A c-myc gene copy number droplet digital PCR detection kit

Abstract

The present invention relates to a c-myc gene copy number microdroplet digital PCR detection kit, belonging to the field of biomedicine technology. The present invention provides a c-myc gene copy number microdroplet digital PCR quantitative detection method, which calculates the c-myc gene copy number based on the fluorescence values of the c-myc gene and an internal reference gene; the present invention discloses primers and probes for the above method and kit. By combining the present invention with clinical pathological information, follow-up results, treatment response, and fluorescence in situ hybridization methods, the optimal threshold value of c-myc gene copy number amplification variation is determined, which serves as a reference indicator for the prognosis of specific tumor patients, providing a convenient and reliable auxiliary diagnostic tool for clinical practice.

Description

Technical Field

[0001] The invention relates to a c-myc gene copy number microdroplet digital PCR detection kit, belonging to the technical field of biomedicine. Background Art

[0002] Droplet digital PCR technology involves microdropletizing samples before traditional PCR amplification. This involves dividing the reaction system containing nucleic acid molecules into thousands of nanoliter-sized droplets. Each droplet contains either no target nucleic acid or one or more. After PCR amplification, each droplet is individually tested. Droplets with a fluorescent signal are assigned a value of 1, while those without are assigned a value of 0. The starting copy number or concentration of the target molecule can be determined based on the Poisson distribution principle and the number and ratio of positive droplets.

[0003] At present, various molecular detection methods have gradually developed, such as traditional in situ hybridization, fluorescence in situ hybridization, Sanger sequencing, ARMS method, high-throughput detection of different molecular combinations, whole exome high-throughput detection, whole genome high-throughput detection, and droplet digital PCR detection methods. Various methods have different application scenarios and advantages and disadvantages. Droplet digital PCR has important application scenarios in research and clinical fields such as gene copy number variation, mutation detection, and gene expression due to its specimen compatibility, ease of operation, time-consuming and short-term effect, simplicity of interpretation, objectivity of thresholds, throughput plasticity, and cost acceptability.

[0004] The c-myc gene is a key member of the myc gene family. Located on human chromosome 8q24, the c-myc gene consists of three exons and two introns. The c-myc gene product is the 62-kDa phosphorylated protein P62c-myc, encoded by exons 2 and 3 of the c-myc gene. This protein, composed of 439 amino acids, is located in the cell nucleus and is a nuclear protein. Functionally, the c-myc oncogene is classified as a nuclear protein gene, capable of transforming cells and possessing the ability to bind to chromosomes and DNA, playing a role in regulating cell growth, differentiation, and malignant transformation.

[0005] In B-cell lymphoma, translocation between the c-myc gene locus and the Ig gene locus often occurs. The gene loci of IgH, IgK, and Igλ chains are at 14q32, 2P13, and 22q11, respectively. That is, the c-myc gene is translocated to the highly active transcription region of the Ig locus, thereby forming a highly transactive rearranged gene, initiating c-myc transcription, enhancing c-myc expression, promoting cell malignancy, and ultimately leading to the occurrence of tumors.

[0006] In addition to translocations, c-myc gene amplification has been found in a variety of human tumors, including myeloid leukemia, retinoblastoma, certain neuroblastomas, breast cancer, and certain lung cancers. More broadly, c-myc gene amplification has also been found in osteosarcoma, chondrosarcoma, chordoma, liposarcoma, and rhabdomyosarcoma. When amplification reaches 30-fold, double minutes (DMs) and homogeneously stained regions (HSRs) appear on the chromosomes. Furthermore, overexpression of c-myc is associated with early tumor recurrence. Recently, c-myc gene amplification has been found in more tumors, such as esophageal cancer, gastric cancer, and intestinal cancer, indicating a poor prognosis. Alternatively, c-myc may play different roles in the pathogenesis of different types of the same tumor. For example, the prognostic role of c-myc differs between intestinal cancers related to schistosomiasis and those not related to schistosomiasis. This shows that the mutation of c-myc gene in tumors is more common in the form of amplification than in the form of translocation. Therefore, the detection of c-myc gene copy number is of great significance for scientific research and clinical application. Summary of the Invention

[0007] One of the technical problems to be solved by the present invention is to provide a method for quantitative detection of c-myc gene copy number by droplet digital PCR and a detection kit thereof.

