A method for detecting foodborne pathogens based on enzyme-free cascade signal amplification

Abstract

The present invention discloses a method for detecting foodborne pathogens based on enzyme-free cascade signal amplification. Specifically, probe 1 (Probe1) and DNA probe 2 (Probe2) and a trigger chain (tDNA) complementary to the target bacterial DNA are modified on magnetic beads and polystyrene microspheres, and the target bacterial DNA is molecularly hybridized with the DNA probe on the carrier according to the principle of base complementary pairing. Subsequently, magnetic beads or PS microspheres modified with hairpin 1 (H1) and hairpin 2 (H2) are introduced into the system. Under the triggering of tDNA, the hairpins can efficiently bind, resulting in a significant change in the state of the magnetic bead or microsphere carrier, so that the biosensor based on the magnetic / electric principle can respond sensitively. The present invention adopts a non-enzyme-assisted signal amplification method, which is low in cost and stable, and overcomes the problem that the microspheres or magnetic beads modified with antibodies in the immune reaction cause self-aggregation due to the inherent electrostatic interaction between antibodies, resulting in false positive results.

Description

Technical Field

[0001] The invention belongs to the field of biochemical detection, and in particular relates to a method for detecting foodborne pathogenic bacteria based on non-enzyme cascade signal amplification. Background Art

[0002] Foodborne pathogens are an important source of food safety problems. Common foodborne pathogens include Staphylococcus aureus, Vibrio parahaemolyticus, Listeria monocytogenes, Cronobacter sakazakii, Salmonella typhimurium, Escherichia coli O157:H7, etc. They mainly infect humans by contaminating animal food, causing bacterial food poisoning, enteric fever, sepsis, etc., and even leading to death. Therefore, it is crucial to construct a series of detection methods for bacteria or their DNA.

[0003] The traditional method of microbial testing is the culture and separation method, which relies on culture media for culture, separation and biochemical identification. The testing of pathogenic bacteria is generally time-consuming, including a series of cumbersome testing procedures such as pre-enrichment, selective enrichment, microscopic examination and serological verification, and it often takes 5 to 7 days to obtain the results. The molecular biological detection technology using polymerase chain reaction (PCR) (such as real-time fluorescence quantitative qPCR) is mainly based on the three steps of denaturation, annealing and extension. Compared with traditional methods, it greatly shortens the detection time. Generally, the results can be obtained in 5-24 hours, and it has high sensitivity. However, this technology still has problems such as expensive equipment, the need to use heat-resistant nucleases, strict operating conditions and easy to produce false positives, which cannot meet the needs of rapid on-site detection.

[0004] Biosensors constructed based on electrical and magnetic principles not only have the advantages of simple operation, high signal-to-noise ratio, good stability, and sensitivity, but also have the characteristics of miniaturization, portability, and low cost, providing new ideas for on-site rapid detection of foodborne pathogens. The microporous particle counting method uses the blocking effect of insulating microspheres on microchannels. Through the signal processing inside the instrument, the response relationship between the target and the number / state of particles can be constructed. The magnetic relaxation biosensor uses the effect of magnetic particles (MNP) on the transverse relaxation time (T2) of water molecules to construct the response relationship between the target and T2. Based on the above principles, polystyrene (PS) microspheres or MNPs are used as carriers to modify them with various biorecognition molecules. The reaction between the target and the biorecognition molecules causes the change of the state of the PS microspheres or MNPs (from dispersion to aggregation), and the quantitative analysis of the target can be achieved. The traditional method modifies antibodies on the carrier, and the detection of foodborne pathogens can be achieved through immune response. However, due to the large molecular weight of antibodies, clusters can be formed under the triggering of intermolecular interactions (such as electrostatic and hydrophobic interactions). Even if there is no target, it will cause mutual aggregation between carriers, resulting in false positive detection results. Compared with antibodies, nucleic acid chains have a smaller molecular weight and are not easy to agglomerate, so they can solve the problem of self-aggregation between carriers. In addition, since the synthesis cost of nucleic acid chains is much lower than that of antibodies, molecular hybridization biosensors constructed based on them are more economical. However, due to the limited degree of aggregation of PS microspheres or MNPs caused by single target bacterial DNA, simple molecular hybridization methods are still difficult to distinguish signal differences when continuously detecting targets within a low concentration range. The content of pathogenic bacteria in food is often low. In order to achieve high-sensitivity detection, it is urgent to develop different signal amplification methods.

[0005] Existing signal amplification methods mainly focus on amplifying the target bacterial DNA, including enzyme-assisted nucleic acid amplification and enzyme-free isothermal nucleic acid amplification. The reaction conditions of enzyme-assisted nucleic acid amplification are often more complicated, and some methods require precise thermal cycling equipment such as PCR instruments. In addition, due to the high production cost of enzymes and the fact that their stability is greatly affected by environmental factors, this not only increases the detection cost, but also reduces the reproducibility of the detection method. Therefore, it is very necessary to construct a simple enzyme-free signal amplification method. Summary of the invention

[0006] In order to solve the above problems, the present invention provides a method for detecting foodborne pathogens based on enzyme-free cascade signal amplification.

