A high-throughput screening method for phenylethanolamine n-methyltransferase
By using NDCC compounds to detect the enzyme activity of phenylethanolamine-N-methyltransferase in a 96-well plate of an ELISA reader, the problems of low screening efficiency and high cost in existing technologies are solved, realizing a high-throughput, low-cost enzyme screening method suitable for large-scale screening of phenylethanolamine-N-methyltransferase.
Patent Information
- Application Number
- CN202210670475.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-06-14
- Publication Date
- 2026-05-29
- Estimated Expiration
- 2042-06-14
AI Technical Summary
Existing screening methods for phenylethanolamine-N-methyltransferases are inefficient, costly, and have poor selectivity, making it difficult to meet the needs of high-throughput screening.
The reaction was carried out in a 96-well plate of an ELISA reader. The enzyme activity of phenylethanolamine-N-methyltransferase was detected by using NDCC compounds. The enzyme activity was detected by the color change of the hydrolysis reaction of S-adenosylmethionine byproduct S-adenosylhomocysteine. High-throughput screening was achieved by combining the reaction of phenylethanolamine-N-methyltransferase samples with enzyme-free empty bacterial samples.
It achieves high-throughput, low-cost, and accurate phenylethanolamine-N-methyltransferase screening, which is suitable for large-scale screening, simplifies the operation process, and reduces detection costs.
Smart Images

Figure CN114854822B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to high-throughput screening technology, specifically to a high-throughput screening method for phenylethanolamine-N-methyltransferase, belonging to the field of biotechnology. Background Technology
[0002] Phenylethanamine-N-methyltransferase (PNMT) is an enzyme that catalyzes the transfer of a methyl group from S-adenosylmethionine to the amino terminus of norepinephrine to generate epinephrine. The synthesis of epinephrine from norepinephrine using PNMT is a mild, environmentally friendly reaction with no pollutant generation, and has wide applications in biocatalysis and biomedicine.
[0003] Novel enzymes can be discovered through natural mutation screening, but this method is inefficient and lacks specificity, necessitating the development of rapid and efficient new methods. Molecular modification methods were employed to screen for novel phenylethanolamine-N-methyltransferases. When existing enzymes are mutated using molecular modification methods, a large library is typically formed, making high-throughput detection methods crucial for screening. Currently, high-performance liquid chromatography (HPLC) is a widely used screening method due to its high separation efficiency, good selectivity, high detection sensitivity, and wide application range; however, it is costly and time-consuming, failing to improve screening efficiency.
[0004] Therefore, developing a high-throughput screening method for phenylethanolamine-N-methyltransferases is of great significance for the directed evolution of phenylethanolamine-N-methyltransferases. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide a high-throughput screening method for phenylethanolamine-N-methyltransferases, addressing the shortcomings of the prior art.
[0006] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:
[0007] A high-throughput screening method for phenylethanolamine-N-methyltransferase involves adding substrates norepinephrine and S-adenosylmethionine, PBS buffer, and S-adenosyl-L-homocysteine hydrolase (SAHH) to a 96-well plate of a microplate reader. Then, enzyme solutions of phenylethanolamine-N-methyltransferase samples and enzyme-free empty bacterial samples pET24a / E. coli BL21(DE3) are added separately. The plate is then incubated in a microplate shaker at 20-50°C and 500-1000 rpm for 1-3 hours, followed by centrifugation at 3700 rpm for 10 minutes at 4°C. The supernatant is collected, and NDCC compound is added. The reaction is continued for 0-90 minutes. During the reaction, the 96-well plate is removed every 1-30 minutes, and the absorbance at 405 nm is measured. Based on the change in absorbance, enzyme activity is defined as the change in OD405 nm absorbance per minute multiplied by 1,000,000 under specific conditions.
[0008] The synthesis method of the compound NDCC is as follows: 0.1-0.2 g of 5-nitrosalicylic acid aldehyde, 0.1-0.2 g of 2-cyclopenten-1-one and 0.05-0.1 g of imidazole are dissolved in a mixed solution of 1.5 mL of tetrahydrofuran and 1.5 mL of deionized water, stirred overnight at 20 °C, then diluted 4.3 times with deionized water, and extracted with ethyl acetate. The organic components are combined, and ethyl acetate is removed by vacuum filtration. NDCC is then purified by rapid chromatography.
