A method for detecting classical swine fever virus based on a G4-ThT biosensor and NASBA and its kit

Abstract

The present invention belongs to the technical field of genetic engineering, in particular to a method for detecting classical swine fever virus based on a G4-ThT biosensor and NASBA and a kit thereof. The specific method includes using the viral RNA extracted from a classical swine fever virus sample as the amplification target, performing isothermal amplification using an isothermal nucleic acid amplification technique, then adding a buffer solution containing Tris-HCl and KCl, and further adding thioflavin T to promote the folding of G-quadruplexes on the amplification products to form a complex, detecting fluorescence under the excitation of a light source with a specific wavelength, and making a judgment according to the intensity thereof. The present invention provides a probe that does not require special biotin labeling or thiol modification treatment, a detection method with significantly reduced detection costs, and a kit.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to a method for detecting classical swine fever virus based on a G4-ThT biosensor and NASBA and a kit thereof. Background Art

[0002] The Chinese invention patent "CN104611462A - A method for detecting classical swine fever virus based on the fluorescence characteristics of G-quadruplex and a kit thereof" discloses a related method for detecting classical swine fever virus based on the fluorescence characteristics of G-quadruplex. However, this method requires the use of expensive fluorescent group-labeled probes in the G-quadruplex fluorescence detection reaction buffer, resulting in a high cost. Summary of the Invention

[0003] In order to solve the above problems, the present invention provides a probe that does not require special biotin labeling or thiol modification treatment, a detection method with significantly reduced detection cost, and a kit. The technical solutions adopted are as follows:

[0004] A method for detecting classical swine fever virus based on a G4-ThT biosensor and NASBA uses the viral RNA extracted from a classical swine fever virus sample as the amplification target, adopts isothermal nucleic acid amplification technology, and uses reverse transcriptase AMV, ribonuclease H, and T7 RNA polymerase for isothermal amplification to generate a large amount of single-stranded RNA amplification products; then a buffer containing Tris-HCl and KCl is added, and then thioflavin T is added to promote the folding of G-quadruplex on the amplification products and form a complex. Then, the amplification products are excited with a light source with a wavelength of 425 nm and the fluorescence emitted at a wavelength of 490 nm is detected, and the judgment is made according to the intensity of the fluorescence.

[0005] The specific steps of the method are as follows:

[0006] Step 1. NASBA amplification: Add the purified classical swine fever virus RNA sample to the NASBA reaction buffer system, which contains 50 mM Tris / HCl pH 8.5, 10 mM MgCl2, 90 mM KCl, 10 mM DTT, 1 mM of each dNTP, 2 mM of each NTP, 10% (v / v) DMSO, 0.4 μM NASBA forward primer and 0.4 μM NASBA reverse primer. The reaction steps are as follows: Add 2 μL of target RNA, incubate the mixture at 65 °C for 5 minutes to unwind the secondary structure of the target RNA, then transfer the reaction mixture to 41 °C for annealing for 5 min, and then add 5.6 μL of enzyme mixture to the tube. The enzyme mixture contains 4 mM DTT, 2 μg BSA, 30 U T7 RNA polymerase, 6 U AMV-Rt, 0.1 U RNase H to obtain a final volume of 25 μL. Incubate the mixture at 41 °C for 2 hours for isothermal amplification of the target RNA; The forward primer is E2F-GG29: CCCCTACCTCCCGCCCCTACCCGTCCCCC-CACCACCTGGAAAGAA; The reverse primer is E2R-T7: AATTCTAATACGACTCACTATAGGGAGATACCTCCTACTGACCA;

[0007] Step 2. G-quadruplex fluorescence detection reaction: Take the G-quadruplex amplification product fluorescence detection reaction buffer. The composition of the reaction buffer includes 50 mM Tris-HCl, pH 7.0 and 50 mM potassium chloride. Make up to 72 μl with sterile double-distilled water, add 25 μL of the solution after NASBA reaction, and then denature at 85 °C for 3 min and cool to room temperature; Add 3 μL of 100 μM thioflavin T solution, then transfer the solution to a 96-well microplate reader. Place the microplate reader in a microplate reader or fluorometer, excite with a light source at a wavelength of 425 nm, and detect the fluorescence emitted at a wavelength of 490 nm. If the detected fluorescence intensity is higher than 1.0×10 6 RFU, it is judged as positive for classical swine fever virus.