[0007] The present invention introduces a catalytic hairpin self-assembly (CHA) strategy when using the molecular hybridization principle to detect foodborne pathogens. Taking the microporous particle counting method as an example, the simple molecular hybridization method only requires that the DNA probe 1 (Probe1) and probe 2 (Probe2) for pathogenic bacteria be modified onto PS microspheres respectively. When pathogenic bacterial DNA is present, a PS-Probe1-pathogenic bacterial DNA-Probe2-PS complex is formed through molecular hybridization reaction, and the solution is measured. On the basis of the above, the present invention modifies Probe1 onto 1000nm magnetic particles (MNP 1000 -Probe1), a triggering strand DNA (tDNA) was introduced on PS-Probe2, and a MNP-Probe1-pathogenic bacteria DNA-Probe2-PS-tDNA complex with a large amount of tDNA was obtained by magnetic separation. In addition, PS microspheres (PS-H1 and PS-H2) modified with different hairpin DNAs were prepared. Due to the triggering of tDNA on hairpin DNA, after introducing PS microspheres (PS-H1 and PS-H2) modified with different hairpins into the complex, a large amount of aggregation between PS microspheres can be triggered. This process converts the amount of target bacterial DNA into the amount of tDNA, and the aggregation of a large number of PS microspheres caused by tDNA causes a significant change in the potential of the particle counter, so that it can respond sensitively. Similarly, the CHA cascade amplification strategy is also suitable for constructing magnetic relaxation molecular hybridization biosensors. Specifically, Probe1 is modified onto a magnetic particle with a diameter of 1000nm (MNP 1000 -Probe1), Probe2 and tDNA were modified onto 30nm magnetic particles (tDNA-MNP 30 -Probe2), due to MNP 30 With MNP 1000 The saturation magnetization of MNP is different. 1000 MNPs can be separated magnetically in a very short time. 30 No, so MNPs can only be formed through molecular hybridization reactions 1000 -Probe1-pathogenic bacteria DNA-Probe2-MNP 30 -tDNA complex. After the reaction is completed, magnetic separation is performed and MNP is added to the complex 30 -H1 and MNP 30 -H2, can also induce a large number of MNPs under the triggering of tDNA 30 Aggregation of MNPs 30The state change can significantly affect the T2 value of water molecules, so the constructed magnetic relaxation biosensor can also respond sensitively to pathogenic bacteria. Thanks to the large specific surface area of ​​PS microspheres and MNPs, a large number of tDNA and hairpin sequences can be modified on their surfaces, so the presence of a single target bacterial DNA can also trigger the effect of cascade amplification. Therefore, the molecular hybridization method using the CHA amplification strategy can greatly broaden the linear range of the above-mentioned electrical and magnetic sensors, improve the sensitivity of the method, and has broad application prospects in the field of foodborne pathogen detection.

[0008] A molecular hybridization method for detecting foodborne pathogens based on enzyme-free cascade signal amplification that causes significant changes in the state of microspheres / magnetic beads. The principle is to modify DNA probe 1 (Probe1) and probe 2 (Probe2) and the initiator chain (tDNA) that are complementary to the target bacterial DNA on different carriers (such as MNP and PS microspheres), and through the principle of base complementary pairing, the target bacterial DNA is molecularly hybridized with the DNA probes on the carriers, and a sandwich complex is obtained by magnetic separation. Subsequently, different carriers (such as PS-H1, PS-H2 or MNP) that are modified with hairpin 1 (H1) and hairpin 2 (H2) are introduced into the system. 30 -H1, MNP 30 -H2), under the trigger of tDNA, the ring structure on H1 is opened and partially base-paired with tDNA, while the remaining unpaired fragment on H1 can open the ring structure on H2. Finally, due to the relative dominance of base complementarity between H1 and H2, the complex with tDNA is separated from the hybrid chain and continues to trigger the unhybridized PS-H1, PS-H2 or MNP. 30 -H1, MNP 30 -H2, until the free hairpin is completely consumed and the reaction is terminated. In the process of catalytic hairpin self-assembly, the sandwich complex with tDNA can be recycled to achieve PS microspheres or MNPs in a short time. 30 The above cascade reaction makes it possible for even a single target bacterial DNA to cause PS microspheres or MNPs to aggregate efficiently. 30 The significant change in state, based on which the electrical and magnetic biosensors constructed can achieve sensitive detection of low-concentration pathogens. This method has the advantages of simple operation, no need for enzymes and antibodies, good stability, high sensitivity, small sample requirements and low cost.

[0009] The technical solution of the present invention is as follows:

[0010] A molecular hybridization method based on cascade signal amplification for detecting foodborne pathogens, the detection method comprising the following steps:

[0011] 1) Preparation of Probe1 modified magnetic beads MNP-Probe1;

[0012] 2) Preparation of Probe2 and tDNA modified MNPs (t DNA-MNP-Probe2) or PS microspheres (t DNA-PS-Probe2);

[0013] 3) Preparation of H1 and H2 modified MNPs (MNP-H1 and MNP-H2) or PS microspheres (PS-H1 and PS-H2);

[0014] 4) Detection of target bacterial DNA.

[0015] Preferably, the sequence of the DNA chain is:

[0016] Probe1 has the nucleotide sequence shown in SEQ ID NO.1;

[0017] Probe2 has the nucleotide sequence shown in SEQ ID NO.2;

[0018] The tDNA has the nucleotide sequence shown in SEQ ID NO.3;

[0019] H1 has the nucleotide sequence shown in SEQ ID NO.4;

[0020] H2 has the nucleotide sequence shown in SEQ ID NO.5.

[0021] Preferably, the preparation process of MNP-Probe1 in step (1) is:

[0022] (1-1) Place the magnetic beads in a centrifuge tube, wash them 2-3 times with MEST buffer solution (4-morpholineethanesulfonic acid solution containing 0.5% Tween 20), perform magnetic separation and discard the supernatant to obtain washed magnetic beads;

[0023] (1-2) taking a solution of EDC (1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide) and NHS (active ester of N-hydroxysulfosuccinimide) with a mass concentration of (1-2): 1 in a test tube and adjusting the volume with a MES (4-morpholineethanesulfonic acid) solution, wherein the EDC (1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide) and NHS (active ester of N-hydroxysulfosuccinimide) solution accounts for 1-5% of the final solution volume, adding the magnetic beads washed in step (1), placing the beads at room temperature for activation for 15-30 minutes to obtain aminated magnetic beads, and finally performing magnetic separation and discarding the supernatant;

[0024] (1-3) Probe1 was added to the amino-modified magnetic beads and diluted 5-10 times with Tris-EDTA buffer, wherein the mass ratio of Probe1 to the amino-modified magnetic beads was 1:(100-200), and then allowed to react at room temperature for 1.5-2 h to obtain MNP-Probe1; the obtained MNP-Probe1 was washed 3-5 times with TT buffer (Tris-HCl solution containing 0.5% Tween-20), and the MNP-Probe1 was resuspended with TE buffer (Tris-HCl solution containing 1% EDTA), and stored at 4°C for later use.