[0008] In order to achieve the purpose of solving the above problems, the technical solution adopted by the present invention is to provide a c-myc gene copy number droplet digital PCR quantitative detection method, which obtains the c-myc gene copy number through the droplet digital PCR method.

[0009] Preferably, in the method, the gene copy number of c-myc is calculated based on the fluorescence values of the c-myc gene and the internal reference gene.

[0010] Preferably, in the method, the gene copy number of c-myc is calculated based on the fluorescence values of the c-myc gene and the internal reference EFTUD2 gene.

[0011] Preferably, in the droplet digital PCR method, the DNA amplification primers used for the c-myc gene and the internal reference EFTUD2 gene are as follows: the c-myc gene-forward primer sequence is shown in SEQ ID No. 1; the c-myc gene-reverse primer is shown in SEQ ID No. 2; the EFTUD2 gene-forward primer is shown in SEQ ID No. 4; and the EFTUD2 gene-reverse primer is shown in SEQ ID No. 5.

[0012] Preferably, the probes and fluorescent labels of the c-myc gene and the internal reference EFTUD2 gene used in the droplet digital PCR method are as follows: the c-myc gene-probe sequence is shown in SEQ ID No. 3, the 5' end of the sequence is labeled with a fluorescent group FAM, and the 3' end is labeled with a quencher group BHQ; the EFTUD2 gene-probe sequence is shown in SEQ ID No. 6, the 5' end of the SEQ ID No. 6 sequence is labeled with a fluorescent group HEX, and the 3' end is labeled with a quencher group BHQ.

[0013] The present invention provides a c-myc gene copy number droplet digital PCR quantitative detection kit, which calculates the c-myc gene copy number through a droplet digital PCR method.

[0014] Preferably, the kit calculates the gene copy number of c-myc based on the fluorescence values of the c-myc gene and the internal reference gene.

[0015] Preferably, the kit includes DNA amplification primers for the c-myc gene and the internal reference EFTUD2 gene, and the primer sequences are as follows: the c-myc gene-forward primer sequence is shown in SEQ ID No. 1; the c-myc gene-reverse primer is shown in SEQ ID No. 2; the EFTUD2 gene-forward primer is shown in SEQ ID No. 4; and the EFTUD2 gene-reverse primer is shown in SEQ ID No. 5.

[0016] Preferably, the kit includes probes for the c-myc gene and the internal reference EFTUD2 gene, as well as fluorescent markers, as follows: the c-myc gene-probe sequence is shown in SEQ ID No. 3, the 5' end of the sequence is labeled with a fluorescent group FAM, and the 3' end is labeled with a quencher group BHQ; the EFTUD2 gene-probe sequence is shown in SEQ ID No. 6, the 5' end of the SEQ ID No. 6 sequence is labeled with a fluorescent group HEX, and the 3' end is labeled with a quencher group BHQ.

[0017] The present invention provides an application of a c-myc gene copy number droplet digital PCR quantitative detection kit in esophageal cancer prognosis. The c-myc gene copy number is detected by the droplet digital PCR quantitative detection kit. If the c-myc gene copy number result reaches 1.9, it indicates that the prognosis of the esophageal cancer patient is poor.

