Uses and drugs related to ARPC1B gene
By detecting and inhibiting ARPC1B gene expression, a diagnostic and therapeutic drug for glioma has been developed, solving the problem of the lack of effective treatments for glioma in existing technologies. This drug inhibits the proliferation, invasion, and migration of glioma cells, providing a new treatment and diagnostic approach.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-04-11
- Publication Date
- 2026-03-13
AI Technical Summary
Current technologies lack effective treatments for gliomas. The biological function and clinical significance of the ARPC1B gene in gliomas are unknown, and there are no reports of its application in the preparation or screening of drugs for the treatment of gliomas.
By detecting the expression level of the ARPC1B gene, and using ARPC1B gene inhibitors such as interfering RNA (e.g., CK-636) and nucleic acid molecules, we can inhibit ARPC1B gene expression to prepare drugs that inhibit the proliferation, invasion and migration of glioma cells, and develop diagnostic kits that utilize the ARPC1B gene as a biomarker and therapeutic target for gliomas.
Downregulation of the ARPC1B gene inhibits the proliferation, invasion, and migration of glioma cells, altering their proliferative state and providing new methods for glioma treatment and diagnosis, thus offering strong support for targeted therapy of gliomas.
Smart Images

Figure CN114854856B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of biomedicine and molecular biology, and relates to the uses and drugs of the ARPC1B gene. Background Technology
[0002] Gliomas are the most common and deadliest type of intracranial malignant tumor in humans, accounting for 74.6% of central nervous system malignancies, and currently there is still no effective treatment. While existing traditional treatments, such as surgical resection combined with radiotherapy and chemotherapy, have made progress, they still cannot significantly improve overall survival. Therefore, in-depth research into the molecules that play a key role in the development and progression of gliomas will provide new prognostic biomarkers for gliomas and contribute to the development of new and effective therapeutic targets.
[0003] The actin-associated protein 2 / 3 complex (Arp2 / 3) is an evolutionarily conserved molecular machine that generates a branched actin network. ARPC1B is one of the regulatory subunits of the Arp2 / 3 complex, contributing to the assembly and maintenance of the entire complex. Existing research has found that mutations in the ARPC1B gene lead to combined immunosuppressive autosomal recessive syndromes, reduced T cell migration and proliferation, and thrombocytopenia. Furthermore, ARPC1B is associated with malignant phenotypes in tumors such as melanoma, osteosarcoma, and oral squamous cell carcinoma. However, the biological function and clinical significance of the ARPC1B gene in gliomas remain unknown, and to date, there are no reports in domestic or international literature regarding the application of the ARPC1B gene in the preparation or screening of drugs for the treatment of gliomas. Summary of the Invention
[0004] To address the shortcomings of existing technologies, this invention provides the application of ARPC1B in the preparation or screening of drugs for glioma progression, treatment, and prognosis. Specifically, studies have found that ARPC1B expression increases with the malignancy of gliomas and is negatively correlated with survival. Downregulation of ARPC1B inhibits glioma cell proliferation, invasion, and migration, while also altering the epithelial-mesenchymal transition state of glioma cells. This invention is the first to demonstrate that ARPC1B is an oncogene involved in glioma development and can be used as a biomarker and therapeutic target for glioma, enabling the preparation or screening of drugs and related diagnostic kits for glioma treatment.
[0005] This invention is achieved through the following technical solution: One aspect of this invention provides a composition for diagnosing, detecting, monitoring, or predicting the progression of gliomas, comprising a substance for detecting the transcription of the ARPC1B gene in glioma samples based on high-throughput sequencing and / or quantitative PCR and / or probe hybridization; or for detecting the expression of the ARPC1B gene in glioma samples based on immunoassay. Specifically, Northern blotting, mRNA expression profiling microarrays, ribozyme protection assays, RAKE assays, and in situ hybridization are used to detect the transcription of ARPC1B in glioma samples; ELISA, colloidal gold test strips, and protein microarrays are used to detect the expression of ARPC1B in glioma samples.