[0025] Further preferably, the preparation process of MNP-Probe1 in step (1) is as follows: 1 mg of magnetic beads (MNP 1000 ) in a centrifuge tube and washed twice with MEST buffer solution; take 50 μL EDC (10 mg / mL) and 25 μL NHS (10 mg / mL) solution in a test tube and adjust the volume to 900 μL with MES solution, then place it at room temperature for activation for 20 minutes and wash it twice to obtain amino-modified magnetic beads. Add 5 μg of probe1 to the test tube of amino-modified magnetic beads and adjust the solution volume to 500 μL with Tris-EDTA buffer, then place it at room temperature for reaction for 2 hours. Use 1 mL TT buffer to mix the obtained MNPs 1000 -Probe1 was washed three times, each time for 30 min; finally, MNPs were washed with TE buffer 1000 -Probe1 was resuspended and stored at 4°C for further use.

[0026] Preferably, in step (2), the preparation process of tDNA-PS-Probe2 / tDNA-MNP-Probe2 is:

[0027] (2-1) Put PS microspheres or MNPs into a test tube and wash them 2-3 times with MEST buffer (4-morpholineethanesulfonic acid solution containing 0.5% Tween 20), and then centrifuge to remove the supernatant;

[0028] (2-2) Adding EDC (1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide) and NHS (N-hydroxysulfosuccinimide active ester) solutions in a mass concentration ratio of (1-2):1 to a test tube containing PS microspheres or MNPs, and adjusting the volume with MES (4-morpholineethanesulfonic acid) solution, the EDC (1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide) and NHS (N-hydroxysulfosuccinimide active ester) solutions accounting for 1-5% of the final solution volume, and then leaving it at room temperature for activation for 15-30 minutes to obtain amino-modified PS microspheres or MNPs;

[0029] (2-3) Probe2 and tDNA are added to a test tube containing amino-modified PS microspheres or MNPs, with the mass ratio of Probe2 and tDNA to amino-modified PS microspheres being 1:(100-200), and diluted 5-10 times with TE buffer (Tris-HCl solution containing 1% EDTA), followed by reaction at room temperature for 1.5-2 hours; the obtained tDNA-PS-Probe2 or tDNA-MNP-Probe2 is washed 3-5 times with TT buffer (Tris-HCl solution containing 0.5% Tween-20); the tDNA-PS-Probe2 or tDNA-MNP-Probe2 is resuspended with TE buffer (Tris-HCl solution containing 1% EDTA), and stored at 4°C for later use.

[0030] Further preferably, in step (2), the preparation process of tDNA-PS-Probe2 / tDNA-MNP-Probe2 is as follows: 1 mg of PS microspheres with a diameter of 3 μm or MNPs with a diameter of 30 nm (MNP 30 ) in a test tube and washed twice with MEST buffer. Take 50 μL of EDC (10 mg / mL) and 25 μL of NHS (10 mg / mL) solution in a test tube and adjust the volume to 900 μL with MES solution, then place it at room temperature for activation for 20 min and wash it twice; take 9 μg Probe2 and 7 μg tDNA in a centrifuge tube and adjust the solution volume to 500 μL with TE buffer, then place it at room temperature for reaction for 2 h. Use 1 mL of TT buffer to obtain tDNA-PS-Probe2 / tDNA-MNP 30 -Probe2 was washed three times, each time for 30 min; finally, tDNA-PS-Probe2 / tDNA-MNP was washed with TE buffer 30 -Probe2 was resuspended and stored at 4°C for further use.

[0031] Preferably, in step (3), the preparation process of PS-H1, PS-H2 or MNP-H1, MNP-H2 is:

[0032] (3-1) H1 and H2 were denatured at 95°C before use and then kept at room temperature for 1 h to allow the hairpin structure to form;

[0033] (3-2) Put the PS microspheres or MNPs into a test tube and wash them with MEST buffer (4-morpholineethanesulfonic acid containing 0.5% Tween-20), then centrifuge and discard the supernatant;

[0034] (3-3) Adding EDC (1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide) and NHS (N-hydroxysulfosuccinimide active ester) solutions at a mass concentration ratio of (1-2):1 to a test tube containing PS microspheres or MNPs, and adjusting the volume with MES (4-morpholineethanesulfonic acid) solution, the EDC (1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide) and NHS (N-hydroxysulfosuccinimide active ester) solutions accounting for 1-5% of the final solution volume, and then leaving it at room temperature for activation for 15-30 min to obtain amino-modified PS microspheres or MNPs;

[0035] (3-4) The aminated PS microspheres or MNPs are centrifuged or magnetically separated, the supernatant is removed, H1 or H2 is added thereto, and the mixture is diluted 5-10 times with TE buffer and then allowed to react at room temperature for 1.5-2 h.

[0036] (3-5) Wash the obtained PS-H1, PS-H2 or MNP-H1, MNP-H2 3-5 times with TT buffer (Tris-HCl solution containing 0.5% Tween-20); finally, resuspend PS-H1, PS-H2 or MNP-H1, MNP-H2 with TE buffer (Tris-HCl solution containing 1% EDTA) and store at 4°C for future use.

[0037] Further preferably, in step (3), the preparation process of PS-H1, PS-H2 or MNP-H1, MNP-H2 is as follows: H1 and H2 are denatured at 95°C for 5 min before use, and then kept at room temperature for 1 h to form a hairpin structure; 1 mg of PS microspheres with a diameter of 3 μm or MNPs with a diameter of 30 nm (MNP 30 ) in a test tube and washed twice with MEST buffer; 50 μL of EDC (10 mg / mL) and 25 μL of NHS (10 mg / mL) solution were taken in a test tube and the volume was adjusted to 900 μL with MES solution, then activated at room temperature for 20 min and washed twice; after removing the supernatant, 5 μg of H1 or H2 was added to the centrifuge tube, and the solution volume was adjusted to 500 μL with TE buffer, and then reacted at room temperature for 2 h; the obtained PS-H1, PS-H2 or MNP was prepared with 1 mL of TT buffer. 30 -H1, MNP 30 -H2 was washed three times, each time for 30 min; finally, PS-H1, PS-H2 or MNP were washed with TE buffer 30 -H1, MNP 30 -H2 was resuspended and stored at 4°C for further use.

