InDel molecular marker system covering the entire genome of *Cyclophorus* and its applications

By constructing an InDel molecular marker system covering the entire genome of *Gypsophila spp.*, the problem of the lack of genetic maps in existing technologies has been solved, enabling efficient genetic diversity analysis and variety identification, and laying the foundation for molecular breeding of *Gypsophila spp.*.

CN114807422BActive Publication Date: 2025-12-02FLOWER RES INST OF YUNNAN ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210542853.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-05-18
Publication Date
2025-12-02
Estimated Expiration
2042-05-18

AI Technical Summary

Technical Problem

The lack of a genetic map and marker system covering the entire genome of *Gnaphalium affine* in existing technologies hinders its molecular biology research and the identification of commercial varieties.

Method used

An InDel molecular marker system covering the entire genome of *Gnaphalium affine* was developed, including primer pairs with 191 marker sites. Primers were identified and designed using next-generation sequencing technology, and genetic maps were constructed and varieties were identified by combining PCR amplification and agarose gel electrophoresis.

Benefits of technology

It provides InDel markers with high levels of polymorphism, increases the variety and number of molecular markers, supports genetic diversity analysis, variety identification and molecular breeding of *Cyclocarya paliurus*, and lays the foundation for genetics and molecular breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114807422B_ABST
    Figure CN114807422B_ABST
Patent Text Reader

Abstract

This invention discloses an InDel molecular marker system covering the entire genome of *Gypsophila paniculata* and its applications. The InDel molecular marker system includes primer pairs corresponding to 191 marker sites, with primer sequences shown in SEQ ID NO.1 to SEQ ID NO.382. Based on next-generation sequencing technology, this invention develops 191 InDel markers for genomic polymorphisms, increasing the variety and number of molecular markers for *Gypsophila paniculata* genetic diversity analysis and variety identification, thus aiding in the detection of *Gypsophila paniculata* varieties and laying the foundation for *Gypsophila paniculata* genetics and molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to an InDel molecular marker system covering the entire genome of a star and its applications. Background Technology

[0002] Molecular markers have been widely used in the genetic and evolutionary research of ornamental species, such as germplasm identification, genetic mapping, diversity analysis, and marker-assisted breeding selection. In the history of molecular marker development, DNA-based marker systems such as RFLP (Restriction Fragment Length Polymorphism) have been gradually replaced by PCR-based markers such as RAPD (Random Amplified Polymorphic DNA), SSR (Simple Sequence Repeat), SNP (Single Nucleotide Polymorphism), and INDEL (Insertion / Deletion). The development of next-generation sequencing (NGS) technology has facilitated the sequencing of more and more ornamental plant genomes, thereby promoting the identification and development of SNP and INDEL markers in flowering species such as roses and chrysanthemums. SNP and INDEL markers have become the most commonly used molecular markers in plant research due to their rich polymorphism, genome-wide distribution, co-dominance, and cost-effectiveness. Some studies have reported the application of SNP and KASP techniques for genetic mapping and genotyping, and for measuring genetic diversity in Arabidopsis and other crops. Utilizing significantly correlated molecular markers for QTL mapping and candidate gene identification in ornamental plants is also important. Recently, using molecular marker-guided cloning technology, the double-flowered gene AP2L was discovered in Dianthus chinensis. Therefore, establishing a genetic marker system for ornamental plants is crucial for conducting research on ornamental plants.

[0003] Baby's breath (2n=34) is a perennial herbaceous shrub belonging to the genus *Gypsophila*, comprising approximately 150 species of annuals, biennials, and perennials. Originating in temperate regions of Asia and Europe, it exhibits a wide variety of morphological types in different regions. It is commonly used as filler in floral arrangements and is also an important cut flower in the global market. However, there is a lack of genetic research on baby's breath in current technology, which is inconsistent with its significant market position. Some studies have reported preliminary assessments of genetic diversity among species and hybrids of the genus *Gypsophila* using molecular markers, but no information exists regarding a genetic map or marker system covering the entire genome of baby's breath. This significantly hinders scientific research in its molecular biology and the identification of commercial varieties. Therefore, the construction of a molecular marker system is crucial for the study of baby's breath. Summary of the Invention

[0004] Therefore, embodiments of the present invention provide an InDel molecular marker system covering the entire genome of *Hypericum spp.* and its application.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0006] In a first aspect, the present invention provides an InDel molecular marker system covering the entire genome of *Hypericum spp.*, wherein the InDel molecular marker system includes primer pairs corresponding to 191 marker sites, and the primer sequences are shown in SEQ ID NO.1 to SEQ ID NO.382.

[0007] A second aspect of this invention provides the application of the InDel molecular marker system covering the entire genome of *Gastrodia elata* as described above in the construction of a genetic map of *Gastrodia elata*.

[0008] A third aspect of this invention provides the application of the InDel molecular marker system covering the entire genome of *Gnaphalium affine* as described above in the analysis of genetic diversity in *Gnaphalium affine*.

[0009] A fourth aspect of this invention provides the application of the InDel molecular marker system covering the entire genome of *Gypsophila spp.* as described above in molecular breeding of *Gypsophila spp.*

[0010] A fifth aspect of this invention provides the application of the InDel molecular marker system covering the entire genome of *Gypsophila spp.* as described above in the identification of *Gypsophila spp.* varieties.

[0011] A sixth aspect of the present invention provides a method for identifying the variety of *Gypsophila*, comprising the following steps:

[0012] (1) Obtain the genomic DNA of the sample to be tested;

[0013] (2) The genomic DNA was amplified by PCR using the primers described above;

[0014] (3) The PCR amplification products were detected by agarose gel electrophoresis;

[0015] (4) Determine the variety of the sample to be tested.

[0016] Furthermore, the PCR amplification program is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 29 cycles; 72℃ extension for 7 min.

[0017] Furthermore, each 10 μL of the PCR amplification system comprises: 7.3 μL ddH2O; 1 μL 10×Taq buffer; 0.8 μL dNTP; 0.2 μL each of the 10 μM front and back primers; 0.1 μL Taq enzyme; and 0.4 μL genomic DNA.

[0018] Furthermore, the concentration of the agarose gel used for electrophoresis detection is 3.0%-3.5%.

[0019] Furthermore, the electrophoretic detection pressure is 100V, and the time is 1.0h-1.5h.

[0020] The embodiments of the present invention have the following advantages:

[0021] This invention develops 191 high-level polymorphic InDel markers based on next-generation sequencing technology, which increases the types and number of molecular markers for the analysis of genetic diversity and variety identification of *Gymnocalycium mihanovichii*, and helps in the detection of *Gymnocalycium mihanovichii* varieties and lays the foundation for the genetics and molecular breeding of *Gymnocalycium mihanovichii*. Attached Figure Description

[0022] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are merely exemplary, and those skilled in the art can derive other embodiments based on the provided drawings without creative effort.

[0023] Figure 1 A map of InDel molecular markers across the entire genome of *Gypsyum fasciculata*.

[0024] Figure 2 Polymorphism maps of 191 markers in 5 varietals of *Gymnocalycium mihanovichii* are presented, where black indicates the same genotype as WT-F, dark gray, gray and light gray indicate new genotypes, and white indicates no amplification. Detailed Implementation

[0025] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0026] The *Gypsophila* varieties shown in the following examples were all provided by Yuxi Yunxing Biotechnology Co., Ltd.

[0027] Example 1

[0028] InDel markers for constructing the whole genome of *Cyclophorus*

[0029] The whole genome of wild-type white-flowered Gypsophila (WT-W) was re-sequencing using next-generation sequencing technology and compared with the reference genome sequence of wild-type pink-flowered Gypsophila (WT-P). A series of InDel molecular markers distributed throughout the genome were detected. Furthermore, 407 InDel markers with variant sequence lengths greater than 10 bp were selected every 2 Mb, as shown in [link to relevant documentation]. Figure 1 The name code of the InDel tag is represented by chromosome number-physical distance.

