A molecular marker related to watermelon tendril degeneration and self-topping and its application

Abstract

The present invention discloses a molecular marker related to watermelon tendril degeneration and self-capping and its application. The present invention performs whole genome sequencing on watermelon tendril degeneration and self-capping material TL-DF and normal tendril unlimited growth material Sanbaigua, develops SNP and INDEL molecular markers by comparing the sequence with the reference genome 97103v2, and uses TL-DF and Sanbaigua to hybridize and then construct BC1 and F2 segregation populations respectively, and finds that tendril degeneration and self-capping traits co-appear and are controlled by the same gene locus. The tendril degeneration and self-capping genes are preliminarily located on watermelon chromosome 4 by the BSA-seq method, and then the tendril degeneration and self-capping genes are finely located by using the BC1 segregation population, and a molecular marker ID_PB3 co-segregated with the two traits is developed. It is proved by experiments that the molecular marker ID_PB3 of the present invention is co-segregated with tendril degeneration and self-capping traits in the natural population of watermelon, and can be used for molecular marker-assisted breeding of watermelon.

Description

Technical Field

[0001] The invention belongs to the technical field of watermelon molecular breeding, and particularly relates to a molecular marker related to watermelon tendril degeneration and self-topping and an application thereof. Background Art

[0002] Watermelon (Citrullus lanatus) is an important economic crop, widely cultivated around the world. According to the United Nations Food and Agriculture Organization database (FAOSTAT), in 2018, my country's cultivated area reached 1.51 million hm2, accounting for 46.58% of the world's total area, and the total output exceeded 60 million tons, accounting for 60.64% of the world's total output. The watermelon industry has become one of the important pillar industries for the development of my country's agricultural economy.

[0003] Watermelon is a vine-growing cucurbit crop. Under normal circumstances, a lateral vine is produced in the axil of each leaf, and its inflorescence is of unlimited growth type. A large number of branches and unlimited growth require a lot of time and labor to prune and top the watermelon in production. Therefore, improving the plant shape of watermelon and cultivating new varieties with less branches and self-capping types are an important means to achieve light and simplified cultivation of watermelon. Among cucurbit crops, there is very little research on the natural capping (self-capping) trait, and this trait is also less used in production. It is currently only used in cucumbers in small quantities. In the early stage of the present invention, a watermelon tendril degeneration and self-capping mutant material was obtained. After 7 consecutive generations of self-pollination, a stable hereditary tendril degeneration and self-capping inbred line was obtained, which was named TL-DF. Further analysis of the inheritance of the self-capping trait, positioning the self-capping related genes and developing molecular markers will greatly promote the molecular breeding of new watermelon self-capping varieties, and provide variety reserves for light and simplified cultivation of watermelon.

[0004] Compared with traditional breeding, molecular marker-assisted selection can achieve the selection of target traits at the seedling stage, and has the advantages of good stability, high sensitivity, and simple operation. At the same time, it can greatly reduce labor, shorten the breeding cycle, and improve breeding efficiency. Analyzing the inheritance of watermelon tendril degeneration and self-topping traits and developing stable and reliable molecular markers are important tasks for future watermelon plant type improvement and molecular-assisted breeding. At present, the regulatory mechanism of watermelon tendril degeneration and self-topping traits is still unclear, and further gene mapping is needed to develop breeding molecular markers that are closely linked to this trait. Summary of the invention

[0005] In order to improve the efficiency of watermelon plant shape improvement, the present invention provides an InDel molecular marker (insertion-deletion) related to the watermelon tendril degeneration and self-capping traits. The present invention constructs BC1 and F2 segregation populations by hybridizing the watermelon material TL-DF with degenerated tendrils and self-capping with the normal tendril unlimited growth type material Sanbaigua, identifies the correlation between the two traits, conducts fine positioning of the tendril degeneration and self-capping related genes, and develops InDel molecular markers closely linked to the tendril degeneration and self-capping traits. The InDel molecular markers can be used to accurately and quickly identify whether the tendril of the watermelon is degenerated and the growth type (self-capping or unlimited growth type) at the seedling stage, thereby improving the efficiency of watermelon plant shape improvement.

[0006] The purpose of the invention is to provide an InDel molecular marker related to the watermelon tendril degeneration and self-topping traits.

[0007] Another object of the present invention is to provide a primer set for detecting the above-mentioned InDel marker.

