Escherichia coli pentanediamine-responsive promoter and application thereof

Abstract

The application discloses an Escherichia coli pentanediamine response promoter and application. Pyruvate carboxylase in corynebacterium glutamicum is synthesized from scratch and is heterologously expressed in Escherichia coli, and a pentanediamine response promoter PgrcA and lysine decarboxylase cadA in Escherichia coli are copied by PCR, and a PcadR-PgrcA-pyc-trc-cadA-rrnB recombination plasmid is constructed. The plasmid grows well in Escherichia coli with high lysine yield, gene expression is stable, glucose is efficiently utilized, can respond to pentanediamine, the fermentation cycle is short, and byproducts are few. It can be seen from the fermentation result that the pentanediamine yield of the recombined Escherichia coli KAGPC is significantly improved compared with a control group.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of strain metabolic modification, and particularly relates to an Escherichia coli pentanediamine response promoter and application. BACKGROUND

[0002] 1,5-Diaminopentane, also known as cadaverine or 1,5-diaminopentane, is a kind of biological amine widely existing in organisms. 1,5-Diaminopentane has a wide range of applications in industry, agriculture and medicine. In industry, 1,5-diaminopentane can be reacted with diacid to synthesize bio-based polyamide (commonly known as nylon, PA); in agriculture, it can be used for plant growth metabolism regulation, fruit quality and yield improvement; in medicine, it can be used for treating dysentery. At present, the demand for polyamide is increasing worldwide. In addition to the traditional chemical synthesis of 1,5-diaminopentane, biological methods are also maturing, gradually replacing chemical synthesis method and becoming the mainstream method for synthesizing 1,5-diaminopentane. Among them, biological methods mainly include biological catalysis and cell fermentation. Catalysis mainly uses L-lysine as raw material to generate 1,5-diaminopentane through lysine decarboxylase. However, it needs expensive coenzyme and has low reuse rate. Compared with the catalysis method, the fermentation method has the advantages of mild conditions, diverse raw materials, low production cost and controllable process. However, 1,5-diaminopentane is toxic to host bacteria, resulting in low cell production efficiency.

[0003] With the development of synthetic biology, Escherichia coli can be used as a model industrial strain to produce bulk chemicals, including 1,5-diaminopentane. However, due to the physicochemical properties of 1,5-diaminopentane, such as alkalinity and slight toxicity, it is difficult for Escherichia coli to carry out normal physiological activities in high-concentration 1,5-diaminopentane. Therefore, it is necessary to develop a promoter to meet the production needs. SUMMARY

[0004] In view of the deficiencies of the prior art, the present application provides an Escherichia coli pentanediamine response promoter and application. By mining the endogenous pentanediamine response promoter of Escherichia coli and regulating the key genes, the yield of pentanediamine is further improved to 14.1 g / L.

[0005] To solve the problems of the prior art, the technical scheme adopted by the present application is as follows:

[0006] An Escherichia coli pentanediamine response promoter, the nucleotide sequence of the promoter is shown in SEQ ID No. 7.

[0007] A recombinant plasmid PcadR-PgrcA-GFP containing the nucleotide plasmid of the above-mentioned Escherichia coli pentanediamine response promoter.

[0008] The recombinant plasmid PcadR-PgrcA-pyc-trc-cadA-rrnB is constructed by the following steps: constructing a pentamethylene diamine response promoter screening plasmid PcadR-GFP, wherein the primers of PET28a and Ptrc99a have Nco I and Xho I enzyme cutting sites, and the PcadR-GFP is obtained through homologous recombination; screening an endogenous pentamethylene diamine response promoter PgrcA of the E.coli, wherein the upstream primer of the synthesized PgrcA promoter has BglII an enzyme cutting site, the downstream primer has XbaI an enzyme cutting site, and the PcadR-PgrcA-GFP is obtained through enzyme cutting and linking; the screened response promoter PgrcA is used for regulating pyruvate carboxylase pyc of the Corynebacterium glutamicum, and lysine decarboxylase cadA is constructed on the same plasmid to construct the recombinant plasmid PcadR-PgrcA-pyc-trc-cadA-rrnB; the primers are used for amplifying the pyruvate carboxylase pyc and the lysine decarboxylase cadA, and the PcadR-PgrcA-pyc-trc-cadA-rrnB is successfully constructed through homologous recombination, and the recombinant plasmid is introduced into a cloning vector Trans1-T1; after preliminary screening through an LB plate, a single colony growing on the plate is selected for PCR verification, and the positive strain is sent for measurement.