[0030] Example 2

[0031] In this embodiment, the effectiveness of 407 InDel markers was detected by PCR amplification using the genomes of WT-P and four commercial varieties of *Gypsophila* ('YX1', 'Qiangwanxing', 'Richu', and 'Huixing').

[0032] The detection method is as follows:

[0033] 1. Extracting genomic DNA from *Gypsophila*

[0034] Young leaves of WT-P, 'YX1', 'Qianwanxing', 'Richu', and 'Huixing' were placed in 2 mL centrifuge tubes, respectively. Grinding beads were added, and the mixture was flash-frozen in liquid nitrogen before being ground in a grinder. 800 μL of 2×CTAB extract was added, vortexed, and incubated in a 65°C water bath for 1 hour, shaking every 15 minutes. After cooling to room temperature, an equal volume of chloroform:isoamyl alcohol (24:1) mixture was added, gently inverted, and centrifuged at 12000 rpm for 10 minutes. The supernatant was transferred to a new 1.5 mL centrifuge tube, and the chloroform:isoamyl alcohol (24:1) mixture was added again and centrifuged at 12000 rpm for 10 minutes. The supernatant was then transferred to another new 1.5 mL centrifuge tube, and an equal volume of isopropanol was added and mixed. The mixture was incubated at -20°C for at least 30 minutes, then centrifuged at 12000 rpm for 10 minutes. The supernatant was discarded. 600 μL of [unspecified ingredient] was added to the centrifuge tube. After gently mixing with 70% alcohol, centrifuge at 12000r for 5min, repeat 2-3 times; remove the supernatant, air dry naturally, add 100μL ddH2O, dissolve completely, and store at -20℃.

[0035] 2. Primer design

[0036] Specific primers were designed based on the sequences flanking the 407 InDel marker sites. The range of primer design was 18-24 bp, the product size was 200-400 bp, and the annealing temperature was 56℃.

[0037] 3. PCR cycling

[0038] PCR was performed using Taq polymerase from Transgen in a 10 μL system (7.3 μL ddH2O; 1 μL 10×Taq buffer; 0.8 μL dNTP; 0.2 μL each of 10 μM front and back primers; 0.1 μL Taq polymerase; 0.4 μL DNA template). The PCR cycle consisted of: full denaturation at 95 °C for 5 min; 29 cycles (95 °C, 30 s; 56 °C, 30 s; 72 °C, 30 s); and extension at 72 °C for 7 min.

[0039] 4. Agarose gel electrophoresis

[0040] Prepare 100 mL of 3.0-3.5% agarose gel. After slightly cooling, add 10 μL of Gelstain nucleic acid dye, mix well, and pour into the electrophoresis tank with the sample comb installed. After the gel cools, place it in an electrophoresis apparatus filled with 0.5×TBE buffer. Add 5 μL of PCR amplification product to 3 μL of 6×DNALoading Buffer and pipette the sample. Perform electrophoresis at a constant voltage of 100V for 1.0-1.5 h, until the amplified DNA bands are fully developed. Use a 100 bp DNA ladder as a marker.

[0041] Testing revealed that 191 InDel markers exhibited extremely high polymorphism across the five *Gypsophila* cultivars (see...). Figure 2 These markers can be used for variety identification, genetic diversity analysis, etc. The primer sequences for the 191 InDel markers are shown in Table 1.

[0042] Table 1

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049]

[0050] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

[0051] References

[0052] 1. Xue Y, Liu R, Xue J, Wang S, Zhang X: Genetic Diversity and Relatedness Analysis of Nine Wild Species of Tree Peony Based on Simple Sequence Repeats Markers. Horticultural Plant Journal 2021.

[0053] 2. Sousa A, Souza MM, Melo C, Sodré G: ISSR markers in wild species of Passiflora L. (Passifloraceae) as a tool for taxon selection in ornamental breeding. Genetics & Molecular Research Gmr2015, 14(4): 18534.

[0054] 3. Semagn K, Babu R, Hearne S, Olsen M: Single nucleotide polymorphism genotyping using Kompetitive Allele Specific PCR (KASP): overview of the technology and its application in crop improvement. Molecular Breeding 2014, 33(1): 1 - 14.

[0055] 4. Kirov I, Van Laere K, De Riek J, De Keyser E, Van Roy N, Khrustaleva L: Anchoring linkage groups of the Rosa genetic map to physical chromosomes with Tyramide - FISH and EST - SNP markers. PloS one 2014, 9(4): e95793.

[0056] 5.Saint-Oyant LH,Ruttink T,Hamama L,Kirov I,Lakhwani D,Zhou NN,Bourke P,Daccord N,Leus L,Schulz D:A high-quality genome sequence of Rosachinensis to elucidate ornamental traits.Nature plants 2018,4(7):473-484.

[0057] 6. Song X, Xu Y, Gao K, Fan G, Zhang F, Deng C, Dai S, Huang H,

[0058] 7.Mieulet D,Aubert G,Bres C,Klein A,Droc G,Vieille E,Rond-CoissieuxC,Sanchez M,Dalmais M,Mauxion JP et al:Unleashing meiotic crossovers incrops.Nature Plants 2018,4(12):1010-1016.

[0059] 8.Li F:Meiotic recombination suppressors of Arabidopsisthaliana.Ghent University;2018.

[0060] 9.De Maagd RA,Loonen AEHM,Chouaref J,Pele A,Meijerdekens F,Fransz P,Bai Y:CRISPR / Cas inactivation of RECQ4 increases homeologous crossovers in aninterspecific tomato hybrid.Plant Biotechnology Journal 2020,18(3):805-813.

[0061] 10.Girard C,Chelysheva L,Choinard S,Froger N,Macaisne N,Lehmemdi A,Mazel J,Crismani W,Mercier R:AAA-ATPase FIDGETIN-LIKE 1 and helicase FANCMantagonize meiotic crossovers by distinct mechanisms.PLoS genetics 2015,11(7):e1005369.

[0062] 11.Serra H,Lambing C,Griffin CH,Topp SD,Nageswaran DC,Underwood CJ,Ziolkowski PA,Séguela-Arnaud M,Fernandes JB,Mercier R:Massive crossoverelevation via combination of HEI10 and recq4a recq4b during Arabidopsissimaiosis 2018,115(10):201713071.

[0063] 12.Fernandes JB,Séguéla-Arnaud M,Larchevêque C,Lloyd AH,Mercier R:Unleashing meiotic crossovers in hybrid plants.Proceedings of the NationalAcademy of Sciences 2018,115(10):2431-2436.

[0064] 13.Wang Q,Zhang X,Lin S,Yang S,Yan X,Bendahmane M,Bao M,Fu X:Mappinga double flower phenotype-associated gene DcAP2L in Dianthuschinensis.Journal of Experimental Botany 2020,71(6):1915-1927.

[0065] 14.Lu D,Nicholas JT:Gypsophila Linnaeus,vol.6.Beijing / St.Louis:Science Press / Missouri Botanical Garden;2001.

[0066] 15.Li F,Wang G,Yu R,Wu M,Shan Q,Wu L,Ruan J,Yang C:Effects ofSeasonal Variation and Gibberellic Acid Treatment on the Growth andDevelopment of Gypsophila paniculata.HortScience 2019,54(8):1370-1374.

[0067] 16.Yang ML,Rice E,Leimbach-Maus H,Partridge CG:Identification andcharacterization of Gypsophila paniculata color morphs in Sleeping Bear DunesNational Lakeshore,MI,USA.Peerj 2019,7:e7100.

[0068] 17. Baskett CA, Emery SM, Rudgers JA: Pollinator visits to threatened species are restored following invasive plant removal. International Journal of Plant Sciences 2011,172(3):411-422.

[0069] 18.Cao TX,Piao XC,Wu SQ,Wang SM,Lian ML:Analysis of RAPD Fingerprintof Shoots and Its Vitrification Shoots in vitro of Gypsophila paniculataL.Plant Physiology Communications 2007,43(2):288-290.

