Mnp marker site, primer composition and kit for identifying lycium barbarum varieties and application thereof
By screening MNP marker sites on the wolfberry genome and designing a multiplex PCR primer combination, combined with a second-generation sequencing platform, the problem of wolfberry variety identification was solved, high-throughput and accurate variety identification and database construction were achieved, supporting the genetic diversity analysis of wolfberry varieties.
Patent Information
- Application Number
- CN202210620701.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-06-01
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2042-06-01
AI Technical Summary
Existing technologies are difficult to effectively distinguish wolfberry varieties, especially polyploid plants, and have high detection costs and poor flexibility, which cannot meet the needs of identifying substantially derived varieties.
Using MNP marker sites and multiplex PCR primer combinations, combined with a second-generation sequencing platform, high-throughput and accurate DNA detection of wolfberry varieties was performed. 500 MNP marker sites were screened, 500 pairs of primers were designed for multiplex PCR amplification, and a DNA fingerprint database was constructed.
It has achieved high-throughput and high-accuracy identification of wolfberry varieties, can distinguish polyploid plants, build a DNA fingerprint database, support variety authenticity identification, substantial derivation identification and genetic diversity analysis, and promote industrial development.
Smart Images

Figure CN114990254B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of molecular biology, and more particularly to a MNP marker site, primer composition and kit for identifying Lycium varieties and application thereof. BACKGROUND
[0002] Lycium barbarum L. is a perennial deciduous branching shrub of Solanaceae, and its fruit Lycium has been praised as "tree of life" since ancient times. Lycium is rich in nutrients and has great medicinal value, and is widely used in medical treatment, diet, health care and many other aspects. There are many varieties of Lycium, among which Ningxia Lycium is listed in Chinese Pharmacopoeia 2015 edition, and the market demand is increasing, and the economic value is high. Therefore, the phenomenon of using inferior products to replace good products is common in the market, which damages the rights and interests of consumers and is not conducive to the sustainable development of Lycium industry.
[0003] Lycium variety identification has experienced the development process from morphological identification, cytological identification, biochemical identification to DNA molecular identification. The use of molecular marker technology to statistically analyze the polymorphic information of DNA between varieties can comprehensively grasp the genetic diversity and genetic variation level of germplasm resources, and therefore is widely used in plant variety identification. The currently widely used molecular marker types include SSR (Simple Sequence Repeats) markers and SNP (Single Nucleotide Polymorphism) markers. SSR markers contain a simple repeat sequence, and its outstanding advantage is high polymorphism. However, the number of SSRs that can be amplified by one PCR is generally not more than 5, and the throughput is low. In addition, when DNA polymerase amplifies SSR sites, there is a sliding phenomenon, which is easy to produce false sliding genotypes. The sliding genotype cannot be distinguished from the main genotype in the sample, which makes it difficult to use SSR marker method for identification of polyploid plants. Whole genome resequencing technology can detect a large number of SSR sites at one time, but only ~ 3% of the sequences in the genome are SSR sites, resulting in high detection cost. Therefore, in practical application, only a limited number of SSR sites can be detected, which cannot meet the requirement of the number of markers for substantial derivative variety identification. Gene chip method can detect thousands or even hundreds of thousands of SNP sites at one time, and the throughput is much higher than that of SSR markers. However, a SNP marker site only has two allelic genotypes, and the polymorphism is much lower than that of SSR markers, which makes it difficult to distinguish polyploid plants. In addition, the probes for detecting SNP markers are fixed on the chip, and once the chip is synthesized, it is difficult to adjust and change, and the flexibility is poor.
[0004] At present, there is no standard for authenticating the true identity of wolfberry varieties. Although a few research papers have published the application of SSR markers in genetic breeding and genetic analysis of wolfberry, the number of marker sites is small. For example, the paper "Construction of Wolfberry Variety Molecular Identity Card Using SSR Markers" only studied the effects of 24 SSR sites on the differentiation of 16 wolfberry varieties. Although the effect of variety differentiation can be achieved, the number of markers is too small to identify substantial derivative varieties.
[0005] Therefore, developing new molecular markers with high polymorphism for wolfberry variety identification and their detection techniques has become a technical problem to be solved. SUMMARY
[0006] Therefore, the present application provides a MNP marker site, primer composition and kit for wolfberry variety identification and their applications. The MNP marker site can not only be used for authenticating the true identity of wolfberry varieties and identifying substantial derivative varieties, but also for genetic analysis of wolfberry varieties, which has the effects of strong discrimination, high throughput and high accuracy.
[0007] To achieve the above-mentioned purposes, the present application adopts the following technical solutions:
[0008] The present application provides a MNP marker site for wolfberry variety identification, which is a genomic region with multiple nucleotide polymorphisms in the wolfberry population screened on the wolfberry genome. The MNP marker site includes the marker sites of MNP-1 to MNP-500 on the wolfberry genome GCA_019175385.1.
[0009] In the above technical solution, the marker sites of MNP-1 to MNP-500 are specifically shown in Table 1 of the specification. The start and end positions of the MNP marker marked in Table 1 are determined based on the GCA_019175385.1 sequence.
[0010] The second object of the present application is to provide a multiplex PCR primer composition for detecting the above-mentioned MNP marker site, which includes 500 pairs of primers. The nucleotide sequences of the 500 pairs of primers are shown in SEQ ID NO. 1 to SEQ ID NO. 1000.