[0008] Another object of the present invention is to provide a method for identifying the degeneration and self-topping characteristics of watermelon tendrils at the seedling stage.

[0009] Another object of the present invention is to provide a product for identifying whether watermelon tendrils are degenerated and the growth type.

[0010] Another object of the present invention is to provide the application of the above-mentioned InDel molecular marker in watermelon plant shape molecular assisted selection breeding.

[0011] The technical solution provided by the present invention is as follows:

[0012] The present invention provides an InDel molecular marker related to the tendril degeneration and self-topping traits of watermelon. The InDel molecular marker is ID_PB3, and its nucleotide sequence in watermelons with tendrils and indefinite growth is shown in Sequence 1, and its nucleotide sequence in watermelons with tendril degeneration and self-topping is shown in Sequence 2.

[0013] The InDel molecular marker of the present invention has a 3 bp insertion at the 67th base from the 5' end of the sequence in the tendril degeneration and self-capping material compared with the tendril-indefinite growth material, and the insertion is located in chromosome 4 of the watermelon genome (97103v2). The watermelon with 3 bp inserted in the site shows that the tendril is degenerated and self-capping, and the watermelon with no base inserted in the InDel site shows that the tendril is present and grows indefinitely.

[0014] The present invention provides a primer set for detecting the above-mentioned specific InDel molecular marker, wherein the specific primer pair of the InDel molecular marker is composed of two single-stranded DNAs, wherein the upstream primer (sequence 3) is: 5'-GATTATAACTTGAAAACAAAACACATGAGTGG-3'; the downstream primer (sequence 4) is: 5'-TTTTTCTCTTTTTGTGAGTTCAATGTAGCCTG-3'. The length of the amplified fragment of the primer pair is 121 bp or 124 bp.

[0015] The present invention provides a method for identifying watermelon tendril degeneration and self-topping traits at the seedling stage, the method comprising the following steps:

[0016] DNA extraction: The genomic DNA of the cotyledon tissue of each individual plant of the watermelon population material was extracted using the CTAB method (Paterson et al. 1993);

[0017] PCR amplification: Using the watermelon genomic DNA to be tested as a template, the above primers are used to perform PCR amplification on the sample to be tested;

[0018] Genotyping: The base type of the InDel site was identified by polyacrylamide gel electrophoresis. The watermelon material without base insertion at the InDel site was of the infinite growth type with tendrils, and the watermelon material with 3bp base added at the InDel site had degenerated tendrils and self-capping.

[0019] The reaction system of the PCR amplification is: 20 μL of 1.3×PCR Mix, 3 μL of DNA, 1 μL of upstream primer, and 1 μL of downstream primer.

[0020] The reaction procedure of the PCR amplification is: 98°C for 2 min; 98°C for 10 sec, 56°C for 10 sec, 72°C for 10 sec, for a total of 35 cycles; 72°C for 5 min; and storage at 4°C.

[0021] The present invention provides a product for identifying whether the tendril of a watermelon material is degenerated and the inflorescence type. The product is a primer pair consisting of sequence 3 and sequence 4; or a PCR reagent containing a primer pair consisting of sequence 3 and sequence 4; or a kit of PCR reagents containing a primer pair consisting of sequence 3 and sequence 4.

[0022] The present invention provides an application of InDel molecular marker ID_PB3 in molecular assisted selection breeding of watermelon plant shape, and uses InDel marker ID_PB3 to perform molecular marker identification of tendril-free and self-capping traits in relevant breeding populations such as TL-DF and three white melons. Through detection, the watermelon plant with no base insertion at the 67th position of the InDel marker ID_PB3 is an unlimited growth type with tendrils, and the watermelon plant with 3bp base inserted at the 67th position of the InDel marker ID_PB3 is a tendril-degenerated and self-capping type. Therefore, the above-mentioned InDel marker can select the presence or absence of tendrils and the self-capping trait at the seedling stage, which provides great convenience for the identification of the presence or absence of tendrils and the self-capping traits of backcross progeny and their derivative lines, and can reduce labor, save costs, and improve breeding efficiency.