[0070] 19.Calistri E, Buiatti M, Bogani P:Characterization of Gypsophilaspecies and commercial hybrids with nuclear whole-genome and cytoplasmicmolecular markers.Plant Biosystems-An International Journal Dealing with allAspects of Plant Biology 2016,150(1):11-21. sequence list <110> Yunnan Academy of Agricultural Sciences Flower Research Institute <120> InDel molecular marker system covering the entire genome of *Cyclophorus* and its applications <130> GG221096638A <160> 382 <170> SIPOSequenceListing 1.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <400> 1 ttaggaacgt cacaaccc 18 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <400> 2 cttatcaatt ttcaggca 18 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <400> 3 agcaagaaag aagggact 18 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <400> 4 tttggtgaac tgaagacc 18 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <400> 5 gaaaacccgt aatagcaa 18 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <400> 6 agaatggagg aagaacaa 18 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <400> 7 ctccgatttc ccactgat 18 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <400> 8 atgttggctt ttacccct 18 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <400> 9 aaattcatac gaaactcg 18 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <400> 10 gaacattcat caccacct 18 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <400> 11 tggtaatggc ttttcgggca 20 <210> 12 <211> twenty one <212> DNA <213> Artificial Sequence <400> 12 gaattgcagc ccaagaggag a 21 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <400> 13 aaaagagcct catacaca 18 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <400> 14 tacagacacg agaccgat 18 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <400> 15 atggatgttt tttgttga 18 <210> 16 <211> 18 <212> DNA <213> Artificial Sequence <400> 16 aagcgaagtc tgtgagta 18 <210> 17 <211> twenty one <212> DNA <213> Artificial Sequence <400> 17 agcgggagca tcttcttact c 21 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <400> 18 cacaccgtca ccaatgacca 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <400> 19 acccttcatt ctacgccacc 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <400> 20 caaaaacggc aagggtcctc 20 <210> twenty one <211> 20 <212> DNA <213> Artificial Sequence <400> twenty one aaacgaggtg caggactagc 20 <210> twenty two <211> 20 <212> DNA <213> Artificial Sequence <400> twenty two acggctgcac aacttccata 20 <210> twenty three <211> 20 <212> DNA <213> Artificial Sequence <400> twenty three acaaatgagg ccaaccgcag 20 <210> twenty four <211> twenty one <212> DNA <213> Artificial Sequence <400> twenty four cgcttgtccc tgtattcctc a 21 <210> 25 <211> twenty one <212> DNA <213> Artificial Sequence <400> 25 aggcgtctac tttccaggtt g 21 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <400> 26 tttgggctcc tctgtgcttt 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <400> 27 agcaggtgag ggtagtcctt 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <400> 28 tctgctttcg ctctttcgct 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <400> 29 tgctgtcgtt catccccaaa 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <400> 30 tgtttgaacc cgtttgcgtc 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <400> 31 tgcgcaacat ccgaaagaag 20 <210> 32 <211> twenty one <212> DNA <213> Artificial Sequence <400> 32 ccactggtga gcacattttg g 21 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <400> 33 atggaagtgg ctcggtttgg 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <400> 34 cgttggttta acactcggca 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <400> 35 gcacaaggca ctgacaagag 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <400> 36 tggtaacaac ctcacagggg 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <400> 37 cttcgtgtca acggtgcaat 20 <210> 38 <211> twenty one <212> DNA <213> Artificial Sequence <400> 38 gacccccttg cccatcatat t 21 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <400> 39 acaaaggagc atacggcctg 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <400> 40 cgtacagaag gcgtgtccag 20 <210> 41 <211> twenty one <212> DNA <213> Artificial Sequence <400> 41 gttgctctca gttgtgtccc t 21 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <400> 42 gcacgacggt gagttttgat 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <400> 43 ttggtcgggc agcatctatt 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <400> 44 gaatggggcg gagtacctga 20 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <400> 45 ccgggaacag ccgtataaca 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <400> 46 aaagacgggg tcattgggtc 20 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <400> 47 tcaagggtac agccaagacc 20 <210> 48 <211> twenty one <212> DNA <213> Artificial Sequence <400> 48 aagaaaagac gctctcctgc c 21 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <400> 49 aagcgggaaa caggcgatta 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <400> 50 ccgggcacaa gaacactact 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <400> 51 gggctttctc caactgacga 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <400> 52 tgcggtggag aagtttcact 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <400> 53 tggttatcca ctgcttggga 20 <210> 54 <211> twenty one <212> DNA <213> Artificial Sequence <400> 54 agcgctcttg gactaaacag g 21 <210> 55 <211> twenty two <212> DNA <213> Artificial Sequence <400> 55 aaaggcaatg gatagtggag ca 22 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <400> 56 ttagagttcc ccattgccgt 20 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <400> 57 tgaacgtgga aggcgaagag 20 <210> 58 <211> 19 <212> DNA <213> Artificial Sequence <400> 58 cagccttacg cgccatttc 19 <210> 59 <211> twenty one <212> DNA <213> Artificial Sequence <400> 59 cgccttacct taccccttgt t 21 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <400> 60 atcgaaccca gaaaagccct 20 <210> 61 <211> twenty one <212> DNA <213> Artificial Sequence <400> 61 caggtctgag caacaattgc c 21 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <400> 62 cgggaattag gagtgggcta 20 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <400> 63 gaggttgcgg gaaggaatcg 20 <210> 64 <211> 20 <212> DNA <213> Artificial Sequence <400> 64 ggagcgtggt tcgtgtcttt 20 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <400> 65 tgtcgggacg aaatcagtgg 20 <210> 66 <211> twenty two <212> DNA <213> Artificial Sequence <400> 66 tgaacggtct aatgtacgca gt 22 <210> 67 <211> 20 <212> DNA <213> Artificial Sequence <400> 67 gcaaaccgcc ctggtaattc 20 <210> 68 <211> 20 <212> DNA <213> Artificial Sequence <400> 68 tttttccggt gatacgggct 20 <210> 69 <211> 20 <212> DNA <213> Artificial Sequence <400> 69 ctgcacaaca gcgtcgaatg 20 <210> 70 <211> twenty two <212> DNA <213> Artificial Sequence <400> 70 cccgaactac atactctctg ct 22 <210> 71 <211> 20 <212> DNA <213> Artificial Sequence <400> 71 caacgaagac ggggaagaca 20 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <400> 72 gacgagttgg gaggatcgtg 20 <210> 73 <211> 20 <212> DNA <213> Artificial Sequence <400> 73 ggcctacgat tccctccatt 20 <210> 74 <211> twenty one <212> DNA <213> Artificial Sequence <400> 74 cccatcaggg aaagagtcca a 21 <210> 75 <211> twenty one <212> DNA <213> Artificial Sequence <400> 75 tgatgccgac acagcactat t 21 <210> 76 <211> 19 <212> DNA <213> Artificial Sequence <400> 76 ccaaagggct ctcgaccag 19 <210> 77 <211> twenty one <212> DNA <213> Artificial Sequence <400> 77 tctcgttctc ctcaggttgt g 21 <210> 78 <211> twenty one <212> DNA <213> Artificial Sequence <400> 78 ggagcctcaa gtgaaccact a 21 <210> 79 <211> 20 <212> DNA <213> Artificial Sequence <400> 79 gtttttgcgg tgctttgtgg 20 <210> 80 <211> 20 <212> DNA <213> Artificial Sequence <400> 80 accaaccact accggatctc 20 <210> 81 <211> twenty one <212> DNA <213> Artificial Sequence <400> 81 tcctgatggt tgattggcct g 21 <210> 82 <211> 20 <212> DNA <213> Artificial Sequence <400> 82 atggctcagc aaattggggg 20 <210> 83 <211> twenty one <212> DNA <213> Artificial Sequence <400> 83 acaccgttac cactccttga a 21 <210> 84 <211> twenty two <212> DNA <213> Artificial Sequence <400> 84 accgttgtgg atggttattg ga 22 <210> 85 <211> 20 <212> DNA <213> Artificial Sequence <400> 85 gcggataggt tggtgcatct 20 <210> 86 <211> 20 <212> DNA <213> Artificial Sequence <400> 86 ccgttcggta cgtatgtgga 20 <210> 87 <211> 20 <212> DNA <213> Artificial Sequence <400> 87 ggggtcgatt gctgtaccat 20 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <400> 88 gtgtccgccc cttcatgttt 20 <210> 89 <211> 20 <212> DNA <213> Artificial Sequence <400> 89 catggcacgc agagcattag 20 <210> 90 <211> 20 <212> DNA <213> Artificial Sequence <400> 90 tggcacagtt cttcgtgtgt 20 <210> 91 <211> 20 <212> DNA <213> Artificial Sequence <400> 91 agctgctgca aggaaattca 20 <210> 92 <211> twenty one <212> DNA <213> Artificial Sequence <400> 92 cctgtcgtct gcgtctaatc a 21 <210> 93 <211> 20 <212> DNA <213> Artificial Sequence <400> 93 aggttgatgt ccctgacgag 20 <210> 94 <211> twenty one <212> DNA <213> Artificial Sequence <400> 94 aagccactgg aaaacaagtg c 21 <210> 95 <211> twenty three <212> DNA <213> Artificial Sequence <400> 95 catgcaaaac ccttagaaat ccc 23 <210> 96 <211> 20 <212> DNA <213> Artificial Sequence <400> 96 atggtggtgg atatggtccc 20 <210> 97 <211> 20 <212> DNA <213> Artificial Sequence <400> 97 tcatccaggc aaagaccgag 20 <210> 98 <211> 20 <212> DNA <213> Artificial Sequence <400> 98 gtgcaggaga tttcgtcgct 20 <210> 99 <211> 20 <212> DNA <213> Artificial Sequence <400> 99 ctccgcttca ccatgagcaa 20 <210> 100 <211> 20 <212> DNA <213> Artificial Sequence <400> 100 tgcatccgct cctaccaaag 20 <210> 101 <211> twenty one <212> DNA <213> Artificial Sequence <400> 101 gtctgagaga gcaaaggtcc a 21 <210> 102 <211> 20 <212> DNA <213> Artificial Sequence <400> 102 cggaggtcgt cctcgtctaa 20 <210> 103 <211> 20 <212> DNA <213> Artificial Sequence <400> 103 gaccgtaaga gttccgtcca 20 <210> 104 <211> 20 <212> DNA <213> Artificial Sequence <400> 104 ccaagatccc gtcactccct 20 <210> 105 <211> 20 <212> DNA <213> Artificial Sequence <400> 105 cttgacacga tcaggccgaa 20 <210> 106 <211> 20 <212> DNA <213> Artificial Sequence <400> 106 catcagcgtc aacggcataa 20 <210> 107 <211> 20 <212> DNA <213> Artificial Sequence <400> 107 taatcccatt ggtggccctc 20 <210> 108 <211> 20 <212> DNA <213> Artificial Sequence <400> 108 atggaacgag tgcggatgac 20 <210> 109 <211> 20 <212> DNA <213> Artificial Sequence <400> 109 gggaacctgg ctggaaacac 20 <210> 110 <211> 20 <212> DNA <213> Artificial Sequence <400> 110 ccgcagtaaa gctgaaagca 20 <210> 111 <211> 20 <212> DNA <213> Artificial Sequence <400> 111 gctgagcttt tccgagcatc 20 <210> 112 <211> 20 <212> DNA <213> Artificial Sequence <400> 112 cgtccaccag gcaatgatct 20 <210> 113 <211> 20 <212> DNA <213> Artificial Sequence <400> 113 tccccaagca gatgacaagc 20 <210> 114 <211> 20 <212> DNA <213> Artificial Sequence <400> 114 cattcttctt gctccaccgc 20 <210> 115 <211> 20 <212> DNA <213> Artificial Sequence <400> 115 tgggcaactt tttctcgcaa 20 <210> 116 <211> 20 <212> DNA <213> Artificial Sequence <400> 116 tggagagaaa gaccacgacg 20 <210> 117 <211> 20 <212> DNA <213> Artificial Sequence <400> 117 atggacttag gcggaacgac 20 <210> 118 <211> 20 <212> DNA <213> Artificial Sequence <400> 118 agcttaccaa gcaggccatt 20 <210> 119 <211> twenty one <212> DNA <213> Artificial Sequence <400> 119 catcctcgta tcgttcctgc t 21 <210> 120 <211> 20 <212> DNA <213> Artificial Sequence <400> 120 ctcaacctcc cgtcttcgtc 20 <210> 121 <211> 20 <212> DNA <213> Artificial Sequence <400> 121 gacagcccat tcacactgct 20 <210> 122 <211> twenty one <212> DNA <213> Artificial Sequence <400> 122 ccatcgccac caaagctaaa g 21 <210> 123 <211> twenty three <212> DNA <213> Artificial Sequence <400> 123 ggaaaagatg gagacggaaa cag 23 <210> 124 <211> twenty one <212> DNA <213> Artificial Sequence <400> 124 aaagcagaaa accgcactca c 21 <210> 125 <211> 20 <212> DNA <213> Artificial Sequence <400> 125 ttttggggat tcacgactgc 20 <210> 126 <211> 20 <212> DNA <213> Artificial Sequence <400> 126 actgcttttg agatgggacc 20 <210> 127 <211> twenty one <212> DNA <213> Artificial Sequence <400> 127 gccaaaatct caatgtccgc t 21 <210> 128 <211> twenty one <212> DNA <213> Artificial sequence <400> 128 gctgtgttct ctttgaggca g 21 <210> 129 <211> 20 <212> DNA <213> Artificial sequence <400> 129 acggaacatc cacgggtatc 20 <210> 130 <211> 20 <212> DNA <213> Artificial sequence <400> 130 acttcgtcag tcgcaccaaa 20 <210> 131 <211> 20 <212> DNA <213> Artificial sequence <400> 131 tcagagcgag cagaaacgac 20 <210> 132 <211> 20 <212> DNA <213> Artificial sequence <400> 132 aactcgccct tttcgacctt 20 <210> 133 <211> 20 <212> DNA <213> Artificial sequence <400> 133 tcaagccaaa ccaagcaacg 20 <210> 134 <211> 20 <212> DNA <213> Artificial sequence <400> 134 cactttcacc gccacaacag 20 <210> 135 <211> 20 <212> DNA <213> Artificial sequence <400> 135 cgtcaacctt gcctctgtct 20 <210> 136 <211> 20 <212> DNA <213> Artificial sequence <400> 136 acctgtgtgt accgttcgac 20 <210> 137 <211> twenty one <212> DNA <213> Artificial sequence <400> 137 aagcagtcca cgtttctgac a 21 <210> 138 <211> twenty one <212> DNA <213> Artificial sequence <400> 138 aggtcatgga gcagacaaca g 21 <210> 139 <211> 20 <212> DNA <213> Artificial sequence <400> 139 tgttcgtgat gactgcccaa 20 <210> 140 <211> 20 <212> DNA <213> Artificial sequence <400> 140 gtgcttttca ctggagtggc 20 <210> 141 <211> 20 <212> DNA <213> Artificial sequence <400> 141 actcgtggaa gaacgagcaa 20 <210> 142 <211> twenty one <212> DNA <213> Artificial sequence <400> 142 aagaccccat cgaccaacaa a 21 <210> 143 <211> 20 <212> DNA <213> Artificial sequence <400> 143 tgcgtcagga taggcatctt 20 <210> 144 <211> 20 <212> DNA <213> Artificial sequence <400> 144 ccactgtttg gaggttgcgt 20 <210> 145 <211> 20 <212> DNA <213> Artificial sequence <400> 145 cttggtggcc gaggctatac 20 <210> 146 <211> 20 <212> DNA <213> Artificial sequence <400> 146 tgccgtgttg cttctatggt 20 <210> 147 <211> twenty one <212> DNA <213> Artificial sequence <400> 147 tgtagtcatt tgtccccgca t 21 <210> 148 <211> 20 <212> DNA <213> Artificial sequence <400> 148 tatcgcaacg caacgacgaa 20 <210> 149 <211> 20 <212> DNA <213> Artificial sequence <400> 149 acttccaacc gcatcgctta 20 <210> 150 <211> 20 <212> DNA <213> Artificial sequence <400> 150 tgcaacacat gggcatacct 20 <210> 151 <211> 20 <212> DNA <213> Artificial sequence <400> 151 atcaacccac tccccgtttc 20 <210> 152 <211> 