[0011] In the above technical solution, the primers of each MNP marker site include an upper primer and a lower primer, which are specifically shown in Table 1 of the specification. In which, the upper primer of SEQ ID NO. 1 is SEQ ID NO. 1, the lower primer of SEQ ID NO. 1 is SEQ ID NO. 2, the upper primer of SEQ ID NO. 3 is SEQ ID NO. 3, the lower primer of SEQ ID NO. 1 is SEQ ID NO. 4, the upper primer of SEQ ID NO. 5 is SEQ ID NO. 5, the lower primer of SEQ ID NO. 1 is SEQ ID NO. 6, and so on.
[0012] A third object of the present application is to provide a kit for detecting the MNP marker site, which comprises the primer composition.
[0013] Preferably, the kit for detecting the MNP marker site further comprises a multiplex PCR premix.
[0014] A fourth object of the present application is to provide the application of the MNP marker site, the multiplex PCR primer composition or the kit in the authenticity identification of wolfberry varieties.
[0015] The application of the MNP marker site, the multiplex PCR primer composition or the kit in the identification of substantial derivative varieties of wolfberry is provided.
[0016] The application of the MNP marker site, the multiplex PCR primer composition or the kit in the construction of a DNA fingerprint database of wolfberry varieties is provided.
[0017] The application of the MNP marker site, the multiplex PCR primer composition or the kit in the genetic diversity analysis of wolfberry germplasm resources is provided.
[0018] The application of the MNP marker site, the multiplex PCR primer composition or the kit in the molecular breeding of wolfberry is provided.
[0019] Advantages of the present application:
[0020] The present application provides a MNP marker site, a primer composition and a kit for wolfberry variety identification and applications thereof. The 500 MNP sites and the primer composition of wolfberry provided can be amplified by multiplex PCR, and the sequencing of the amplified products is performed on a second-generation sequencing platform. The detection of wolfberry varieties has the characteristics of high throughput, high resolution and high accuracy. Experiments have proved that the 500 MNP marker sites, primer compositions and kits provided by the present application can not only meet the needs of wolfberry variety authenticity identification and substantial derivative identification, but also realize the free comparison of variety data in the DNA fingerprint database. Therefore, the 500 MNP marker sites and primer compositions provided by the present application can be applied to wolfberry variety authenticity identification, substantial derivative identification, database construction, genetic diversity analysis of germplasm resources and other related applications, and provide strong technical support for the molecular breeding, intellectual property protection, market supervision and other aspects of wolfberry varieties in China, and promote the healthy development of the industry. BRIEF DESCRIPTION OF DRAWINGS
[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description only are the embodiments of the present application, and for those skilled in the art, other drawings can be obtained based on the provided drawings without any creative effort.
[0022] Figure 1 Figure 4 is a distribution diagram of the number of MNP marker detection sites of 44 wolfberry samples in Example 1; the vertical coordinate is the number of MNP marker detection sites corresponding to the sample, and the horizontal coordinate is the sample number, which is LY0001-LY0044 in turn.
[0023] Figure 2 Figure 5 is a distribution of MNP marker site differences between 946 pairs of eggplant samples; the vertical coordinate represents the logarithm of pairwise comparison, and the horizontal coordinate represents the percentage distribution of difference sites between the two comparisons. DETAILED DESCRIPTION
[0024] The advantages and various effects of the embodiments of the present application will be more clearly presented by the following specific embodiments and examples. Those skilled in the art should understand that these specific embodiments and examples are used to illustrate the embodiments of the present application, rather than limit the embodiments of the present application.
[0025] Throughout the specification, unless otherwise specifically indicated, the terms used herein are to be understood as having the meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as generally understood by those skilled in the art to which the embodiments of the present application belong. If there is a conflict, the present specification takes precedence.
[0026] Unless otherwise specifically indicated, the various raw materials, reagents, instruments and equipment used in the embodiments of the present application can be purchased from the market or can be prepared by existing methods.
[0027] The technical solutions of the embodiments of the present application are to solve the above technical problems, and the general idea is as follows:
[0028] Screening MNP markers suitable for distinguishing different Lycium barbarum varieties as detection targets. MNP markers refer to polymorphic markers caused by multiple nucleotides in a region of the genome. Compared with others, MNP markers have the following advantages: (1) allele-rich, high polymorphism, 2n allelic genotypes on a single MNP site (n is the number of MNP markers); (2) strong variety distinguishing ability, due to the multiple allelic genotypes of MNP markers, the maximum distinguishing effect can be achieved by using limited marker sites; (3) high efficiency, multiple sites can be amplified in a single tube PCR reaction, for example, 317-1042 MNP markers can be amplified simultaneously in the existing national standard GB / T 38551; combined with high-throughput sequencing, hundreds of samples can be detected simultaneously; (4) high accuracy, genotype data is obtained by sequencing using the gold standard method, and the second-generation high-throughput sequencer sequences each MNP marker product hundreds of times, greatly reducing the genotype typing errors caused by experimental errors; (5) strong data sharing, the sequencing output result is a base sequence, no parallel experiment is needed, and the data can be compared arbitrarily.
[0029] Therefore, based on the sequencing data of different Lycium barbarum varieties and combined with the Lycium barbarum reference genome, a set of high polymorphic Lycium barbarum MNP marker sites are screened, and the MNP marker sites are genomic regions with multiple nucleotide polymorphisms in the Lycium barbarum population screened on the Lycium barbarum genome, including the marker sites of MNP-1 to MNP-500 on the Lycium barbarum genome GCA_019175385.1.