[0009] A recombinant strain ka30-PcadR-PgrcA-pyc-trc-cadA-rrnB, which expresses the lysine high-yield E.coli ka30 of the recombinant plasmid PcadR-PgrcA-pyc-trc-cadA-rrnB.

[0010] The recombinant strain ka30-PcadR-PgrcA-pyc-trc-cadA-rrnB is applied to synthesis of pentamethylene diamine.

[0011] Beneficial effects:

[0012] Compared with the prior art, the E.coli pentamethylene diamine response promoter and application can further improve the yield of pentamethylene diamine to 14.1g / L by mining the endogenous pentamethylene diamine response promoter of the E.coli and regulating the key genes. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 For HPLC detection of the generation of pentamethylene diamine in the application, (a) is a pentamethylene diamine standard; (b) is a comparison of the yield of pentamethylene diamine in the example and the control group.

[0014] Figure 2 It is the recombinant protein expression. DETAILED DESCRIPTION

[0015] The application is further described through the description of the specific embodiments, but this is not a limitation to the application, and those skilled in the art can make various modifications or improvements according to the basic idea of the application, as long as the modifications or improvements do not deviate from the basic idea of the application, and are within the scope of the application.

[0016] The technologies not mentioned in the embodiments are the conventional technologies in the art, and in addition, the E. coli Trans1-T1, pET28a, Ptrc99a and other materials used are commercial products and can be directly purchased.

[0017] The concentrations of glucose and pentamethyldiamine mentioned in the embodiments refer to the final concentrations in the system.

[0018] Pentamethyldiamine determination method: Agilent YMC Carotenoid chromatographic column, mobile phase is 5% acetonitrile and 0.5% trifluoroacetic acid; flow rate 0.8 mL·min -1 ; differential detector.

[0019] Example 1 Construction of PcadR-GFP promoter screening plasmid

[0020] Plasmid PET28a and plasmid Ptrc99a were used as templates for PCR amplification,

[0021] PET28a was used as a template

[0022] The upstream primer has a restriction site Nco I , and the sequence is SEQ ID NO. 1:

[0023] GACGGAGCTCGAATTTTACTCTTTATCACCCAGCAGTACGGAT;

[0024] The downstream primer has a restriction site Xho I , and the sequence is SEQ ID NO. 2:

[0025] AGGAGATATACCATGATGGCCACCCCACACAT;

[0026] Ptrc99a was used as a template

[0027] The upstream primer has a restriction site Nco I , and the sequence is SEQ ID NO. 3:

[0028] CATGccatggaattcgagctcgg

[0029] The downstream primer has an enzyme cutting site Xho I , and the sequence is shown in SEQ ID NO. 4:

[0030] ccgCTCGAGaaaaggccatccgtcag.

[0031] The reaction conditions are: 95℃ 2 min, 95℃ 20 s, 55℃ 20 s, 72℃ 10 s, for a total of 30 cycles; 72℃ 5 min. The obtained sequence is recovered after 1% agarose gel electrophoresis. The recovered fragment is cut by Nco I and Xho I enzymes, and the enzyme cutting reaction system is: 10×buffer 1 μL, Nco I 1 μL, Xho I 1 μL, and 7 μL of each of the two recovered fragments. The enzyme cutting system is reacted at 37℃ for 1 hour. The two fragments have the same sticky end, and are linked by T4 ligase to form a recombinant plasmid, and the reaction system is: Takara T4 Ligase 1 μL, 10×T4 DNA Ligase Buffer 1 μL, and 4 μL of each of the two fragments. The reaction system is reacted at 25℃ for 1 hour. The ligation product is transformed into E. coli Trans1-T1, and the positive strain is screened by PCR and verified by DNA sequencing, so as to verify that the construction of the PcadR-GFP promoter screening plasmid is correct.