[0018] The present invention provides c-myc gene and internal reference EFTUD2 gene DNA amplification primers and probes and fluorescent labels as follows:

[0019] c-myc gene-forward primer: ACAGATCAGCAACAACCGAA, as shown in SEQ ID No. 1;

[0020] c-myc gene - reverse primer: AACTCCGGGATCTGGTCAC, as shown in SEQ ID No. 2;

[0021] c-myc gene-probe sequence: CCTCTGGCGCTCCAAGACGTT, as shown in SEQ ID No. 3, the 5' end of the sequence is labeled with a fluorescent group FAM, and the 3' end is labeled with a quencher group BHQ;

[0022] EFTUD2 gene - forward primer: TGAGAGGACACACGCAAAAC, as shown in SEQ ID No. 4;

[0023] EFTUD2 gene - reverse primer: GGTCTTGCCAGACACCAAAG, as shown in SEQ ID No. 5;

[0024] EFTUD2 gene-probe sequence: TCAAAAGCCAAAGGATGTCCTACCTG, as shown in SEQ ID No. 6, the 5' end of the sequence is labeled with a fluorescent group HEX, and the 3' end is labeled with a quenching group BHQ.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The present invention can establish a multi-platform gene detection system based on existing tissue core libraries, facilitating identification by professional pathologists and molecular pathologists. Tissue core libraries are rich in types, including normal tissues, various non-tumor and tumor tissues. The threshold deviation set by the c-myc gene amplification droplet digital PCR detection kit is small, which can ensure its application in specific clinical scenarios. The tested lesion tissue contains clinical pathology and prognostic information, ensuring the prognostic and predictive value of the c-myc gene amplification droplet digital PCR detection kit in lesions.

[0027] The beneficial effects of the present invention include: 1. The present invention is not limited by the specimen type and is applicable to tissue, cell, and liquid specimens; 2. It is simple to operate and can run automatically after being put on the machine; 3. The operating cycle is short, and results can be obtained in 2 hours; 4. The result display is intuitive and simple, and no long-term training is required; 5. The specific copy number of the c-myc gene can be obtained; 6. Quality control can be achieved in each tube; 7. An objective threshold value can be obtained by combining clinical information; 8. The throughput is flexible and can be started from 1 to 96 cases; 9. It is low cost, highly accepted, and has a wide range of promotion. The results obtained by the present invention can be used as a reference indicator for the prognosis of specific tumor patients, providing a convenient and reliable auxiliary diagnostic tool for clinical practice. DETAILED DESCRIPTION

[0028] In order to make the present invention more clearly understood, preferred embodiments are described in detail as follows:

[0029] The technical solution adopted by the present invention is to provide a method for quantitative detection of the copy number of the c-myc gene by droplet digital PCR, and the gene copy number of c-myc is obtained by the droplet digital PCR method. In the above method, the gene copy number of c-myc can be calculated based on the fluorescence value of the c-myc gene and the internal reference gene. More specifically, the gene copy number of c-myc is calculated based on the fluorescence value of the c-myc gene and the internal reference EFTUD2 gene. In the above droplet digital PCR method, the DNA amplification primers used for the c-myc gene and the internal reference EFTUD2 gene are as follows: the c-myc gene-forward primer sequence is shown in SEQ ID No.1; the c-myc gene-reverse primer is shown in SEQ ID No.2; the EFTUD2 gene-forward primer is shown in SEQ ID No.4; and the EFTUD2 gene-reverse primer is shown in SEQ ID No.5. The probes and fluorescent labels of the c-myc gene and internal reference EFTUD2 gene used are as follows: the c-myc gene-probe sequence is shown in SEQ ID No. 3, the 5' end of the sequence is labeled with the fluorescent group FAM, and the 3' end is labeled with the quencher group BHQ; the EFTUD2 gene-probe sequence is shown in SEQ ID No. 6, the 5' end of the sequence of SEQ ID No. 6 is labeled with the fluorescent group HEX, and the 3' end is labeled with the quencher group BHQ.