[0006] Another aspect of the present invention provides a substance for inhibiting the ARPC1B gene and its expression product and / or reducing the activity of inhibiting the ARPC1B gene and its expression product, said substance being used in at least one of the following (1)-(3):
[0007] (1) Prepare products for inhibiting the proliferation of glioma cells;
[0008] (2) Prepare products for inhibiting the invasion and migration of glioma cells;
[0009] (3) Prepare products for inhibiting epithelial-mesenchymal transition in glioma cells.
[0010] The products described in (1)-(3) include various forms of drugs, drug compositions, kits, reagents, etc.
[0011] A third aspect of the invention provides the use of the ARPC1B gene and its expression product in the preparation of products (medications, pharmaceutical compositions, kits, reagents) for diagnosing, detecting, monitoring, or predicting the progression of gliomas. The products are capable of diagnosing, detecting, monitoring, or predicting the progression of gliomas by detecting the level of the ARPC1B gene and / or its expression product; the progression of gliomas includes the proliferation, invasion, migration, and epithelial-mesenchymal transition of glioma cells.
[0012] Specifically, the use of molecules capable of inhibiting ARPC1B gene expression and / or the activity of ARPC1B gene expression products in the preparation or screening of glioma therapeutic drugs, wherein the molecules include nucleic acid molecules, small chemical molecules, antibody drugs, peptides, and lipids that inhibit ARPC1B gene expression.
[0013] Preferably, the molecule is the interfering RNA of the ARPC1B gene or CK-636;
[0014] The interfering RNA of the ARPC1B gene targets the target sequence of the ARPC1B gene.
[0015] The target sequence of the ARPC1B gene is: GGCUCUCGUGUGAUCUCCAU, GGGUACAUGGCGUCUGUUU or UCCAGAACCUGGACAAGAA.
[0016] The structure of the CK-636 is as follows:
[0017] .
[0018] CK-636 can inhibit ARPC1B gene expression and affect the activity of the product 2 / 3 complex (Arp2 / 3), thereby inhibiting the proliferation of glioma cells.
[0019] A nucleic acid molecular drug for treating glioma, said nucleic acid molecular drug comprising a nucleic acid molecule capable of reducing ARPC1B gene expression;
[0020] The nucleic acid molecule that reduces ARPC1B gene expression includes:
[0021] a) A double-stranded RNA of the ARPC1B gene, wherein the ARPC1B double-stranded RNA contains a nucleotide sequence capable of hybridizing with the ARPC1B gene; or
[0022] b) ARPC1B gene shRNA, wherein the ARPC1B gene shRNA contains a nucleotide sequence capable of hybridizing with the ARPC1B gene.
[0023] Preferably, the ARPC1B gene double-stranded RNA comprises a first strand and a second strand, which are complementary to form an RNA dimer, and the sequence of the first strand is identical to the target sequence of the ARPC1B gene; the ARPC1B gene shRNA comprises a sense strand fragment and an antisense strand fragment, and a stem-loop structure connecting the sense strand fragment and the antisense strand fragment, the sequences of the sense strand fragment and the antisense strand fragment being complementary, and the sequence of the sense strand fragment being identical to the target sequence of the ARPC1B gene. There is no particular limitation on the stem-loop structure; it can be selected from stem-loop structures available in the art based on the sequence of the sense strand fragment.
[0024] More preferably, the ARPC1B gene double-stranded RNA is a small interfering RNA, and the sequence of the first strand of the ARPC1B gene small interfering RNA is GGCUCUCGUGUGAUCUCCAU (SEQ ID NO: 4 in the sequence listing), GGGUACAUGGCGUCUGUUU (SEQ ID NO: 5 in the sequence listing), or UCCAGAACCUGGACAAGAA (SEQ ID NO: 6 in the sequence listing), and the sequence of the ARPC1B gene shRNA is GGCUCUCGUGUGAUCUCCAU (SEQ ID NO: 4 in the sequence listing).
