Construction and application of multi-stage targeting carrier loaded with viral antigen and adjuvant
By constructing multi-level targeted liposomes, viral antigens are precisely delivered to the endoplasmic reticulum of dendritic cells. Combined with low-dose adjuvants, the problems of insufficient cellular immunity and adjuvant toxicity in existing vaccines are solved, and efficient and controllable synergistic induction of cellular and humoral immunity with viral antigens is achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ZHEJIANG UNIV
- Filing Date
- 2022-05-13
- Publication Date
- 2026-07-10
AI Technical Summary
Existing antiviral vaccines mainly focus on humoral immunity, neglecting the regulation of cellular immunity, resulting in insufficient activation of cellular immunity. Furthermore, traditional adjuvants may trigger immunopathological reactions, making it difficult to achieve an effective synergistic response between cellular and humoral immunity.
Multi-level targeted liposomes were constructed, and nanocarriers were modified with phospholipid-targeting DC and endoplasmic reticulum-targeting molecules to precisely deliver viral antigens to the endoplasmic reticulum of DC cells. Combined with a low-dose adjuvant CpG ODN, the antigen presentation mode was regulated to achieve synergistic induction of cellular and humoral immunity.
It significantly enhanced CD8+ T cell-mediated cellular immune responses and CD4+ T cell activation, reduced adjuvant-induced immunotoxicity, and achieved efficient delivery of viral antigens and controllable regulation of immune responses.
Smart Images

Figure GDA0005495071600000081 
Figure GDA0005495071600000091 
Figure GDA0005495071600000111
Abstract
Description
Technical Field
[0001] This invention belongs to the field of pharmaceutics and relates to the construction and application of a multi-level targeting carrier carrying viral antigens and adjuvants. By controlling the precise targeting of the nanocarrier to dendritic cells (DCs) and their endoplasmic reticulum, the presentation of exogenous antigens by DCs is enhanced, the presentation of MHC class I and MHC class II antigens is actively regulated, the activation levels of CD8+ T and CD4+ T cells are enhanced, and the cellular and humoral immunity induced by viral antigens is strengthened. This carrier can be effectively used for the delivery and stepwise release of viral antigens such as those from COVID-19. At the same time, this targeting strategy can be used to effectively and precisely deliver viral antigen proteins such as those from MERS, Ebola virus disease, dengue virus, and Zika virus to the endoplasmic reticulum of DCs. Background Technology
[0002] To date, SARS-CoV-2 infection has become a significant global public health issue, with over 500 million confirmed cases and nearly 5 million deaths reported worldwide. Related disease outbreaks and complications have also increased dramatically. Viral vaccines can mobilize and train the body's specific immune response and memory. Furthermore, their preparation is controllable, readily available, and has low side effects. In particular, they can provide long-term protection, making them a primary means of human defense against viruses. The development of COVID-19 vaccines has become a global health priority. Humoral and cellular immunity complement each other in the body, and their synergistic cooperation is key to effective, durable, and safe antiviral / tumor immune responses [J Immunol 172, 6265-6271 (2004)]. For humoral immunity-based antiviral vaccines, appropriately regulating the participation and response capacity of cellular immunity is crucial for optimizing their antiviral efficacy [New Engl J Med 382, 1969-1973 (2020)]. Antibody-mediated humoral immunity alone is insufficient to combat severe viral infections [Immunity 52,910-941 (2020)] because antibodies struggle to penetrate cells and attack viruses hidden within them. Virulent T-cell-mediated cellular immunity can compensate for this deficiency. Furthermore, antigenic drift caused by viral mutations can easily lead to decreased antibody affinity, or even loss of viral neutralization ability [Plos Pathogens 9,e1003354 (2013)]. In contrast, cellular immunity is more tolerant to viral mutant immune escape [Adv VirusRes 78,43-86 (2010)], and T-cell immunity involving multiple antigenic epitopes or sequences can further reduce the risk of such mutant escape. The collaboration between humoral and cellular immunity results in a powerful antiviral response. Activated helper T cells provide co-stimulatory signals to initially activated B cells, promoting their full activation and proliferation, increasing their potential for plasma cell differentiation and antibody secretion, and thus amplifying humoral immunity [Annu Rev Immunol 34, 317-334 (2016); SciTransl Med 5, 176ra32 (2013)]. On the other hand, B cells can act as antigen-presenting cells (APCs) to present antigens to T cells and provide co-stimulatory molecules, promoting T cell activation and inducing cellular immunity. In addition, factors secreted by T and B cells can mutually promote their functions and the establishment of long-term immune memory [Neurosci Biobehav Rev 25, 29-41 (2001); Celland Tissue Biology 7, 539-544 (2013)].
[0003] Mobilizing antiviral humoral or cellular immunity singly or uncontrollably also carries safety risks. Overly strong antiviral cellular immunity may induce Th2 cell-associated eosinophilic infiltration [J Virol 85, 12201-12215 (2011)] or autoimmune diseases [Cell Mol Immunol 16, 602-610 (2019)]. Furthermore, excessive reliance on neutralizing antibodies may induce overexpression of pro-inflammatory factors, triggering an immune storm, or damage organ tissues through antibody-dependent enhancement (ADE) [SSRNE Electronic J, 2020030138 (2020)]. Therefore, enhancing the synergistic mobilization of humoral and cellular immunity and ensuring controllable antiviral immune responses is crucial for safety and efficacy. Optimized synergy between controllable regulation and screening will be an important direction for designing high-quality antiviral vaccines.
[0004] Dendritic cells (DCs) are central to immune induction, activating both T and B cells. Compared to other cell types such as macrophages and B cells, DCs are professional antigen-presenting cells (APCs) capable of intercepting different antigens through pinocytosis, endocytosis, or phagocytosis. To fulfill their role as APCs, DCs express a large number of extracellular and intercellular receptors responsible for their ability to "sense" their environment. When they encounter antigens in an infectious / inflammatory context, DCs undergo a maturation process that leads to the upregulation of co-stimulatory molecules and MHC molecules, increasing their ability to present antigens under MHC I and MHC II conditions [Boscardin, 10 (2019)].