[0023] The present invention mines SNP and InDel (Insertion / Deletion) markers based on the genome resequencing information of TL-DF and Sanbaigua by sequence alignment with the reference genome 97103v2. BC1 and F2 segregation populations are constructed by hybridization and backcrossing or self-pollination of TL-DF and Sanbaigua, and the extreme phenotype plants in the F2 population are mixed and BSA-seq analyzed to preliminarily locate the tendril degeneration and self-capping trait genes, and then the BC1 segregation population is used to finely locate the gene, and the InDel molecular marker ID_PB3 that is closely linked to the tendril degeneration and self-capping traits is developed. Experiments have proved that the molecular marker ID_PB3 of the present invention is co-segregated with the tendril degeneration and self-capping traits of watermelon, thereby achieving the purpose of molecular assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a diagram showing the preliminary localization results of the tendril degeneration and self-capping genes in Example 1;

[0025] Figure 2 Fine-scale mapping of genes responsible for tendril degeneration and self-topping in watermelon. DETAILED DESCRIPTION

[0026] The present invention is further illustrated below by detailed description of specific embodiments, but it is not intended to limit the present invention and is merely an example.

[0027] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0028] Unless otherwise specified, the consumables, reagents, etc. used in the following examples can be obtained from commercial sources.

[0029] Example 1. Obtaining InDel marker ID_PB3 for co-segregation of watermelon tendril degeneration and self-capping genes

[0030] 1. Materials and Group Construction

[0031] With TL-DF (watermelon material with degenerated tendrils and self-capping) as the female parent and Sanbaigua (watermelon material with normal and unlimited growth of tendrils) as the male parent, the F1 generation was obtained by hybridization with the above-mentioned TL-DF female parent and Sanbaigua as the male parent. The F1 generation was backcrossed with TL-DF to obtain the BC1P1 generation population, and the F1 generation was self-pollinated to obtain the F2 generation population.

[0032] 2. Preliminary localization of tendril degeneration and self-capping genes

[0033] In the spring of 2021, the parent TL-DF, three white melons, F1 generation plants, 113 F2 plants, and 62 BC1 plants were planted in Wuhan, and the tendril degeneration and self-topping traits were identified, genetically analyzed, and genes were initially located for the parents, F1 generation, F2 populations, and BC1 populations. Observations of the BC1 and F2 populations revealed that the presence of tendrils was dominant over tendril degeneration, and unlimited growth was dominant over self-topping. Moreover, the tendril degeneration and self-topping traits were simultaneously expressed in all population plants. Statistical analysis showed that the tendril degeneration and self-topping traits were controlled by the same single gene (Table 1). The extreme phenotypic plants in the 113 F2 populations were mixed and analyzed by BSA-seq, and the tendril degeneration and self-topping genes were preliminarily located in the 4.97Mb interval of chromosome 4 of watermelon, such as Figure 1 shown.

[0034] Table 1 Genetic analysis of tendril degeneration and self-topping traits

[0035]

[0036]

[0037] 3. Fine mapping of tendril degeneration and self-capping genes

[0038] 1. Molecular marker development

[0039] The whole genome resequencing of parental materials TL-DF and Sanbaigua was performed, and the sequencing reads were aligned to the reference genome (97103v2, http: / / cucurbitgenomics.org / organism / 21). The software GATK (Genome Analysis ToolKit) was used to detect the variation between the two parental materials, and a total of 220,368 SNPs and 39,453 InDels were obtained in the whole genome.

[0040] A total of 11 InDel molecular markers (ID_PA1-ID_PA11) were developed within the initially located 4.97 Mb interval, with a density of approximately 500 Kb.

[0041] The above primers were synthesized by the Wuhan Synthesis Department of Beijing Qingke Xinye Biotechnology Co., Ltd.

[0042] The InDel marker detection of all materials in this experiment was carried out by polyacrylamide gel electrophoresis. The sample DNA extraction, PCR reaction and electrophoresis test involved in the experiment were completed by Wuhan Kinosek Technology Co., Ltd.

[0043] 2. Fine-map co-segregated InDels

[0044] The above 11 InDel markers were used to detect the genotypes of 113 F2 plants, and the target gene was further narrowed down to an interval of about 460Kb on chromosome 4 combined with the phenotypes of the F2 plants. In the autumn of 2021, a large BC1 segregation population containing 1,156 plants was sown in Wuhan. During the seedling stage, the genotypes of all plants were detected using markers on both sides of the target interval. 94 exchange plants were screened and planted in the field for phenotypic identification. At the same time, 30 non-exchange plants were randomly selected for planting for phenotypic verification. InDel markers were continued to be developed within the 460Kb interval and exchange plants were tested. Finally, the tendril degeneration and self-topping genes were located between markers ID_PB2 and ID_PB4. Marker ID_PB3 was co-segregated with the tendril degeneration and self-topping traits, such as Figure 2 shown.