[0025] The isolated ARPC1B gene can be used to prepare or screen drugs for treating gliomas: The ARPC1B gene can be used as a drug target for glioma cells in the preparation or screening of drugs for treating gliomas. For example, the ARPC1B gene can be used as a target for RNA interference to prepare drugs targeting gliomas, thereby reducing the ARPC1B gene level in glioma cells. Another example is using the product of ARPC1B gene expression as a drug target for gliomas to screen small molecule drugs for treating gliomas. The aforementioned nucleic acid molecules, interfering RNA, or CK-636 are all drug molecules screened using the ARPC1B gene or its expression product as targets. The preferred target sequences of the ARPC1B gene are: GCUCUGCUGUGAUCUCCAU (SEQ ID NO: 1 in the sequence listing), GGGUACAUGGCGUCUGUUU (SEQ ID NO: 2 in the sequence listing), or UCCAGAAACCUGGACAAGAA (SEQ ID NO: 3 in the sequence listing).
[0026] The isolated ARPC1B gene can be used to prepare diagnostic drugs or kits for gliomas: using the expression level of the ARPC1B gene as an indicator, substances that detect the expression level of the ARPC1B gene or the expression product level of the ARPC1B gene are used in the preparation of diagnostic drugs or kits for gliomas.
[0027] Furthermore, the present invention provides a kit comprising a composition for diagnosing, detecting, monitoring, or predicting the progression of glioma.
[0028] Specifically, the kit uses Northern blotting, mRNA expression profiling microarrays, ribozyme protection assays, RAKE assays, and in situ hybridization to detect ARPC1B transcription in glioma samples; and uses ELISA, colloidal gold test strips, and protein microarrays to detect ARPC1B expression products in glioma samples. The progression of glioma is indicated based on the detected ARPC1B gene expression level or ARPC1B gene expression product level, which includes glioma cell proliferation, invasion, migration, and epithelial-mesenchymal transition.
[0029] Primers for detecting ARPC1B gene levels are used in the preparation of a kit for the auxiliary diagnosis and prognostic evaluation of gliomas. The kit is used to detect the ARPC1B gene expression level in glioma cells and contains primers for detecting ARPC1B gene expression levels.
[0030] For example, a glioma auxiliary diagnostic kit of the present invention includes a SYBR Green polymerase chain reaction system, which comprises PCR buffer, dNTPs, SYBR Green fluorescent dye, enzyme-free water, and a quantitative PCR plate. It also includes an RNA extraction reagent comprising Trizol, chloroform, isopropanol, 75% ethanol, and RNase-free water.
[0031] The kit also includes a system for reverse transcription of mRNA into cDNA and a real-time PCR reaction system. The system for reverse transcription of mRNA into cDNA contains a 5X RT mastermix reverse transcription complex reagent, which contains PrimeScript RTase, RNase Inhibitor, Random 6 mers, Oligo dTPrimer, dNTPMixture, and reaction buffer.
[0032] The real-time PCR reaction system contains the real-time PCR enzyme SYBR Premix Ex Taq™.
[0033] The detection steps for detecting ARPC1B gene levels using the kit include:
[0034] a) The obtained fresh glioma tissue was ground after being treated with liquid nitrogen and then RNA was extracted.
[0035] b) The extracted RNA is reverse transcribed into the corresponding cDNA;
[0036] c) The reverse-transcribed cDNA was used to amplify the ARPC1B and 18s genes by real-time PCR.
[0037] d) Using 18s as an internal reference, record the Ct value for each reaction. The detection result is expressed as -ΔCt, where ΔCt = Ct. ARPC1B -Ct 18s , with 2 -ΔCt As an indicator for evaluating the expression level of the ARPC1B gene.
[0038] Wherein, Ct is the number of cycles required for the fluorescence signal in each reaction tube to reach the set threshold. ARPC1B It is the number of cycles required to amplify ARPC1B expression in the reaction tube, Ct 18s It is the number of cycles required to amplify 18s expression in the reaction tube.