[0005] Antigen-targeted endoplasmic reticulum (ER) delivery can significantly enhance cellular immune responses. Precise ER-targeted distribution of the carrier was achieved by modifying or adding targeting molecules to the surface of nanocarriers. After entering the cell, the carrier exhibits non-lysosomal intracellular transport behavior, undergoing endocytosis mediated by caveolin and then transported along intracellular microtubule pathways to the perinuclear ER site [ACSCent Sci 6, 174-188 (2020)]. This intracellular transport mechanism, similar to that of some viruses, helps the encapsulated active molecules evade lysosomal capture and reduces degradation. The ER-associated degradation system (ERAD) is an important mechanism for protein quantity control in eukaryotic cells. It alleviates ER stress by retroverting terminal misfolded proteins in the ER lumen to the cytoplasm for ubiquitin-proteasome-mediated degradation. In dendritic cells (DCs), ERAD also plays a role in promoting antigen processing and presentation. By using an ER-targeting vector to accumulate exogenous protein antigens at the ER site, and further utilizing the ERAD mechanism to process and present the antigens, this strategy has been found to significantly increase the presentation of MHC class I antigens, induce a specific CD8+ T cell-mediated cellular immune response, and significantly enhance the antitumor efficacy of the vaccine [Adv Healthc Mater, e2001934(2021)]. The core of this vaccine strategy is to shift the way dendritic cells (DCs) process exogenous antigens from primarily inducing humoral immunity to cellular immunity. The extent of this shift depends on the ER-targeting efficiency of the vector, which can be further controlled by the number of targeted modification molecules on the vector.
[0006] Currently, research on antiviral vaccines mainly focuses on exploring the mechanisms and effects of antiviral humoral immunity. Their design and application primarily revolve around antibody-dependent humoral immunity, with insufficient investigation and mobilization of cellular immunity [Microbiol Mol Biol R 80, 989-1010 (2016); Transfus Apher Sci 59, 102922 (2020)]. Current research on cellular immunity is mainly concentrated in the field of antitumor therapy [J Cell Physiol 234, 8509-8521 (2019); AdvExp Med Biol 1224, 53-62 (2020)]. However, with a gradual understanding of viral mechanisms of action, some research related to antiviral cellular immunity has been reported.
[0007] The low immunogenicity of subunit vaccines, such as those targeting spike proteins, limits their application and development, often requiring adjuvants to enhance their ability to generate an immune response. Adjuvants can be categorized based on their properties, including aluminum salt-based adjuvants (aluminum hydroxide and aluminum phosphate), squalene oil emulsion-based adjuvants such as MF59 and AS0, and Toll-like receptor (TLR) agonists, including the TLR9 agonist CpG1018, and the TLR4 agonist monophospholipid A (MPL)-based adjuvants AS01B (MPL and saponin QS-21) and AS04 (MPL and aluminum hydroxide). Currently, most candidate vaccines against SARS-CoV use aluminum-based adjuvants. Evidence suggests that aluminum-adjuvant-based vaccines are prone to inducing vaccine-associated enhanced respiratory disease [Nature 579, 270–273 (2020)]. The selection of adjuvants must be extremely careful during vaccine construction [Sci Rep 10, 20085 (2020)]. Synthetic oligodeoxynucleotides (CpG ODNs) with CpG motifs are agonists of TLR9, mimicking the activity of naturally occurring CpG motifs in bacterial DNA. Once activated, TLR9 migrates from the endoplasmic reticulum to the Golgi apparatus and lysosomes, where it interacts with MyD88, a key protein in the signaling pathway. Delivering CpG ODNs to the endoplasmic reticulum of dendritic cells using precise targeting vectors reduces the adjuvant dosage and mitigates potential Th2 and Th17-induced immunopathological responses induced by adjuvants. Summary of the Invention
[0008] One objective of this invention is to provide a method for constructing a multi-level targeting vector carrying viral antigens and adjuvants, specifically a method for constructing multi-level targeting charged liposomes for delivering viral antigens such as SARS-CoV-2, comprising the following three parts:
[0009] 1. Phospholipid-targeting DC molecule DSPE-PEG 2000 -Man, phospholipid-targeting endoplasmic reticulum molecule DSPE-PEG 2000 -Par's construction method:
[0010] This invention leverages the high expression of mannose receptors in dendritic cells (DCs) and utilizes 4-isothiocyanate phenyl-A-D-mannoside, which specifically recognizes the receptor, as a target for DCs. It employs 4-isothiocyanate phenyl-A-D-mannoside in conjunction with DSPE-PEG. 2000 -NH2,DSPE-PEG 2000 -COOH or DSPE-PEG 2000 -SH, through an addition reaction, forms the phospholipid-targeting molecule DSPE-PEG. 2000 -Man. DSPE-PEG 2000-Man can be dissolved in organic reagents such as ethanol, acetone, dichloromethane, and trichloromethane. The specific method is as follows: DSPE-PEG... 2000 -NH2,DSPE-PEG 2000 -COOH or DSPE-PEG 2000 -SH and 4-isothiocyanate phenyl-A-D-mannoside are dissolved in 2-10 mL of tetrahydrofuran solution at a molar ratio of 1-5:1. After reacting at room temperature in the dark for 2-24 hours, the reaction product is purified by recrystallization or dialysis. For example, the reactants are collected using a dialysis bag with a molecular weight cutoff of 3000, and the organic solvent is removed by dialysis with pure water. The product is then lyophilized to obtain DSPE-PEG. 2000 -Man, the phospholipidized mannose target is amphiphilic. Its hydrophobic end is the phospholipid part, which can be anchored on the surface of the liposome nanocarrier, while the hydrophilic part of Man is exposed and can be used as a target to recognize mannose receptors on DC cells, thus targeting the liposome nanocarrier to DC cells.
[0011] Construction of Phospholipid-Targeted Endoplasmic Reticulum Molecules: Pardaxin (Par) is an antimicrobial peptide, initially isolated from the secretions of the Red Sea Moses sole, a small polypeptide containing 33 amino acid residues. After entering the cell, it can bypass mitochondria, Golgi apparatus, and lysosomes and target the endoplasmic reticulum. Par has strong hydrophilicity; to better anchor it on the surface of the nanocarrier, we modified it with hydrophobicity using DSPE-PEG. 2000 -NH2 reacts with the free carboxyl group on Par to form an amphiphilic DSPE-PEG. 2000 -Par can improve the solubility of Par in organic solvents such as ethanol, acetone, dichloromethane, and chloroform.