[0038] Preferably, the detection process of the target bacterial DNA in step (4) is:

[0039] (4-1) Place MNP-Probe1, tDNA-PS-Probe2 or tDNA-MNP-Probe2, target bacterial DNA extract, 10× sodium citrate (SSC) solution and sterile water in a centrifuge tube, react in a 95°C water bath for 5-15 min, cool in an ice bath for 5-10 min, and then transfer to a hybridizer for reaction for 45-90 min to obtain a mixture;

[0040] (4-2) The above mixture is subjected to magnetic separation to remove excess tDNA-PS-Probe2 or tDNA-MNP 30 -Probe2, to obtain MNP-Probe1-target DNA-Probe2-PS-tDNA complex or MNP-Probe1-target DNA-Probe2-MNP 30 -tDNA complex.

[0041] (4-3) Adding a polynucleotide containing MNP-Probe1-target DNA-Probe2-PS-tDNA complex or MNP-Probe1-target DNA-Probe2-MNP 30 -tDNA complex system, adding equal masses of PS-H1 / PS-H2 or MNP-H1 / MNP-H2, the mass ratio of PS-H1 / PS-H2 or MNP-H1 / MNP-H2 to MNP-Probe1 in (4-1) is (150-200):1, reacting for 30-60 minutes, performing magnetic separation, and collecting the supernatant;

[0042] (4-4) The supernatant is detected by a particle counter or a low-field nuclear magnetic resonance instrument; at the same time, the target bacterial DNA is detected using a hybridization reaction without catalytic hairpin assembly signal amplification.

[0043] Further preferably, the detection process of the target bacterial DNA in step (4) is as follows: take 120 μL MNP 1000 -Probe1, 120μL tDNA-PS-Probe2 or tDNA-MNP 30 -Probe2, 60 μL target bacterial DNA extract, 50 μL 10× sodium citrate (SSC) solution and 150 μL sterile water were placed in a centrifuge tube, reacted in a 95°C water bath for 10 min, then transferred to an ice bath for 10 min, and then moved to a 53°C hybridization instrument for 1 h; the above mixture was magnetically separated to remove excess tDNA-PS-Probe2 or tDNA-MNP 30 -Probe2; add equal concentrations of PS-H1, PS-H2 or MNP to the system 30 -H1, MNP 30-H2, after reacting at 37°C for 1 hour, magnetic separation was performed again, and the supernatant was collected and detected by a particle counter or low-field nuclear magnetic resonance. At the same time, the target bacterial DNA was detected using a hybridization reaction without catalytic hairpin assembly signal amplification.

[0044] The beneficial effects of the present invention are:

[0045] (1) Good stability: The present invention adopts a signal amplification method without enzyme assistance, which solves the instability caused by the use of enzymes / antibodies in traditional methods that are easily affected by factors such as temperature and pH. At the same time, compared with commonly used signal probes (such as gold nanoparticles), PS microspheres have the advantages of long-term storage and low aggregation. Therefore, the present invention has good stability.

[0046] (2) High sensitivity: The present invention introduces a cascade signal amplification method into a simple molecular hybridization method, specifically including the enrichment of a large amount of tDNA through MNP / PS microspheres, and the molecular hybridization between MNP-hairpin or PS-hairpin caused by tDNA catalytic self-assembly. The above cascade reaction can cause a great change in the state of MNP / PS microspheres in the solution, so that the sensitivity of magnetic and electrical biosensors whose response performance is closely related to the state of particles is greatly improved. At the same time, since the particles of the modified nucleic acid chain rarely self-aggregate, this method overcomes the disadvantage of false positive results caused by microsphere self-aggregation when detecting pathogens based on immune response.

[0047] (3) Low detection cost: The present invention uses small and portable electrical and magnetic biosensors. Compared with the PCR method, it does not require the use of expensive PCR instruments, and the required biological reagents are mainly nucleic acids, and the synthesis cost is much lower than biological reagents such as enzymes and antibodies. Therefore, the detection cost of the present invention is much lower than the pathogenic bacteria detection method based on enzymes and antibodies.

[0048] (4) Small sample usage: The output of the signal molecule of the commonly used DNA molecular beacon-modified gold nanoprobe is accompanied by the consumption of the target molecule during detection, which greatly limits the sample usage. In the present invention, the sandwich complex formed by the hybridization of the sample DNA with MNP-Probe1 and tDNA-PS-Probe2 / tDNA-MNP-Probe2 can be continuously recycled in the reaction system, and a small amount of sample can meet the detection needs. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 The schematic diagram of cascade signal amplification based on catalytic hairpin assembly (CHA);

[0050] Figure 2 It is the self-aggregation of the carrier when modifying antibodies or nucleic acid chains on the carrier. Figure 2 A and Figure 2B is the aggregation of PS microspheres (3 μm in diameter) when modified with antibodies and nucleic acid chains; Figure 2 C and Figure 2 D is the aggregation of MNPs (1 μm in diameter) when modified with antibodies and nucleic acid chains, respectively;

[0051] Figure 3 is the relationship between the concentration of Listeria monocytogenes and the corresponding number of particles under different conditions. Figure 3 A represents different MNP-Probe1 concentrations, Figure 3 B shows different tDNA-PS-Probe2 concentrations, Figure 3 C is different hybridization reaction time, Figure 3 D is different PS-hairpin concentrations and CHA reaction times;

[0052] Figure 4 The standard curve and linear range (wherein, Figure 4 A is the standard curve of two methods for Listeria monocytogenes detection. CMORA stands for microporous particle counting method based on non-enzyme cascade signal amplification, and the hybridization method stands for microporous particle counting method based on simple molecular hybridization. Figure 4 B is based on Figure 4 A obtained linear range);

[0053] Figure 5 These are the results of the present invention and the qPCR method for detecting Listeria monocytogenes in actual milk, pork, and fish samples (wherein the proposed approach is the microporous particle counting method based on enzyme-free cascade signal amplification in the present invention).