[0039] Compared with existing technologies, this invention has the following advantages and beneficial effects: It is the first invention to demonstrate that ARPC1B gene expression increases with the malignancy of gliomas and is negatively correlated with glioma survival. Downregulation of the ARPC1B gene inhibits glioma cell proliferation, invasion, and migration, while also altering the epithelial-mesenchymal transition state of glioma cells. Further research on the ARPC1B gene provides more information about the molecular mechanisms of glioma occurrence and progression. Furthermore, research on the application of the ARPC1B gene in the preparation of glioma therapeutic and diagnostic drugs and kits provides a powerful tool for future targeted therapy of gliomas, possessing significant practical application value. Attached Figure Description
[0040] Figure 1 This is a graph showing the relationship between ARPC1B gene expression levels and glioma grade.
[0041] In the figure, a is the expression level of ARPC1B gene mRNA in gliomas of different grades; b is the expression of ARPC1B in gliomas of different grades detected by Western blot; and c is the expression of ARPC1B gene in gliomas of different grades detected by immunohistochemistry.
[0042] Figure 2 This is a graph showing the relationship between ARPC1B gene expression levels and survival in glioma patients.
[0043] In this figure, a is a comparison of the survival of glioma patients with low and high ARPC1B gene expression; b is a comparison of the survival of glioblastoma (GBM) patients with low and high ARPC1B gene expression.
[0044] Figures 3A-3BA series of figures illustrating the effect of knocking down ARPC1B gene expression to inhibit glioma cell proliferation.
[0045] Among them, a is a diagram of immunofluorescence double staining of ARPC1B and GFAP genes in clinical tissue specimens; b is a diagram of the effect of MTS on the cell proliferation rate of U87 and PGC28 cells by ARPC1B gene knockdown; c is a diagram of the effect of EdU on the cell proliferation of U87 and PGC28 cells by ARPC1B gene knockdown.
[0046] Figures 4A-4B A series of figures illustrating the effect of knocking down ARPC1B gene expression to inhibit glioma cell migration and invasion.
[0047] In the figure, a is a graph showing the effect of ARPC1B gene knockdown on cell migration in U87 and PGC28 cells; b is a bar chart showing the effect of ARPC1B gene knockdown on cell migration in U87 and PGC28 cells; c is a graph showing the effect of ARPC1B gene knockdown on cell invasion in U87 and PGC28 cells; and d is a bar chart showing the effect of ARPC1B gene knockdown on cell invasion in U87 and PGC28 cells.
[0048] Figure 5 A diagram illustrating the altered epithelial-mesenchymal transition state of glioma cells by knocking down ARPC1B gene expression.
[0049] Figure 6 This figure shows the influence of the ARPC1B gene on glioma progression in a subcutaneous tumorigenic animal model.
[0050] In the figure, a is a Western blot diagram of detecting ARPC1B protein expression level knocked down by lentivirus shARPC1B; b is a subcutaneous image of nude mice implanted with shNC and shARPC1B groups; c is a tumor growth curve diagram of shNC and shARPC1B groups; d is a comparison of the expression of ARPC1B, N-cadherin and E-cadherin in tumor tissues of shNC group and shARPC1B group.
[0051] Figure 7 This figure shows the influence of the ARPC1B gene on glioma progression in an animal model of intracranial implantation tumor formation.
[0052] In the figure, a is the overall survival time of the shNC group and the shARPC1B group; b is the tumor size of the shNC group and the shARPC1B group as shown by H&E staining; c is a comparison of the expression of ARPC1B, N-cadherin and E-cadherin in the tumor tissue of the shNC group and the shARPC1B group. Detailed Implementation
[0053] The present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. The following embodiments are only for further illustration of the present invention and should not be construed as limiting the present invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, and the experimental reagents and materials involved are conventional biochemical reagents and materials unless otherwise specified.
[0054] Example 1: Correlation experiment between ARPC1B gene expression and glioma grade.
[0055] We investigated the expression of the ARPC1B gene in the Chinese Glioma Genome Atlas (CGGA) and The Cancer Genome Atlas (TCGA) glioma database platforms. We used the R language's "ggplot2" package to plot differences in ARPC1B gene expression among patients of different grades. ARPC1B transcriptional levels significantly increased with glioma grade (e.g., ...). Figure 1 (As shown in Figure a). We collected clinical samples of human gliomas and evaluated the expression of the ARPC1B gene in samples of different grades using Western blot and immunohistochemistry (IHC). We found that the expression of the ARPC1B gene increased with the increase of glioma grade (e.g., ...). Figure 1 (As shown in b and c).
