InDel molecular markers tightly linked to tomato male sterility gene ms-7 and their primers and applications

Abstract

The present invention discloses an InDel molecular marker TMMS7 tightly linked to a tomato male sterile gene ms-7, located at the position of 8638522bp of chromosome 11, and its nucleotide sequence is shown in SEQ ID NO.5, which is obtained by amplifying the primer sequences shown in SEQ ID NO.3 and SEQ ID NO.4. The InDel molecular marker tightly linked to the tomato male sterile gene developed by the present invention is a pair of co-dominant specific molecular markers, with a clear physical position and convenient identification. The detection accuracy rate in the seedling stage on the nursery bed is 100%, eliminating the need to wait until the flowering stage to identify male sterility after planting, saving labor costs and time costs. At the same time, the complicated procedure of artificial emasculation of the female parent in the seed production process is eliminated, greatly improving the breeding efficiency and production efficiency.

Description

Technical Field

[0001] The invention belongs to the field of plant biotechnology, and in particular relates to an InDel molecular marker tightly linked to a tomato male sterile gene ms-7, a primer thereof and an application thereof. Background Art

[0002] Tomato (Solanum lycopersicum) is an important vegetable and cash crop, and is widely popular around the world. my country is the largest producer of fresh tomatoes and the third largest producer of processed tomatoes, and plays a pivotal role in the world tomato market. In recent years, due to economic reasons and quality issues, my country's tomato sauce exports have been greatly reduced, and the area of ​​processing tomato cultivation has also shrunk seriously. Hybrid vigor is a common phenomenon in the biological world and an important way to improve crops and significantly increase yields. Since the beginning of the 20th century, male sterility has been discovered in various crops, and male sterility has been used to produce hybrids in production. In some crops, such as corn, sorghum, and rice, great achievements have been made. Tomato is a self-pollinating crop, and hybrid vigor is very obvious. Hybrids increase yield by more than 20%-30% compared with ordinary varieties, and have high uniformity and strong stress resistance. With the increasing difficulty of multi-objective breeding of tomatoes such as high yield, high quality and stress resistance, the use of hybrid complementary effects to achieve simultaneous breakthroughs in tomato yield, quality, resistance and other traits has become an important development direction of tomato breeding research. Since there are still certain difficulties in the use of male sterile lines of tomatoes, the hybrids promoted on a large scale in production are still mainly artificially emasculated, and the high cost of seed production has become one of the main limiting factors for the use of tomato heterosis. Therefore, the large-scale promotion and utilization of hybrid tomatoes still requires breakthroughs in high-efficiency and low-input seed production methods. The application of male sterile lines in vegetable hybrid seed production provides a new idea for the production of tomato hybrid seeds. Since there are still certain difficulties in the use of male sterile lines of tomatoes, when male sterile lines are used for breeding, the fertile and sterile plants of their offspring are separated. Using molecular markers, sterile and fertile plants can be identified in the seedling stage, which solves the problem that the original dual-purpose lines can only identify sterile and fertile plants when they are in bloom. However, the commercial traits of general sterile lines are poor, so in practical applications, male sterile genes need to be transferred. However, the breeding cycle of ordinary sterile lines is very long, and it is possible to breed an excellent male sterile line through repeated hybridization and self-pollination for many generations. How to effectively identify fertile and sterile plants in the early stage will directly affect their application value. Summary of the invention

[0003] The purpose of the present invention is to provide an InDel molecular marker tightly linked to the tomato male sterility gene ms-7, as well as primers and applications thereof, which are intended to be applied to tomato male sterility identification and related assisted breeding, and can quickly and effectively carry out male sterility genotype identification, breeding and seed production, so as to overcome the defects of time-consuming, labor-intensive breeding and seed impurity in the breeding and seed production processes of the prior art.

[0004] The object of the present invention is achieved by the following technical solution: through sequence alignment, an insertion / deletion (AGGAATTATAAACTCTAATTCCTAG) polymorphic site is obtained at the position of 8638522bp on chromosome 11 of the tomato reference genome (https: / / solgenomics.net / organism / Solanum_lycopersicum / genome), as described in SEQID NO.5.

[0005] According to the sequence information on both sides of the polymorphic site, a pair of primers suitable for the InDel molecular marker was designed, and the upstream primer sequence is shown in SEQ ID NO.3 and the downstream primer sequence is shown in SEQ ID NO.4.

[0006] The InDel molecular marker and primers thereof can be used for identification of male sterility traits of tomatoes and for breeding.

[0007] The above method is used to identify the male sterility trait of tomato, and the steps are as follows:

[0008] (1) Using a high-efficiency plant genomic DNA extraction kit (purchased from Tiangen Biochemical Technology Co., Ltd., catalog number: DP305), extract genomic DNA from tomato seedling leaves; (2) using the upstream and downstream primers, using the genomic DNA extracted in step (1) as a template, perform PCR amplification; (3) electrophoresing, staining and developing the amplified product in step (2), and finally determining the genotype according to the size and position of the displayed fragment.