[0008] A classical swine fever virus detection kit based on a G4-ThT biosensor and NASBA, comprising the following substances:

[0009] (1) NASBA reaction buffer includes: 50 mM Tris / HCl pH 8.5, 10 mM MgCl2, 90 mM KCl, 10 mM DTT, 1 mM of each dNTP, 2 mM of each NTP, 10% (v / v) DMSO;

[0010] (2) NASBA forward primer and reverse primer, including: 0.4 μM forward primer E2F-GG29: CCCCTACCTCCCGCCCCTACCCGTCCCCC-CACCACCTGGAAAGAA; 0.4 μM reverse primer E2R-T7: AATTCTAATACGACTCACTATAGGGAGATACCTCCTACTGACCA; wherein the front end of the forward primer contains the reverse complementary sequence CCCCTACCTCCCGCCCCTACCCGTCCCCC of the G-quadruplex sequence GG29 and the CSFV-E2 binding sequence CACCACCTGGAAAGAA, and the front end of the reverse primer is added with the T7 promoter sequence AATTCTAATACGACTCACTATAGGGAGA with a protective base and the CSFV-E2 binding sequence TACCTCCTACTGACCA;

[0011] (3) NASBA enzyme reaction solution, including: 4 mM DTT, 2 μg BSA, 30 U T7 RNA polymerase, 6 U AMV-Rt, 0.1 U RNase H;

[0012] (4) G-quadruplex amplification product detection reaction buffer, including: 50 mM Tris-HCl pH 7.0 and 50 mM potassium chloride; thioflavin T 3 μM.

[0013] Compared with the prior art "CN104611462A", the principle of this application is to add the reverse complementary sequence of the G-quadruplex to the forward primer of NASBA amplification. In the presence of target RNA, the NASBA reaction directly amplifies the RNA product with a G-quadruplex tail label, and then the G-quadruplex-thioflavin T fluorescence biosensor outputs a fluorescence signal. In the system, when there is target RNA, a significant fluorescence enhancement can be detected after the G-quadruplex structure is formed in the amplification product and binds to thioflavin T. When there is no target RNA, the product containing G-quadruplex will not be amplified, and thus no fluorescence enhancement phenomenon will occur. While "CN104611462A" performs NASBA amplification without discrimination. After the reaction, a split G-quadruplex probe that can bind to the specific amplification product is added. When there is an amplification product that can be recognized by the probe, the two split probes can form a G4 structure. When there is no specific amplification product, the probe will not form a G4 structure because it cannot recognize and bind.

[0014] Meanwhile, the thioflavin T used in this application binds to G-quadruplex, which is a novel fluorescent biosensor. There is no actual application research on virus detection using this sensor yet. The reaction conditions of this sensor are simpler. A strong fluorescent response can be detected only in a simple ionic environment. In contrast, in "CN104611462A", protoporphyrin IV is used to bind to the G4 structure formed by the probe, with complex reaction conditions and an unclear fluorescent response.

[0015] Generally speaking, although both methods use NASBA as the amplification method and G-quadruplex as the detection target, in this application, a specifically designed primer can directly amplify to form G-quadruplex in the product. Meanwhile, the fluorescent biosensor constructed by G-quadruplex and thioflavin T applied to the NASBA method for RNA detection is more creative. Moreover, the fluorescent response of this sensor is stronger and more significant. On the premise of ensuring high sensitivity and high accuracy, it can quickly judge classical swine fever virus, shorten the detection period to 2 hours, and does not require special skills of the detection personnel. Therefore, it is fast. Adding a complementary sequence in the forward direction of G-quadruplex to the primer does not require an additional fluorescence labeling procedure, nor does it require adding expensive fluorescent-labeled probes, so the cost is low. In "CN104611462A", two split probes need to be added after the reaction, and G-quadruplex can be formed only after the probe recognizes the specific target sequence. Moreover, using protoporphyrin as the fluorescent dye, the reaction conditions are more complex and the fluorescent response is not significant enough. Brief Description of the Drawings

[0016] Figure 1 This is the principle of the fluorescence detection of CSFV RNA in the present invention. First, a large number of specific products with G4 sequences at the ends are amplified from the target RNA using three enzymes (T7 RNApoly, AMV RT, RNase H); then, K+ and THT are added to promote the formation of the folded G4 structure; subsequently, a significant fluorescence enhancement can be detected under the excitation light of 425 nm and the emission light of 490 nm for the product. In the absence of target RNA, products with G4 sequences cannot be formed, and thus enhanced fluorescence cannot be detected.