[0056] Example 2: In the CGGA and TCGA databases, survival curves were plotted with survival time on the x-axis and survival rate on the y-axis to show the expression levels of the ARPC1B gene.
[0057] In the CGGA and TCGA databases, glioma patients were first sorted by ARPC1B gene mRNA expression level from lowest to highest. Patients were then divided into low ARPC1B expression and high ARPC1B expression groups based on the median ARPC1B expression, and survival curves were plotted. Results showed that glioma patients with high ARPC1B gene expression had significantly lower cumulative survival rates than those with low ARPC1B gene expression (e.g., ...). Figure 2 (as shown in a).
[0058] The prognostic impact of ARPC1B gene expression in GBM was further investigated. In the CGGA and TCGA databases, GBM patients were sorted by ARPC1B mRNA expression level from lowest to highest. Patients were then divided into low ARPC1B expression and high ARPC1B expression groups based on the median ARPC1B expression level, and survival curves were plotted. Results showed that the cumulative survival rate in glioma patients with high ARPC1B expression was significantly lower than that in glioma patients with low ARPC1B expression (e.g., ...). Figure 2 (As shown in b).
[0059] Example 3: The inhibitory effect of downregulating ARPC1B expression on glioma cell proliferation.
[0060] First, immunofluorescence was used to double-stain the ARPC1B gene and GFAP (glial cell marker) in clinical specimens. Co-staining of ARPC1B and GFAP was observed, indicating that the ARPC1B gene is expressed in glioma cells (as shown in Figure 3a). To investigate the role of the ARPC1B gene in the malignant phenotype of glioma, we used siRNA to knock down the expression of the ARPC1B gene in glioma cells (U87 and PGC28). The siRNA used in this example was synthesized by Sangon Biotech. The first strand consists of a 19-base target sequence plus a 2-base 3' hanger (TT). The study included siRNA-si467 (first-strand sequence: GCUCUCGUGUGAUCUCCAUTT) targeting the ARPC1B gene, siRNA-si731 (first-strand sequence: GGGUACAUGGCGUCUGUUUTT) targeting ARPC1B, and a negative control siRNA-siNC (first-strand sequence: UUCUCCGAACGUGUCACG UTT). The siRNAs were transfected into the target cells using Lipofectamine transfection reagent. The transfection procedure was as follows: Lipofectamine 3000 reagent was diluted with Opti-MEM medium and thoroughly mixed; then the siRNA reagent was diluted with Opti-MEM medium and thoroughly mixed; and the diluted siRNA was added to each diluted Lipofectamine 3000 reagent tube. After incubation at room temperature for 15 minutes, the solution was added to the cell culture medium. Functional experiments were performed 48 hours after transfection. We used MTS (cell counting kit) and EdU staining to detect the effect of the ARPC1B gene on cell proliferation. The MTS assay showed that the cell proliferation rate in the siARPC1B group was significantly lower than that in the siNC group (as shown in Figure 3b). Furthermore, the EdU assay also confirmed that knocking down the ARPC1B gene has the function of inhibiting glioma cell proliferation (as shown in Figure 3c).
[0061] Example 4: Knockdown of ARPC1B inhibits the migration and invasion of glioma cells.
[0062] We used siRNA to knock down the expression of the ARPC1B gene in glioma cells (U87 and PGC28). The siRNAs used in this example and the transfection method for U87 and PGC28 cells were the same as in Example 3. Functional experiments were performed 48 hours after transfection. We used transwell technology to evaluate the effect of the ARPC1B gene on the migration and invasion abilities of glioma cells. To assess cell migration and invasion abilities, U87 cells transfected with different siRNAs were resuspended in DMEM medium containing 0.2% fetal bovine serum and incubated at 2 × 10⁻⁶ cells / mL. 4 Seeds were placed in the upper chamber of the Transwell at a density of 200 μl. 600 μl of DMEM medium containing 20% fetal bovine serum was added to the lower chamber. PGC28 cells transfected with different siRNAs were resuspended in 1640 medium containing 0.2% fetal bovine serum and seeded at 2 × 10⁻⁶ cells / mL. 4 The cells were seeded at a density of 200 μl in the upper chamber of a Transwell. 600 μl of 1640 medium containing 20% fetal bovine serum was added to the lower chamber. Compared to the siNC group, the migration and invasion abilities of U87 and PGC28 cells in the siARPC1B group were significantly reduced (as shown in Figure 4). These results indicate that knocking down the ARPC1B gene can significantly inhibit the migration and invasion abilities of glioma cells.