[0009] The enzyme sample was phenylethanolamine-N-methyltransferase, and the enzyme source was referenced in the patent: A phenylethanolamine-N-methyltransferase hPNMT54 and its cloning, expression and application.
[0010] The high-throughput screening method for phenylethanolamine-N-methyltransferase described in this invention refers to phenylethanolamine-N-methyltransferase, which is a methyltransferase that catalyzes the synthesis of epinephrine from norepinephrine.
[0011] The principle of detection using chemically synthesized NDCC compounds described in this invention is as follows: phenylethanolamine-N-methyltransferase transfers the methyl group of S-adenosylmethionine to the amino terminus of norepinephrine to generate epinephrine. S-adenosylmethionine generates its byproduct S-adenosyl homocysteine, which is hydrolyzed into adenosine and homocysteine by S-adenosyl-L-homocysteine hydrolase (SAHH). The NDCC compound can detect homocysteine, showing an absorbance change at 405 nm, changing from colorless to yellow, indicating relatively sensitive detection.
[0012] As an improvement, the nucleotide sequence of the phenylethanolamine-N-methyltransferase is shown in SEQ ID No. 1.
[0013] SEQ ID No. 1:
[0014] atggaccctggtcgtgaaagcagcattgcagcagttgcagaaagctatcagaaatttgat60ccgcgtgcatatctgcagaataactatgttccgcctcgtgcagattttagccgtgaagat120agcgttgttccgtggaaactgcgttgtctggccgaagcatttgcaaccggtgaaattcat180ggtcgtaccctgattgatattggtagcggtccgaccatttatcagctgctgagcgcatgt240gaacattttgaagaaattatcatgaccgattttctggaagtgaatcgtcaagaactgcgt300cgttggctgcgtggtgaaccgggtgcatttgattggagcccgtatctgcagcatgtttgt360aaaattgaaggtaaaggtgaaagctggcaagaaaaagaacgtcgtctgcgtgaacgtgtt420aaacgtgttctgccgattgatgttcatcagccgaatccgttaggtagcggtagcctggca480ccggaaccggttgatgcactggttagcaccttttgtctggaagcagttagtccggatcgt540gcgagctttcagcgtgcactggaaaacattaccacactgctgaaacctggtggtcatttt600ctgatgattggtgccctggaagaaagtttttatctggcaggcgaagcacgtctgagcgtt660gtgccggttagcgaagaagaagttcgcgaagcactgaccaaaagcggttatgaaattcgt720gattttcgcacctataccatgcctccgagcctgaaagttggtgttgatgatgttcgtggt780atcttttttgtttgggcacagaaaaaagcagcagcacatcaccatcatcatcac834
[0015] As an improvement, the nucleotide sequence of the S-adenosyl-L-homocysteine hydrolase is as shown in SEQ ID No.2.
[0016] SEQ ID No.2:
[0017]
[0018] As an improvement, in this step, the plasmid sequence of the enzyme-free empty bacteria pET24a / E.coli BL21(DE3) is shown in SEQ ID No. 3.
[0019] SEQ ID No. 3:
[0020]
[0021] A further improvement is that the phenylethanolamine-N-methyltransferase is obtained through the following steps:
[0022] Step 1: Construct the genetically engineered bacterium pET24a-hPNMT54-E.coli BL21(DE3) expressing PNMT.
[0023] After codon optimization based on the amino acid ancestor sequence mined by enzyme ancestor sequence reconstruction technology, the whole gene was synthesized and subcloned into the vector pET24a to obtain the recombinant plasmid pET24a-hPNMT54. The constructed recombinant plasmid pET24a-hPNMT54 was transformed into the E. coli expression host BL21(DE3) using the calcium chloride method to obtain the phenylethanolamine-N-methyltransferase expression strain pET24a-hPNMT54-E.coli BL21(DE3);
[0024] Step 2, in vitro expression induction
[0025] The phenylethanolamine-N-methyltransferase expression strain pET24a-hPNMT54-E.coli BL21(DE3) was inoculated into 96-well plates. 300-500 μl of LB medium containing 50 μg / mL kanamycin was added to each well. After overnight incubation at 25-40℃ for 10-20 h, 1 ml of LB medium containing 50 μg / mL kanamycin was added. When OD600 = 0.4-0.8, IPTG was added at a final concentration of 0.25 mM-1 mM. The plates were then incubated at 15-30℃ and 500-1000 rpm for 15-20 h.