20 <212> DNA <213> Artificial sequence <400> 152 ttgccctgat gaacccactc 20 <210> 153 <211> 20 <212> DNA <213> Artificial sequence <400> 153 agaacccgcc tttcaactcc 20 <210> 154 <211> twenty one <212> DNA <213> Artificial sequence <400> 154 tctaaacccc ttccctctcc a 21 <210> 155 <211> 20 <212> DNA <213> Artificial sequence <400> 155 gccgacattc ttcgtcaagg 20 <210> 156 <211> 20 <212> DNA <213> Artificial sequence <400> 156 atacgcagcc atcaccttcg 20 <210> 157 <211> 20 <212> DNA <213> Artificial sequence <400> 157 tctcaccttg gcactacctc 20 <210> 158 <211> 20 <212> DNA <213> Artificial sequence <400> 158 gctgctatat ccgtcaccct 20 <210> 159 <211> 20 <212> DNA <213> Artificial sequence <400> 159 ctctaggcga tggggtgttg 20 <210> 160 <211> 20 <212> DNA <213> Artificial sequence <400> 160 agctttgccc tcactttcgt 20 <210> 161 <211> 20 <212> DNA <213> Artificial sequence <400> 161 tgcacacctg ttcccatacc 20 <210> 162 <211> 20 <212> DNA <213> Artificial sequence <400> 162 aacgaggatg aaacggggac 20 <210> 163 <211> 20 <212> DNA <213> Artificial sequence <400> 163 ctggtagtgg ccgacatgaa 20 <210> 164 <211> 20 <212> DNA <213> Artificial sequence <400> 164 ggcgctctgt cacgatttct 20 <210> 165 <211> 20 <212> DNA <213> Artificial sequence <400> 165 tcgtgtgtca aatcagggga 20 <210> 166 <211> 20 <212> DNA <213> Artificial sequence <400> 166 tagccgaaaa gccagccaaa 20 <210> 167 <211> 20 <212> DNA <213> Artificial sequence <400> 167 taccttcaca cttccccggt 20 <210> 168 <211> twenty one <212> DNA <213> Artificial sequence <400> 168 cctctgttct cttctgtgcg t 21 <210> 169 <211> 20 <212> DNA <213> Artificial sequence <400> 169 tactacctga agcgcacacg 20 <210> 170 <211> 20 <212> DNA <213> Artificial sequence <400> 170 gagatggctg aaaggttgcc 20 <210> 171 <211> 20 <212> DNA <213> Artificial sequence <400> 171 tacaccctca cctgcacaac 20 <210> 172 <211> 20 <212> DNA <213> Artificial sequence <400> 172 atatccggta aggcggtgtt 20 <210> 173 <211> 20 <212> DNA <213> Artificial sequence <400> 173 gtcgctccct cggtaagttc 20 <210> 174 <211> 20 <212> DNA <213> Artificial sequence <400> 174 caaagaagcc gcaaccgaaa 20 <210> 175 <211> 20 <212> DNA <213> Artificial sequence <400> 175 agcggttcag gacgaagttt 20 <210> 176 <211> 20 <212> DNA <213> Artificial sequence <400> 176 ctctcgctgt tgttgacgct 20 <210> 177 <211> 20 <212> DNA <213> Artificial sequence <400> 177 agcgtgaagt aacaaccgcc 20 <210> 178 <211> 20 <212> DNA <213> Artificial sequence <400> 178 ttatgggttg tggctggcta 20 <210> 179 <211> 20 <212> DNA <213> Artificial sequence <400> 179 agctcgacag tccaacgaag 20 <210> 180 <211> 20 <212> DNA <213> Artificial sequence <400> 180 cccccatttt gcatcgcatt 20 <210> 181 <211> 20 <212> DNA <213> Artificial sequence <400> 181 acttgctgct tgccatgagg 20 <210> 182 <211> 20 <212> DNA <213> Artificial sequence <400> 182 acgtgccttc tcaatcaacc 20 <210> 183 <211> 20 <212> DNA <213> Artificial sequence <400> 183 cgggatggta gcctcttgac 20 <210> 184 <211> 20 <212> DNA <213> Artificial sequence <400> 184 gctacaacag cgatgccttg 20 <210> 185 <211> 20 <212> DNA <213> Artificial sequence <400> 185 accggctgaa agtccagaaa 20 <210> 186 <211> 20 <212> DNA <213> Artificial sequence <400> 186 agaggccgaa ccccttaaac 20 <210> 187 <211> 20 <212> DNA <213> Artificial sequence <400> 187 tacaaaaggc ccaggcgatg 20 <210> 188 <211> 20 <212> DNA <213> Artificial sequence <400> 188 cggtaggcat ggcaatagga 20 <210> 189 <211> twenty one <212> DNA <213> Artificial sequence <400> 189 aggagatcac atttcccagc c 21 <210> 190 <211> 20 <212> DNA <213> Artificial sequence <400> 190 gagcaacaag gaacgtgcaa 20 <210> 191 <211> 20 <212> DNA <213> Artificial sequence <400> 191 accgaatcag aggtcccaca 20 <210> 192 <211> twenty one <212> DNA <213> Artificial sequence <400> 192 cttccagtgc tatgtacgcc a 21 <210> 193 <211> 20 <212> DNA <213> Artificial sequence <400> 193 atgccttcaa cagcttgctt 20 <210> 194 <211> twenty one <212> DNA <213> Artificial sequence <400> 194 ctaaaacatg caggcaaccg a 21 <210> 195 <211> twenty one <212> DNA <213> Artificial sequence <400> 195 ggtggcagaa tttggtgtga a 21 <210> 196 <211> 20 <212> DNA <213> Artificial sequence <400> 196 gctcaacaaa ccgctcatcg 20 <210> 197 <211> 20 <212> DNA <213> Artificial sequence <400> 197 gcggcagttt gtgaggttag 20 <210> 198 <211> 20 <212> DNA <213> Artificial sequence <400> 198 acggccacca actgatagtc 20 <210> 199 <211> 20 <212> DNA <213> Artificial sequence <400> 199 agccctagca acggaaacaa 20 <210> 200 <211> 20 <212> DNA <213> Artificial sequence <400> 200 ctgatcctcg tctgatgcct 20 <210> 201 <211> 20 <212> DNA <213> Artificial sequence <400> 201 aacgtattgc tttgccgctg 20 <210> 202 <211> 20 <212> DNA <213> Artificial sequence <400> 202 gctgccctag agactgtgtg 20 <210> 203 <211> 20 <212> DNA <213> Artificial sequence <400> 203 gatgggtctg tggaaacggt 20 <210> 204 <211> 20 <212> DNA <213> Artificial sequence <400> 204 ggaagggccc gtatggttag 20 <210> 205 <211> 20 <212> DNA <213> Artificial sequence <400> 205 agttcctcac atcaccgcct 20 <210> 206 <211> 20 <212> DNA <213> Artificial sequence <400> 206 atcagaacaa cgaccaccct 20 <210> 207 <211> 20 <212> DNA <213> Artificial sequence <400> 207 agagtccgac gaaccaacac 20 <210> 208 <211> 20 <212> DNA <213> Artificial sequence <400> 208 cctggtatcg tctcaccgac 20 <210> 209 <211> 20 <212> DNA <213> Artificial sequence <400> 209 tggttttgcc acaggaggtt 20 <210> 210 <211> 20 <212> DNA <213> Artificial sequence <400> 210 acccaatagc acgcaactca 20 <210> 211 <211> twenty one <212> DNA <213> Artificial sequence <400> 211 actccacgtc aaccggaata a 21 <210> 212 <211> 20 <212> DNA <213> Artificial sequence <400> 212 atgagcagag aattgcgagc 20 <210> 213 <211> 20 <212> DNA <213> Artificial sequence <400> 213 tggtggctac tgtgtatgga 20 <210> 214 <211> 20 <212> DNA <213> Artificial sequence <400> 214 atgtcgcaat catccgctct 20 <210> 215 <211> 20 <212> DNA <213> Artificial sequence <400> 215 ccgtaaattg cgacgcctaa 20 <210> 216 <211> 20 <212> DNA <213> Artificial sequence <400> 216 gcggcccatt tgagttcttc 20 <210> 217 <211> 20 <212> DNA <213> Artificial sequence <400> 217 gaggcagcag ccgatcttta 20 <210> 218 <211> 20 <212> DNA <213> Artificial sequence <400> 218 agctcgggta tccacctgat 20 <210> 219 <211> 20 <212> DNA <213> Artificial sequence <400> 219 gaggagaccg ttgcctagat 20 <210> 220 <211> twenty one <212> DNA <213> Artificial sequence <400> 220 gggtgattgg tgaggttgga g 21 <210> 221 <211> twenty one <212> DNA <213> Artificial sequence <400> 221 ttgagagttg cacaccaact g 21 <210> 222 <211> 20 <212> DNA <213> Artificial sequence <400> 222 agcgtccttg gtggaaaaca 20 <210> 223 <211> twenty two <212> DNA <213> Artificial sequence <400> 223 ccatcgttgt ccaattcctc gt 22 <210> 224 <211> 20 <212> DNA <213> Artificial sequence <400> 224 gcgtttaacc tctcgacaca 20 <210> 225 <211> 20 <212> DNA <213> Artificial sequence <400> 225 acttgcggct ctgtcttagt 20 <210> 226 <211> 20 <212> DNA <213> Artificial sequence <400> 226 tgtttgtggt tggctgacga 20 <210> 227 <211> 20 <212> DNA <213> Artificial sequence <400> 227 gccccgcgaa aaacaaatga 20 <210> 228 <211> twenty two <212> DNA <213> Artificial sequence <400> 228 gcagggtaaa taaccactag cc 22 <210> 229 <211> 20 <212> DNA <213> Artificial sequence <400> 229 cataggcaag