[0054] Figure 6 The standard curve and linear range for detecting Salmonella using the present invention and the magnetic relaxation biosensor based on simple molecular hybridization (wherein, Figure 6 A is the standard curve of two methods for Salmonella detection. CHA-MRS stands for magnetic relaxation biosensor based on enzyme-free cascade signal amplification, and the hybridization method stands for magnetic relaxation biosensor based on simple molecular hybridization. Figure 6 B is based on Figure 6 A obtained linear range);

[0055] Figure 7 These are the results of the present invention and the qPCR method for detecting Salmonella in actual milk, chicken and egg samples. DETAILED DESCRIPTION

[0056] The technical solution of the present invention is further described below by specific implementation methods. It should be understood by those skilled in the art that the embodiments are only to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0057] Example 1 Method for detecting Listeria monocytogenes by microporous particle counting method based on non-enzyme cascade signal amplification Construction of experimental materials Description

[0058] Carboxylated magnetic particles (MNPs), with a particle size of 1000 nm (10 mg / mL), were purchased from Ocean NanoTech.

[0059] Carboxylated polystyrene (PS) microspheres, particle size 3 μm (100 mg / mL), were purchased from Bangs Laboratories, Inc.

[0060] 1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), N-hydroxysulfosuccinimide active ester (sμlfo-NHS): purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. Tween-20: purchased from Amresco.

[0061] Listeria monocytogenes (L. monocytogenes, ATCC 19115) was purchased from ATCC Biological Standard Resource Center, USA.

[0062] 4-Morpholineethanesulfonic acid (MES) buffer (0.1M, pH=6.0): Dissolve 21.325 g of MES in deionized water and make up to 1000 mL to obtain solution A; dissolve 4 g of NaOH in deionized water and make up to 1000 mL to obtain solution B; mix 1000 mL of solution A and 400 mL of solution B and shake well.

[0063] MEST: Add 0.05% Tween-20 to the prepared PBS or MES buffer.

[0064] The Probe1 and Probe2 used were customized from Qingke Biotechnology Co., Ltd., and the hairpins H1 and H2 and the priming chain tDNA used were purchased from Shanghai Shenggong Bioengineering Technology Service Co., Ltd.

[0065] The Listeria monocytogenes DNA extraction kit was purchased from Beijing Zhuangmeng Biotechnology Co., Ltd.

[0066] Milk, pork, and fish samples were obtained from the Hubei Provincial Food Quality and Safety Supervision and Inspection Institute.

[0067] The signal was read out using an RC-2100 particle counter purchased from Zhuhai OMEC Instrument Co., Ltd.

[0068] Test steps description

[0069] (1) Listeria monocytogenes Probe1 modified magnetic beads (MNP 1000 Preparation of -Probe1

[0070] Take 1 mg of magnetic beads with a diameter of 1000 nm in a centrifuge tube and wash twice with MEST buffer solution. Take 50 μL of EDC (10 mg / mL) and 25 μL of NHS (10 mg / mL) solution in a test tube and adjust the volume to 900 μL with MES solution, then place it at room temperature for activation for 20 minutes and wash it twice. Add 5 μg of probe1 to the test tube and adjust the solution volume to 500 μL with Tris-EDTA buffer, then place it at room temperature for reaction for 2 hours. Use 1 mL of TT buffer to mix the obtained MNPs. 1000 -Probe1 was washed three times, each time for 30 min. Finally, MNPs were washed with TE buffer. 1000 -After Probe1 is resuspended, store it at 4 °C for further use.

[0071] (2) Preparation of Listeria monocytogenes Probe2 and t DNA modified PS microspheres (t DNA-PS-Probe2)

[0072] Take 1 mg of carboxyl PS microspheres with a diameter of 3 μm in a test tube and wash twice with MEST buffer. Take 50 μL of EDC (10 mg / mL) and 25 μL of NHS (10 mg / mL) solution in a test tube and adjust the volume to 900 μL with MES solution, then place it at room temperature for activation for 20 minutes and wash it twice. Take 9 μg of probe2 and 7 μg of tDNA in a centrifuge tube, and adjust the solution volume to 500 μL with TE buffer, then place it at room temperature for reaction for 2 hours. Wash the resulting Probe2-PS-tDNA three times with 1 mL of TT buffer, each time for 30 minutes. Finally, resuspend the tDNA-PS-Probe2 with TE buffer and store it at 4°C for further use.

[0073] (3) Preparation of H1 and H2 modified poly PS microspheres (PS-H1 and PS-H2)

[0074] Before use, H1 and H2 were denatured at 95°C for 5 min, then cooled to room temperature and kept for 1 h to ensure the formation of the hairpin structure. 1 mg of PS microspheres with a diameter of 3 μm were placed in a test tube and washed twice with MEST buffer. 50 μL of EDC (10 mg / mL) and 25 μL of NHS (10 mg / mL) solution were placed in a test tube and the volume was adjusted to 900 μL with MES solution, then placed at room temperature for activation for 20 min and washed twice. After removing the supernatant, 5 μg of H1 or H2 was added to the centrifuge tube, and the solution volume was adjusted to 500 μL with TE buffer, and then placed at room temperature for reaction for 2 h. The obtained PS-H1 or PS-H2 was washed three times with 1 mL of TT buffer, each for 30 min. Finally, PS-H1 or PS-H2 was resuspended with TE buffer and stored at 4°C for further use.

[0075] (4) Detection of Listeria monocytogenes DNA

[0076] Take 120 μL MNP 1000 -Probe1, 120μL tDNA-PS-Probe2, 60μL Listeria monocytogenes DNA extract, 50μL 10× sodium citrate (SSC) solution and 150μL sterile water were placed in a centrifuge tube, reacted in a 95°C water bath for 10 minutes, and then the centrifuge tube was transferred to an ice bath for 10 minutes, and then moved to a 53°C hybridization instrument for 1 hour. The above mixture was magnetically separated to remove excess tDNA-PS-Probe2. Equal concentrations of PS-H1 and PS-H2 were added to the system, reacted at 37°C for 1 hour, and then magnetically separated again, the supernatant was collected, and detected by a particle counter.