[0063] Example 5: Effect of knockdown of ARPC1B expression on epithelial-mesenchymal transition status of glioma cells.
[0064] Epithelial-mesenchymal transition (EMT) plays a crucial role in tumorigenesis and development, typically accompanied by decreased E-cadherin expression and increased N-cadherin and Vimentin expression. We used siRNA to knock down the ARPC1B gene expression in glioma cells (U87 and PGC28). The siRNA used in this example and the transfection method for U87 and PGC28 cells with siRNA were the same as in Example 3. Forty-eight hours after transfection, whole-protein samples were extracted from U87 and PGC28 cells transfected with different siRNAs, and Western blot analysis was performed to detect the expression of relevant indicators. It was found that siARPC1B significantly downregulated N-cadherin and Vimentin expression while upregulating E-cadherin expression (e.g., [missing information]). Figure 5 (As shown in the image). This indicates that downregulating ARPC1B expression can weaken the epithelial-mesenchymal transition state of tumor cells.
[0065] Example 6: The effect of downregulating ARPC1B gene expression on glioma progression in a subcutaneous tumorigenic mouse model.
[0066] The target gene fragment (shRNA consisting of a 19-base target sequence plus a 3' 2-base TT hanger, denoted as GCUCUGCUGUGAUCUCCAUTT) was constructed into a lentiviral vector (hU6-MCS-Ubiquitin-firefly_Luciferase-IRES-puromycin) and transfected into 293T cells. After 48-72 hours of transfection, the cell supernatant was collected by centrifugation. The virus was harvested by filtration (0.45 μm) and ultracentrifugation to remove other proteins and DNA. Further concentration of the virus was achieved by ultrafiltration to obtain high-purity lentivirus. U87 cells were transfected with lentivirus carrying ARPC1B knockdown (shRNA). Transfected cells were selected 15 days after transfection using 3 μg / ml puromycin. A portion of transfected U87 cells were collected, and total cellular protein levels were analyzed using Western blotting. The results showed that ARPC1B gene expression in cells transfected with shARPC1B was significantly lower than that in the control group (e.g., ...). Figure 6 (As shown in a). Another portion of U87 cells with knocked-down ARPC1B gene expression was implanted subcutaneously into BALB / C mice. For the subcutaneous tumorigenesis model, 3 × 10⁻⁶ cells were implanted. 6 shNC / shARPC1B-U87 cells were injected subcutaneously into the left side of BALB / c nude mice. Tumor size was measured every four days using calipers (using the formula V = (length × width)). 2 (Tumor volume was calculated as ) / 2). Mice were sacrificed by cervical dislocation on day 35 post-implantation, and the tumors were photographed. We found that the tumors in the shARPC1B group had smaller volumes (e.g., ...). Figure 6 As shown in Figure b), the tumor growth rate in the shARPC1B group was also significantly lower than that in the shNC group (as shown in Figure b). Figure 6 (As shown in c). Fixation and immunohistochemical staining of the tumor sections revealed decreased expression of ARPC1B and N-cadherin genes and increased expression of E-cadherin gene in the shARPC1B group, indicating a weak epithelial-mesenchymal transition state (e.g., as shown in c). Figure 6 (as shown in d).
[0067] Example 7: Targeting the ARPC1B gene to reduce the malignant phenotype of glioma in an intracranial implantation mouse model.