[0030] Then, a multiplex PCR primer composition for amplifying these MNP marker sites is designed, and the multiplex PCR primer composition includes 500 pairs of primers, and the nucleotide sequences of the 500 pairs of primers are shown in SEQ ID NO. 1 to SEQ ID NO. 1000. The primers do not conflict with each other, can be efficiently amplified by multiplex PCR, have high identification accuracy and strong result reproducibility, and meet the requirements of DNA fingerprint database construction;
[0031] The multiplex PCR primer composition can be used in a detection kit for detecting the MNP marker sites. The primers and the detection kit are applied to Lycium barbarum variety authenticity identification, substantial derivation identification, database construction and other related fields.
[0032] The MNP marker sites, primer composition and kit for Lycium barbarum variety identification and the application thereof will be described in detail below in combination with examples and experimental data.
[0033] Example 1
[0034] Screening of MNP marker sites for Lycium barbarum variety identification and design of multiplex PCR amplification primers
[0035] S1, Screening of MNP marker loci for Lycium barbarum variety identification
[0036] Simplified genome sequencing was performed on 44 Lycium barbarum varieties collected by the unit, including N1 red, N1 yellow, N1-1, N1-2, N1-1-14, N1-20, N2, N3, N4, N5, N6, N7, N8, H10, N10, Ningqicai No.1, Ningnongqi No.4, Ningnongqi No.5, Ningnongqi No.9, 16-23-8-10, Ningnongqi 15, Ningnongqi 16, Ningnongqi 17, HLB39, Jiege, Pianguo, Tianjing No.3, 07-01, 0704, 09-3-8, 09-02 small, 09-02 large, 0903, Qin 4-1, Xin 9, Hongzhi, 14-02-2, China, South Korea, Column, H15-1, etc. A total of 78.68 Gb of sequencing data was obtained. The publicly released Lycium barbarum genome sequence GCA_019175385.1 was used as the reference genome. Samtools (Version 1.2) and BCFtools (Version:1.2) were used for sequence analysis to obtain SNP loci on the Lycium barbarum genome, and comparison analysis was performed with the NT library of NCBI. The screening of MNP markers was performed according to the following principles: (1) The marker sequence is unique to Lycium barbarum and does not appear in other species; (2) The sequence is single copy in the genome; (3) There are at least three non-continuous SNPs on the marker sequence; (4) The length of the marker sequence is less than 250 bp; further analysis of the discrimination of the candidate MNP markers screened by the measured Lycium barbarum variety simplified sequencing data, finally 568 candidate MNP marker loci were screened out.
[0037] S2, Design of multiplex PCR amplification primers
[0038] Multiplex PCR amplification primers for the above-mentioned 568 candidate MNP loci were designed by primer design software. The primer design followed the principle of non-interference between primers, and all primers could be combined into a primer pool for multiplex PCR amplification, i.e. all designed primers could be normally amplified in one amplification reaction. Finally, 68 primers that could not be compatible were discarded, and 500 MNP marker loci were retained as Lycium barbarum variety identification MNP markers. This set of markers was evenly distributed in the Lycium barbarum genome, with an average of 41.58 MNP markers per chromosome. The 500 marker loci and amplification primer sequences are shown in Table 1.
[0039] Table 1-500 Lycium barbarum MNP marker loci and their starting positions on the reference sequence and corresponding primer groups
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063] Example 2
[0064] Evaluation of MNP markers, primer compositions, and kits for identification of goji cultivars
[0065] After synthesizing 500 primer pairs, 5 μl of each primer was mixed in equal amounts to form a primer mix (a 1:1 mixture of F and R primers). The developed MNP markers, primers, and kit were evaluated using 44 wolfberry varieties collected by the unit to test the detection rate, accuracy, and discrimination of the MNP marker loci.
[0066] Multiplex PCR library construction system
[0067] Multiplex PCR System and Procedure: Using a 0.2mL PCR tube / 96-well PCR plate, set up the following reaction: 4µl of MNP-labeled primer mix, 10µl of template DNA, 10µl of high-fidelity DNA polymerase, and 6µl of H2O (total 30µl). After complete system setup, shake and centrifuge, place in a PCR instrument, and cycle at 95°C for 3 minutes; 95°C for 20 seconds, 60°C for 4 minutes (17 cycles), and 72°C for 4 minutes. Amplified products were then purified using a DNA Beads system and ligated to the appropriate adapters and sample barcodes for sequencing on Illumina or BGI sequencers.
[0068] Taking the Illumina sequencer system as an example, to establish a sequencing library: add the purified product to the following system, and choose different barcode primers for different samples. After the PCR amplification product is purified, it is directly used in the sequencer for high-throughput sequencing. System: 10ul high-fidelity DNA polymerase reaction solution, P5 barcode (5uM)
[0069] 2ul, P7 barcode (5uM) 2ul and H2O 16ul (total 30ul). The program was 95°C for 3min; 95°C for 15s, 58°C for 15s, 70°C for 30s (8 cycles); 72°C for 5min.
[0070] (2) MNP labeling detection rate
[0071] Multiplex PCR amplification and sequencing library construction were performed using the kit described in the present invention. Multiplex amplification, second-generation high-throughput sequencing, and data analysis were performed on these 44 wolfberry DNA samples, achieving the detection of 500×44=22,000 markers in a single experiment. The average sequencing coverage of each sample reached more than 800 times, demonstrating the high efficiency of MNP marker detection.
[0072] The distribution of the number of detection sites of wolfberry MNP markers is shown in the attached figure. Figure 1 As shown in the data, the number of MNP markers detected was counted in the sequencing data of these 44 samples. On average, 477.75 MNP markers could be detected for each variety, with a detection rate of 95.55%, which met the requirements of the national standard for the detection rate of variety identification markers in the MNP marker method.