[0012] The specific method is as follows: Accurately weigh a certain amount of Par polypeptide and dissolve it in 2-10 mL of anhydrous tetrahydrofuran solvent. Under light-protected and ice-bath conditions, add (BOC)₂O reagent to protect the four free amino groups on the Par polypeptide. The reaction is carried out under nitrogen atmosphere and protected from light for 12 hours. After protection with (BOC)₂O reagent, add EDC and NHS to activate the carboxyl groups on the Pardaxin polypeptide (n(EDC):n(Pardaxin) = 5-20:1, n(NHS):n(Pardaxin) = 5-20:1). Activation is carried out at room temperature for 2 hours. After activation, add DSPE-PEG-NH₂ and DSPE-PEG. 2000The molar ratio of -NH2 to Par peptide was 1-10:1, and the reaction was carried out under magnetic stirring for 24 hours. After the reaction was completed, the BOC protection was removed by stirring with 1-5 mL of 12M HCl for 2 hours. Then, the solution was adjusted back to neutral with 3M NaOH. The organic reagents and free reactants were removed by dialyzing with a dialysis bag with a molecular weight cutoff of 8000. The product was then lyophilized to obtain DSPE-PEG-Par.
[0013] 2. The method for constructing multi-level targeted charged liposomes is specifically achieved through the following steps:
[0014] Multi-compartment liposomes are prepared by dissolving egg yolk lecithin, cholesterol, phospholipidized mannose molecules, phospholipidized endoplasmic reticulum (ER)-targeting molecules, and cationic (anionic) lipids in solvents such as ethanol, acetone, acetonitrile, dichloromethane, or chloroform as a hydrophobic phase. Viral antigens and adjuvants are dissolved in a buffer solution as a hydrophilic phase. Multi-compartment liposomes are prepared using ethanol injection, reverse evaporation, thin-film dispersion, or microfluidic technology. Single-compartment cationic liposomes are then formed by probe sonication or water bath sonication. In this invention, the cationic (anionic) lipids account for 0.5%-30% of the total lipid mass as needed, and the phospholipidized mannose molecules and phospholipidized ER-targeting molecules each account for 0.01%-10% of the total lipid mass as needed. The molar ratio of phospholipidized mannose molecules to phospholipidized ER-targeting molecules is not fixed and the number of liposomes entering the endoplasmic reticulum of dendritic cells (DC) cells can be effectively adjusted by adjusting the target ratio. This allows for the allocation of viral antigens in the endoplasmic reticulum and lysosomes, thereby regulating antigen-induced cellular and humoral immunity as needed.
[0015] The cationic lipids in this invention can be positively charged lipids, such as (2,3-dioleoyl-propyl)trimethylammonium chloride (DOTAP), dimethyl dioctadecylammonium (DDA), 1,2-dimethyl-3-trimethylammonium-propane (DMTAP), 1,2-stearoyl-3-trimethylammonium-propane (DSTAP), or 3β-[N-(N'N'-dimethylaminoethyl)aminoformyl]cholesterol (DC-Chol); or they can be ionizable lipids, such as methyl 4-(N,N-dimethylamino)butyrate (dilinoleyl) ester (DLin-MC3-DMA, pKa = 6.44). The anionic lipids in this invention can be phosphatidylglycerol, phosphatidylserine, or phosphatidic acid, etc.
[0016] 3. A method for loading antigens and adjuvants onto multi-level targeted cationic liposomes is achieved through the following means:
[0017] The viral antigens in this invention are primarily loaded via electrostatic adsorption. The buffer system composed of Na₂HPO₄ and KH₂PO₄ is adjusted based on the isoelectric point of the antigen protein / peptide to give it an opposite charge to the liposomes, allowing antigen loading through electrostatic adsorption and hydrophilic cavity loading. The antigens involved can be spike proteins (S protein), nucleocapsid proteins (N protein), membrane proteins (M protein), and envelope proteins (E protein) of novel coronavirus (SARS-CoV-2), Middle East Respiratory Syndrome (MERS), Ebola virus, and Zika virus, etc. They can also be antigen proteins of DNA viruses such as hepatitis B virus, rabies virus, varicella virus, and leprosy virus.
[0018] The adjuvants in this invention are primarily loaded via electrostatic adsorption and hydrophilic cavity loading. Toll-like receptor (TLR) agonists are mainly selected as immunoadjuvants according to the needs of this invention. Synthetic oligodeoxynucleotides (CpG ODNs) with CpG motifs are TLR9 agonists, mimicking the activity of naturally occurring CpG motifs in bacterial DNA. Once activated, TLR9 migrates from the endoplasmic reticulum to the Golgi apparatus and lysosomes, where it interacts with MyD88, a major protein in the signaling pathway. Delivering CpG ODNs to the endoplasmic reticulum of dendritic cells using precise targeting vectors reduces the adjuvant dosage and mitigates potential Th2 and Th17-induced immunopathological responses induced by the adjuvant. The CpG-ODNs in this invention can be class A, B, or C CpG ODNs. Their sequences are shown in SEQ ID No. 1-5.
[0019] Another object of the present invention is to provide the application of the aforementioned multi-level targeted charged liposomes in the preparation of vectors for the precise delivery of antiviral antigens to the endoplasmic reticulum of dendritic cells. The application of the present invention is mainly achieved through the following methods.
[0020] 1. Liposomes loaded with antigens and adjuvants are precisely localized to the endoplasmic reticulum of dendritic cells.
[0021] Dendritic cells (DCs) are professional antigen-presenting cells and key messengers for activating cellular immunity. The liposomes described in this invention possess multi-level targeting capabilities to DCs and the endoplasmic reticulum (ER). By modifying the liposome surface with a phospholipid-modified ER-targeting peptide (DSPE-PEG-Par), the liposomes are recognized and taken up by DCs, then internalized via caveolin-mediated endocytosis. Once inside the cell, they are transported along intracellular microtubule pathways to the perinuclear ER, where they release antigens and adjuvants. This intracellular transport mechanism, similar to that of some viruses, helps the encapsulated active molecules evade lysosomal capture and reduces degradation.
[0022] 2. Liposomes loaded with antigens and adjuvants mediate controlled antigen cross-presentation in dendritic cells.