[0030] The present invention provides a c-myc gene copy number microdroplet digital PCR quantitative detection kit, which calculates the c-myc gene copy number through the microdroplet digital PCR method. The c-myc gene copy number is calculated based on the fluorescence values of the c-myc gene and an internal reference gene. The kit includes DNA amplification primers for the c-myc gene and the internal reference EFTUD2 gene, and the primer sequences are as follows: the c-myc gene-forward primer sequence is shown in SEQ ID No. 1; the c-myc gene-reverse primer is shown in SEQ ID No. 2; the EFTUD2 gene-forward primer is shown in SEQ ID No. 4; and the EFTUD2 gene-reverse primer is shown in SEQ ID No. 5. The kit includes probes for the c-myc gene and the internal reference EFTUD2 gene, as well as fluorescent markers, as follows: the c-myc gene-probe sequence is shown in SEQ ID No. 3, with the 5' end of the sequence labeled with the fluorescent group FAM and the 3' end labeled with the quencher group BHQ; the EFTUD2 gene-probe sequence is shown in SEQ ID No. 6, with the 5' end of the sequence labeled with the fluorescent group HEX and the 3' end labeled with the quencher group BHQ.

[0031] The present invention provides an application of a method for quantitatively detecting the copy number of a c-myc gene by droplet digital PCR.

[0032] The present invention provides an application of a c-myc gene copy number microdroplet digital PCR quantitative detection kit.

[0033] The present invention provides an application of a c-myc gene copy number droplet digital PCR quantitative detection kit in esophageal cancer prognosis. The c-myc gene copy number is detected by the droplet digital PCR quantitative detection kit. If the c-myc gene copy number result reaches 1.9, it indicates that the prognosis of the esophageal cancer patient is poor.

[0034] The present invention provides c-myc gene and internal reference EFTUD2 gene DNA amplification primers and probes and fluorescent labels as follows:

[0035] c-myc gene-forward primer: ACAGATCAGCAACAACCGAA, as shown in SEQ ID No. 1;

[0036] c-myc gene - reverse primer: AACTCCGGGATCTGGTCAC, as shown in SEQ ID No. 2;

[0037] c-myc gene-probe sequence: CCTCTGGCGCTCCAAGACGTT, as shown in SEQ ID No. 3, the 5' end of the sequence is labeled with a fluorescent group FAM, and the 3' end is labeled with a quencher group BHQ;

[0038] EFTUD2 gene - forward primer: TGAGAGGACACACGCAAAAC, as shown in SEQ ID No. 4;

[0039] EFTUD2 gene - reverse primer: GGTCTTGCCAGACACCAAAG, as shown in SEQ ID No. 5;

[0040] EFTUD2 gene-probe sequence: TCAAAAGCCAAAGGATGTCCTACCTG, as shown in SEQ ID No. 6, the 5' end of the sequence is labeled with a fluorescent group HEX, and the 3' end is labeled with a quenching group BHQ.

[0041] The method for using the kit provided in the present invention and the basis for calculating the threshold value are:

[0042] Based on clinical practice and scientific research, the present invention discovered the clinical application value of c-myc gene amplification and established a method for constructing a c-myc gene copy number droplet digital PCR detection kit. By comparing with the FISH test results, the threshold of c-myc gene amplification was determined. The kit can specifically detect the copy number of the c-myc gene in different diseases and different sample types, assist in determining the amplification status of the c-myc gene, and achieve the functions of assisting in determining the molecular typing, prognosis and prediction of the lesions.

[0043] The formula and composition of the kit include: DNA extraction kit, droplet generation oil, pipeline cleaning oil, primers and probes of c-myc gene, primers and probes of reference EFTUD2 gene, and ddPCR Mix.

[0044] Methodological optimization includes: comparison of extraction efficiency of DNA extraction kits; screening of multiple sets of primers and probes for the c-myc gene; screening of multiple reference gene primers and probes; exploration of the optimal loading amount; calculation of the threshold for c-myc gene copy number amplification in different tumors by comparing with fluorescence in situ hybridization experiments and combining follow-up results; and evaluation of relevant clinical significance by combining clinical information.