[0073] (3) Accuracy analysis of Gouqi MNP markers
[0074] To test the accuracy of Gouqi MNP markers, reproducibility experiments (two independent experiments performed by different personnel, different batches of reagents, and different instruments) were performed on 16 Gouqi varieties. The common marker loci between the two batches of data for each sample were compared and analyzed, and the accuracy of the typing was calculated. The accuracy rate = 1 - (1 - precision) / 2. Among them, the precision refers to the proportion of marker loci with consistent typing results in two experiments. The reproducibility experiment simulates different batches of identification, and a high accuracy rate means that the identification results of different laboratories can be accurately compared with each other. The statistical results are shown in Table 2. The results show that a total of 7567 MNP markers were compared, and the proportion of non-reproducible sites was 0.17%, and the typing accuracy was 99.91%.
[0075] Table 2-500 Gouqi MNP marker site accuracy evaluation information table
[0076]
[0077]
[0078] (4) Gouqi MNP marker variety discrimination
[0079] The genotypes of the 44 Gouqi samples at the 500 MNP marker loci were counted, and pairwise comparisons were made. Based on the principle that at least one SNP difference in the same MNP marker locus genotype in different varieties is considered to be different, the number of different MNP markers between the 44 samples was counted. The results are shown in the attached Figure 2
[0080] A total of 946 sample comparison results were obtained. Except for the 6 pairs of N1 red, N1 yellow, N1-1, N1-1-14, N1-2, and N1-20, which had 0 differences, the average number of MNP markers between any Gouqi varieties was 122, and the average genetic difference was 72.53%, which could significantly distinguish 99.37% of the Gouqi varieties in this batch. The 6 pairs of Gouqi varieties with 0 differences were also compared by whole genome sequencing, and no obvious differences were found, indicating that the genetic background of the 6 pairs of samples was highly similar, and it was speculated that they may have been cultivated by asexual reproduction such as bud mutation.
[0081] Example 3
[0082] Gouqi variety authenticity identification and substantial derivative variety determination
[0083] The existing Plant Variety Identification MNP Marking Method national standard takes genetic similarity coefficient as the basis for determining the conclusion in variety identification. The calculation of genetic similarity coefficient needs to accurately count the number of different and same genotype marker sites between the sample to be tested and the control sample. Therefore, the accuracy of genotyping will affect the accuracy of the identification conclusion. Taking the analysis in Table 2 in Example 2 as an example, the genotyping results of 7567 markers show that the accuracy rate of the genotyping results of 500 wolfberry MNP markers in the application is 99.91%. The high accuracy indicates that in future applications, the influence of detection results from different times or laboratories on the accuracy of the variety identification conclusion can be basically ignored. Therefore, when applied to variety authenticity identification, it is not necessary to perform parallel experiments on the sample to be tested and the standard sample in the same laboratory, and the sample to be tested can be directly compared with the standard DNA fingerprint data, which provides great convenience for management agencies and companies to perform variety identification.
[0084] In the Plant Variety Identification MNP Marking Method national standard, for field crops such as rice, corn, cotton, etc., when the genetic similarity is less than 96%, it is determined that the variety to be tested and the control variety are "different varieties"; when the genetic similarity is greater than or equal to 96% and less than 99%, it is determined that the variety to be tested and the control variety are "similar varieties"; and when the genetic similarity is greater than or equal to 99%, it is determined that the variety to be tested and the control variety are "very similar varieties or the same variety".
[0085] We used this threshold value to perform variety authenticity identification on eight main cultivated varieties, i.e., "Ningqi No. 1", "Ningqi No. 2", "Ningqi No. 3", "Ningqi No. 5", "Ningqi No. 6", "Ningqi No. 7", "Ningqi No. 10", and "Ningnongqi No. 9", and the results are shown in Table 3; the identification conclusion for the comparison between these varieties is "different varieties", which is consistent with the actual situation, and the identification accuracy is 100%. At the same time, we also compared "Ningqi No. 1 red" and "Ningqi No. 1 yellow" two strains, and the identification result is that there are 0 MNP markers different between the two strains, and the conclusion is "very similar varieties or the same variety", which is also consistent with the actual breeding process.
[0086] Table 3 - Authenticity identification results between main cultivated wolfberry varieties
[0087]
[0088] The data of the DNA fingerprint obtained by the MNP marker technology is a series of DNA base sequences, which can be stored in a computer or server for a long time, and the data storage and traceability are strong, so that the detection data of each resource or variety can be saved to form a DNA fingerprint database. Further, we only need to compare the DNA fingerprint of the obtained sample to be tested with the data of all varieties in the DNA fingerprint database, and count the number of differences and genetic similarity of MNP markers between varieties, so as to obtain the identification conclusion of the sample to be tested and all samples in the database. This will greatly facilitate the application of approximate variety screening, determination of variety right infringement object, and identification of substantial derivative varieties, etc. These applications need to compare the typing results of a variety with the DNA fingerprints of hundreds or thousands of varieties; assuming that the traditional identification method is used, parallel experiments (two samples to be compared are detected at the same time) need to be done hundreds or thousands of times, which is a huge workload and difficult to achieve. Through the MNP molecular marker, primer composition and kit of the application, only one experiment is needed to obtain the DNA fingerprint of the sample to be tested, and then the comparison work is handed over to the computer for processing, which improves the work efficiency by hundreds of times. In addition, the number of MNP markers in the application reaches 500, the number of identified marker sites is large, which can accurately analyze the genetic differences between varieties, and ensure the correctness of the conclusions of approximate variety screening, determination of variety right infringement object, and identification of substantial derivative varieties. The method of the application is the method with the largest number of markers for the identification of wolfberry varieties at present, and also meets the requirements of Article 23 of the No. 14 document of the Supreme People's Court issued on July 5, 2021 (identification by gene fingerprinting and other molecular marker detection methods … The people's court may also take measures such as expanding the detection site for additional testing or extracting the standard sample of the authorized variety for testing according to the application of the parties), which has good application value in the field of variety identification.