[0023] Intracellular transport of antigens affects their presentation fate, leading to differences in the type of immune response. The liposomes loaded with antigens and adjuvants constructed in this invention can effectively control the antigen presentation pattern of dendritic cells (DCs), thereby inducing controllable cellular and humoral immunity. This is mainly achieved through the following mechanisms: professional antigen-presenting cells (DCs) typically use the lysosomal pathway to present exogenous antigens to CD4+ T cells via the MHC class II pathway, promoting humoral immunity; and process endogenous antigens via the MHC class I pathway and present them to CD8+ T cells, inducing a CTL-dominated cellular immune response. When exogenous antigens leave the lysosome, cross-presentation may also occur, inducing cellular immunity through MHC class I molecules. Therefore, regulating the type and degree of involvement of MHC molecules in antigen-presenting cells is an important means of determining the type of T cell subsets and the dominant immune response (humoral or cellular immunity) in the body's immune response after exogenous antigen vaccine delivery.
[0024] This invention uses the SARS-CoV-2 spike protein (S protein), containing the COVID-19 viral antigenic epitope, as an exogenous model antigen to construct a liposomal vaccine featuring secondary release of the S protein and precise endoplasmic reticulum (ER) targeting of dendritic cells (DCs). The S protein is loaded onto the periphery and core of the liposomes via electrostatic adsorption and encapsulation, respectively, for diversified presentation of exogenous antigens. After vaccination, the adsorbed antigen on the liposome surface is rapidly released, inducing B cell activation. The liposomes, having released the surface antigen, utilize exposed Man and Par peptides to achieve specific delivery and release of the antigen at the ER of dendritic cells (DCs), inducing CTL-dependent cellular immunity. By altering the modification degree of the Man and Par ER-targeting peptides, the presentation mode of the exogenous antigen is regulated, i.e., the cross-presentation ratio, affecting the activation of CD8+ T cells and CD4+ T cells, thereby allocating the degree and proportion of cellular and humoral immunity induction. This project can be used to screen for the optimal combination of antiviral cellular and humoral immunity, providing effective guidance for designing high-quality antiviral vaccine vectors and addressing different viral infections.
[0025] 3. Targeted liposomes achieve lymph node enrichment in mice.
[0026] One approach to elicit a stronger and more durable immune response against a specific virus is to target viral antigens and adjuvants to antigen-presenting macrophages and dendritic cells (DCs). These cells typically encounter antigens at peripheral vaccination sites, then mature, enter lymphatic vessels, and migrate to lymph nodes to trigger effector lymphocytes. This invention achieves the enrichment of antigen- and adjuvant-loaded liposomes in lymph nodes by leveraging the "hitchhiking" effect of antigen-presenting cells. Specifically, after subcutaneous injection of liposomes into mice, the liposomes, free on the surface of the target cells, specifically recognize mannose receptors on the surface of antigen-presenting cells (primarily DCs). DCs that take up the liposomes migrate to the lymph nodes, thus enriching the carrier in the lymph nodes.
[0027] 4. Liposomes loaded with antigens and adjuvants induce humoral and cellular immunity in mice.
[0028] The advantage of this invention is that it can regulate the presentation mode of exogenous antigens and optimize the minimum effective dose of adjuvants by altering the modification degree of Man and Par, thereby activating cellular and humoral immunity mediated by CD8+ T cells and CD4+ T cells. This invention optimizes the targeting liposomes loaded with the SARS-CoV-2 S protein and CpG adjuvant, injects them subcutaneously into mice, and examines the humoral immunity induced by antigen-specific immunoglobulins in mouse plasma; it also examines the humoral and cellular immunity induced by liposomes by detecting antigen-specific B cell and T cell subtypes in the spleen and lymph nodes of mice. This invention can provide effective guidance for the prevention and treatment of various viral infections.
[0029] Based on the above background, this invention utilizes lipids with high biocompatibility and low immunogenicity as the main material to construct and apply nanoliposomes that can precisely deliver viral antigens such as SARS-CoV-2 and immune adjuvants to the endoplasmic reticulum of dendritic (DC) cells. This invention uses mannose (Man) and the endoplasmic reticulum-targeting peptide (Par) to modify the surface of the liposomes, endowing them with multi-level targeting of DCs and their endoplasmic reticulum. By adjusting the ratio of Man to Par, the processing of antigens in the DC endoplasmic reticulum and lysosomes can be effectively regulated, enhancing the presentation of exogenous antigens by DCs and promoting the activation of CD8+ and CD4+ T cells. Simultaneously, these liposomes can also directly deliver extremely low doses of CpG-ODNs adjuvants to the DC endoplasmic reticulum, mitigating the potential immunotoxicity induced by adjuvants.
[0030] The beneficial features of this invention are as follows:
[0031] (1) This invention provides a novel means and mechanism for enhancing the body's cellular immune response.
[0032] Antigen-presenting cells (DCs) in the body exhibit significant differences in their presentation mechanisms for exogenous and endogenous antigens. Exogenous antigens taken up by DCs are primarily transported and processed via lysosomes, presented as MHC class II antigens for humoral immune responses. Endogenous antigens produced by DCs themselves are often processed and presented as MHC class I molecules to exert cellular immune responses. This study aims to transport exogenous antigens in DCs via a non-lysosomal pathway and target their accumulation at the endogenous erythrocyte exotropium (ER). The ERAD mechanism will then be used to process the antigens and effectively present antigenic epitopes from the ER. This allows DCs to process exogenous antigens as if they were endogenous, accumulating them at the target site, thus efficiently presenting MHC class I antigens and significantly enhancing the body's cellular immune response.
[0033] (2) This invention provides a novel strategy for regulating cellular and humoral immune responses in the body using antiviral vaccines.
[0034] Traditional antiviral vaccine technologies, such as recombinant viral proteins and inactivated viruses, primarily rely on the delivery of exogenous antigens. Because antigen-presenting cells preferentially process exogenous antigens, the body mainly focuses on inducing humoral immune responses, resulting in insufficient activation of cellular immunity, which significantly impacts subsequent antiviral efficacy. This project aims to leverage a two-stage release mechanism of exogenous antigens to exert immunomodulatory effects: a portion of the antigen is rapidly released after inoculation for primary B cell activation; the other portion, through controlled delivery efficiency targeting the ER, regulates the MHC class I and II antigen presentation ratios, respectively inducing cellular immune responses by activating CD8+ T cells and amplifying humoral immune responses by activating CD4+ T cells, ultimately achieving effective regulation of both cellular and humoral immune induction.
[0035] (3) This invention provides a novel liposome construction technology for loading viral protein antigens and adjuvants.