[0045] The sequence of the marker ID_PB3 co-segregating with the tendril degeneration and self-capping traits is as follows:

[0046] ID_PB3-F (upstream primer sequence): 5′-GATTATAACTTGAAAACAAAACACATGAGTGG-3′ (sequence 3);

[0047] ID_PB3-R (downstream primer sequence): 5'-TTTTTCTCTTTTTGTGAGTTCAATGTAGCCTG-3' (SEQ ID NO: 4).

[0048] 4. Verification of ID_PB3 Marking

[0049] The TL-DF (tendrils degenerated and self-capping) was used as the female parent and the Sanbaigua (normal tendril unlimited growth type) was used as the male parent. The F1 generation was obtained by hybridizing the above TL-DF as the female parent and the Sanbaigua as the male parent. The F1 generation was hybridized with the female parent TL-DF to obtain the BC1P1 population.

[0050] The ID_PB3 marker was used to verify the parent TL-DF, the parent Sanbaigua, and the BC1P1 population containing 62 individual plants, and the results are shown in Table 3. The results showed that the ID_PB3 marker was co-segregated with the tendril degeneration and self-capping traits in the BC1P1 population, indicating that the InDel site and the ID_PB3 marker designed using the InDel site have high utilization value in identifying the tendril degeneration and self-capping traits of watermelon, and can be effectively used in molecular assisted breeding of watermelon. The specific steps are as follows:

[0051] Genomic DNA extraction

[0052] The CTAB method (Paterson et al. 1993) was used to extract the DNA of individual strains of the BC1P1 population.

[0053] PCR amplification

[0054] The genomic DNA extracted in step 1 was used as a template, and PCR amplification was performed using primers ID_PB3-F and ID_PB3-R to obtain PCR amplification products.

[0055] The reaction system of the above PCR amplification reaction is: 16 μL of PCR premix containing 15 mM MgCl2, 2.5 mM dNTPs and 1 U Taq DNA polymerase; 2 μL of 10 mM PCR upstream and downstream mixed primers (0.5 μL of each upstream and downstream primer); 2 μL of 50 ng template DNA; PCR premix was purchased from Beijing Qingke Xinye Biotechnology Co., Ltd.

[0056] The reaction procedure of the above PCR amplification reaction is as follows: stage 1: pre-denaturation at 98°C for 3 min; stage 2: 98°C for 10 s, 56°C for 10 s, 72°C for 10 s, for a total of 35 cycles; stage 3: extension at 72°C for 5 min; stage 4: hold at 4°C.

[0057] PCR amplification product detection

[0058] The PCR amplification products were detected by polyacrylamide gel electrophoresis.

[0059] Table 3 shows whether there is a 3bp base insertion at position 67 of the ID_PB3 marker in the parent TL-DF, the parent Sanbaigua, and 62 BC1P1 plants. The watermelon materials with a 3bp base insertion (+) showed tendril degeneration and self-capping, and those without a base insertion (-) showed normal tendrils and unlimited growth. The results showed that the presence or absence of tendrils and inflorescence type traits of the 62 BC1P1 plants were completely consistent with the results of the ID_PB3 marker test, indicating that the ID_PB3 marker can be used to accurately identify whether the tendril of the tested watermelon is degenerated and the inflorescence growth type.

[0060] Table 3 Marker identification results for the presence or absence of tendrils and inflorescence type traits of the parental TL-DF, Sanbaigua and 62 BC1P1 populations

[0061] (In the marker test, + / + means the tendril is degenerated and self-capping, + / - and - / - mean the tendril is normal and grows indefinitely)

[0062]

[0063]

[0064]

[0065] Example 2, identification of watermelon tendrils and self-capping traits

[0066] To further verify the linkage relationship between the ID_PB3 marker in Example 1 and the watermelon flesh color gene, 50 natural populations were used for verification. The specific steps are as follows:

[0067] 1. Test Materials

[0068] The test materials were 50 natural resource populations of watermelon, all of which were of normal tendril and inflorescence unlimited growth type (see Table 4 for details); the test materials in Table 4 were all germplasm resource materials preserved by the melon research group of the Institute of Economic Crops, Hubei Academy of Agricultural Sciences.