[0077] Example 2 Optimization of conditions for detecting Listeria monocytogenes using microporous particle counting method based on non-enzyme cascade signal amplification

[0078] To obtain the best analysis results, the other steps are the same as in Example 1, except that the MNP in step (4) of Example 1 is 1000 -Probe1, tDNA-PS-Probe2, hybridization reaction time, PS-hairpin concentration and catalytic hairpin self-assembly reaction time were optimized respectively.

[0079] Change the MNP in the reaction system 1000 -Probe1 concentration (20μg / mL, 30μg / mL, 40μg / mL, 50μg / mL), other experimental steps are the same as Example 1. The results are as follows Figure 2 As shown in A, MNP 1000 -The particle counter has the best response effect when the concentration of Probe1 is 30μg / mL.

[0080] The concentration of tDNA-PS-Probe2 in the reaction system was changed (20 μg / mL, 30 μg / mL, 50 μg / mL), and the other experimental steps were the same as in Example 1. Figure 2 As shown in B, the particle counter has the best response effect when the tDNA-PS-Probe2 concentration is 30 μg / mL.

[0081] The hybridization reaction time in the reaction system was changed (40 min, 60 min, 80 min), and the other experimental steps were the same as in Example 1. Figure 2 As shown in C, the particle counter has the best response effect when the hybridization reaction time is 60 minutes.

[0082] The concentrations of PS-H1 and PS-H2 in the reaction system were changed (10 μg / mL, 15 μg / mL, 20 μg / mL, 25 μg / mL, 30 μg / mL), and the other experimental steps were the same as in Example 1. The results are shown in FIG. Figure 2 As shown in D, the particle counter has the best response effect when the concentration of PS-H1 and PS-H2 is 20 μg / mL.

[0083] The CHA reaction time in the reaction system was changed (30 min, 45 min, 60 min, 75 min), and the other experimental steps were the same as in Example 1. Figure 2 As shown in D, the particle counter has the best response effect when the catalytic hairpin self-assembly reaction time is 60 minutes.

[0084] Final determination of optimal reaction conditions: MNP 1000 -Probe1 concentration was 30 μg / mL, tDNA-PS-Probe2 concentration was 30 μg / mL, hybridization reaction time was 60 min, PS-H1 and PS-H2 concentrations were 20 μg / mL, and catalytic hairpin self-assembly reaction time was 60 min.

[0085] Example 3 Changes in sensitivity of microporous particle counting method for detecting Listeria monocytogenes after introduction of non-enzyme cascade signal amplification

[0086] The specific operation of using the micropore particle counting method based on simple molecular hybridization to detect Listeria monocytogenes is the same as step (4) of Example 1, except that the "MNP 1000 -Probe1" is replaced with "PS-Probe1", and "The mixture is subjected to magnetic separation to remove excess tDNA-PS-Probe2. PS-H1 and PS-H2 of equal concentrations are added to the system, reacted at 37°C for 1 hour, and then magnetically separated again, the supernatant is collected, and detected by a particle counter." is replaced with "The solution after the reaction is detected by a particle counter." in this embodiment.

[0087] Under the optimal conditions of Example 2, a standard curve was established for detecting Listeria monocytogenes using the micropore particle counting method before and after enzyme-free cascade signal amplification. Figure 3 As shown in Figure B, compared with the microporous particle counting method based on simple molecular hybridization, the linear range of the microporous particle counting method based on non-enzymatic cascade signal amplification in the detection of Listeria monocytogenes was increased from 10 3 CFU / mL-10 7 CFU / mL is expanded to 10CFU / mL-10 5 CFU / mL, the detection limit was reduced from 570 CFU / mL to 4 CFU / mL. It can be seen that the sensitivity of the present invention in detecting Listeria monocytogenes is increased by 142.5 times compared with the simple molecular hybridization method.

[0088] Example 4: Spiked recovery rate of Listeria monocytogenes detected by microporous particle counting method based on non-enzyme cascade signal amplification

[0089] After centrifuging the spiked milk sample, the suspended sample matrix was removed to reduce interference. DNA was extracted from the sample supernatant after impurities were removed using a Listeria monocytogenes DNA extraction kit. The "60 μL Listeria monocytogenes DNA extract" in step (4) of Example 1 was replaced with the "DNA extract extracted in this example". The other steps were the same as in Example 1, and the spiked sample was tested.

[0090] The experimental results are shown in Table 1. The spike recoveries and coefficients of variation of different spike levels of Listeria monocytogenes in milk samples indicate that this method has good accuracy and precision for the detection of Listeria monocytogenes.

[0091] Table 1 Recovery and coefficient of variation of different spike levels of Listeria monocytogenes in milk

[0092]

[0093] Example 5 Actual sample analysis of Listeria monocytogenes detection based on microporous particle counting method without enzyme cascade signal amplification

[0094] Fifteen blind samples (milk, pork and fish) were used to evaluate the practicality of the above method. The specific operation steps are as follows: the sample is homogenized and then centrifuged, and then the suspended sample matrix is ​​removed to reduce interference; DNA is extracted from the sample supernatant after impurities are removed using a Listeria monocytogenes DNA extraction kit, and the "60 μL Listeria monocytogenes DNA extract" in step (4) of Example 1 is replaced with the "extracted DNA extract" of this example, and the rest is the same as Example 1, and then the Listeria monocytogenes in the sample is detected simultaneously by test step (4) and qPCR. The results are shown in FIG. Figure 4The results of the two methods were consistent, indicating that this method has good practical application ability for the detection of Listeria monocytogenes.

[0095] Example 6 Method for detecting Salmonella using magnetic relaxation biosensor based on enzyme-free cascade signal amplification Experimental Materials Description

[0096] Carboxylated magnetic particles (MNPs), with a particle size of 30 nm (10 mg / mL), were purchased from Ocean NanoTech.

[0097] 1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), N-hydroxysulfosuccinimide active ester (sμlfo-NHS): purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. Tween-20: purchased from Amresco.

[0098] Salmonella enteritidis (ATCC 13076) was purchased from ATCC Biological Standard Resource Center, USA.