[0036] We plan to utilize ionizable lipids and pH regulation in the formulation to achieve stepwise encapsulation of viral antigens and adjuvants in vitro and in vivo within liposomes. We will control the encapsulation ratio of antigens and adjuvants in both parts by adjusting the feed ratio. Furthermore, we will modify the liposome surface with targeting molecules against dendritic cells (DCs) and the endoplasmic reticulum. The degree of modification will control the delivery site and presentation mode of the encapsulated antigen within the liposomes. This is the foundation for the vaccine to effectively regulate antiviral cellular and humoral immune responses. This novel vaccine construction technology based on exogenous antigens can provide another effective approach for the development of antiviral vaccine vectors. Attached Figure Description
[0037] Figure 1Preparation and characterization of S+CpG@PM-LIPO. (AD) Transmission electron microscopy and particle size distribution of different LIPO vaccine formulations, n=3. Scale bar, 100 nm. (E) Surface potential of different LIPO vaccine formulations, n=3. (F) Cell toxicity of different concentrations of the carrier after co-incubation with DC2.4 and BMDCs, n=5. (G) Release curve of the S protein-loaded liposome carrier, n=3. (H) SDS-PAGE analysis of S@PM-LIPO.
[0038] Figure 2 Enhanced and controllable antigen presentation effect. (A) Expression of activation markers after co-incubation of vectors modified with different Par ratios with BMDCs, n=6. (B) Representative flow cytometry plots of CD11c+MHC-I+MHC-II+BMDCs.
[0039] Figure 3 Antibody concentrations in mouse serum after .S+CpG@PM-LIPO vaccine administration. (A) Schematic diagram of the vaccination method for mice. (B) Weight changes in mice during the vaccination period. (C) IgM antibody concentration in mouse serum. (D) IgG antibody concentration in mouse serum.
[0040] Figure 4 Following the .S+CpG@PM-LIPO vaccine, the concentrations of cytokines and S-neutralizing antibodies in mouse serum were measured. (A) The concentrations of cytokines IL-12, IL-4, and IL-6 in serum collected at weeks 3, 5, and 7 were detected by ELISA. (BC) Neutralizing antibodies targeting the S protein were detected. S-specific neutralizing antibodies in serum target the S protein and block its binding to ACE2 (D). The inhibition rate determined the level of neutralizing antibodies against SARS-CoV-2 in the sample. A positive result (inhibition rate ≥20%) indicated the detection of SARS-CoV-2 neutralizing antibodies (E). (F) The titer of S-specific antibodies in serum collected at weeks 3, 6, and 8.
[0041] Figure 5 Changes in B cells and T cells in mice after .S+CpG@PM-LIPO vaccine administration. (AC) Flow cytometry results of CD19+ B cells and mature B cells in bone marrow, spleen, and lymph nodes. (D) Percentage of CD8+ T and CD4+ T cells in blood by flow cytometry analysis. (EF) Percentage of CD8+ T, CD4+ T cells, and central memory CD8+ T (CD8+Tcm) and CD4+ Tcm in spleen and lymph nodes.
[0042] Figure 6In vitro cell antigen uptake and endoplasmic reticulum colocalization. (A) Representative confocal images of BMDCs incubated for 24 hours with various DID-labeled LIPOs (OVA@LIPO, OVA@Par-LIPO, OVA@Man-LIPO, and OVA@PM-LIPO) (scale bar: 25 μm). (B) Mean fluorescence intensity of FITC-OVA uptake by BMDCs after incubation with various OVA-loaded LIPOs. (C) Mean fluorescence intensity of DID-LIPO uptake by BMDCs after incubation with various DID-labeled LIPOs. (D) Endoplasmic reticulum colocalization images of different LIPOs after uptake by BMDCs (scale bar: 5 μm). (E) 3D images of individual BMDCs after endocytosis of OVA@LIPO, OVA@Par-LIPO, and OVA@PM-LIPO.
[0043] Figure 7 Enhanced and controllable cross-presentation effect of BMDCs. (AB) Flow cytometry representation of activated BMDCs. (C) Quantification of BMDCs expressing MHC-I and MHC-II after incubation with various Par-modified LIPOs based on flow cytometry data (n=6). (D) Quantification of DCs expressing MHC-I and MHC-II after incubation with OVA liposomes of different Par modification degrees.
[0044] Figure 8 Enrichment study of liposomal vaccines in mouse lymph nodes. (AC) Mouse images of DiR-labeled LIPOs or free OVA in draining lymph nodes at different time points after subcutaneous injection. (D) Mean fluorescence intensity of lymph nodes from various organs (EF) dissected after subcutaneous injection of DID-loaded LIPOs 72 hours later. (G) Fluorescence photographs of lymph nodes after subcutaneous injection of DID-labeled LIPOs 72 hours later. (HI) Mean fluorescence intensity of lymph nodes. Detailed Implementation
[0045] The present invention will be further described in conjunction with the accompanying drawings and embodiments.
[0046] Example 1
[0047] Preparation and application of liposomes loaded with anti-SARS-CoV-2 viral S protein and CpG adjuvant that can precisely target the endoplasmic reticulum of dendritic cells (S+CpG@PM-LIPO).
[0048] The prescription is as follows:
[0049]
[0050]
[0051] To investigate the targeting effect of the liposome vaccine prepared in this invention on the endoplasmic reticulum of DC cells and the results of its regulation of cell-humoral immunity in vivo and in vitro, this invention conducted the following study using Example 1 as an example.
[0052] The 2019 COVID-19 pandemic has had a profound impact on global health and lives. Research into COVID-19 vaccines is currently in full swing, and the public has gained some protection through vaccination. However, the complexity of virus-host cell interactions, the virus's high mutability, and its ability to evade the immune system mean that effective strategies for dealing with most other viral infections still lack. Viruses will remain one of the greatest threats to human health, both in the past, present, and future. Constructing a SARS-CoV-2 subunit liposomal vaccine that can precisely target dendritic cells (DCs) provides a reference for the optimized development of other vaccines. This invention is the first to construct a multi-level targeted liposomal vaccine using a thin-film dispersion method, and includes formulation investigation, regulation of antigen cross-presentation, and studies on post-vaccination cellular and humoral immune responses in mice.
[0053] 1. Construction and characterization of liposomes loaded with antigens and adjuvants.