[0026] Step 3, Obtaining phenylethanolamine-N-methyltransferase
[0027] After in vitro induction of expression, the bacterial cells were collected by centrifugation at 3000-8000 rpm for 10-15 min at 4℃. The bacterial cells were washed three times with PBS buffer and then resuspended in PBS buffer.
[0028] Beneficial effects:
[0029] Compared with existing technologies, this invention provides a high-throughput screening method for phenylethanolamine-N-methyltransferase. The method establishes a high-throughput screening approach that utilizes the reaction of synthesized NDCC compounds with S-adenosylhomocysteine, a byproduct of S-adenosylmethionine, after hydrolysis by SAHH hydrolase to produce homocysteine, resulting in a color change from colorless to yellow, with a change in absorbance at 405 nm. This method is used to detect the enzyme reaction rate of phenylethanolamine-N-methyltransferase, thereby detecting its enzyme activity. It features simple operation, low cost, and accurate detection, making it suitable for large-scale high-throughput screening for the directed evolution of this enzyme. Attached Figure Description
[0030] Figure 1 This is a schematic diagram illustrating the principle of high-throughput detection of phenylethanolamine-N-methyltransferase in this invention;
[0031] Figure 2 The structural formula of the NDCC compound in this invention is shown below;
[0032] Figure 3 The nuclear magnetic resonance spectrum of the NDCC compound in this invention;
[0033] Figure 4 This invention compares the enzymatic reactions of phenylethanolamine-N-methyltransferase PNMT54 with those of enzyme-free empty bacteria pET24a / E.coli BL21(DE3). Detailed Implementation Plan
[0034] The present invention will be further described below through embodiments, but these are not intended to limit the scope of protection of the present invention.
[0035] Unless otherwise specified, the experimental methods used in these examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified. Furthermore, all quantitative experiments in these examples were performed in triplicate, and the results were averaged. The instruments used included: an ELISA reader, a microplate shaker, and a multi-channel pipette.
[0036] The substrates norepinephrine and S-adenosylmethionine were purchased from Nanjing Wanqing Chemical Glassware Co., Ltd.
[0037] The synthesis method of compound NDCC in Example 1 is as follows:
[0038] (1) 0.167 g 5-nitrosalicylic acid, 0.164 g 2-cyclopenten-1-one and 0.068 g imidazole were dissolved in a mixed solution of 1.5 mL tetrahydrofuran and 1.5 mL deionized water;
[0039] (2) Stir at 20℃ for 72 hours to complete the reaction and obtain a mixture;
[0040] (3) The final mixture was diluted 4.3 times with water and extracted with ethyl acetate;
[0041] (4) The crude product was subjected to silica gel chromatography, using ethyl acetate and petroleum ether (volume ratio 1:4) as eluents;
[0042] (5) The solution was slowly evaporated at room temperature to form yellow crystals;
[0043] (6) The synthesized compound was subjected to nuclear magnetic resonance to confirm that the compound was successfully synthesized. The results are shown in Figure 3.
[0044] Example 2: Induced expression of phenylethanolamine-N-methyltransferase
[0045] (1) Step 1: Construct the genetically engineered bacterium pET24a-hPNMT54-E.coli BL21(DE3) expressing PNMT.
[0046] After codon optimization based on the amino acid ancestor sequence mined by enzyme ancestor sequence reconstruction technology, the whole gene was synthesized and subcloned into the vector pET24a to obtain the recombinant plasmid pET24a-hPNMT54. The constructed recombinant plasmid pET24a-hPNMT54 was transformed into the E. coli expression host BL21(DE3) using the calcium chloride method to obtain the phenylethanolamine-N-methyltransferase expression strain pET24a-hPNMT54-E.coli BL21(DE3);
[0047] (2) In vitro induction of expression
[0048] The phenylethanolamine-N-methyltransferase expression strain pET24a-hPNMT54-E.coli BL21(DE3) was inoculated into 96-well plates, with 300-500 μl of LB medium containing 50 μg / mL kanamycin added to each well. After sealing, the plates were cultured at 37°C and 500-1000 rpm in a microplate shaker for 12 h. Then, 200 μl of the medium was transferred to a new 96-well plate containing 50 μg / mL kanamycin in LB medium and cultured at 37°C and 500-1000 rpm in a microplate shaker for 2 h. 0.2-0.5 mM IPTG was added for induction, and the plates were cultured at 25°C and 500-1000 rpm in a shaker for 12-18 h.