[0089] Finally, it should be noted that the terms "comprising", "including", or any other variant thereof are intended to cover non-exclusive inclusions, so that a process, method, article or equipment including a series of elements not only includes those elements, but also includes other elements not explicitly listed or inherent to such a process, method, article or equipment.
[0090] The various embodiments in the specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between various embodiments can be referred to each other.
[0091] The above description of disclosed embodiments enables one of ordinary skill in the art to make and use the application. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein can be applied to other embodiments without departing from the spirit or scope of the application. Thus, the present application is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein. SEQUENCE LISTING <110> Ningxia Academy of Forestry and Horticulture, Wolfberry Science Institute <120> MNP marker loci, primer composition and kit for identifying wolfberry varieties and application thereof <160> 1000 <170> SIPOSequenceListing 1.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <400> 1 tttttgggca caaatcaggt tagaa 25 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <400> 2 taggaatgta cacagggaaa gtgag 25 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <400> 3 tttttgactg acccgactca tttca 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <400> 4 TGTAGGTGAA CTCAAATCAG AAGG 25 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <400> 5 TTTTTCTCGAA ATGGACGAAG ACAG 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <400> 6 TTCCGCGACT TTCTTATTTCC AAAA 25 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <400> 7 TTTTGAAATC ATGCCGTTTT GGATG 25 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <400> 8 TATTTCAAAG TCATTGGACCG CTCG 25 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <400> 9 TTTTCTTCCA ACTCATTGAC ATGCA 25 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <400> 10 aatggttggt atctctcgaa aggaa 25 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <400> 11 ttttcagctc ttgagacaaa tgcaa 25 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <400> 12 ctgaaaatct tgaaaacatg tgggc 25 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <400> 13 ttttattttg cagttctctc ccacc 25 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <400> 14 gacatggatg aaggaaccag aaaag 25 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <400> 15 ttttaattat cgttaggcgt tccgg 25 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <400> 16 ccactgaact aacataacgg gacta 25 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <400> 17 tttgctgcgt ttgtcaaact tattg 25 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <400> 18 tgtgcttaca agaacaagag accta 25 <210> 19 <211> 25 <212> DNA <213> Artificial Sequence <400> 19 tttcttgcta ggttgggata gtgaa 25 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <400> 20 ttcgtcttat caagagaaag ctgga 25 <210> 21 <211> 25 <212> DNA <213> Artificial Sequence <400> 21 tttcttctca aggtctcagg caata 25 <210> 22 <211> 25 <212> DNA <213> Artificial Sequence <400> 22 ttggaacctt tcagaatgaa cttgg 25 <210> 23 <211> 25 <212> DNA <213> Artificial Sequence <400> 23 tttccttgtt gtagtctcac ctcat 25 <210> 24 <211> 25 <212> DNA <213> Artificial Sequence <400> 24 tgtatgccca tgccatatag acatg 25 <210> 25 <211> 25 <212> DNA <213> Artificial Sequence <400> 25 tttatttgac catcactagg cctga 25 <210> 26 <211> 25 <212> DNA <213> Artificial Sequence <400> 26 atttggggtg tgacagaatt accta 25 <210> 27 <211> 25 <212> DNA <213> Artificial Sequence <400> 27 tttatgttaa ttctcgcctc gcttc 25 <210> 28 <211> 25 <212> DNA <213> Artificial Sequence <400> 28 aatgataagt caagaaagca gcacg 25 <210> 29 <211> 25 <212> DNA <213> Artificial Sequence <400> 29 ttgtttggta ggactgtagg gtaac 25 <210> 30 <211> 25 <212> DNA <213> Artificial Sequence <400> 30 accgagattt ccaaatgaaa ccttc 25 <210> 31 <211> 25 <212> DNA <213> Artificial Sequence <400> 31 ttgtgatacg aggacatatt tcgga 25 <210> 32 <211> 27 <212> DNA <213> Artificial Sequence <400> 32 tcatcaccta tgttatagca tctatgc 27 <210> 33 <211> 25 <212> DNA <213> Artificial Sequence <400> 33 ttgtcctttg cagaggggta tcttc 25 <210> 34 <211> 22 <212> DNA <213> Artificial Sequence <400> 34 gatcagtgtt gccctttcca tg 22 <210> 35 <211> 25 <212> DNA <213> Artificial Sequence <400> 35 ttggttgttg gaaaacttgg atgaa 25 <210> 36 <211> 25 <212> DNA <213> Artificial Sequence <400> 36 gtacacaaca ctttcttgtc atcgt 25 <210> 37 <211> 25 <212> DNA <213> Artificial Sequence <400> 37 ttggatatcc ccatcattct ttgga 25 <210> 38 <211> 25 <212> DNA <213> Artificial Sequence <400> 38 gtattacatt gagctcccgt tatgc 25 <210> 39 <211> 25 <212> DNA <213> Artificial Sequence <400> 39 ttggagttta ggtgcttact aggac 25 <210> 40 <211> 25 <212> DNA <213> Artificial Sequence <400> 40 ttacttgtgt tgtagggatg tgatg 25 <210> 41 <211> 25 <212> DNA <213> Artificial Sequence <400> 41 ttgcgtttat caatttcctg tgcta 25 <210> 42 <211> 25 <212> DNA <213> Artificial Sequence <400> 42 cacttgtggc tctctctttt acatg 25 <210> 43 <211> 25 <212> DNA <213> Artificial Sequence <400> 43 ttctggcaaa ttttctgaac aagat 25 <210> 44 <211> 25 <212> DNA <213> Artificial Sequence <400> 44 aggatttaca ccaatctgaa gtcat 25 <210> 45 <211> 25 <212> DNA <213> Artificial Sequence <400> 45 ttctcttcaa cctgtccaac aaatg 25 <210> 46 <211> 25 <212> DNA <213> Artificial Sequence <400> 46 acctcaaaat ctccttatgt tgtga 25 <210> 47 <211> 25 <212> DNA <213> Artificial Sequence <400> 47 ttctcccaat acagactgtt caact 25 <210> 48 <211> 25 <212> DNA <213> Artificial Sequence <400> 48 gccgatatgt ttcccttgtt ttgta 25 <210> 49 <211> 25 <212> DNA <213> Artificial Sequence <400> 49 ttctataggt gttgtaagtc tcggc 25 <210> 50 <211> 25 <212> DNA <213> Artificial Sequence <400> 50 tcgatcagaa gtagaacatg cagat 25 <210> 51 <211> 25 <212> DNA <213> Artificial Sequence <400> 51 ttcgtcatcc caccatgctt atata 25 <210> 52 <211> 25 <212> DNA <213> Artificial Sequence <400> 52 cagtgtaatc ttttggtgaa gggga 25 <210> 53 <211> 25 <212> DNA <213> Artificial Sequence <400> 53 ttccttcaga tgtagcagct atctg 25 <210> 54 <211> 25 <212> DNA <213> Artificial Sequence <400> 54 aggacagcta aggaccatca tattc 25 <210> 55 <211> 25 <212> DNA <213> Artificial Sequence <400> 55 ttcctgtcac accgttcttt aaaac 25 <210> 56 <211> 25 <212> DNA <213> Artificial Sequence <400> 56 ttatttcgtg tcacaagaat ccacg 25 <210> 57 <211> 25 <212> DNA <213> Artificial Sequence <400> 57 ttcagcagct acaatacaat tggaa 25 <210> 58 <211> 25 <212> DNA <213> Artificial Sequence <400> 58 ccttgtcatg gctatttttg agagg 25 <210> 59 <211> 25 <212> DNA <213> Artificial Sequence <400> 59 ttcaagttat gccatgaatg agagc 25 <210> 60 <211> 25 <212> DNA <213> Artificial Sequence <400> 60 ctgtgtgagc tcatttacat tgctg 25 <210> 61 <211> 25 <212> DNA <213> Artificial Sequence <400> 61 ttcaaccttc ccggaaattc ataac 25 <210> 62 <211> 25 <212> DNA <213> Artificial Sequence <400> 62 attgaggtat atctggacga tgtcg 25 <210> 63 <211> 25 <212> DNA <213> Artificial Sequence <400> 63 ttcaaagcaa tcaagaacct tggaa 25 <210> 64 <211> 25 <212> DNA <213> Artificial Sequence <400> 64 ggagcacctg taagaaaaat acgag 25 <210> 65 <211> 25 <212> DNA <213> Artificial Sequence <400> 65 ttaggcccaa aaacactatg taacg 25 <210> 66 <211> 25 <212> DNA <213> Artificial Sequence <400> 66 ttagctcaac aaatgaagac acgtg 25 <210> 67 <211> 25 <212> DNA <213> Artificial Sequence <400> 67 ttaatcttct ggatatccac ccgaa 25 <210> 68 <211> 25 <212> DNA <213> Artificial Sequence <400> 68 accagtggtg ttcatggatt taatg 25 <210> 69 <211> 25 <212> DNA <213> Artificial Sequence <400> 69 ttaaactcgg tcacttttgc ttcaa 25 <210> 70 <211> 27 <212> DNA <213> Artificial Sequence <400> 70 tggagaagat accatattca aaatgga 27 <210> 71 <211> 25 <212> DNA <213> Artificial Sequence <400> 71 tgtttgtgta ttgaagcagc aagat 25 <210> 72 <211> 25 <212> DNA <213> Artificial Sequence <400> 72 ccattttcat tacatggtac cggag 25 <210> 73 <211> 27 <212> DNA <213> Artificial Sequence <400> 73 tgtttaaaca cttcaaggat actctgg 27 <210> 74 <211> 25 <212> DNA <213> Artificial Sequence <400> 74 ggaccatttc cgtctatttt cagat 25 <210> 75 <211> 25 <212> DNA <213> Artificial Sequence <400> 75 tgttgctagt agagtcaatc accaa 25 <210> 76 <211> 25 <212> DNA <213> Artificial Sequence <400> 76 attcttttct ttggtttcgc agcta 25 <210> 77 <211> 25 <212> DNA <213> Artificial Sequence <400> 77 