[0045] Comparison of DNA extraction kit extraction efficiency:

[0046] Twenty FFPE samples were extracted using both the Genolution automated nucleic acid extraction kit and the Aide manual DNA extraction kit. Five 8-μm paraffin sections were cut from each sample. After extraction, the concentration and purity of the extracted samples were measured using the NanoDrop One nucleic acid quantification instrument. The results showed that the extraction efficiency of the two extraction kits was similar.

[0047]

[0048] Multiple sets of primer probes were designed in different regions of the three exons of the c-myc gene and tested and evaluated together with the internal reference gene.

[0049] Based on abundant clinical samples, the internal reference gene EFTUD2 was screened out from 5 internal reference genes (EFTUD2, RPP30, GAPDH, HPRT1, TBP), which can maintain a stable copy number in both positive and negative states of c-myc gene amplification.

[0050] Using samples with positive and negative c-myc gene amplification, different primer and probe combinations were tested and analyzed to identify a reaction system with a small deviation in the c-myc / EFTUD2 copy number ratio and good differentiation between different quadrant droplets. The primers and probes for c-myc gene and internal reference EFTUD2 gene DNA amplification, as well as the fluorescent markers, were obtained as follows:

[0051] c-myc gene-forward primer: ACAGATCAGCAACAACCGAA

[0052] c-myc gene - reverse primer: AACTCCGGGATCTGGTCAC

[0053] c-myc gene-probe sequence: CCTCTGGCGCTCCAAGACGTT, the 5' end of the sequence is labeled with the fluorescent group FAM, and the 3' end is labeled with the quencher group BHQ.

[0054] EFTUD2 gene - forward primer: TGAGAGGACACACGCAAAAC

[0055] EFTUD2 gene - reverse primer: GGTCTTGCCAGACACCAAAG

[0056] EFTUD2 gene-probe sequence: TCAAAAGCCAAAGGATGTCCTACCTG, the 5' end of the sequence is labeled with a fluorescent group HEX, and the 3' end is labeled with a quencher group BHQ.

[0057] Exploration of the optimal loading amount

[0058] A probe-based quantitative reaction system was prepared, and different sample loads were analyzed using samples with positive and negative c-myc gene amplification to identify a reaction system with good discrimination between different quadrant droplets. The sample loads of c-myc gene amplification primers, internal reference EFTUD2 gene amplification primers, genomic DNA template (diluted to 10 ng / μL), ddPCRMix, and double-distilled water were obtained as follows:

[0059]

[0060] Esophageal cancer specimens with c-myc gene fluorescence in situ hybridization results were screened from a tissue core library. Sixty-three specimens that were positive for c-myc and 152 specimens that were negative for c-myc fluorescence in situ hybridization were selected. The corresponding tissue blocks were retrieved, sectioned, deparaffinized, and DNA extracted and concentration determined. The reaction system was prepared, droplets were generated, and droplet digital PCR reactions were performed. The results were then read. The positive judgment value and negative / negative concordance of the c-myc gene droplet PCR kit were evaluated. Using the receiver operating characteristic (ROC) curve method, the positive and negative judgment values of the kit were 1.9 and 1.2, respectively. The positive concordance rate was 96.9%, the negative concordance rate was 84.5%, and the overall concordance rate was 89.3%. The Kappa value was 0.79 ≥ 0.75, indicating good overall concordance and satisfactory specificity.

[0061] Combined with prognostic information, the c-myc value detected by droplet PCR reached 1.9, indicating a poor prognosis for esophageal cancer and has potential clinical value.