[0049] (3) Obtaining phenylethanolamine-N-methyltransferase
[0050] After in vitro induction of expression, the bacterial cells were collected by centrifuging the 96-well plate at 3000-8000 rpm for 10-15 min at 4℃. The bacterial cells were washed three times with PBS buffer (pH 7.050 mM) and then resuspended in PBS buffer.
[0051] (4) Here a comparative example is set up, which is a blank phenylethanolamine-N-methyltransferase, named enzyme 1, i.e. pET24a. The construction method is the same as in Example 2 (1) for comparison.
[0052] (5) The in vitro induction expression of enzyme 1 and the method for obtaining the enzyme are as described in (2) and (3) of Example 2.
[0053] Example 3: Detection of phenylethanolamine-N-methyltransferase
[0054] Add the following system to a 96-well plate: 10 μL of 2.5 mM SAM, 10 μL of 5 mM norepinephrine, 20-50 μL of 2 mM NDCC compound, 80 μL of SAHH hydrolase, 80 μL of phenylethanolamine-N-methyltransferase enzyme solution or enzyme 1, and 20 μL of PBS buffer (pH 7.050 mM).
[0055] First, add 10 μL of 2.5 mM SAM, 10 μL of 5 mM norepinephrine, 80 μL of SAHH hydrolase, 80 μL of phenylethanolamine-N-methyltransferase enzyme solution or enzyme 1, and 20 μL of PBS buffer (pH 7.0 50 mM) to a 96-well plate. Incubate at 37°C in a microplate shaker at 500-1000 rpm for 1-3 hours. Remove the plate, centrifuge at 3700 rpm for 10 minutes at 4°C, and then add 20-50 μL of 2 mM NDCC compound to the supernatant. Incubate for 0-90 minutes, removing the plate every 30 minutes and measuring the absorbance at 405 nm using a microplate reader. Enzyme activity is defined as the change in OD405 nm absorbance per minute multiplied by 1,000,000 under specific conditions, based on the change in absorbance.
[0056] Based on the absorbance values at different time points in the experimental group, the earlier the absorbance value reaches a larger value, the higher the corresponding enzyme activity. Based on the difference in absorbance values between the experimental group and the control group, the difference reflects that this high-throughput detection method can detect the activity of phenylethanolamine-N-methyltransferase, and can further screen for phenylethanolamine-N-methyltransferases with higher enzyme activity.
[0057] The above description is merely a preferred embodiment of the present invention, and the scope of protection of the present invention is not limited thereto. Any simple changes or equivalent substitutions of the technical solutions that can be obviously obtained by those skilled in the art within the scope of the technology disclosed in the present invention shall fall within the scope of protection of the present invention. sequence list <110> Nanjing University of Technology <120> A high-throughput screening method for phenylethanolamine-N-methyltransferase <160> 3 <170> SIPO Sequence Listing 1.0 <210> 1 <211> 834 <212> DNA <213> Artificial Sequence <400> 1 atggaccctg gtcgtgaaag cagcattgca gcagttgcag aaagctatca gaaatttgat 60 ccgcgtgcat atctgcagaa taactatgtt ccgcctcgtg cagattttag ccgtgaagat 120 agcgttgttc cgtggaaact gcgttgtctg gccgaagcat ttgcaaccgg tgaaattcat 180 ggtcgtaccc tgattgatat tggtagcggt ccgaccattt atcagctgct gagcgcatgt 240 gaacattttg aagaaattat catgaccgat tttctggaag tgaatcgtca agaactgcgt 300 cgttggctgc gtggtgaacc gggtgcattt gattggagcc cgtatctgca gcatgtttgt 360 aaaattgaag gtaaaggtga aagctggcaa gaaaaagaac gtcgtctgcg