[0009] Furthermore, when determining the genotype in the above step (3), if a fragment of 295 bp (SEQ NO.1) is amplified, both alleles of the sample are ms-7, and the phenotype is male sterility; if a fragment of 320 bp (SEQ NO.2) is amplified, both alleles of the sample are MS-7, and the phenotype is male fertility; if two fragments of 295 bp and 320 bp are amplified, one allele of the sample is ms-7, and the phenotype is male sterility; the other allele is MS-7, and the phenotype is male fertility.

[0010] The beneficial effects of the present invention are as follows: (i) the present invention obtains an InDel molecular marker closely linked to the tomato male sterility gene ms-7 through sequence alignment, and this site is located at an insertion / deletion variation at 8638522bp of chromosome 11 of the tomato reference genome (https: / / solgenomics.net / organism / Solanum_lycopersicum / genome), and the specific variation information of the sequence is shown in SEQ NO.1 and SEQ NO.2; (ii) the present invention also designs a pair of specific InDel molecular marker primers based on the sequence information at both ends of the variation site, and the specific information of the primer sequence is shown in SEQ NO.3 and SEQ NO.4. NO.4; the primer detection is simple and convenient, easy to operate, with excellent repeatability and stability, and high accuracy. Its detection accuracy is as high as 100% in the F2 segregation population; (iii) the present invention utilizes simple methods and operating steps to quickly determine whether the tomato germplasm material is a male sterile line during the tomato seedling stage, providing efficient technical support for the breeding and production of male sterile tomatoes, greatly shortening the breeding cycle and seed production procedures; and laying a preliminary foundation for further research on the biological function of the male sterile gene ms-7. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 The floral organ phenotypes of the tomato male sterile mutant ms-7 and the male fertile wild type MS-7 are shown in the figure, wherein the left side shows the floral organ phenotype of the mutant ms-7, and the right side shows the floral organ phenotype of the male fertile wild type MS-7; Figure 2 This is the BSA-Seq localization map of the tomato male sterility gene ms-7; Figure 3 Detection of the InDel molecular marker TMMS7 of the tomato male sterile mutant ms-7, the wild type MS-7 and some F2, where M is Marker, lane 1 is ms-7, lane 2 is MS-7, and lanes 3 to 39 are some F2. DETAILED DESCRIPTION

[0012] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0013] Example 1: Development of InDel molecular markers for the tomato male sterility gene ms-7. The mutant 2-089 of ms-7 (introduced from the Tomato Genetics Center, which is an open institution and ordinary researchers can apply to introduce materials) was used as the female parent, and the wild-type MS-7 line San Marzano (also introduced from the Tomato Genetics Center) was used as the male parent. Hybridization was performed to obtain the F1 generation, all of which were male fertile. The F1 generation was self-pollinated to obtain an F2 segregation population, of which 760 were male fertile and 256 were male sterile, with a segregation ratio of 2.97:1. The chi-square test was in line with the Mendelian inheritance law of 3:1, indicating that the sterility gene is a single recessive gene.

[0014] In the F2 segregation population, 30 male sterile plants and 30 male fertile plants were randomly selected to construct 30×30 sterile DNA pools and fertile DNA pools. Next-generation sequencing was used for resequencing to detect polymorphic sites on the genomes of sterile parents, fertile parents, sterile pools, and fertile pools. Through association analysis, the ms-7 gene was finally located in the candidate region between 5.92Mb and 9.45Mb on tomato chromosome 11, such as Figure 2 shown.

[0015] By comparing the differences in the parental genome sequences in the candidate region, an insertion / deletion (AGGAATTATAAACTCTAATTCCTAG) difference at the 8638522bp position was obtained. Based on the sequence information at both ends of this difference, specific amplification primers were designed (the primer sequence information is shown in SEQ NO.3 and SEQ NO.4), and finally the InDel molecular marker TMMS7 was obtained.

[0016] Example 2: Application of InDel molecular marker TMMS7 in identifying male fertility of tomato seedlings. Genomic DNA of two parents and F2 plants was extracted, and PCR reaction was performed using genomic DNA as template. PCR reaction system: DNA template 1 μL, PfuPCR MasterMix (2×) 12.5 μL, forward primer 1 μL, reverse primer 1 μL, ddH2O 9.5 μL; PCR reaction procedure: 94°C pre-denaturation for 3 minutes; 94°C denaturation for 30 seconds, 60°C annealing for 30 seconds, 72°C extension for 60 seconds, 35 cycles; 72°C extension for 5 minutes. PCR products were detected by electrophoresis using 8% polyacrylamide gel. The results are as follows: Figure 3 shown.