ggcaccgatt 20 <210> 230 <211> 20 <212> DNA <213> Artificial sequence <400> 230 gtctcggttg aggactgctg 20 <210> 231 <211> 20 <212> DNA <213> Artificial sequence <400> 231 ttttccttgt cgggccagta 20 <210> 232 <211> 20 <212> DNA <213> Artificial Sequence <400> 232 aggggaagag aacagcgaaa 20 <210> 233 <211> twenty one <212> DNA <213> Artificial sequence <400> 233 ttgagagggg tcagggaaga a 21 <210> 234 <211> 20 <212> DNA <213> Artificial sequence <400> 234 aggttgatga aagtgccgct 20 <210> 235 <211> twenty one <212> DNA <213> Artificial sequence <400> 235 tggacctggt aaagttcctg c 21 <210> 236 <211> 20 <212> DNA <213> Artificial sequence <400> 236 ccgcaagtaa agccatgcga 20 <210> 237 <211> 20 <212> DNA <213> Artificial sequence <400> 237 tgacagcaaa tgtaagcggg 20 <210> 238 <211> twenty one <212> DNA <213> Artificial sequence <400> 238 ttctgggatc aacgcatcag c 21 <210> 239 <211> 19 <212> DNA <213> Artificial sequence <400> 239 tagagcgccc cactgatct 19 <210> 240 <211> 20 <212> DNA <213> Artificial sequence <400> 240 aaagagtgct tgtctccgcc 20 <210> 241 <211> 20 <212> DNA <213> Artificial sequence <400> 241 ggaggcggag gaagtcaaac 20 <210> 242 <211> 20 <212> DNA <213> Artificial sequence <400> 242 ttcgttcatc cgttccgtcc 20 <210> 243 <211> twenty one <212> DNA <213> Artificial sequence <400> 243 acagttctcc aggctcttgt g 21 <210> 244 <211> twenty one <212> DNA <213> Artificial sequence <400> 244 atggcctcaa agaatgccag a 21 <210> 245 <211> 20 <212> DNA <213> Artificial sequence <400> 245 tcatcagttc caggtgccaa 20 <210> 246 <211> twenty one <212> DNA <213> Artificial sequence <400> 246 tgttagattg tcgggtgctg g 21 <210> 247 <211> 20 <212> DNA <213> Artificial sequence <400> 247 cgaaaacaat gcccgagagc 20 <210> 248 <211> 20 <212> DNA <213> Artificial sequence <400> 248 tgctcccacg ttgaaaggtt 20 <210> 249 <211> twenty one <212> DNA <213> Artificial sequence <400> 249 agaatcaact cctcgtccgt c 21 <210> 250 <211> twenty three <212> DNA <213> Artificial sequence <400> 250 cactacaaag tctacacccc caa 23 <210> 251 <211> 20 <212> DNA <213> Artificial sequence <400> 251 gcacggaacg cttacaactc 20 <210> 252 <211> 20 <212> DNA <213> Artificial sequence <400> 252 tgcatggcaa cgatgggtat 20 <210> 253 <211> 20 <212> DNA <213> Artificial sequence <400> 253 gaaccaaatg tcaccgcctc 20 <210> 254 <211> 20 <212> DNA <213> Artificial sequence <400> 254 atagaagacg tgccaccgac 20 <210> 255 <211> twenty one <212> DNA <213> Artificial sequence <400> 255 ttcggcagtg ttctaggatg c 21 <210> 256 <211> 20 <212> DNA <213> Artificial sequence <400> 256 ttgggttcgt gctgattggt 20 <210> 257 <211> 25 <212> DNA <213> Artificial sequence <400> 257 tccaacatatttacagtttc ttgct 25 <210> 258 <211> 20 <212> DNA <213> Artificial sequence <400> 258 gccgtatgac gacagactca 20 <210> 259 <211> 20 <212> DNA <213> Artificial sequence <400> 259 gggaccaacc ctcaaagcaa 20 <210> 260 <211> 20 <212> DNA <213> Artificial sequence <400> 260 cacgcccttg accgatacat 20 <210> 261 <211> 20 <212> DNA <213> Artificial sequence <400> 261 agcttggcct cctgtcattg 20 <210> 262 <211> 20 <212> DNA <213> Artificial sequence <400> 262 tcgaaactgc tcctgcctaa 20 <210> 263 <211> twenty one <212> DNA <213> Artificial sequence <400> 263 gcagaatgga gaacgttgtg t 21 <210> 264 <211> 20 <212> DNA <213> Artificial sequence <400> 264 agatggcgta cttgctgact 20 <210> 265 <211> twenty one <212> DNA <213> Artificial sequence <400> 265 cctactgaaa ggctcaccac a 21 <210> 266 <211> twenty one <212> DNA <213> Artificial sequence <400> 266 tgtactccat cggaacaagc c 21 <210> 267 <211> twenty one <212> DNA <213> Artificial sequence <400> 267 ttctcgtgtg cagaaatggg a 21 <210> 268 <211> 20 <212> DNA <213> Artificial sequence <400> 268 gcaacgtccg tgatgctctt 20 <210> 269 <211> 20 <212> DNA <213> Artificial sequence <400> 269 aatacgacat tccgcccacc 20 <210> 270 <211> 20 <212> DNA <213> Artificial sequence <400> 270 tgcaacagaa atcgcactgg 20 <210> 271 <211> twenty one <212> DNA <213> Artificial sequence <400> 271 aggccaaaag ctacaggaca a 21 <210> 272 <211> twenty one <212> DNA <213> Artificial sequence <400> 272 cttgcatttt cctctgcgtg a 21 <210> 273 <211> 20 <212> DNA <213> Artificial sequence <400> 273 aggttggctt ttggacctga 20 <210> 274 <211> 20 <212> DNA <213> Artificial sequence <400> 274 cacgtccccg tcactaaaca 20 <210> 275 <211> 20 <212> DNA <213> Artificial sequence <400> 275 aggttgccta tcagcccaag 20 <210> 276 <211> 20 <212> DNA <213> Artificial sequence <400> 276 ggcggagtat cacgcaaatg 20 <210> 277 <211> twenty one <212> DNA <213> Artificial sequence <400> 277 agaggacaga cgagctatgg a 21 <210> 278 <211> 20 <212> DNA <213> Artificial sequence <400> 278 atcccgagca ccagtagaga 20 <210> 279 <211> 20 <212> DNA <213> Artificial sequence <400> 279 tgctcatcgc tagttcgctt 20 <210> 280 <211> twenty one <212> DNA <213> Artificial sequence <400> 280 cgtgtagtgt acctgctcct t 21 <210> 281 <211> 20 <212> DNA <213> Artificial sequence <400> 281 agttgtccga ggttcccaaa 20 <210> 282 <211> 20 <212> DNA <213> Artificial sequence <400> 282 tcttaggcgc tcaggacgag 20 <210> 283 <211> twenty one <212> DNA <213> Artificial sequence <400> 283 aagttgatgc aagacggctc a 21 <210> 284 <211> 20 <212> DNA <213> Artificial sequence <400> 284 gatcgaggta ggccgaaaga 20 <210> 285 <211> 20 <212> DNA <213> Artificial sequence <400> 285 ctttgttccc gtagccgagt 20 <210> 286 <211> 20 <212> DNA <213> Artificial sequence <400> 286 ccgatgtcgt ttgaccttcg 20 <210> 287 <211> 20 <212> DNA <213> Artificial sequence <400> 287 acccccttta ccccgttagg 20 <210> 288 <211> 20 <212> DNA <213> Artificial sequence <400> 288 acgagtatgg gctctgacga 20 <210> 289 <211> 20 <212> DNA <213> Artificial sequence <400> 289 atctgccgtt aggtgtcgtc 20 <210> 290 <211> 20 <212> DNA <213> Artificial sequence <400> 290 gacagcgggg aatgtcgtag 20 <210> 291 <211> 20 <212> DNA <213> Artificial sequence <400> 291 cttacggcag ggcatgtagg 20 <210> 292 <211> twenty one <212> DNA <213> Artificial sequence <400> 292 tcccaacagt agccacattc t 21 <210> 293 <211> 20 <212> DNA <213> Artificial sequence <400> 293 cttggagggt tgggtcgatg 20 <210> 294 <211> 20 <212> DNA <213> Artificial sequence <400> 294 tggaatcagg ctttcggagt 20 <210> 295 <211> 20 <212> DNA <213> Artificial sequence <400> 295 acaccgatgg agccaagaaa 20 <210> 296 <211> 20 <212> DNA <213> Artificial sequence <400> 296 aactccaacg taaacgggct 20 <210> 297 <211> 20 <212> DNA <213> Artificial sequence <400> 297 gcacggccac cagagaataa 20 <210> 298 <211> 20 <212> DNA <213> Artificial sequence <400> 298 acctgatgga agtgtgccaa 20 <210> 299 <211> twenty two <212> DNA <213> Artificial sequence <400> 299 tgttccaact caaactacac ca 22 <210> 300 <211> 20 <212> DNA <213> Artificial sequence <400> 300 ccgaaaccac ctctccgttt 20 <210> 301 <211> twenty two <212> DNA <213> Artificial sequence <400> 301 accctgaagc tgatgaagga tt 22 <210> 302 <211> 20 <212> DNA <213> Artificial sequence <400> 302 ccactctcgt catacccact 20 <210> 303 <211> 20 <212> DNA <213> Artificial sequence <400> 303 aaccgccctt agagttcgtc 20 <210> 304 <211> 20 <212> DNA <213> Artificial sequence <400> 304 gtacggaaga ctgagcacga 20 <210> 305 <211> 20 <212> DNA <213> Artificial sequence <400> 305 aaaagctgaa aagaggggcg 20 <210> 306 <211> twenty