[0054] DSPE-PEG-NH2 and 4-isothiocyanatophenylα-D-mannopyranoside or Paradaxin (Par) are synthesized by forming an amide bond through a coupling reaction. Then, liposomes loaded with S protein (NCBI reference sequence: YP_009724390.1) and CpG adjuvant (base sequence: 5-ggGGTCAACGTTGAgggggg-3′) were prepared by thin-film dispersion: Dimethyl octadecyl ammonium bromide (DDA), egg yolk lecithin E80, cholesterol Chol, DSPE-PEG-Par, and DSPE-PEG-Man were dissolved in chloroform at a certain molar ratio, and the chloroform was removed by rotary evaporation under reduced pressure to form a lipid film. The film was hydrated by adding PBS solution containing 10 μg of S protein (buffer solution composed of Na2HPO4 and KH2PO4, with the pH of the buffer adjusted to 7.5-8.0 according to the isoelectric point of S protein). The film was prepared by ultrasonication with a probe (power 150W, working for 3 seconds, pausing for 2 seconds, and co-ultrasonication for 5 minutes). The film was further incubated with PBS solution of CpG-ODNs (pH 7.0-8.0) for 30 min and purified by dextran gel column (Sephadex G50). Based on the same principle, other liposome reference standards were prepared. They were named S+CpG@Man-LIPO (containing only the Man target), S+CpG@Par-LIPO (containing only the Par target), S+CpG@PM-LIPO (containing both Man and Par targets), and S+CpG@LIPO (without target molecule modification) according to whether they contained or did not.
[0055] Transmission electron microscopy (TEM) reveals the typical phospholipid bilayer structure of LIPO, PM-LIPO, and S+CpG@PM-LIPO, with liposome particle sizes ranging from 100 to 150 nm. Figure 1 AD). The mixture of S and CpG is negatively charged (~-9mV) in buffer (pH 7.4), while PM-LIPO is positively charged (~+50mV). After successful loading of S and CpG, the Zeta potential of S+CpG@PM-LIPO decreased slightly. Figure 1 E). We used the BCA protein concentration assay kit and nanodrop to determine the encapsulation efficiency of S protein and CpG in S+CpG@LIPO and S+CpG@PM-LIPO, respectively. The data showed that the encapsulation efficiency of both was above 50%. Furthermore, this blank vector, at a concentration as high as 0.625 mg / mL, did not exhibit significant toxicity to DC2.4 and BMDCs cells. Figure 1F). We further investigated the drug release behavior of the liposomes and found that the released S protein gradually increased over time. In the first 8 hours, S+CpG@PM-LIPO released approximately 70% of the S protein, after which the drug release rate slowly decreased, reaching a relatively stable level by 24 hours. Figure 1 G). We first ultrafiltered the prepared liposomes to remove unencapsulated drug, and then used SDS-PAGE analysis to verify the integrity of the S protein in the liposomes. Figure 1 H).
[0056] 2. Research on controllable antigen cross-presentation mediated by DC and endoplasmic reticulum-targeted liposomes.
[0057] We first prepared a series of liposomal vaccines, modifying the surface of the liposomes with different mass fractions of Par (0.3%–0.5%), Medium (0.9%–1.5%), and High (3%–5%). Then, we co-incubated the liposomes with mouse bone marrow-derived dendritic cells (BMDCs) to investigate their ability to upregulate BMDC co-stimulatory molecules (CD80 and CD86). The results showed that Par-modified liposomes significantly increased the proportion of activated BMDCs compared to unmodified liposomes. Furthermore, we investigated whether liposomes promoted the cross-presentation ability of BMDCs. Regarding the upregulation of MHC I and MHC II expression, compared to untargeted liposomes, liposomes modified with medium to high proportions of Par significantly enhanced the expression of MHC-I and MHC-II. While low proportions of Par did not promote MHC-I expression, they significantly enhanced MHC II expression. The double-positive results for MHC-I and MHC-II indicate that Par can significantly promote the presentation and processing of exogenous antigens by BMDCs. Figure 2 (AB). This result indicates that adjusting the modification ratio of Par can effectively regulate the cross-presentation of antigens by BMDCs.
[0058] 3. Study on humoral and cellular immunity induced in mice by liposomes loaded with S protein.
[0059] We administered the vaccine to healthy C57 mice three times, on days 0, 14, and 28. Figure 3 A). During the vaccination period, the mice's body weight remained within a normal range of variation, indicating that the vaccine has good biosafety. Figure 3B). IgM is a basic antibody secreted by B cells and is the first antibody to react upon contact with an antigen. We found that after the first week of vaccination, the concentration of immunoglobulin M (IgM) in S+CpG@PM-LIPO was higher than 15 ng / mL, significantly higher than the control group. However, in the third week, there was no significant difference in IgM levels among the groups. Figure 3 C). B lymphocytes transform into plasma cells after antigen stimulation and produce a certain amount of immunoglobulin G (IgG), which is the main component of immunoglobulins in serum. After three vaccinations, the amount of IgG in the LIPO vaccine significantly increased. Figure 3 D). This result indicates that the LIPO vaccine has strong immunogenicity and can effectively activate the body's humoral immunity. We measured the serum concentrations of IL-12, IL-4, and IL-6 using an ELISA kit at weeks 3, 5, and 7. IL-12 is mainly produced by activated inflammatory cells (monocytes, macrophages, dendritic cells, and other APCs). After vaccination with S+CpG@PM-LIPO, the level of IL-12 in mice increased ( Figure 4 A). IL-4 is produced by helper Th cells and mainly acts on B cells, enhancing IgE-mediated humoral immunity. IL-6 stimulates the proliferation of activated B cells and the secretion of antibodies. S+CpG@PM-LIPO vaccine induces higher levels of IL-4 and IL-6 than free S+CpG or S+CpG@LIPO vaccine. Figure 4 BC). We then evaluated the neutralizing capacity of sera collected from different groups at different time points. S-specific neutralizing antibodies (SNA) in serum neutralized the S protein and blocked its binding to ACE2. Figure 4 D). Figure 4 The inhibition rate shown by E determines the level of neutralizing antibodies against SARS-CoV-2 in the sample. A positive result (inhibition rate ≥20%) indicates the presence of SARS-CoV-2 neutralizing antibodies in the sample. This data shows that the S+CpG@PM-LIPO vaccine-induced SNA inhibition rate exceeded 40% at weeks 6 and 8, with a significant increase in SNA titer after 6 weeks of vaccination, maintaining a high SNA titer until week 8. Figure 4 F).