[0068] U87 cells transfected with ARPC1B knockdown lentivirus (shARPC1B), the same as in Example 6, were used. 3 μl of cell suspension (shNC / shARPC1B-U87 cells) was injected into the brain of mice. Mice were sacrificed at the same time for immunohistochemical analysis or observed until death for survival analysis. The section with the largest tumor cross-sectional area was selected for intracranial tumor size measurement. It was found that ARPC1B knockdown significantly prolonged the survival of tumor-bearing mice (e.g., ...). Figure 7 As shown in Figure a), HE staining revealed that the shARPC1B group had smaller tumor volumes (e.g., Figure 7 (As shown in b). Fixation and immunohistochemical staining of the tumor sections revealed decreased expression of ARPC1B and N-cadherin genes and increased expression of E-cadherin gene in the shARPC1B group, indicating a weak epithelial-mesenchymal transition state (e.g., ...). Figure 7 (As shown in c).
[0069] SEQUENCE LISTING
[0070] <110> Wu Anhua
[0071] <120> Uses and drugs related to ARPC1B gene
[0072] <130> 202106
[0073] <160> 7
[0074] <170> PatentIn version 3.3
[0075] <210> 1
[0076] <211> 19
[0077] <212> RNA
[0078] <213> Homo Sapiens
[0079] <400> 1
[0080] gcucucgugu gaucuccau 19
[0081] <210> 2
[0082] <211> 19
[0083] <212> RNA
[0084] <213> Homo Sapiens
[0085] <400> 2
[0086] ggguacaugg cgucuguuu 19
[0087] <210> 3
[0088] <211> 19
[0089] <212> RNA
[0090] <213> Homo Sapiens
[0091] <400> 3
[0092] uccagaaccu ggacaagaa 19
[0093] <210> 4
[0094] <211> 19
[0095] <212> RNA
[0096] <213> Artificial sequence
[0097] <400> 4
[0098] gcucucgugu gaucuccau 19
[0099] <210> 5
[0100] <211> 19
[0101] <212> RNA
[0102] <213> Artificial sequence
[0103] <400> 5
[0104] ggguacaugg cgucuguuu 19
[0105] <210> 6
[0106] <211> 19
[0107] <212> RNA
[0108] <213> Artificial sequence
[0109] <400> 6
[0110] uccagaaccu ggacaagaa 19
[0111] <210> 7
[0112] <211> 19
[0113] <212> RNA
[0114] <213> Artificial sequence
[0115] <400> 7
[0116] uucuccgaac gugucacgu 19 sequence list <110> Wu Anhua <120> Uses and drugs related to ARPC1B gene <130> 202106 <160> 7 <170> SIPOSequenceListing 1.0 <210> 1 <211> 19 <212> RNA <213> Homo Sapiens <400> 1 gcucucgugu gaucuccau 19 <210> 2 <211> 19 <212> RNA <213> Homo Sapiens <400> 2 ggguacaugg cgucuguuu 19 <210> 3 <211> 19 <212> RNA <213> Homo Sapiens <400> 3 uccagaaccu ggacaagaa 19 <210> 4 <211> 19 <212> RNA <213> Artificial sequence <400> 4 gcucucgugu gaucuccau 19 <210> 5 <211> 19 <212> RNA <213> Artificial sequence <400> 5 ggguacaugg cgucuguuu 19 <210> 6 <211> 19 <212> RNA <213> Artificial sequence <400> 6 uccagaaccu ggacaagaa 19 <210> 7 <211> 19 <212> RNA <213> Artificial sequence <400> 7 uucuccgaac gugucacgu 19
Claims
1. Use of a nucleic acid molecule that reduces the expression of the ARPC1B gene for the manufacture of a medicament for the treatment of glioma, characterized in that, The drug is a nucleic acid molecule capable of reducing the expression of the ARPC1B gene; The nucleic acid molecule capable of reducing the expression of the ARPC1B gene is small interfering RNA or shRNA; The sequence of the first strand of the small interfering RNA is GCUCUCGUGUGAUCUCCAU or GGGUACAUGGCGUCUGUUU; The target sequence of the shRNA is GCUCUCGUGUGAUCUCCAU.