[0032] The GFP fluorescent protein is inserted into the PcadR-GFP promoter screening plasmid as a reporter gene for promoter screening. The GFP gene can be synthesized and amplified by PCR as a template. The sequence is as follows:

[0033] SEQ ID NO. 5

[0034] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA

[0035] PCR using the synthesized GFP gene as a template

[0036] The sequence of the used upstream primer is as SEQ ID NO. 6:

[0037] ATGGTGAGCAAGGGCGAG

[0038] The sequence of the used downstream primer is as SEQ ID NO. 7:

[0039] TACTTGTACAGCTCGTCCATGCC

[0040] The reaction conditions are: 95℃ for 2 min, 95℃ for 20 s, 55℃ for 20 s, 72℃ for 10 s, a total of 30 cycles; 72℃ for 5 min. The obtained sequence is recovered after 1% agarose gel electrophoresis. At the same time, PcadR-GFP is cut by restriction enzymes Sal I and Nco I of Takara Company, the enzyme cutting reaction system is: 10x buffer 1 μL, Nco I 1 μL, Sal I 1 μL, and 7 μL of recovered fragments. The recovered GFP gene and PcadR-GFP are connected by T4 ligase, and the reaction system is: 1 μL of T4 Ligase of Takara Company, 1 μL of 10x T4 DNA Ligase Buffer, and 4 μL of each of the two fragments. The reaction system is reacted at 25℃ for 1 hour. The ligation product is transformed into Escherichia coli Trans1-T1, and the positive strain PcadR-GF is screened by PCR and verified by DNA sequencing

[0041] Example 2 Construction of PcadR-PgrcA-GFP plasmid

[0042] Through transcriptome analysis of genes responsive to pentanediamine in Escherichia coli, the transcription analysis method and results can be seen: Wang X, Guo X, Wang J, et al. Ameliorating end-product inhibition to improve cadaverine production in engineered Escherichia coli and its application in the synthesis of bio-based diisocyanates [J]. Synthetic and Systems Biotechnology, 2021, 6(4):243-253. The promoter PgrcA is obtained by confirming the start codon,

[0043] The nucleotide sequence of the pentanediamine down-regulated promoter PgrcA is shown in SEQ ID No. 8:

[0044] TTGCGACCATACTTGATGTGTGGTTTTTATTGATTTAAATCAAAGATTCAAGGGTGTTTGAGGAGTATATATACACTCAAGCAACAATGGTTTTACCAATTGGCCGCGACAGGCTGAACAAATCAAATAATTTTGCCGGGGAGGCATCAC

[0045] The genome of E. coli Trans1-T1 was used as a template, and the upstream and downstream sequences of the promoter were used as primers.

[0046] The upstream primer used had a restriction site Xbal I , and the sequence was as shown in SEQ ID NO. 9:

[0047] AGATCTTTGCGACCATACTTGATGT.

[0048] The downstream primer had a restriction site Bgll II , and the sequence was as shown in SEQ ID NO. 10:

[0049] TCTAGAGTGATGCCTCCCCGGC.

[0050] The reaction conditions were as follows: 95℃ for 2 min, 95℃ for 20 s, 55℃ for 20 s, 72℃ for 10 s, for a total of 30 cycles; and 72℃ for 5 min. The obtained sequence was subjected to 1% agarose gel electrophoresis, and the corresponding fragment was recovered. The recovered fragment and the recombinant plasmid PcadR-GFP constructed above were subjected to restriction enzyme digestion with Takara's restriction enzymes Xbal I and Bgll II , and the enzyme digestion reaction system was as follows: 10×buffer 1 μL, Xbal I 1 μL, Bgll II 1 μL, and recovered fragment 7 μL. The recovered promoter and PcadR-GFP promoter screening plasmid were connected using T4 ligase, and the reaction system was as follows: Takara's T4 Ligase 1 μL, 10×T4 DNA Ligase Buffer 1 μL, and the two fragments were each 4 μL. The reaction system was reacted at 25℃ for 1 hour. The ligation product was transformed into E. coli Trans1-T1, and positive strains were screened by PCR and verified by DNA sequencing, thereby verifying that the recombinant plasmid PcadR-PgrcA-GFP was constructed correctly.

[0051] Example 3 Characterization of the response promoter PgrcA

[0052] The positive strain of Example 2 was inoculated into LB liquid medium containing different concentrations of pentamethylene diamine in a 96-well plate, and the composition of the LB liquid medium was as follows: 10 g / L of proteose peptone, 5 g / L of yeast powder, and 5 g / L of sodium chloride, and the concentration of pentamethylene diamine was 0 g / L, 10 g / L, 20 g / L, 30 g / L, and 40 g / L, respectively. The culture was incubated at 37℃ and 200 rpm for overnight. The biomass (OD 600) and fluorescence value (GFP), and calculate GFP / OD 600 The promoter PgrcA, which showed a good response to pentanediamine, was selected.