[0017] Statistics and judgment of electrophoresis band type: If only a band of 295bp is amplified in the tested plant, the genotype of the plant is aa, which can be judged as male sterile; if only a band of 320bp is amplified in the tested plant, the genotype of the plant is AA, which can be judged as male fertile; if two bands of 295bp and 320bp are amplified in the tested plant, the genotype of the plant is Aa, which can be judged as male fertile. The statistical results are shown in Table 1. The results of molecular marker detection in the seedling stage are completely consistent with the phenotypic identification results of the field flowering stage.

[0018] Table 1 Identification table of genotypes and male sterility phenotypes of the two parents and F2 individual plants

[0019]

[0020] The 9 male sterile plants identified as aa homozygous genotype by InDel molecular marker TMMS7 also had male sterile flowering phenotypes; the 11 male fertile plants identified as AA homozygous genotypes also had male fertile flowering phenotypes; the 19 male fertile plants identified as Aa heterozygous genotypes also had male fertile flowering phenotypes (Table 1). It can be seen that the accuracy of the genotype and phenotype identification of the InDel molecular marker TMMS7 of the present invention is 100%. Therefore, the InDel molecular marker TMMS7 of the present invention can be used for the identification of male sterile traits of tomatoes, assisted breeding and seed production. SEQUENCE LISTING <110> Institute of Horticultural Crops, Xinjiang Academy of Agricultural Sciences <120> InDel Molecular Markers Tightly Linked to Tomato Male Sterility Gene ms-7 Its primers and applications <160> 5 <170> PatentIn version 3.5 <210> 1 <211> 295 <212> DNA <213> Tomato Male Sterility Gene ms-7 <400> 1 ccaaattcgc cttaggaaca ggtttatgtt atatgttcct ttgagaaatt acaatagtta 60 cgttttgtga agtaaataaa ataatgacac aatactttat cgcggaaaac cccaactcac 120 atgggtaaaa actacgacct acacctctgt aggatttaac tccattttat tagatttcaa 180 gtctcaacaa aagattacaa agctatgtaa cctaaggaat tataaactct aattcctagc 240 taagaaatta taaactctaa tttctagcta cccaaagaca caaaaccccc gattt 295 <210> 2 <211> 320 <212> DNA <213> Tomato male fertile gene MS-7 <400> 2 ccaaattcgc cttaggaaca ggtttatgtt atatgttcct ttgagaaatt acaatagtta 60 cgttttgtga agtaaataaa ataatgacac aatactttat cgcggaaaac cccaactcac 120 atgggtaaaa actacgacct acacctctgt aggatttaac tccattttat tagatttcaa 180 gtctcaacaa aagattacaa agctatgtaa cctaaggaat tataaactct aattcctaga 240 ggaattataa actctaattc ctagctaaga aattataaac tctaatttct agctacccaa 300 agacacaaaa cccccgattt 320 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <400> 3 ccaaattcgc cttaggaaca 20 <210> 4 <211> 20 <212> DNA <213> Artificial sequence <400> 4 aaatcggggg ttttgtgtct 20 <210> 5 <211> 25 <212> DNA <213> InDel molecular markers <400> 5 aggaattata aactctaatt cctag 25

Claims

1. An InDel molecular marker TMMS7 tightly linked to the tomato male sterility gene ms-7, the sequence of which is shown in SEQ ID NO.1 or SEQ NO.

2.

2. A kit, characterized in that: The method comprises a PCR primer designed for the InDel molecular marker TMMS7 according to claim 1, wherein the PCR primer sequence is as follows: TMMS7-F: 5'-CCAAATTCGCCTTAGGAACA-3', That is, SEQ NO.3; TMMS7-R: 5'-AAATCGGGGGTTTTGTGTCT-3', that is, SEQ NO.

4.

3. Use of the InDel molecular marker TMMS7 tightly linked to the tomato male sterility gene ms-7 as a detection target in the identification of tomato male sterility genotype and phenotype.

4. Use of the InDel molecular marker TMMS7 tightly linked to the tomato male sterility gene ms-7 as claimed in claim 1 in tomato male sterility assisted breeding and seed production.

5. The use according to claim 3 or 4, characterized in that: The method comprises the following steps: using the tomato genomic DNA to be detected as a template and performing PCR amplification using the primers described in claim 2; The PCR products were subjected to electrophoresis, staining, development and band reading. If a 295bp fragment was amplified, both alleles of the tomato were ms-7, and the phenotype was male sterile; if a 320bp fragment was amplified, both alleles of the tomato were MS-7, and the phenotype was male fertile; if two fragments of 295bp and 320bp were amplified, one allele of the tomato was ms-7 and the other allele was MS-7, and the phenotype was male fertile.

Images