tgaacgtgtt 420 aaacgtgttc tgccgattga tgttcatcag ccgaatccgt taggtagcgg tagcctggca 480 ccggaaccgg ttgatgcact ggttagcacc ttttgtctgg aagcagttag tccggatcgt 540 gcgagctttc agcgtgcact ggaaaacatt accacactgc tgaaacctgg tggtcatttt 600 ctgatgattg gtgccctgga agaaagtttt tatctggcag gcgaagcacg tctgagcgtt 660 gtgccggtta gcgaagaaga agttcgcgaa gcactgacca aaagcggtta tgaaattcgt 720 gattttcgca cctataccat gcctccgagc ctgaaagttg gtgttgatga tgttcgtggt 780 atcttttttg tttgggcaca gaaaaaagca gcagcacatc accatcatca tcac 834 <210> 2 <211> 1407 <212> DNA <213> Artificial Sequence <400> 2 atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60 atggctagca tgactggtgg acagcaaatg ggtcgcggat ccgaattcat ggccgataaa 120 ctgccgtata aagtggccga tattggtctg gcagcctggg gtcgtaaagc cctggatatt 180 gccgaaaatg aaatgccggg cctgatgcgt atgcgtgaaa tgtatagcgc aagtaaaccg 240 ctgaaaggtg cacgcattgc aggttgtctg cacatgaccg ttgaaaccgc cgttctgatt 300 gaaaccctgg ttgccctggg tgccgaagtt cgttggagta gttgcaatat ttttagtacc 360 caggatcatg ccgcagcagc cattgcaaaa gcaggtattc cggtgtttgc ctggaaaggc 420 gaaaccgatg aagaatatct gtggtgcatt gaacagaccc tgcattttaa agatggtccg 480 ctgaatatga ttctggatga tggcggcgat ctgaccaatc tgattcatac caaacatccg 540 cagctgctga gtggtattcg tggcattagc gaagaaacca ccaccggtgt gcataatctg 600 tataaaatga tggcaaatgg cattctgaaa gtgccggcca ttaatgtgaa tgatagtgtg 660 accaaaagca aatttgataa tctgtatggt tgccgcgaaa gcctgattga tggtattaaa 720 cgcgcaaccg atgttatgat tgcaggtaaa gtggcagttg tggccggtta tggtgatgtg 780 ggtaaaggct gtgcccaggc actgcgcggt tttggtgccc gtgttattat taccgaaatt 840 gatccgatta acgccctgca ggcagcaatg gaaggttatg aagtgaccac aatggatgaa 900 gcctgtaaag aaggtaatat ttttgtgacc accaccggct gtgtggatat tattctgggt 960 cgccattttg aacagatgaa agatgatgcc attgtttgta atatcggtca ttttgatgtg 1020 gaaattgatg ttaaatggct gaatgaaaac gccgttgaaa aagtgaatat taaaccgcag 1080 gtggatcgct atctgctgaa aaatggccat cgcattattc tgctggccga aggccgtctg 1140 gtgaatctgg gctgtgcaat gggtcatccg agctttgtta tgagcaatag ctttaccaat 1200 caggtgatgg cacagattga actgtggacc catccggata aatatccggt gggtgttcat 1260 tttctgccga aaaaactgga tgaagcagtg gccgaagcac atctgggtaa actgaatgtt 1320 aaactgacca aactgaccga aaaacaggca cagtatctgg gcatgccgat taatggtccg 1380 tttaaaccgg atcattatcg ttattaa 1407 <210> 3 <211> 5310 <212> DNA <213> Artificial Sequence <400> 3 tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60 cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120 ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180 gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240 acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300 ctttaatagt ggacttgt tccaactgg aaacactc aaccctatct cggtctattc 360 ttttgattta taaggatt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420 acaaaaattt aacgcgaatt ttaacaaaat attackttt acatttcag gtggcacttt 480 tcggggaaat gtgcgcggaa cccctatttg tttattttc taaatacatt caatatgta 540 tccgctcatg aattaatttct tagaaaact catcgagcat caatgaac tgcaatttat 600 tcatatcagg attatcaata ccatatttt gaaaaagccg ttctgtaat gaaggagaaa 660 actcaccgag gcagttccat aggatggcaa gatcctgta tcggtctgcg attccgactc 720 gtccaacatc atacaacct attaatttcc cctcgtcaaa ataaggtta tcaagtgaga 780 aatcaccatg agtgacgact gatccggtg agaatggcaa aagtttagc atttctttcc 840 agacttgttc aacaggccag ccattacgct cgtcatcaaa atcactcgca tcaccaac 900 cgttattcat tcgtgattgc gcctgagcga gacgaaatac gcgatcgctg ttaaaaggac 960 attackacaac aggaatcgaa tgcaccggc gcaggacc tgccagcgca tcacaat 1020 tttcacctga atcaggatat