[0053] Example 4 Construction of Trans1-PcadR-PgrcA-pyc expression strain

[0054] With pyruvate carboxylase ( pyc Using the genome of Corynebacterium glutamicum (available at China General Microbiological Culture Collection Center, number ATCC13032) (as shown in SEQ NO.12) as a template, the nucleotide sequence of pyruvate carboxylase was amplified by conventional PCR.

[0055] The upstream primer used has a homologous arm, and its sequence is shown in SEQ ID NO.11:

[0056] CATCGCCACCGTGTCGATTCACACATCTTCAACG

[0057] The downstream primer has a homologous arm, the sequence of which is shown in SEQ ID NO.12:

[0058] GCAGGTCGACTTAGGAAACGACGACGATCAAGTC

[0059] The reaction conditions were: 95℃ for 2 min, 95℃ for 15 s, 55℃ for 20 s, 72℃ for 210 s, for a total of 30 cycles; followed by 72℃ for 5 min. The obtained sequences were recovered by 1% agarose gel electrophoresis.

[0060] The GFP gene was deleted from the PcadR-PgrcA-GFP plasmid. The required PCR primers are as follows:

[0061] The upstream primer used has a homologous arm, and its sequence is shown in SEQ ID NO.13:

[0062] GAGTCGACACGGTGGCGATGGATCCG

[0063] The downstream primer has a homologous arm, the sequence of which is shown in SEQ ID NO.14:

[0064] CGTTTCCTAAAGTTGGCTGCTGCCAC

[0065] The reaction conditions are: 95 °C for 2 min, 95 °C for 15 s, 55 °C for 20 s, 72 °C for 210 s, for a total of 30 cycles; 72 °C for 5 min. The obtained sequence is recovered after 1% agarose gel electrophoresis. The two fragments obtained by the above PCR amplification are subjected to homologous recombination through the homologous arms to obtain a recombinant plasmid, and the recombination reaction system is: 5 X CE II buffer 4 μL, Exnase II 2 μL, and two basic fragments 7 μL each, which are connected at 37 °C for 1 hour. The ligation product is transformed into E. coli Trans1-T1. The positive strain Trans1-PcadR-PgrcA-pyc is screened by PCR and subjected to DNA sequencing to verify that the recombinant plasmid PcadR-PgrcA-pyc is constructed correctly.

[0066] Nucleotide sequence of the synthetic pyruvate carboxylase gene pyc from Corynebacterium glutamicum

[0067] SEQ ID No. 15

[0068]

[0069] Example 5 Construction of BL21(DE3)-PcadR-grcA-pyc-trc-cadA recombinant strain

[0070] Lysine decarboxylase cadA was obtained from strain KA30, which was obtained from CN113817762A. The lysine decarboxylase (cadA) was amplified by conventional PCR using the gene as a template

[0071] The upstream primer used has a homologous arm, and the sequence is shown as SEQ ID NO. 16:

[0072] GCTGCTAACATTGCGACCATACTTGATGTGTG

[0073] The downstream primer has a homologous arm, and the sequence is shown as SEQ ID NO. 17:

[0074] GCAGCCAACTTTAGGAAACGACGACGATCAAGTC

[0075] The reaction conditions are: 95°C for 2 min, 95°C for 15 s, 55°C for 20 s, 72°C for 180 s, for a total of 30 cycles; 72°C for 5 min. The obtained sequence was recovered after 1% agarose gel electrophoresis. The vector plasmid PcadR-PgrcA-pyc was linearized by PCR, and the PCR primers used are as follows:

[0076] The upstream primer used has a homologous arm, and the sequence is shown as SEQ ID NO. 18:

[0077] ATGGTCGCAATGTTAGCAGCCGGATCTCA

[0078] The downstream primer used has a homologous arm, and the sequence is shown as SEQ ID NO. 19:

[0079] CGTTTCCTAAAGTTGGCTGCTGCCAC

[0080] The reaction conditions were: 95 °C for 2 min, 95 °C for 15 s, 55 °C for 20 s, 72 °C for 360 s, for a total of 30 cycles; 72 °C for 5 min. The obtained sequence was recovered after 1% agarose gel electrophoresis. The target fragment and the vector fragment were combined into a new plasmid by homologous recombination. The homologous recombination system used was as follows: 5 X CE II buffer 4 μL, Exnase II 2 μL, gene fragment 7 μL, vector 7 μL, all from Vazyme. The ligation was reacted at 37 °C for 1 hour. The ligation product was transformed into Trans1 E. coli, and positive strain Trans1-PcadR-PgrcA-pyc-trc-cadA-rrnB was screened by PCR and DNA sequencing to verify that the recombinant plasmid Trans1-PcadR-PgrcA-pyc-trc-cadA-rrnB was constructed correctly. The recombinant strain was cultured overnight in LB / Kan 5 mL medium, the plasmid was extracted using a Genoripta plasmid extraction kit and transformed into BL21(DE3) to construct BL21(DE3)-PcadR-PgrcA-pyc-trc-cadA recombinant strain.