[0060] As key cells for humoral immunity, we then examined changes in B cells in the bone marrow (BM), spleen, and lymph nodes of mice after vaccination. Flow cytometry results showed that the total number of B cells in the BM (the main site of B cell maturation) did not change significantly, but the proportion of mature B cells was significantly increased in the S+CpG@PM-LIPO vaccine group compared to other free S+CpG or S+CpG@LIPO vaccines. Figure 5After maturation, B cells migrate to the red pulp of the spleen and the cortex of the lymph nodes. Flow cytometry results showed a significant increase in activated B cells in the lymph nodes and spleen of mice treated with S+CpG@PM-LIPO, further indicating that the vaccine vector can effectively activate the humoral immunity of mice. Figure 5 AC).
[0061] The levels of immune factor release described above indicate that S+CpG@PM-LIPO also induced a strong T cell response. We then analyzed different T cell populations in the blood, spleen, and lymph nodes of vaccinated mice. Six weeks after a booster vaccination, we found that both S+CpG@LIPO and S+CpG@PM-LIPO vaccines induced higher levels of CD4+ and CD8+ T cells in the blood. The number of CD4+ and CD8+ central memory T (CD62L+CD44+Tcm) cells found in S+CpG@PM-LIPO was significantly higher than that found in the spleen and lymph nodes of mice vaccinated with free S+CpG. Figure 5 DF).
[0062] Example 2
[0063] Preparation and application of liposomes (OVA@PM-LIPO) loaded with anti-ovalbumin (OVA) antigen and CpG adjuvant that can precisely target the endoplasmic reticulum of dendritic cells:
[0064] The prescription is as follows:
[0065]
[0066] The steps for liposome preparation are as follows:
[0067] Dimethyl octadecyl ammonium bromide (DDA), egg yolk lecithin E80, cholesterol Chol, DSPE-PEG-Par, and DSPE-PEG-Man were dissolved in chloroform according to the above-mentioned formulation. The chloroform was removed by rotary evaporation under reduced pressure to form a lipid film. The film was hydrated by adding PBS solution (pH 6.5-7.0) containing 10 μg of OVA protein. Liposomes were prepared by ultrasonication using a probe (150 W power, 3 seconds on, 2 seconds off, co-ultrasonication for 5 minutes). CpG-ODNs in PBS solution (pH 7.0-8.0) were further added and incubated for 30 min. The liposomes were then purified by dextran gel column chromatography (Sephadex G50). Other liposome controls were prepared based on the same principle. Example 2 of this invention was used as an example for the following research.
[0068] 1. Research on the precise localization of liposomes loaded with antigens and adjuvants to the endoplasmic reticulum of dendritic cells (DCs) and their role in promoting DC maturation.
[0069] To evaluate PM-LIPO-mediated antigen uptake and endoplasmic reticulum targeting capabilities, LIPO vaccine vectors loaded with FITC-OVA were labeled with DID. Fluorescence images show that most of the OVA (green) was encapsulated within LIPOs (red), merging into an orange fluorescent signal. Figure 6 A) Once given targeted functionality, LIPOs are more easily absorbed by BMDCs. For example... Figure 6 As shown in AC, after 24 hours of co-incubation with the vector, BMDCs took up significantly more targeted LIPOs (OVA@Par-LIPO and OVA@Man-LIPO) compared to non-targeted LIPOs (OVA@LIPO). The targeted uptake function of the PM-LIPO vaccine was further validated in three other immortalized cell lines (DC2.4 and Raw264.7). Both Man-LIPO and PM-LIPO exhibited strong internalization due to the high expression of the Man receptor in these cells. Meanwhile, Par-LIPO showed a slight increase in internalization in DC2.4 and Raw264.7 cells compared to the LIPO group due to its enhanced cation penetration effect. Then, after 12 hours of incubation with various DID-labeled LIPOs, the endoplasmic reticulum of BMDCs was labeled with ER-tracker green. Two-dimensional and three-dimensional confocal images showed that Par-mediated LIPOs (OVA@Par-LIPO and OVA@PM-LIPO) exhibited greater co-localization with the endoplasmic reticulum. Figure 6 The results showed that PM-LIPO can accurately deliver antigens to the ER of the DC for processing.
[0070] 2. Study on controllable antigen cross-presentation mediated by liposomes loaded with antigens and adjuvants.
[0071] Endogenous antigens and cross-presented exogenous antigens undergo cytoubin-proteasome degradation and are presented in MHC class I and II restricted modes, correspondingly activating CD8+ and CD4+ T cells. Enhanced cellular uptake and specific localization of antigens on the endoplasmic reticulum contribute to the activation of BMDCs. Figure 7As shown in Figures AB, OVA@LIPO exerted a weak promoting effect, while OVA-loaded targeted LIPOs, especially OVA@PM-LIPO, significantly upregulated the expression of MHC-II and CD80 molecules. From the above results and our previous studies, it is clear that by accumulating exogenous antigens at endoplasmic reticulum sites and further utilizing the ERAD mechanism for antigen processing and presentation, DCs can significantly increase the presentation of MHC class I antigens, induce specific CD8+ T cell-mediated cellular immune responses, and significantly enhance the antitumor / viral effects of vaccines. We then similarly investigated the effect of different proportions of Par-modified OVA@PM-LIPO on activating BMDCs. From the expression of CD80 and CD86 co-stimulatory molecules (… Figure 7 C) Par-modified LIPOs promoted a higher proportion of BMDC activation. We then investigated their promoting effects on MHC-I and MHC-II expression in BMDCs. Compared to untargeted LIPOs, medium-to-high proportion Par-modified LIPOs significantly enhanced MHC-I and MHC-II expression. While low proportions of Par did not promote MHC-I expression, they significantly enhanced MHC-II expression. The double-positive results for MHC-I and MHC-II indicate that Par can significantly promote the presentation and processing of exogenous antigens by DCs. Figure 7 D).