[0062] In clinical practice, fluorescence in situ hybridization (FISH) is commonly used to detect translocations and amplifications of the c-myc gene. However, this technique is limited to tissue sections or cell smears and is not suitable for liquid specimens. Furthermore, accurate counts may be inaccurate when the signal exhibits a clustered amplification pattern. High-throughput sequencing requires complex equipment and data algorithms, placing high demands on sample quality. Droplet digital PCR, on the other hand, offers advantages in detecting gene copy number: 1. It is not restricted by specimen type and is applicable to tissue, cell, and liquid specimens; 2. It is simple to operate and can run automatically upon installation; 3. It has a short run time, with results available in 2 hours; 4. The result display is intuitive and simple, requiring no extensive training; 5. It can determine the specific copy number of the c-myc gene; 6. It allows for quality control across all samples; 7. It can be combined with clinical information to determine objective thresholds; 8. It has flexible throughput, allowing for operation from 1 to 96 samples; 9. It is low-cost, highly accepted, and widely applicable.

[0063] The present invention is based on the rich pathological specimen resources of the pathology department. First, a tissue core library is established, which has rich disease resources and follow-up information. Secondly, a complete set of droplet digital PCR methodology systems is established from primer and probe design, development, screening, and verification. Finally, clinical pathological information, follow-up results, treatment response, and fluorescence in situ hybridization methods are combined to determine the optimal threshold of c-myc gene copy number amplification variation, as well as the potential prognostic factor and optimal threshold for specific tumors. Therefore, the present invention is not only embodied in the design, development, and verification of the c-myc gene copy number droplet digital PCR kit, but also in the use of statistical analysis methods to determine the threshold of c-myc gene amplification and verify the significance of specific clinical application scenarios of c-myc gene amplification.

[0064] Example

[0065] Droplet digital PCR detection of c-myc gene in colorectal cancer tissue;

[0066] 1. Case Preparation: Eight cases of colorectal cancer tissue were selected, and 4 cases were analyzed for c-myc gene amplification and 4 cases were analyzed for c-myc gene amplification. The sections were deparaffinized and then immersed in water. The tissue was scraped into an EP tube and 500 μl of lysis buffer and 20 μl of proteinase K were added.

[0067] 2. DNA preparation: Use an automatic DNA extractor to extract DNA. After purification and elution, obtain 150 μL of DNA and measure the DNA concentration.

[0068] 3. Prepare PCR reaction solution: Vortex the c-myc probe premix and centrifuge to remove bubbles.

[0069] 4. Prepare droplets: Mount an 8-well droplet generation plate on a stand. Add 20 μl of sample reaction system to each of the eight wells in the middle row of the droplet generation plate. Add 70 μl of droplet generation oil to each of the eight wells in the bottom row of the droplet generation plate.

[0070] 5. Droplet Generation: Cover the plate with a rubber pad, place it firmly in the droplet generator, and begin droplet generation. Once complete, droplets will be generated in the top row of wells on the plate.

[0071] 6. Perform PCR amplification: Using a pipette, transfer approximately 40 μl of each sample's droplet from the droplet generation plate to a 96-well PCR plate, with eight samples occupying eight wells. Seal the plate with a film sealer, transfer to a PCR instrument, select parameters, and start the run.

[0072] 7. Read and analyze the results: After the PCR is complete, assemble the 96-well plate in the base, cover the top bracket, and place it steadily in the droplet reader. The droplet reader will sequentially aspirate the droplets from each well, allow the droplets to flow through the detector for fluorescence detection, and record the relative fluorescence value of each droplet.

[0073] 8. Data Analysis: The program automatically calculates the template concentration (copies / μl) in the system. Based on the fluorescence values of the c-myc gene FAM and the internal reference EFTUD2 gene HEX, the copy number and ratio of the c-myc gene to the EFTUD2 internal reference gene are calculated to obtain the c-myc gene copy number.

[0074] The copy number results of c-myc gene detected by droplet digital PCR in 8 cases of colorectal cancer were 1.0, 1.1, 1.1, 1.2, 1.6, 1.7, 3.3, and 4.5, respectively.

[0075] Following the above steps, the kit successfully detected the copy number of c-myc gene in colorectal cancer tissue.