[0081] The nucleic acid sequence of the synthetic lysine decarboxylase gene CadA is shown in SEQ ID No. 20:

[0082]

[0083] Example 6 Expression of pyruvate carboxylase and lysine decarboxylase

[0084] The obtained BL21(DE3)-PcadR-PgrcA-pyc-trc-cadA recombinant strain was cultured in 100 mL of LB medium in a 500 mL conical flask at 37℃ and 200 rpm. When the OD 600 600 value reached 0.4-0.6, 1‰ IPTG was added for induction, the induction temperature was 18℃, and the bacteria were collected after 24 hours of culture and ultrasonic disruption. The supernatant and precipitate after centrifugation of the disrupted bacterial solution were separated, and the supernatant and precipitate were verified by running a protein gel. Figure 2

[0085] Example 7 Introduction of recombinant plasmid PcadR-PgrcA-pyc-trc-cadA into lysine high-yield Escherichia coli strain ka30, the strain obtained from CN113817762A

[0086] The plasmid of the recombinant strain in Example 5 above was extracted using a Geneseed plasmid extraction kit, and the extracted recombinant plasmid was introduced into the competent lysine high-yield Escherichia coli for fermentation verification ka30-PcadR-PgrcA-pyc-trc-cadA.

[0087] Method for preparing Escherichia coli competence:

[0088] A single colony was picked on an LB plate and then inoculated into a shake tube (LB medium), and cultured at 37℃ and 200 rpm for 10-12h. Then, 1% of the inoculum was transferred to 50ml of liquid LB medium in a 500ml shake flask, and cultured at 37℃ and 200 rpm. When the optical density value OD 600 of the bacterial solution grew to 0.4-0.5, the shake flask was placed on ice for ice bath for 20 min (stop growth activity), and then centrifuged at 4000 rpm for 10 min at 4℃ in a pre-cooled centrifuge. After removing the supernatant, the bacterial cells were collected. The bacterial cells were resuspended with 10 mL of 0.1 mol / L pre-cooled (4℃) CaCl2 solution containing 20% glycerol, and placed on ice for 15 min. Then, the bacterial cells were centrifuged at 4000 rpm for 10 min at 4℃ (this step was repeated twice). After removing the supernatant, 1 mL of 0.1 mol / L CaCl2 solution containing 15% glycerol pre-cooled in the refrigerator was added to resuspend the cells, and the competent cell suspension was prepared after placing on ice for 5 min. The competent cell suspension was aliquoted into 80μL / tube and stored at -80℃. -1

[0089] ​​Example 8 Fermentation verification of recombinant E. coli ka30-PcadR-PgrcA-pyc-trc-cadA one-step method for producing putrescine

[0090] The recombinant E. coli was inoculated into 5 ml of seed medium (the formula of the seed medium is shown in Table 1) in a 50 ml centrifuge tube, and enriched to OD 600 0.8, the enriched seed medium was inoculated into 30 ml of fermentation medium (the formula of the fermentation medium is shown in Table 2), and 20 g / L of initial sugar was added, when the OD 600 0.6, the expression of lysine decarboxylase was induced by adding inducer IPTG, and samples were taken at 24 h and 48 h of fermentation, respectively, to measure the residual sugar content and putrescine yield, until the fermentation ended when the residual sugar was consumed.