tcttctaata cctggaatgc tgttttcccg gggatcgcag 1080 tggtgagtaa ccatgcatca tcaggagtac ggataaaatg cttgatggtc ggaagaggca 1140 taaattccgt cagccagttt agtctgacca tctcatctgt aacatcattg gcaacgctac 1200 ctttgccatg tttcagaaac aactctggcg catcgggctt cccatacaat cgatagattg 1260 tcgcacctga ttgcccgaca ttatcgcgag cccatttata cccatataaa tcagcatcca 1320 tgttggaatt taatcgcggc ctagagcaag acgtttcccg ttgaatatgg ctcataacac 1380 cccttgtatt actgtttatg taagcagaca gttttattgt tcatgaccaa aatcccttaa 1440 cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga 1500 gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg 1560 gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc 1620 agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag 1680 aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc 1740 agtggcgata agtcgtgtct taccggggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac 1860. accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggga acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gccttttc ggttcctggc cttttgctgg cttttgctc acatgttctt tcctgcgtta 2160 tccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc 2220 agccgaacga ccgagcgcag cgagtcagtg agcgaggag cggaagagcg cctgatgcgg 2280. tattttctcc ttacgcatct gtgcggtatt tcacaccgca fatherggtgc actctcagta caatctgctc tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg ggtcatggct gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag 2520 gttttcaccg tcatcaccga aacgcgcgag gcagctgcgg taaagctcat cagcgtggtc 2580 gtgaagcgat tcacagatgt ctgcctgttc atccgcgtcc agctcgttga gtttctccag 2640 aagcgttaat gtctggcttc tgataaagcg ggccatgtta agggcggttt tttcctgttt 2700 ggtcactgat gcctccgtgt aagggggatt tctgttcatg ggggtaatga taccgatgaa 2760 acgagagagg atgctcacga tacgggttac tgatgatgaa catgcccggt tactggaacg 2820 ttgtgagggt aaacaactgg cggtatggat gcggcgggac cagagaaaaa tcactcaggg 2880 tcaatgccag cgcttcgtta atacagatgt aggtgttcca cagggtagcc agcagcatcc 2940 tgcgatgcag atccggaaca taatggtgca gggcgctgac ttccgcgttt ccagacttta 3000 cgaaacacgg aaaccgaaga ccattcatgt tgttgctcag gtcgcagacg ttttgcagca 3060 gcagtcgctt cacgttcgct cgcgtatcgg tgattcattc tgctaaccag taaggcaacc 3120 ccgccagcct agccgggtcc tcaacgacag gagcacgatc atgcgcaccc gtggggccgc 3180 catgccggcg ataatggcct gcttctcgcc gaaacgtttg gtggcgggac cagtgacgaa 3240 ggcttgagcg agggcgtgca agattccgaa taccgcaagc gacaggccga tcatcgtcgc 3300 gctccagcga aagcggtcct cgccgaaaat gacccagagc gctgccggca cctgtcctac 3360 gagttgcatg ataaagaaga cagtcataag tgcggcgacg atagtcatgc cccgcgccca 3420 ccggaaggag ctgactgggt tgaaggctct caagggcatc ggtcgagatc ccggtgccta 3480 atgagtgagc taacttacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa 3540 cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 3600 tgggcgccag ggtggttttt cttttcacca gtgagacggg caacagctga ttgcccttca 3660 ccgcctggcc ctgagagagt tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa 3720 aatcctgttt gatggtggtt aacggcggga tataacatga gctgtcttcg gtatcgtcgt 3780 atcccactac cgagatatcc gcaccaacgc gcagcccgga ctcggtaatg gcgcgcattg 3840 cgcccagcgc catctgatcg ttggcaacca gcatcgcagt gggaacgatg ccctcattca 3900 gcatttgcat ggtttgttga aaaccggaca tggcactcca gtcgccttcc cgttccgcta 3960 tcggctgaat ttgattgcga gtgagatatt tatgccagcc agccagacgc agacgcgccg 4020 agacagaact taatgggccc gctaacagcg cgatttgctg gtgacccaat gcgaccagat 4080 gctccacgcc cagtcgcgta ccgtcttcat gggagaaaat aatactgttg atgggtgtct 4140 ggtcagagac atcaagaaat aacgccggaa cattagtgca ggcagcttcc acagcaatgg 4200 catcctggtc