tgttcaaaga aaaacagctg aggtt 25 <210> 78 <211> 25 <212> DNA <213> Artificial Sequence <400> 78 agtgcatgca aagaatcttg taaca 25 <210> 79 <211> 25 <212> DNA <213> Artificial Sequence <400> 79 tgttattcca gctgaaatca cagtg 25 <210> 80 <211> 25 <212> DNA <213> Artificial Sequence <400> 80 ggctgtcagg atatcctttc atgta 25 <210> 81 <211> 25 <212> DNA <213> Artificial Sequence <400> 81 tgtgtttggt agtagagtct ccaag 25 <210> 82 <211> 25 <212> DNA <213> Artificial Sequence <400> 82 attctgatca gatttttcgt cggtg 25 <210> 83 <211> 25 <212> DNA <213> Artificial Sequence <400> 83 tgtgtaaact tggggaagat tgttg 25 <210> 84 <211> 25 <212> DNA <213> Artificial Sequence <400> 84 cttttcaaaa taccaacacc atggc 25 <210> 85 <211> 25 <212> DNA <213> Artificial Sequence <400> 85 tgtctctctt cattgtttgc attcc 25 <210> 86 <211> 25 <212> DNA <213> Artificial Sequence <400> 86 tactttgcat ctccaagtac cgaat 25 <210> 87 <211> 25 <212> DNA <213> Artificial Sequence <400> 87 tgtcgtagtc catatgtttc tttgc 25 <210> 88 <211> 25 <212> DNA <213> Artificial Sequence <400> 88 aacgtacagc atatcgaagg tatga 25 <210> 89 <211> 27 <212> DNA <213> Artificial Sequence <400> 89 tgtccatagt tattaatttg catggct 27 <210> 90 <211> 25 <212> DNA <213> Artificial Sequence <400> 90 atatcaccag aactgtggga ttttt 25 <210> 91 <211> 25 <212> DNA <213> Artificial Sequence <400> 91 tgtattcatt attgctagac ccact 25 <210> 92 <211> 23 <212> DNA <213> Artificial Sequence <400> 92 gttatgttcg gccctctagg tac 23 <210> 93 <211> 25 <212> DNA <213> Artificial Sequence <400> 93 tgtactggtt ttctgtactc ttcac 25 <210> 94 <211> 25 <212> DNA <213> Artificial Sequence <400> 94 ccgtacccct ggacaaaata catat 25 <210> 95 <211> 25 <212> DNA <213> Artificial Sequence <400> 95 tggttcttgg ccaaattcct aattc 25 <210> 96 <211> 25 <212> DNA <213> Artificial Sequence <400> 96 agctcgtaat catctcttgt ctcat 25 <210> 97 <211> 25 <212> DNA <213> Artificial Sequence <400> 97 tggttcagtt ttctgttttt cctcc 25 <210> 98 <211> 25 <212> DNA <213> Artificial Sequence <400> 98 tacctttcag ttcctcatcc aatga 25 <210> 99 <211> 25 <212> DNA <213> Artificial Sequence <400> 99 tggtacttct gtaaagttgt ctcgt 25 <210> 100 <211> 25 <212> DNA <213> Artificial Sequence <400> 100 caaccacaca gtctccttct ataca 25 <210> 101 <211> 25 <212> DNA <213> Artificial Sequence <400> 101 tggcgatgga tttggcctaa tatat 25 <210> 102 <211> 25 <212> DNA <213> Artificial Sequence <400> 102 cggtttccaa ttctcccttt tcttt 25 <210> 103 <211> 25 <212> DNA <213> Artificial Sequence <400> 103 tggcagctta atgatatcac ggata 25 <210> 104 <211> 25 <212> DNA <213> Artificial Sequence <400> 104 ctgatgaaag ggccaaacac ttatt 25 <210> 105 <211> 26 <212> DNA <213> Artificial Sequence <400> 105 tggcaaacta ataaagatgt gcttca 26 <210> 106 <211> 25 <212> DNA <213> Artificial Sequence <400> 106 agtaccagta gcatttaagg tcagg 25 <210> 107 <211> 24 <212> DNA <213> Artificial Sequence <400> 107 tggattgcca caatgtcttt agta 24 <210> 108 <211> 26 <212> DNA <213> Artificial Sequence <400> 108 aaaccattgt tgaatttgtt gagatt 26 <210> 109 <211> 27 <212> DNA <213> Artificial Sequence <400> 109 tggatgtgat agcctaaaat agagaga 27 <210> 110 <211> 25 <212> DNA <213> Artificial Sequence <400> 110 gatgctctga gatatcaaat gcagg 25 <210> 111 <211> 25 <212> DNA <213> Artificial Sequence <400> 111 tggactagac tattgcactg gttag 25 <210> 112 <211> 25 <212> DNA <213> Artificial Sequence <400> 112 caggttgaca tttagccaaa ttcct 25 <210> 113 <211> 27 <212> DNA <213> Artificial Sequence <400> 113 tggaatcaag tagcatgaaa gaaagaa 27 <210> 114 <211> 25 <212> DNA <213> Artificial Sequence <400> 114 aatagatggc ttacgtgttg attcg 25 <210> 115 <211> 26 <212> DNA <213> Artificial Sequence <400> 115 tggaatatcg atttcatgtt ttgtga 26 <210> 116 <211> 27 <212> DNA <213> Artificial Sequence <400> 116 cctttttctc cattttcaac aagatgg 27 <210> 117 <211> 25 <212> DNA <213> Artificial Sequence <400> 117 tggaacttag ccactttctg agtta 25 <210> 118 <211> 25 <212> DNA <213> Artificial Sequence <400> 118 gtagactcac agaagattga ggctg 25 <210> 119 <211> 25 <212> DNA <213> Artificial Sequence <400> 119 tgcttttctt cacttttcta cgctt 25 <210> 120 <211> 25 <212> DNA <213> Artificial Sequence <400> 120 aggtgaagta actgaacaga cgaat 25 <210> 121 <211> 25 <212> DNA <213> Artificial