[0069] Table 4 Identification results of individual plant materials and their tendril and inflorescence growth type traits in the natural population of 50 watermelon germplasm resources

[0070] (In the marker test, + / + means the tendril is degenerated and self-capping, + / - and - / - mean the tendril is normal and grows indefinitely)

[0071]

[0072]

[0073]

[0074] Genomic DNA extraction

[0075] The genomic DNA of the above 50 watermelon materials was extracted using the CTAB method.

[0076] PCR amplification

[0077] The genomic DNA extracted in step 1 was used as a template, and PCR amplification was performed using primers ID_PB3-F and ID_PB3-R to obtain PCR amplification products.

[0078] The reaction system of the above PCR amplification reaction is: 16 μL of PCR premix containing 15 mM MgCl2, 2.5 mM dNTPs and 1 U Taq DNA polymerase; 2 μL of 10 mM PCR upstream and downstream mixed primers (0.5 μL of each upstream and downstream primer); 2 μL of 50 ng template DNA; PCR premix was purchased from Beijing Qingke Xinye Biotechnology Co., Ltd.

[0079] The reaction procedure of the above PCR amplification reaction is as follows: stage 1: pre-denaturation at 98°C for 3 min; stage 2: 98°C for 10 s, 56°C for 10 s, 72°C for 10 s, for a total of 35 cycles; stage 3: extension at 72°C for 5 min; stage 4: hold at 4°C.

[0080] PCR amplification product detection

[0081] The PCR amplification products were detected by polyacrylamide gel electrophoresis.

[0082] The detection results of ID_PB3 on 50 natural population materials showed that all materials had no base insertion at base 67 of ID_PB3. The above detection results further confirmed that the ID_PB3 marker of the present invention can be used for molecular marker-assisted breeding of watermelon tendril and inflorescence growth type traits.

[0083] Example 3: Molecular assisted breeding of watermelon tendril and inflorescence growth type traits

[0084] The molecular marker ID_PB3 obtained in Example 1 is used to carry out molecular marker-assisted breeding using watermelon materials with tendril degeneration and inflorescence self-topping, comprising the following steps: DNA extraction: using watermelons with tendril degeneration and self-topping as donor parents and other watermelons with normal tendrils and indefinite growth as recipient parents, hybridizing and backcrossing for multiple generations to obtain substitution lines and derivative lines thereof, and extracting genomic DNA of individual plants of the isolated population by the CTAB method (Paterson et al. 1993) at the seedling stage;

[0085] The genotype of the individual plants in the above population is detected using the molecular marker ID_PB3, and the individual plants with the ID_PB3 marker position 67 being a heterozygous type (+ / -) are selected in each generation for the next round of backcrossing; after 6-8 consecutive generations of backcrossing, self-pollination is performed again, and the genotype of the self-pollinated offspring is detected using the ID_PB3 marker, and the individual plants with a 3bp insertion (+ / +) at the ID_PB3 marker position 67 are selected for self-pollination and seed preservation, and the retained material traits are tendril degeneration and self-capping. The present invention can identify the tendril and inflorescence growth type traits of watermelons at the seedling stage, provide molecular tools for creating tendril degeneration and self-capping watermelon materials and cultivating new varieties of watermelons suitable for light and simplified cultivation, and effectively improve the efficiency of watermelon breeding.

Claims

1. Application of a molecular marker related to watermelon tendril degeneration and self-topping in watermelon breeding, characterized in that: The watermelons are parent TL-DF, parent Sanbaigua and 62 BC1 P1, the molecular marker is ID_PB3, and the specific primer sequence and the length of the amplified target fragment are as follows: The forward primer sequence is GATTATAACTTGAAAACAAAACACATGAGTGG, The reverse primer sequence is TTTTTCTCTTTTTGTGAGTTCAATGTAGCCTG, The amplified length was 121 bp or 124 bp.

2. A use of the molecular marker related to watermelon tendril degeneration and self-topping as claimed in claim 1 in identifying or assisting in identifying the presence or absence of tendrils and whether the watermelon to be tested is self-topping, characterized in that: The watermelon is parent TL-DF, parent Sanbaigua and 62 BC1 P1, The molecular marker is ID_PB3, and its specific primer sequence and the length of the target fragment amplified are as follows: The forward primer sequence is GATTATAACTTGAAAACAAAACACATGAGTGG, The reverse primer sequence is TTTTTCTCTTTTTGTGAGTTCAATGTAGCCTG, The amplified length was 121 bp or 124 bp.

Images