[0091] Table 1 Formula of the liquid medium of the seed liquid

[0092] Table 2 Formula of the liquid medium of the fermentation liquid

[0093]

[0094] The present application further improves the yield of E. coli fermentation to reach 14.1 g / L by mining the endogenous putrescine response promoter in E. coli, obtaining the putrescine response promoter PgrcA and using it for the expression regulation of key genes, which has good market prospects. SEQUENCE LISTING <110> Nanjing University of Technology <120> A putrescine response promoter of E. coli and application <160> 20 <170> SIPOSequenceListing 1.0 <210> 1 <211> 43 <212> DNA <213> Artificial Sequence <400> 1 gacggagctc gaattttact ctttatcacc cagcagtacg gat 43 <210> 2 <211> 32 <212> DNA <213> Artificial Sequence <400> 2 aggagatata ccatgatggc caccccacac at 32 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <400> 3 catgccatgg aattcgagct cgg 23 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <400> 4 ccgctcgaga aaaggccatc cgtcag 26 <210> 5 <211> 720 <212> DNA <213> Artificial Sequence <400> 5 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60 ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120 ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180 ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240 cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300 ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360 gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420 aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480 ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540 gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600 tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660 ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <400> 6 atggtgagca agggcgag 18 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <400> 7 tacttgtaca gctcgtccat gcc 23 <210> 8 <211> 150 <212> DNA <213> Artificial Sequence <400> 8 ttgcgaccat acttgatgtg tggtttttat tgatttaaat caaagattca agggtgtttg 60 aggagtatat atacactcaa gcaacaatgg ttttaccaat tggccgcgac aggctgaaca 120 aatcaaataa ttttgccggg gaggcatcac 150 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <400> 9 agatctttgc gaccatactt gatgt 25 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <400> 10 tctagagtga tgcctccccg gc 22 <210> 11 <211> 34 <212> DNA <213> Artificial Sequence <400> 11 catcgccacc gtgtcgattc acacatcttc aacg 34 <210> 12 <211> 34 <212> DNA <213> Artificial Sequence <400> 12 gcaggtcgac ttaggaaacg acgacgatca agtc 34 <210> 13 <211> 26 <212> DNA <213> Artificial Sequence <400> 13 gagtcgacac ggtggcgatg gatccg 26 <210> 14 <211> 26 <212> DNA <213> Artificial Sequence <400> 14 cgtttcctaa agttggctgc tgccac 26 <210> 15 <211> 3423 <212> DNA <213> Artificial Sequence <400> 15 gtgtcgactc acacatcttc aacgcttcca gcattcaaaa agatcttggt agcaaaccgc 60 ggcgaaatcg cggtccgtgc tttccgtgca gcactcgaaa ccggtgcagc cacggtagct 120 atttaccccc gtgaagatcg gggatcattc caccgctctt ttgcttctga agctgtccgc 180 attggtaccg aaggctcacc agtcaaggcg tacctggaca tcgatgaaat tatcggtgca 240 gctaaaaaag ttaaagcaga tgccatttac ccgggatacg gcttcctgtc tgaaaatgcc 300 cagcttgccc gcgagtgtgc ggaaaacggc attactttta ttggcccaac cccagaggtt 360 cttgatctca ccggtgataa gtctcgcgcg gtaaccgccg cgaagaaggc tggtctgcca 420 cagcttgccc gcgagtgtgc ggaaaacggc attactttta ttggcccaac cccagaggtt 360gttttggcgg aatccacccc gagcaaaaac atcgatgaga tcgttaaaag