[0099] 4-Morpholineethanesulfonic acid (MES) buffer (0.1M, pH=6.0): Dissolve 21.325 g of MES in deionized water and make up to 1000 mL to obtain solution A; dissolve 4 g of NaOH in deionized water and make up to 1000 mL to obtain solution B; mix 1000 mL of solution A and 400 mL of solution B and shake well.

[0100] MEST: Add 0.05% Tween-20 to the prepared PBS or MES buffer.

[0101] The Probe1 and Probe2 used were customized from Qingke Biotechnology Co., Ltd., and the hairpins H1 and H2 and the priming chain tDNA used were purchased from Shanghai Shenggong Bioengineering Technology Service Co., Ltd.

[0102] Salmonella DNA extraction kit was purchased from Beijing Zhuangmeng Biotechnology Co., Ltd.

[0103] Milk, chicken and egg samples came from Hubei Provincial Food Quality and Safety Supervision and Inspection Institute.

[0104] The signal was read out using a low-field nuclear magnetic resonance instrument purchased from Neumai Analytical Instruments Co., Ltd.

[0105] Test steps description

[0106] (1) MNP 1000 - Preparation of Probe 1: The steps are the same as those in Example 1 (1);

[0107] (2) tDNA-MNP 30- Preparation of Probe 2: The other steps are the same as those in Example 1 (2), except that tDNA-PS-Probe 1 is replaced with tDNA-MNP 30 -Probe1;

[0108] (3) MNP 30 -H1 and MNP 30 -H2 preparation: The other steps were the same as Example 1 (3), except that PS-H1 / PS-H2 were replaced by MNP-H1 / MNP-H2;

[0109] (4) Detection of Salmonella DNA: Take 120 μL of MNP 1000 -Probe 1, 120 μL tDNA-MNP 30 -Probe2, 60 μL Salmonella DNA extract, 50 μL 10× sodium citrate (SSC) solution and 150 μL sterile water were placed in a centrifuge tube, reacted in a 95°C water bath for 10 min, then the centrifuge tube was transferred to an ice bath for 10 min, and then moved to a 53°C hybridization instrument for 1 h. The above mixture was magnetically separated to remove excess tDNA-MNPs 30 -Probe 2. Add an equal amount of MNP to the system 30 -H1 and MNP 30 -H2, after reacting at 37°C for 1 h, magnetic separation was performed again, and the supernatant was collected and detected by low-field nuclear magnetic resonance.

[0110] Example 7 Changes in sensitivity of the magnetic relaxation biosensor for detecting Salmonella after the introduction of enzyme-free cascade signal amplification

[0111] The sensitivity test of the magnetic relaxation biosensor for detecting Salmonella before and after the introduction of cascade signal amplification was performed using step (4) of Example 6. Figure 6 As shown in B, before and after the introduction of cascade signal amplification, the linear range of the magnetic relaxation biosensor in detecting Salmonella increased from 10 3 CFU / mL-10 7 CFU / mL expanded to 10 2 CFU / mL-10 8 CFU / mL, the detection limit is reduced from 1055 CFU / mL to 18 CFU / mL. It can be seen that the sensitivity of the present invention is 58.7 times higher than that of the simple molecular hybridization method when detecting Salmonella.

[0112] Example 8: Recovery of Salmonella spiked with magnetic relaxation biosensor based on enzyme-free cascade signal amplification

[0113] After centrifuging the spiked milk sample, the suspended sample matrix was removed to reduce interference. DNA was extracted from the sample supernatant after impurities were removed using a Salmonella DNA extraction kit. In step (4) of Example 6, "60 μL of Salmonella DNA extract" was replaced with "DNA extract extracted in this example". The other steps were the same as in Example 6, and the spiked sample was tested.

[0114] The experimental results are shown in Table 2. The spike recoveries and coefficients of variation of different Salmonella spike levels in milk samples indicate that this method has good accuracy and precision for the detection of Salmonella.

[0115] Table 2 Recovery and coefficient of variation of different Salmonella spike levels in milk

[0116]

[0117] Example 9 Actual sample analysis of Salmonella detection using magnetic relaxation biosensor based on enzyme-free cascade signal amplification

[0118] Fifteen blind samples (milk, chicken and eggs) were used to evaluate the practicality of the magnetic relaxation biosensor after the introduction of CHA. The specific operation steps are as follows: the sample is homogenized and then centrifuged, and then the suspended sample matrix is ​​removed to reduce interference; the DNA is extracted from the sample supernatant after impurities are removed using a Salmonella DNA extraction kit, and the "60 μL Salmonella DNA extract" in step (4) of Example 6 is replaced with the "extracted DNA extract" of this example, and the rest is the same as Example 6, and then the Salmonella in the sample is detected simultaneously by experimental step (4) and qPCR. The results are shown in FIG. Figure 7 ,The results of the two methods are in good agreement, indicating that the magnetic relaxation biosensor has good practical application ability for Salmonella detection after the introduction of cascade signal amplification.

[0119] The technical solution of the present invention is explained through the above embodiments, but the present invention is not limited to the above embodiments, that is, it does not mean that the present invention must rely on the above specific embodiments to be implemented. Any improvements made by technicians in the relevant field based on the present invention, or equivalent replacement of the materials selected by the present invention, etc., fall within the scope of protection of the patent.