[0072] 3. Study on the enrichment of targeted liposomes in mouse lymph nodes
[0073] Next, we investigated the in vivo biodistribution of the LIPO vaccine. LIPO containing FITC-OVA was labeled with DIR and injected into the dorsal skin of mice. The transport of the LIPO vaccine in lymph nodes was then examined using a small animal in vivo fluorescence imaging system. Figure 8 As shown in Figure A, 0.5 h after injection, very obvious OVA signal and DIR-labeled LIPO numbers were observed in the inguinal lymph nodes of mice, with a high degree of overlap. Compared with non-targeted LIPO, PM-LIPO showed stronger fluorescence signal in the inguinal lymph nodes of mice, indicating better accumulation of the targeted carrier in the lymph nodes. 48 h after injection, compared with OVA@LIPO, PM-LIPO showed less OVA antigen and DIR signal at the injection site, but exhibited a stronger DIR signal in the inguinal lymph nodes, indicating that PM-LIPO can rapidly migrate and remain in the lymph nodes. Figure 8 B). In addition, by injecting DIR-labeled LIPO into the footpads of mice, we found that PM-LIPO accumulation in the LN within 120 h was significantly greater than that in the LIPO group. Figure 8EF represents the quantification of OVA and DIR signals. The results show that, compared to free OVA, the LIPO vaccine significantly prolongs the antigen retention time in lymph nodes, and PM-LIPO exhibits significant lymph node targeting. Individual lymph node images show that the fluorescence signals of LIPO and OVA are relatively consistent in the PM-LIPO group, exhibiting the strongest fluorescence signal. Figure 8 GI).
[0074] Example 3
[0075] DSPE-PEG 2000 -Par and DSPE-PEG 2000 Preparation and application of liposomes loaded with SARS-CoV-2 viral spike protein and CpG adjuvant at a Man molar modification ratio of 3:1
[0076] The prescription is as follows:
[0077]
[0078] Example 4
[0079] DSPE-PEG 2000 -Par and DSPE-PEG 2000 Preparation of liposomes loaded with SARS-CoV-2 viral spike protein and CpG adjuvant at a 1:1 molar modification ratio.
[0080] The prescription is as follows:
[0081]
[0082]
[0083] Example 5
[0084] Preparation of multilevel liposomes loaded with SARS-CoV-2 viral spike protein with high CpG-ODN loading
[0085] The prescription is as follows:
[0086]
[0087] Example 6
[0088] Preparation of multilevel targeted liposomes loaded with SARS-CoV-2 viral spike protein with low CpG-ODN loading
[0089] The prescription is as follows:
[0090]
[0091] Example 7
[0092] Preparation of multilevel targeting liposomes loaded with SARS-CoV-2 viral spike RBD protein
[0093] The prescription is as follows:
[0094]
[0095]
[0096] Example 8
[0097] Preparation of multi-level targeted liposomes loaded with Zika virus E protein
[0098] The prescription is as follows:
[0099]
[0100] Example 9
[0101] Preparation of multilevel targeted liposomes loaded with MERS virus S protein
[0102] The prescription is as follows:
[0103] sequence list <110> Zhejiang University <120> Construction and application of a multilevel targeting vector carrying viral antigens and adjuvants <160> 5 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Artificial sequence (Unknown) <400> 1 ggggtcaacg ttgagggggg 20 <210> 2 <211> 28 <212> DNA <213> Artificial sequence (Unknown) <400> 2 tccagtggggggggacgttcctgatgct 28 <210> 3 <211> 28 <212> DNA <213> Artificial sequence (Unknown) <400> 3 tccagtggggggggacgttcctgacgtt 28 <210> 4 <211> 25 <212> DNA <213> Artificial sequence (Unknown) <400> 4 tcgtcgtcgt tcgaacgacg ttgat 25 <210> 5 <211> 25 <212> DNA <213> Artificial sequence (Unknown) <400> 5 tcgtcgtcgt tcgaacgacg ttgat 25
Claims
1. The application of a multi-level targeting vector carrying viral antigens and adjuvants in the preparation of a vector for precisely delivering antiviral antigens to the endoplasmic reticulum of dendritic cells, characterized in that, The multi-level targeting vector is achieved through the following scheme. (1) Construction of phospholipid-targeting DC molecule DSPE-PEG 2000 -Man, phospholipid-targeting endoplasmic reticulum molecule DSPE-PEG 2000 -Pardaxin; (2) Construction of multi-level targeted cationic liposomes Egg yolk lecithin, cholesterol, phospholipidated mannose molecules, phospholipidated endoplasmic reticulum targeting molecules, and cationic lipids are mixed in solvents such as ethanol, acetone, acetonitrile, dichloromethane, or chloroform to form a mixed membrane material. Viral antigens and adjuvants are mixed in a buffered double-distilled aqueous solution as a hydration solution. Multi-compartment liposomes are prepared using ethanol injection, reverse evaporation, thin-film dispersion, or microfluidic technology. Single-compartment cationic liposomes are then formed by probe ultrasound or water bath ultrasound. The cationic lipids account for 0.5%-30% of the total lipid mass. DSPE-PEG 2000 -Par accounts for 0.01%-10% of the total lipid mass; DSPE-PEG 2000 -Man accounts for 0.01%-10% of the total lipid mass; by regulating DSPE-PEG 2000- Par and DSPE-PEG 2000 The molar ratio of -Man regulates the distribution of antigens in the endoplasmic reticulum and lysosomes of dendritic cells, thereby affecting antigen cross-presentation and cellular and humoral immune responses. DSPE-PEG 2000 -Par and DSPE-PEG 2000 - The molar ratio of Man is limited to the range of 1:1 to 3:1; (3) Construction of multi-level targeting vectors loaded with viral antigens and adjuvants Viral antigens are loaded via electrostatic adsorption. The buffer system, composed of different proportions of Na2HPO4 and KH2PO4, is adjusted according to the isoelectric point of the antigen protein / peptide to make it carry the opposite charge to the liposome. Part of the antigen is loaded via electrostatic adsorption, and the other part is loaded via the hydrophilic cavity of the liposome. CpG-ODNs adjuvants are loaded via the same electrostatic adsorption and hydrophilic cavity loading method.
2. The application according to claim 1, characterized in that, The viral antigens are selected from the spike protein, nucleocapsid protein, membrane protein, or envelope protein of the SARS-CoV-2 novel coronavirus for RNA viruses; and from the antigen proteins of hepatitis B virus and varicella virus for DNA viruses.
3. The application according to claim 1, characterized in that, The application is implemented in the following ways: (1) Liposomes loaded with antigens and adjuvants are precisely localized to the endoplasmic reticulum of DC cells; (2) Liposomes loaded with antigens and adjuvants mediate controllable antigen cross-presentation in DC cells; (3) Targeted liposomes achieve accumulation in lymph nodes in mice; (4) Liposomes loaded with antigens and adjuvants induce humoral and cellular immunity in mice.
Citation Information
Patent Citations
Bi-function ligand targeting dendritic cell tumor vaccine and preparation method thereof
CN104623646A
Construction of nano-carrier for regulating adaptive cell and humoral immunity and application thereof
CN113171450A