one <212> DNA <213> Artificial sequence <400> 306 ttcctgaatg tgtcgtgtcg t 21 <210> 307 <211> 20 <212> DNA <213> Artificial sequence <400> 307 cagtcagtgc tatggacggt 20 <210> 308 <211> 19 <212> DNA <213> Artificial sequence <400> 308 gaactcctcg tttccgcca 19 <210> 309 <211> 20 <212> DNA <213> Artificial sequence <400> 309 aacaaccacc gtcgcaatga 20 <210> 310 <211> 20 <212> DNA <213> Artificial sequence <400> 310 ggcgcatttc ctcctaccag 20 <210> 311 <211> 20 <212> DNA <213> Artificial sequence <400> 311 aggccgccta tcctacagaa 20 <210> 312 <211> 20 <212> DNA <213> Artificial sequence <400> 312 gtagtgtgtg aggtacgccc 20 <210> 313 <211> 20 <212> DNA <213> Artificial sequence <400> 313 ttcaaggagt cgtgcaacct 20 <210> 314 <211> twenty one <212> DNA <213> Artificial sequence <400> 314 tgctctcaat tgttcgtcgg t 21 <210> 315 <211> 20 <212> DNA <213> Artificial sequence <400> 315 tcgccacacc aacgtattga 20 <210> 316 <211> 20 <212> DNA <213> Artificial sequence <400> 316 catccgacga acgccaaatc 20 <210> 317 <211> 20 <212> DNA <213> Artificial sequence <400> 317 ggcttcaccg agccactttg 20 <210> 318 <211> twenty one <212> DNA <213> Artificial sequence <400> 318 gtcaatgagc tgttcacgca a 21 <210> 319 <211> 20 <212> DNA <213> Artificial sequence <400> 319 agtggcgcgt ctcaagtatt 20 <210> 320 <211> 20 <212> DNA <213> Artificial sequence <400> 320 gctccggaac catgtccatt 20 <210> 321 <211> 20 <212> DNA <213> Artificial sequence <400> 321 cgctttgagc atggatggac 20 <210> 322 <211> 20 <212> DNA <213> Artificial sequence <400> 322 caatccccac acgtaaccgt 20 <210> 323 <211> 20 <212> DNA <213> Artificial sequence <400> 323 cttccgagca ccttcaaagc 20 <210> 324 <211> 20 <212> DNA <213> Artificial sequence <400> 324 gacgaaggtg acaatgtgcg 20 <210> 325 <211> 20 <212> DNA <213> Artificial sequence <400> 325 acaatctggc ttcagtgcct 20 <210> 326 <211> 20 <212> DNA <213> Artificial sequence <400> 326 gctccaggac tcgtagcatt 20 <210> 327 <211> 20 <212> DNA <213> Artificial sequence <400> 327 gcgatccacg actccttttt 20 <210> 328 <211> twenty one <212> DNA <213> Artificial sequence <400> 328 ttgccagcag aatcagacac a 21 <210> 329 <211> twenty one <212> DNA <213> Artificial sequence <400> 329 tggttctccc attctcgtgt g 21 <210> 330 <211> 20 <212> DNA <213> Artificial sequence <400> 330 agttgggtaa ttccgggacc 20 <210> 331 <211> 20 <212> DNA <213> Artificial sequence <400> 331 caggtgtagc tgtgggcttt 20 <210> 332 <211> 20 <212> DNA <213> Artificial sequence <400> 332 acgcgaagtg caaatgtgtc 20 <210> 333 <211> 20 <212> DNA <213> Artificial sequence <400> 333 acctcgtcca ctcccttcat 20 <210> 334 <211> 20 <212> DNA <213> Artificial sequence <400> 334 cccattctcg acggctctaa 20 <210> 335 <211> twenty one <212> DNA <213> Artificial sequence <400> 335 ttcaggtggt gcttttcctg t 21 <210> 336 <211> 18 <212> DNA <213> Artificial sequence <400> 336 gcaggcgagg tgcctaaa 18 <210> 337 <211> 20 <212> DNA <213> Artificial sequence <400> 337 aagaacaacg tgcccgagat 20 <210> 338 <211> 20 <212> DNA <213> Artificial sequence <400> 338 tctgttggtt gcttttgcga 20 <210> 339 <211> 20 <212> DNA <213> Artificial sequence <400> 339 gagaggtcgc ggatactcct 20 <210> 340 <211> twenty one <212> DNA <213> Artificial sequence <400> 340 ctttcaggcg aaggataggc t 21 <210> 341 <211> 20 <212> DNA <213> Artificial sequence <400> 341 cggttgccca tgaaatcgac 20 <210> 342 <211> 20 <212> DNA <213> Artificial sequence <400> 342 cacctgacga taggagcagc 20 <210> 343 <211> twenty four <212> DNA <213> Artificial sequence <400> 343 tgataaggaa agcaaaaccc ttca 24 <210> 344 <211> 20 <212> DNA <213> Artificial sequence <400> 344 ggtgggaggc ccctattgat 20 <210> 345 <211> twenty one <212> DNA <213> Artificial sequence <400> 345 tggcgcgata ggaaggtaaa a 21 <210> 346 <211> 20 <212> DNA <213> Artificial sequence <400> 346 atcagcggaa tcgtccatcg 20 <210> 347 <211> 20 <212> DNA <213> Artificial sequence <400> 347 aacacccccg acattcagtc 20 <210> 348 <211> twenty two <212> DNA <213> Artificial sequence <400> 348 acgttgatgg tagaaaagcc ga 22 <210> 349 <211> 20 <212> DNA <213> Artificial sequence <400> 349 agcaggcaag cgattaaagt 20 <210> 350 <211> 20 <212> DNA <213> Artificial sequence <400> 350 cccggaaaaa cctcctcaac 20 <210> 351 <211> twenty one <212> DNA <213> Artificial sequence <400> 351 ccctcggaca ctcgtaaaac t 21 <210> 352 <211> twenty two <212> DNA <213> Artificial sequence <400> 352 atgccttgtt tccagagggt ta 22 <210> 353 <211> twenty one <212> DNA <213> Artificial sequence <400> 353 ggttatattc gcctctcccc a 21 <210> 354 <211> twenty one <212> DNA <213> Artificial sequence <400> 354 acacacttct tgtagggcag t 21 <210> 355 <211> 20 <212> DNA <213> Artificial sequence <400> 355 caggaaacgc atcaacatca 20 <210> 356 <211> twenty one <212> DNA <213> Artificial sequence <400> 356 ccaaagtggg gtggtttatg g 21 <210> 357 <211> twenty one <212> DNA <213> Artificial sequence <400> 357 acctcctcaa cctccaaaac a 21 <210> 358 <211> 20 <212> DNA <213> Artificial sequence <400> 358 ccgtctgcgt ctctccatta 20 <210> 359 <211> 20 <212> DNA <213> Artificial sequence <400> 359 agtggacctt gataagccgc 20 <210> 360 <211> 20 <212> DNA <213> Artificial sequence <400> 360 aatacctggc cggaaagagc 20 <210> 361 <211> 20 <212> DNA <213> Artificial sequence <400> 361 cagcatttgt gttgggggtg 20 <210> 362 <211> 20 <212> DNA <213> Artificial sequence <400> 362 aacatcgcac tgattggggt 20 <210> 363 <211> 20 <212> DNA <213> Artificial sequence <400> 363 ctccggttga ccaaaatggc 20 <210> 364 <211> twenty one <212> DNA <213> Artificial sequence <400> 364 gtccttgaca aaggtgcatc a 21 <210> 365 <211> 20 <212> DNA <213> Artificial sequence <400> 365 ctgacccctt ttgcgtccat 20 <210> 366 <211> 20 <212> DNA <213> Artificial sequence <400> 366 ttaatgtctg tgccaagcga 20 <210> 367 <211> twenty one <212> DNA <213> Artificial sequence <400> 367 aaggaggacc cttcagttgt g 21 <210> 368 <211> 20 <212> DNA <213> Artificial sequence <400> 368 ccaaacgcca caaaaacgac 20 <210> 369 <211> 20 <212> DNA <213> Artificial sequence <400> 369 gagcccatgt cgagtagtga 20 <210> 370 <211> 20 <212> DNA <213> Artificial sequence <400> 370 ttgtttccaa cgccggacta 20 <210> 371 <211> 20 <212> DNA <213> Artificial Sequence <400> 371 gaaacgggca tggaaagctc 20 <210> 372 <211> 20 <212> DNA <213> Artificial sequence <400> 372 gggtgcggga atgaatctct 20 <210> 373 <211> 20 <212> DNA <213> Artificial sequence <400> 373 agagaaaact cgggaggtcg 20 <210> 374 <211> 20 <212> DNA <213> Artificial sequence <400> 374 cagagcaaag catgagcaaa 20 <210> 375 <211> twenty one <212> DNA <213> Artificial sequence <400> 375 tgaggcgttg gaaaatggag a 21 <210> 376 <211> 20 <212> DNA <213> Artificial sequence <400> 376 tacggaggcg ttgttaaggg 20 <210> 377 <211> 20 <212> DNA <213> Artificial sequence <400> 377 aaaacgtcga gccaaaagcc 20 <210> 378 <211> 20 <212> DNA <213> Artificial sequence <400> 378 aatgcagggg agttgtcagg 20 <210> 379 <211> 20 <212> DNA <213> Artificial sequence <400> 379 caggtcagtt cgtcacaagc 20 <210> 380 <211> 20 <212> DNA <213> Artificial sequence <400> 380 acggatcttg ggttgcatct 20 <210> 381 <211> 20 <212> DNA <213> Artificial sequence <400> 381 gaacagcttg gcagaagcac 20 <210> 382 <211> 20 <212> DNA <213> Artificial sequence <400> 382 caccatccag cccaagctaa 20