[0017] Figure 2 This shows the fluorescence analysis results (excitation wavelength is 425 nm, emission wavelength is 490 nm) of the present invention for PK-15 cells infected with classical swine fever virus, blank PK-15 cells, and sterile double-distilled water, detected using a multi-functional microplate reader (SpectraMax i3, a product of Molecular Devices). Detailed Description of the Invention

[0018] The present invention will be described in detail below in conjunction with the drawings and embodiments. The content of the present invention is not limited to the following embodiments.

[0019] Example:

[0020] I. Preparation of a kit, whose composition is as follows:

[0021] (1) The NASBA reaction buffer includes: 50 mM Tris / HCl pH 8.5, 10 mM MgCl2, 90 mM KCl, 10 mM DTT, 1 mM of each dNTP, 2 mM of each NTP, 10% (v / v) DMSO;

[0022] (2) NASBA forward primer and reverse primer, including: 0.4 μM forward primer E2F - GG29: CCCCTACCTCCCGCCCCTACCCGTCCCCC - CACCACCTGGAAAGAA; 0.4 μM reverse primer E2R - T7: AATTCTAATACGACTCACTATAGGGAGATACCTCCTACTGACCA; where the front end of the forward primer contains the reverse complementary sequence CCCCTACCTCCCGCCCCTACCCGTCCCCC of the G - quadruplex sequence GG29 and the CSFV - E2 binding sequence CACCACCTGGAAAGAA, and the front end of the reverse primer is added with the T7 promoter sequence AATTCTAATACGACTCACTATAGGGAGA with a protective base and the CSFV - E2 binding sequence TACCTCCTACTGACCA;

[0023] (3) NASBA enzyme reaction solution, including: 4 mM DTT, 2 μg BSA, 30 U T7 RNA polymerase (Thermo Scientific), 6 U AMV - Rt (Promega), 0.1 u RNase H (Thermo Scientific);

[0024] (4) G - quadruplex amplification product detection reaction buffer, including: 50 mM Tris - HCl pH 7.0 and 50 mM potassium chloride; 3 μM thioflavin T. Make up to 72 μl with sterile double - distilled water;

[0025] The composition of the buffer finally used for fluorescence detection includes: 25 μL of NASBA amplification product, denature at 85 °C for 3 minutes after addition, add 3 μM thioflavin T, promote the folding of G - quadruplex on the amplification product and form a complex, and then perform fluorescence detection.

[0026] II. Detect the G - quadruplex fluorescence of classical swine fever virus culture according to the detection method. The specific steps are as follows:

[0027] A, NASBA amplification: Select 200 μl of classical swine fever virus sample, and obtain the target gene RNA using an RNA extraction reagent. Take 2 μL of the prepared RNA and add it to a 25 μL NASBA reaction buffer system. This 25 μL system includes 0.4 μM forward primer and 0.4 mM reverse primer. Reaction steps: Denature at 65 °C for 5 minutes, anneal at 42 °C for 5 minutes. Then add the NASBA enzyme reaction solution for reaction. The isothermal amplification reaction conditions are: React at 41 °C for 2 hours to finally obtain the RNA amplification product.

[0028] B, G-quadruplex fluorescence detection reaction: Take the G-quadruplex fluorescence detection reaction buffer. The composition of the reaction buffer includes 50 mM Tris-HCl (pH 7.0) and 50 mM potassium chloride. Make up to 72 μl with sterile double-distilled water and add 25 μl of the RNA amplification product. Then denature at 85 °C for 3 min; cool to room temperature, add 3 μM thioflavin T, then transfer the solution to a 96-well microplate reader. Place the microplate reader in an enzyme-linked immunosorbent assay (ELISA) reader, excite with a light source of 425 nm wavelength, and detect the fluorescence emitted at 490 nm wavelength.

[0029] Result determination: If the detected fluorescence intensity is higher than 1.0×10 6 RFU, it can be judged as positive for classical swine fever virus; lower than 5.0×10 5 RFU can be judged as negative for classical swine fever virus; if the fluorescence intensity is between 5.0×10 5 RFU and 1.0×10 6 RFU, re-determination is required.