[0076] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form or substance. It should be pointed out that ordinary technicians in this technical field can make several improvements and supplements without departing from the present invention, and these improvements and supplements should also be regarded as the scope of protection of the present invention. Any equivalent changes, modifications and evolutions made by technicians familiar with this profession without departing from the spirit and scope of the present invention by using the technical content disclosed above are all equivalent embodiments of the present invention; at the same time, any equivalent changes, modifications and evolutions made to the above embodiments based on the essential technology of the present invention are still within the scope of the technical solution of the present invention.

[0077]

[0078] Sequence Listing <120> A c-myc gene copy number droplet digital PCR detection kit <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <400> 1 acagatcagc aacaaccgaa 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <400> 2 aactccggga tctggtcac 19 <210> 3 <211> twenty one <212> DNA <213> Artificial Sequence <400> 3 cctctggcgc tccaagacgt t 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 tgagaggaca cacgcaaaac 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 ggtcttgcca gacaccaaag 20 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <400> 6 tcaaaagcca aaggatgtcc tacctg 26

Claims

1. A method for detecting c-myc gene copy number by droplet digital PCR for non-diagnostic purposes, characterized in that: The gene copy number of c-myc was obtained by droplet digital PCR method; In the method, the gene copy number of c-myc is calculated based on the fluorescence values of the c-myc gene and the internal reference EFTUD2 gene; In the droplet digital PCR method, the DNA amplification primers used for the c-myc gene and the internal reference EFTUD2 gene are as follows: the c-myc gene-forward primer sequence is shown in SEQ ID No. 1; the c-myc gene-reverse primer is shown in SEQ ID No. 2; the EFTUD2 gene-forward primer is shown in SEQ ID No. 4; and the EFTUD2 gene-reverse primer is shown in SEQ ID No.

5. The probes and fluorescent labels for the c-myc gene and the internal reference EFTUD2 gene used in the droplet digital PCR method are as follows: the c-myc gene-probe sequence is shown in SEQ ID No. 3, with the 5' end of the sequence labeled with the fluorescent group FAM and the 3' end labeled with the quencher group BHQ; the EFTUD2 gene-probe sequence is shown in SEQ ID No. 6, with the 5' end of the sequence labeled with the fluorescent group HEX and the 3' end labeled with the quencher group BHQ.

2. A c-myc gene copy number quantitative detection kit by droplet digital PCR, characterized in that: The kit calculates the gene copy number of c-myc by using the droplet digital PCR method; The kit calculates the gene copy number of c-myc based on the fluorescence values of the c-myc gene and the internal reference EFTUD2 gene; The kit includes DNA amplification primers for the c-myc gene and the internal reference EFTUD2 gene, and the primer sequences are as follows: the c-myc gene-forward primer sequence is shown in SEQ ID No. 1; the c-myc gene-reverse primer is shown in SEQ ID No. 2; the EFTUD2 gene-forward primer is shown in SEQ ID No. 4; and the EFTUD2 gene-reverse primer is shown in SEQ ID No.

5. The kit includes probes for the c-myc gene and the internal reference EFTUD2 gene, as well as fluorescent markers, as follows: the c-myc gene-probe sequence is shown in SEQ ID No. 3, with the 5' end of the sequence labeled with the fluorescent group FAM and the 3' end labeled with the quencher group BHQ; the EFTUD2 gene-probe sequence is shown in SEQ ID No. 6, with the 5' end of the sequence labeled with the fluorescent group HEX and the 3' end labeled with the quencher group BHQ.

3. Use of a c-myc gene copy number droplet digital PCR quantitative detection kit according to claim 2 in the preparation of an esophageal cancer prognosis product, characterized in that: The c-myc gene copy number was detected by the droplet digital PCR quantitative detection kit. The result of the c-myc gene copy number showed that the c-myc value reached 1.9, indicating that the prognosis of esophageal cancer patients was poor.

Images