Claims

1. An InDel molecular marker primer set covering the entire genome of *Cyclocarya paliurus*, characterized in that... The InDel molecular marker primer set consists of primer pairs corresponding to 191 marker sites, and its primer sequences are shown in SEQ ID NO.1 to SEQ ID NO.

382.

2. The application of the InDel molecular marker primer set covering the entire genome of *Gastrodia elata* as described in claim 1 in the construction of a genetic map of *Gastrodia elata*.

3. The application of the InDel molecular marker primer set covering the entire genome of *Gnaphalium affine* as described in claim 1 in the genetic diversity analysis of *Gnaphalium affine*.

4. The application of the InDel molecular marker primer set covering the entire genome of *Gypsophila spp.* as described in claim 1 in the identification of *Gypsophila spp.* varieties.

5. A method for identifying varieties of Baby's Breath, characterized in that, Includes the following steps: (1) Obtain the genomic DNA of the sample to be tested; (2) PCR amplification of the genomic DNA using the primers described in claim 1; (3) The PCR amplification products were detected by agarose gel electrophoresis; (4) Determine the variety of the sample to be tested.

6. The method for identifying the *Gypsophila* variety according to claim 5, characterized in that, The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 29 cycles; 72℃ extension for 7 min.

7. The method for identifying the *Gypsophila* variety according to claim 5, characterized in that, Each 10 μL of the PCR amplification system includes: 7.3 μL ddH2O; 1 μL 10×Taq buffer; 0.8 μL dNTP; 0.2 μL each of the 10 μM front and back primers; 0.1 μL Taq enzyme; and 0.4 μL genomic DNA.

8. The method for identifying the *Gypsophila* variety according to claim 5, characterized in that, The concentration of the agarose gel used for electrophoresis detection is 3.0%-3.5%.

9. The method for identifying the *Gypsophila* variety according to claim 5, characterized in that, The electrophoresis detection was performed at a pressure of 100V for a time of 1.0h-1.5h.