Claims

1. A method for detecting classical swine fever virus based on G4-ThT biosensor and NASBA, characterized in that: Using the viral RNA extracted from a classical swine fever virus sample as the amplification target, an isothermal nucleic acid amplification technique is adopted, and reverse transcriptase AMV, ribonuclease H, and T7 RNA polymerase are used for isothermal amplification to generate a large amount of single-stranded RNA amplification products; then a buffer solution containing Tris-HCl and KCl is added, and then thioflavin T is added to promote the folding of G-quadruplex on the amplification products and form a complex, and then the amplification products are excited with a light source at a wavelength of 425 nm and the fluorescence emitted at a wavelength of 490 nm is detected, and judgment is made according to the intensity of the fluorescence; The specific steps are as follows: Step 1. NASBA amplification: Add the purified classical swine fever virus RNA sample to the NASBA reaction buffer system, which contains 50 mM Tris / HCl pH 8.5, 10 mM MgCl2, 90 mM KCl, 10 mM DTT, 1 mM of each dNTP, 2 mM of each NTP, 10% (v / v) DMSO, 0.4 μM NASBA forward primer and 0.4 μM NASBA reverse primer. The reaction steps are to add 2 μL of target RNA, incubate the mixture at 65 °C for 5 minutes to unwind the secondary structure of the target RNA, then transfer the reaction mixture to 41 °C for annealing for 5 min, and then add 5.6 μL of enzyme mixture to the tube. The enzyme mixture contains 4 mM DTT, 2 μg BSA, 30 U T7 RNA polymerase, 6 U AMV-Rt, 0.1 U RNase H to obtain a final volume of 25 μL, and the mixture is further incubated at 41 °C for 2 hours for isothermal amplification of the target RNA; the forward primer is E2F-GG29: CCCCTACCTCCCGCCCCTACCCGTCCCCC-CACCACCTGGAAAGAA; the reverse primer is E2R-T7: AATTCTAATACGACTCACTATAGGGAGATACCTCCTACTGACCA; Step 2. G-quadruplex fluorescence detection reaction: Take the fluorescence detection reaction buffer for the G-quadruplex amplification product. The composition of the reaction buffer includes 50 mM Tris-HCl, pH 7.0 and 50 mM potassium chloride. Make up to 72 μl with sterile double-distilled water. Add 25 μL of the NASBA reaction solution, then denature at 85 °C for 3 min and cool to room temperature; add 3 μL of 100 μM thioflavin T solution, then transfer the solution to a 96-well microplate reader. Place the microplate reader in an enzyme-linked immunosorbent assay (ELISA) reader or a fluorometer, excite with a light source at a wavelength of 425 nm, and detect the fluorescence emitted at a wavelength of 490 nm. If the detected fluorescence intensity is higher than 1.0×10 6 RFU, it is judged as positive for classical swine fever virus.

2. A kit for detecting classical swine fever virus based on G4-ThT biosensor and NASBA, characterized in that It includes the following substances: (1) The NASBA reaction buffer includes: 50 mM Tris / HCl pH 8.5, 10 mM MgCl2, 90 mM KCl, 10 mM DTT, 1 mM of each dNTP, 2 mM of each NTP, 10% (v / v) DMSO; (2) NASBA forward primer and reverse primer, including: 0.4 μM forward primer E2F-GG29: CCCCTACCTCCCGCCCCTACCCGTCCCCC-CACCACCTGGAAAGAA; 0.4 μM reverse primer E2R-T7: AATTCTAATACGACTCACTATAGGGAGATACCTCCTACTGACCA; wherein the front end of the forward primer contains the reverse complementary sequence CCCCTACCTCCCGCCCCTACCCGTCCCCC of the G-quadruplex sequence GG29 and the CSFV-E2 binding sequence CACCACCTGGAAAGAA, and the front end of the reverse primer is added with the T7 promoter sequence AATTCTAATACGACTCACTATAGGGAGA with a protection base and the CSFV-E2 binding sequence TACCTCCTACTGACCA; (3) NASBA enzyme reaction solution, including: 4 mM DTT, 2 μg BSA, 30 U T7 RNA polymerase, 6 U AMV-Rt, 0.1 U RNaseH; (4) G-quadruplex amplification product detection reaction buffer, including: 50 mM Tris-HCl pH 7.0 and 50 mM potassium chloride; Thioflavin T 3 μM.

Images