[0120]

[0121] SEQUENCE LISTING <110> Huazhong Agricultural University <120> A method for detecting foodborne pathogens based on enzyme-free cascade signal amplification <130> 7 <160> 5 <170> PatentIn version 3.5 <210> 1 <211> 33 <212> DNA <213> Artificial sequence <400> 1 tttcacgagagcacctggatttttttttttttt33 <210> 2 <211> 33 <212> DNA <213> Artificial sequence <400> 2 ttttttttttttttgacaggaagaacatcgggt33 <210> 3 <211> twenty two <212> DNA <213> Artificial sequence <400> 3 tagcttatcagactgatgttga 22 <210> 4 <211> 47 <212> DNA <213> Artificial sequence <400> 4 tcaacatcagtctgataagctaccatgtgtagatagctttatcagact 47 <210> 5 <211> 52 <212> DNA <213> Artificial sequence <400> 5 tgataagctatctacacatggtagctttatcagactccatgtccatgtgtaga52

Claims

1. A method for detecting foodborne pathogens based on non-enzyme cascade signal amplification, wherein the detection is for non-disease diagnosis purposes, characterized in that: The detection method comprises the following steps: 1) Preparation of Probe1 modified magnetic beads MNP-Probe1; 2) Preparation of tDNA-PS-Probe2: Probe2 and tDNA modified polystyrene PS microspheres; 3) Preparation of PS-H1 and PS-H2: PS microspheres modified with H1 and H2; 4) Detection of target bacterial DNA; The nucleotide sequence of Probe1 is shown in SEQ ID NO.1; The nucleotide sequence of Probe2 is shown in SEQ ID NO.2; The nucleotide sequence of tDNA is shown in SEQ ID NO.3; The nucleotide sequence of H1 is shown in SEQ ID NO.4; The nucleotide sequence of H2 is shown in SEQ ID NO.5; The diameter of MNP is 1000nm, the diameter of PS is 3μm, and the foodborne pathogen is Listeria monocytogenes.

2. A method for detecting foodborne pathogens based on non-enzyme cascade signal amplification according to claim 1, characterized in that: The preparation process of MNP-Probe1 in step (1) is as follows: 1 mg of magnetic beads MNP with a diameter of 1000 nm is taken. 1000 In a centrifuge tube, wash twice with MEST buffer solution; take 50 μL of 10 mg / mL EDC and 25 μL of 10 mg / mL NHS solution in a test tube and adjust the volume to 900 μL with MES solution, then activate at room temperature for 20 minutes and wash twice to obtain amino-modified magnetic beads; add 5 μg of probe1 to the test tube of amino-modified magnetic beads and adjust the solution volume to 500 μL with Tris-EDTA buffer, then react at room temperature for 2 hours; use 1 mL TT buffer to mix the obtained MNPs. 1000 -Probe1 was washed three times, each time for 30 min; finally, MNPs were washed with TE buffer. 1000 -Probe1 was resuspended and stored at 4°C for further use.

3. The method for detecting foodborne pathogens based on non-enzyme cascade signal amplification according to claim 1, characterized in that: In step (2), the preparation process of tDNA-PS-Probe2 is as follows: 1 mg of PS microspheres with a diameter of 3 μm is placed in a test tube and washed twice with MEST buffer; Take 50 μL of 10 mg / mL EDC and 25 μL of 10 mg / mL NHS solution in a test tube and adjust the volume to 900 μL with MES solution, then activate at room temperature for 20 min and wash twice; take 9 μg Probe2 and 7 μg tDNA in a centrifuge tube, adjust the solution volume to 500 μL with TE buffer, and react at room temperature for 2 h; wash the obtained tDNA-PS-Probe2 three times with 1 mL TT buffer, each time for 30 min; finally, resuspend the tDNA-PS-Probe2 with TE buffer and store it at 4°C for further use.

4. The method for detecting foodborne pathogens based on non-enzyme cascade signal amplification according to claim 1, characterized in that: In step (3), the preparation process of PS-H1 and PS-H2 is as follows: before use, H1 and H2 are denatured at 95°C for 5 minutes, and then kept at room temperature for 1 hour to form a hairpin structure; 1 mg of PS microspheres with a diameter of 3 μm are taken in a test tube and washed twice with MEST buffer; 50 μL of 10 mg / mL EDC and 25 μL of 10 mg / mL NHS solution are taken in a test tube and the volume is adjusted to 900 μL with MES solution, and then activated at room temperature for 20 minutes and washed twice; after removing the supernatant, 5 μg of H1 or H2 is added to the centrifuge tube, and the solution volume is adjusted to 500 μL with TE buffer, and then left to react at room temperature for 2 hours; the obtained PS-H1 and PS-H2 are washed three times with 1 mL TT buffer, each time for 30 minutes; finally, PS-H1 and PS-H2 are resuspended with TE buffer and stored at 4°C for further use.

5. The method for detecting foodborne pathogens based on non-enzyme cascade signal amplification according to claim 1, characterized in that: The detection process of target bacterial DNA in step (4) is as follows: (4-1) Place MNP-Probe1, tDNA-PS-Probe2, target bacteria DNA extract, 10× sodium citrate solution and sterile water in a centrifuge tube, react in a 95°C water bath for 5-15 min, cool in an ice bath for 5-10 min, and then transfer to a hybridization instrument for reaction for 45-90 min to obtain a mixture; (4-2) The above mixture is subjected to magnetic separation to remove excess tDNA-PS-Probe2, thereby obtaining a MNP-Probe1-target DNA-Probe2-PS-tDNA complex; (4-3) Add equal amounts of PS-H1 and PS-H2 to the MNP-Probe1-target DNA-Probe2-PS-tDNA complex system, react for 30-60 min, perform magnetic separation, and collect the supernatant; (4-4) The supernatant is detected by a particle counter or a low-field nuclear magnetic resonance spectroscopy; at the same time, the target bacterial DNA is detected using a hybridization reaction without catalytic hairpin self-assembly signal amplification.

6. A method for detecting foodborne pathogens based on non-enzyme cascade signal amplification according to claim 5, characterized in that: The detection process of target bacterial DNA in step (4) is as follows: take 120 μL MNP 1000 -Probe1, 120 μL tDNA-PS-Probe2, 60 μL target bacterial DNA extract, 50 μL 10 × sodium citrate solution and 150 μL sterile water were placed in a centrifuge tube, reacted in a 95°C water bath for 10 min, transferred to an ice bath for 10 min, and then moved to a 53°C hybridizer for reaction for 1 h; the above mixture was magnetically separated to remove excess tDNA-PS-Probe2; equal concentrations of PS-H1 and PS-H2 were added to the system, reacted at 37°C for 1 h, and then magnetically separated again, the supernatant was collected, and detected by a particle counter or a low-field nuclear magnetic resonance instrument; at the same time, the target bacterial DNA was detected using a hybridization reaction without catalytic hairpin self-assembly signal amplification.

Images