gcgggtcgcg cggagggcag 60 cggcgaggaa 70 <210> 6 <211> 55 <212> DNA <213> Artificial sequence() <400> 6 tgtcagccaa cggtattcat cgggatcatt tcggagggtc ctctccagca cgtcc 55 <210> 7 <211> 16 <212> DNA <213> Artificial sequence() <400> 7 cggccgcagc agccag 16 <210> 8 <211> 15 <212> DNA <213> Artificial sequence() <400> 8 cagcacccac cttcg 15 <210> 9 <211> 31 <212> DNA <213> Artificial sequence() <400> 9 cgaaatgatc ccatccagct gcgcgttgac c 31 <210> 10 <211> 88 <212> DNA <213> Artificial sequence () <400> 10 acgcgcagct ggatgggatc atttcggact tcgaaggtgg gtgctgggct ggctgctgcg 60 gccgcggacg tgctggagag gaccctgc 88 <210> 11 <211> 51 <212> DNA <213> Artificial sequence () <400> 11 tgtcagccaa cggtattcat cgttgaccgc gggctcgccg ctgccctccg c 51 <210> 12 <211> 49 <212> DNA <213> Artificial sequence () <400> 12 tgtcagccaa cggtattcat cgttgaccgc gctcgccgct gccctccgc 49 <210> 13​​​​​​​​​​​​​​​​​​​​​​​​

Claims

1. A Septin9 methylation detection composition, characterized in that, The composition comprises a methylation-dependent restriction endonuclease, a capture oligonucleotide, and a universal primer; The capturing oligonucleotide comprises, from the 5' end to the 3' end, a first universal sequence, a folded sequence, and a binding capture sequence; The folded sequence is at least partially identical to the 5' end sequence of the Septin9 methylation site after digestion with a methylation-dependent restriction endonuclease; The binding capture sequence specifically binds to the fragment region containing the detected Septin9 methylation site; The folded sequence is modified with a nucleic acid analog; The nucleic acid sequence of the universal primer is the same as or partially the same as the first universal sequence of the captured oligonucleotide; The nucleic acid analogues include any one or a combination of at least two of peptide nucleic acids, locked nucleic acids, transposed bases, 2'-O,4'-C-methylene bridge RNA, 2'-O-Methyl RNA, or 2'-Fluoro RNA.

2. The composition according to claim 1, characterized in that, The methylation-dependent restriction endonucleases include any one or a combination of at least two of GlaI, FspEI, MspJI, LpnPI, AspBHI, or MseI.

3. The composition according to claim 1, characterized in that, The composition also includes a Septin9 methylation-specific complementary chain, which binds complementaryly to the methylation site to form a local double strand.

4. The composition according to claim 1, characterized in that, The composition also includes Septin9 methylation-specific primers.

5. The composition according to claim 1, characterized in that, The composition also includes a detection probe.

6. The composition according to claim 5, characterized in that, The detection probe is labeled with a fluorescent group and / or a quenching group; The fluorescent group is labeled on the 5' end of the detection probe; The quenching group is labeled on the 3' end of the detection probe; The fluorescent group includes any one of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LC RED460; The quenching group includes any one of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra.

7. The composition according to any one of claims 1-6, characterized in that, The nucleic acid sequences of the captured oligonucleotides are shown in SEQ ID NO: 1, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13; The nucleic acid sequences of the universal primers are shown in SEQ ID NO: 2 or SEQ ID NO:

14.

8. The composition according to claim 4, characterized in that, The nucleic acid sequence of the Septin9 methylation-specific primer is shown in SEQ ID NO: 3 or SEQ ID NO:

7.

9. The composition according to claim 5, characterized in that, The nucleic acid sequence of the detection probe is shown in SEQ ID NO:4 or SEQ ID NO:

8.

10. The composition according to claim 3, characterized in that, The nucleic acid sequence of the Septin9 methylation-specific complementary strand is shown in SEQ ID NO:

9.

11. A Septin9 methylation detection kit, characterized in that, The kit comprises the composition according to any one of claims 1-10.

12. The Septin9 methylation detection kit according to claim 11, characterized in that, The kit also includes DNA polymerase, dNTPs, or Mg. 2+ Any one or at least two of them.

13. The Septin9 methylation detection kit according to claim 11, characterized in that, The kit also includes enzyme digestion buffer and / or PCR buffer.

14. A Septin9 methylation detection system, characterized in that, The system comprises 1-20 nM of the capture oligonucleotide as described in claim 1, 100-400 nM of the universal primer as described in claim 1, 100-300 nM of the detection probe, 1-2 U / μL Taq polymerase, 100-300 μM dNTP, 1-5 mM MgCl2, PCR buffer, and a methylation-dependent restriction endonuclease. The system also includes 100-300 nM Septin9 methylation-specific primers.

15. The use of the composition of any one of claims 1-10, the kit of any one of claims 11-13, or the system of claim 14 in the preparation of reagents and / or devices for early diagnosis of colorectal cancer or gastric cancer.

Images