atccagcgga tagttaatga tcagcccact gacgcgttgc gcgagaagat 4260 tgtgcaccgc cgctttacag gcttcgacgc cgcttcgttc taccatcgac accaccacgc 4320 tggcacccag ttgatcggcg cgagatttaa tcgccgcgac aatttgcgac ggcgcgtgca 4380 gggccagact ggaggtggca acgccaatca gcaacgactg tttgcccgcc agttgttgtg 4440 ccacgcggtt gggaatgtaa ttcagctccg ccatcgccgc ttccactttt tcccgcgttt 4500 tcgcagaaac gtggctggcc tggttcacca cgcgggaaac ggtctgataa gagacaccgg 4560 catactctgc gacatcgtat aacgttactg gtttcacatt caccaccctg aattgactct 4620 cttccgggcg ctatcatgcc ataccgcgaa aggttttgcg ccattcgatg gtgtccggga 4680 tctcgacgct ctcccttatg cgactcctgc attaggaagc agcccagtag taggttgagg 4740 ccgttgagca ccgccgccgc aaggaatggt gcatgcaagg agatggcgcc caacagtccc 4800 ccggccacgg ggcctgccac catacccacg ccgaaacaag cgctcatgag cccgaagtgg 4860 cgagcccgat cttccccatc ggtgatgtcg gcgatatagg cgccagcaac cgcacctgtg 4920 gcgccggtga tgccggccac gatgcgtccg gcgtagagga tcgagatctc gatcccgcga 4980 attaatacg actcactata ggggaattgt gagcggataa caattcccct ctagaaataa 5040 ttttgtttaa ctttaagaag gagatataca tatggctagc atgactggtg gacagcaaat 5100 gggtcgcgga tccgaattcg agctccgtcg acaagcttgc ggccgcactc gagcaccacc 5160 accaccacca ctgagatccg gctgctaaca aagcccgaaa ggaagctgag ttggctgctg 5220 ccaccgctga gcaataacta gcataacccc ttggggcctc taaacgggtc ttgaggggtt 5280 ttttgctgaa aggaggaact atatccggat 5310
Claims
1. A high-throughput screening method for phenylethanolamine-N-methyltransferase, characterized in that, Add substrates norepinephrine and S-adenosylmethionine, PBS buffer, and S-adenosyl-L-homocysteine hydrolase (SAHH) to a 96-well plate of an ELISA reader. Then add phenylethanolamine-N-methyltransferase sample and enzyme-free empty bacterial sample pET24a / E. coli The BL21(DE3) enzyme solution was reacted in a microplate shaker reactor at 20-50℃ and 500-1000 rpm for 1-3 hours, followed by centrifugation at 4℃ and 3700 rpm for 10 minutes. The supernatant was then added to the NDCC compound. The reaction was carried out for 0-90 minutes. Every 30 minutes during the reaction, the 96-well plate was removed and its absorbance at 405 nm was measured using enzyme labeling. Enzyme activity was defined as the change in OD405 nm absorbance per minute multiplied by 1,000,000 under specific conditions. The nucleotide sequence of the S-adenosine-L-homocysteine hydrolase is shown in SEQ ID No.
2. The enzyme-free empty bacterial culture pET24a / E. coli The plasmid sequence of BL21(DE3) is shown in SEQ ID No.
3.
2. The high-throughput screening method for phenylethanolamine-N-methyltransferase according to claim 1, characterized in that, The synthesis method of the compound NDCC is as follows: 0.167 g of 5-nitrosalicylic acid, 0.164 g of 2-cyclopenten-1-one and 0.068 g of imidazole were dissolved in a mixed solution of 1.5 mL tetrahydrofuran and 1.5 mL deionized water. The mixture was stirred at 20 °C for 72 h to complete the reaction and obtain a mixture. The final mixture was diluted 4.3 times with deionized water and extracted with ethyl acetate. The organic components were combined, and the crude product was subjected to silica gel chromatography with ethyl acetate and petroleum ether as eluents. The solution was slowly evaporated at room temperature to form yellow crystals.
Citation Information
Patent Citations
S-adenosylhomocysteine hydrolase mutant as well as application and a preparation method thereof, nucleic acid, expression vector and host cell
CN108624574A