cgctgaaggc 480 cagacttacc ccatctttgt gaaggcagtt gccggtggtg gcggacgcgg tatgcgtttt 540 gttgcttcac ctgatgagct tcgcaaatta gcaacagaag catctcgtga agctgaagcg 600 gctttcggcg atggcgcggt atatgtcgaa cgtgctgtga ttaaccctca gcatattgaa 660 gtgcagatcc ttggcgatca cactggagaa gttgtacacc tttatgaacg tgactgctca 720 ctgcagcgtc gtcaccaaaa agttgtcgaa attgcgccag cacagcattt ggatccagaa 780 ctgcgtgatc gcatttgtgc ggatgcagta aagttctgcc gctccattgg ttaccagggc 840 gcgggaaccg tggaattctt ggtcgatgaa aagggcaacc acgtcttcat cgaaatgaac 900 ccacgtatcc aggttgagca caccgtgact gaagaagtca ccgaggtgga cctggtgaag 960 gcgcagatgc gcttggctgc tggtgcaacc ttgaaggaat tgggtctgac ccaagataag 1020 atcaagaccc acggtgcagc actgcagtgc cgcatcacca cggaagatcc aaacaacggc 1080 ttccgcccag ataccggaac tatcaccgcg taccgctcac caggcggagc tggcgttcgt 1140 cttgacggtg cagctcagct cggtggcgaa atcaccgcac actttgactc catgctggtg 1200 aaaatgacct gccgtggttc cgactttgaa actgctgttg ctcgtgcaca gcgcgcgttg 1260 gctgagttca ccgtgtctgg tgttgcaacc aacattggtt tcttgcgtgc gttgctgcgg 1320 gaagaggact tcacttccaa gcgcatcgcc accggattca ttgccgatca cccgcacctc 1380 cttcaggctc cacctgctga tgatgagcag ggacgcatcc tggattactt ggcagatgtc 1440 accgtgaaca agcctcatgg tgtgcgtcca aaggatgttg cagctcctat cgataagctg 1500 cctaacatca aggatctgcc actgccacgc ggttcccgtg accgcctgaa gcagcttggc 1560 ccagccgcgt ttgctcgtga tctccgtgag caggacgcac tggcagttac tgataccacc 1620 ttccgcgatg cacaccagtc tttgcttgcg acccgagtcc gctcattcgc actgaagcct 1680 gcggcagagg ccgtcgcaaa gctgactcct gagcttttgt ccgtggaggc ctggggcggc 1740 gcgacctacg atgtggcgat gcgtttcctc tttgaggatc cgtgggacag gctcgacgag 1800 ctgcgcgagg cgatgccgaa tgtaaacatt cagatgctgc ttcgcggccg caacaccgtg 1860 ggatacaccc cgtacccaga ctccgtctgc cgcgcgtttg ttaaggaagc tgccagctcc 1920 ggcgtggaca tcttccgcat cttcgacgcg cttaacgacg tctcccagat gcgtccagca 1980 atcgacgcag tcctggagac caacaccgcg gtagccgagg tggctatggc ttattctggt 2040 gatctctctg atccaaatga aaagctctac accctggatt actacctaaa gatggcagag 2100 gagatcgtca agtctggcgc tcacatcttg gccattaagg atatggctgg tctgcttcgc 2160 ccagctgcgg taaccaagct ggtcaccgca ctgcgccgtg aattcgatct gccagtgcac 2220 gtgcacaccc acgacactgc gggtggccag ctggcaacct actttgctgc agctcaagct 2280 ggtgcagatg ctgttgacgg tgcttccgca ccactgtctg gcaccacctc ccagccatcc 2340 ctgtctgcca ttgttgctgc attcgcgcac acccgtcgcg ataccggttt gagcctcgag 2400 gctgtttctg acctcgagcc gtactgggaa gcagtgcgcg gactgtacct gccatttgag 2460 tctggaaccc caggcccaac cggtcgcgtc taccgccacg aaatcccagg cggacagttg 2520 tccaacctgc gtgcacaggc caccgcactg ggccttgcgg atcgtttcga actcatcgaa 2580 gacaactacg cagccgttaa tgagatgctg ggacgcccaa ccaaggtcac cccatcctcc aaggttgttg gcgacctcgc actccacctc gttggtgcgg gtgtggatcc agcagacttt 2700 gctgccgatc cacaaaagta cgacatccca gactctgtca tcgcgttcct gcgcggcgag cttggtaacc ctccaggtgg ctggccagag ccctgcgca cccgcgcact ggaaggccgc tccgaaggca aggcacctct gacggaagtt cctgaggaag agcaggcgca cctcgacgct gatgattcca aggaacgtcg caatagcctc aaccgcctgc tgttcccga gccaaccga gagttcctcg agcaccgtcg ccgcttcggc aacacctctg cgctggatga tcgtgaattc ttctacggcc tggtcgaagg ccgcgagact ttgatccgcc tgccagatgt gcgcacccca 3060 ctgcttgttc gcctggatgc gatctctgag ccagacgata agggtatgcg caatgttgtg 3120. gccaacgtca acggccagat ccgcccaatg cgtgtgcgtg accgctccgt tgagtctgtc 3180 accgcaaccg cagaaaaggc agattcctcc aacaagggcc atgttgctgc accattcgct ggtgttgtca ccgtgactgt tgctgaaggt gatgaggtca aggctggaga tgcagtcgca GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAG 36 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAG 36 taa 36 <210> 16 <211> 32 <212> DNA <213> Artificial Sequence <400> 16 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAG 36 <210> 17 <211> 34 <212> DNA <213> Artificial Sequence <400> 17 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAG 36 <210> 18 <211> 29 <212> DNA <213> Artificial Sequence <400> 18 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAG 36 <210> 19 <211> 26 <212> DNA <213> Artificial Sequence <400> 19 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAG 36 <210> 20 <211> 2126 <212> DNA <213> Artificial Sequence <400> 20 atgaacgtta ttgcaatatt gaatcacatg ggggtttatt ttaaagaaga acccatccgt 60 gaacttcatc gcgcgcttga acgtctgaac ttccagattg tttacccgaa cgaccgtgac 120 gacttattaa aactgatcga aaacaatgcg cgtctgtgcg gcgttatttt tgactgggat 180 aaatataatc tcgagctgtg cgaagaaatt agcaaaatga acgagaacct gccgttgtac 240 gcgttcgcta atacgtattc cactctcgat gtaagcctga atgacctgcg tttacagatt 300 agcttctttg aatatgcgct gggtgctgct gaagatattg ctaataagat caagcagacc 360 actgacgaat atatcaacac tattctgcct ccgctgacta aagcactgtt taaatatgtt 420 cgtgaaggta aatatacttt ctgtactcct ggtcacatgg gcggtactgc attccagaaa 480 agcccggtag gtagcctgtt ctatgatttc tttggtccga ataccatgaa atctgatatt 540 tccatttcag tatctgaact gggttctctg ctggatcaca gtggtccaca caaagaagca 600 gaacagtata tcgctcgcgt ctttaacgca gaccgcagct acatggtgac caacggtact 660 tccactgcga acaaaattgt tggtatgtac tctgctccgg caggcagcac cattctgatt 720 gaccgtaact gccacaaatc gctgacccac ctgatgatga tgagcgatgt tacgccaatc 780 tatttccgcc cgacccgtaa cgcttacggt attcttggtg gtatcccaca gagtgaattc 840 cagcacgcta ccattgctaa gcgcgtgaaa gaaacaccaa acgcaacctg gccggtacat 900 gctgtaatta ccaactctac ctatgatggt ctgctgtaca acaccgactt catcaagaaa 960 acactggatg tgaaatccat ccactttgac tccgcgtggg tgccttacac caacttctca 1020 ccgatttacg aaggtaaatg cggtatgagc ggtggccgtg tagaagggaa agtgatttac 1080 gaaacccagt ccactcacaa actgctggcg gcgttctctc aggcttccat gatccacgtt 1140 aaaggtgacg taaacgaaga aacctttaac gaagcctaca tgatgcacac caccacttct 1200 ccgcactacg gtatcgtggc gtccactgaa accgctgcgg cgatgatgaa gggtaatgct 1260 ggtaagcgtc tgatcaacgg ttccattgaa cgtgcgatca aattccgtaa agagatcaaa 1320 cgtctgagaa cggaatctga tggctggttc tttgatgttt ggcagccgga tcatatcgat 1380 acgactgaat gctggccgct gcgttctgac agcacctggc acggcttcaa aaacatcgat 1440 aacgagcaca tgtatcttga cccgatcaaa gtcaccctgc tgactccggg gatggaaaaa 1500 gacggcacca tgagcgactt tggtattccg gccagcatcg tggcgaaata cctcgacgaa 1560 catggcatcg ttgttgagaa aaccggtccg tataacctgc tgttcctgtt cagcatcggt 1620 atcgataaga ccaaagcact gagcctgctg cgtgctctga ctgacttcaa acgtgcgttc 1680 gacctgaacc tgcgtgtgaa aaacatgctg ccgtctctgt atcgtgaaga tcctgaattc 1740 tatgaaaaca tgcgtattca ggaactggct caaaatatcc acaaactgat tgttcaccac 1800 aatctgccgg atctgatgta tcgcgcattt gaagtgctgc cgacgatggt aatgactccg 1860 tatgctgcgt tccagaaaga gctgcacggt atgaccgaag aagtttacct cgacgaaatg 1920 gtaggtcgta ttaacgccaa tatgatcctt ccgtatccgc cgggagttcc tctggtaatg 1980 ccgggtgaaa tgatcaccga agaaagccgt ccggttctgg agttcctgca gatgctgtgt 2040 gaaatcggcg ctcactatcc gggctttgaa accgatattc acggtgcata ccgtcaggct 2100 gatggccgct ataccgttaa ggtatt 2126

Claims

1. An Escherichia coli pentanediamine-responsive promoter PgrcA, characterized in that, The nucleotide sequence of the promoter is shown as SEQ ID No.

8. The nucleotide sequence of the promoter is shown as SEQ ID No. 8.

Images