Sequence <400> 121 tgctttgagt tgtaacctag tttga 25 <210> 122 <211> 25 <212> DNA <213> Artificial Sequence <400> 122 tgagggagta aaaatcatga cccat 25 <210> 123 <211> 25 <212> DNA <213> Artificial Sequence <400> 123 tgcttgtgtt ttatctctac aggag 25 <210> 124 <211> 25 <212> DNA <213> Artificial Sequence <400> 124 actcctgaaa tagtaagacc ttgaa 25 <210> 125 <211> 25 <212> DNA <213> Artificial Sequence <400> 125 tgctgctgtg aaaactttat agcaa 25 <210> 126 <211> 25 <212> DNA <213> Artificial Sequence <400> 126 agagcagaac aaggtagaaa aagga 25 <210> 127 <211> 25 <212> DNA <213> Artificial Sequence <400> 127 tgctcccttg tacatttctc tatgt 25 <210> 128 <211> 25 <212> DNA <213> Artificial Sequence <400> 128 caaaatgttc tccttgaggt tcaca 25 <210> 129 <211> 25 <212> DNA <213> Artificial Sequence <400> 129 tgctacatgg tcttttcatc acatg 25 <210> 130 <211> 25 <212> DNA <213> Artificial Sequence <400> 130 agacattttt gctatcgtga ggaac 25 <210> 131 <211> 25 <212> DNA <213> Artificial Sequence <400> 131 tgcctcattt cctagttagt tgagt 25 <210> 132 <211> 25 <212> DNA <213> Artificial Sequence <400> 132 ctcatataac cagtctcaag cctga 25 <210> 133 <211> 26 <212> DNA <213> Artificial Sequence <400> 133 tgcccttcca gtaactatat tgtacc 26 <210> 134 <211> 25 <212> DNA <213> Artificial Sequence <400> 134 aaaatttggt ttagacgatg gctcc 25 <210> 135 <211> 27 <212> DNA <213> Artificial Sequence <400> 135 tgattcataa ttccttagtg tcctgga 27 <210> 136 <211> 25 <212> DNA <213> Artificial Sequence <400> 136 cgagcgtaaa agcagatcgt aatag 25 <210> 137 <211> 25 <212> DNA <213> Artificial Sequence <400> 137 ttcatctagg aaggctaagt taccg 25 <210> 138 <211> 25 <212> DNA <213> Artificial Sequence <400> 138 tgatccattg ataccttcga tcaca 25 <210> 139 <211> 25 <212> DNA <213> Artificial Sequence <400> 139 ttgaagatac ggagtttacg gagag 25 <210> 140 <211> 25 <212> DNA <213> Artificial Sequence <400> 140 tgatcacata ccagaaccac atagt 25 <210> 141 <211> 25 <212> DNA <213> Artificial Sequence <400> 141 ccgtatttat gctttagccg gacg 24 <210> 142 <211> 24 <212> DNA <213> Artificial Sequence <400> 142 ccgtatttat gctttagccg gacg 24 <210> 143 <211> 25 <212> DNA <213> Artificial Sequence <400> 143 tgagtttcct ttgcaattct cagac 25 <210> 144 <211> 25 <212> DNA <213> Artificial Sequence <400> 144 caatgaagtt ctttgtcttg gggat 25 <210> 145 <211> 25 <212> DNA <213> Artificial Sequence <400> 145 tgaggatctt catattgacg ctctt 25 <210> 146 <211> 25 <212> DNA <213> Artificial Sequence <400> 146 acccaggaaa ggcaaatata gtagt 25 <210> 147 <211> 25 <212> DNA <213> Artificial Sequence <400> 147 tgaggaggtt catgaaactg attct 25 <210> 148 <211> 25 <212> DNA <213> Artificial Sequence <400> 148 ttggttttta gaattcgatg caagt 25 <210> 149 <211> 25 <212> DNA <213> Artificial Sequence <400> 149 tgagcttaat ctgcccttta actct 25 <210> 150 <211> 25 <212> DNA <213> Artificial Sequence <400> 150 gatgatggca ttcgagttga tactc 25 <210> 151 <211> 25 <212> DNA <213> Artificial Sequence <400> 151 tgagatatgc atttggtgag aatgc 25 <210> 152 <211> 25 <212> DNA <213> Artificial Sequence <400> 152 tatctgtttc acgatccaat gcttg 25 <210> 153 <211> 25 <212> DNA <213> Artificial Sequence <400> 153 tgagacattg tattcttgag gaagt 25 <210> 154 <211> 25 <212> DNA <213> Artificial Sequence <400> 154 ccatacatta cagttttgtg ggcat 25 <210> 155 <211> 25 <212> DNA <213> Artificial Sequence <400> 155 tgagaatagg tgattccaac tcagt 25 <210> 156 <211> 25 <212> DNA <213> Artificial Sequence <400> 156 caatacctga gtatgtcaag catgc 25 <210> 157 <211> 25 <212> DNA <213> Artificial Sequence <400> 157 tgaagtgcaa attgttcacg aattc 25 <210> 158 <211> 25 <212> DNA <213> Artificial Sequence <400> 158 ttgaccgcag ataagttttc acaaa 25 <210> 159 <211> 25 <212> DNA <213> Artificial Sequence <400> 159 tgaagggaca gtttctttat ggtct 25 <210> 160 <211> 25 <212> DNA <213> Artificial Sequence <400> 160 gaaagcataa tgatggaagg agtgg 25 <210> 161 <211> 25 <212> DNA <213> Artificial Sequence <400> 161 tgaaaaagtt tgaggaaagg catca 25 <210> 162 <211> 25 <212> DNA <213> Artificial Sequence <400> 162 aagaaagatc acattcttgg ccaag 25 <210> 163 <211> 25 <212> DNA <213> Artificial Sequence <400> 163 tctttgtgcc tagactatcc caatc 25 <210> 164 <211> 25 <212> DNA <213> Artificial Sequence <400> 164 aattgcattg ttcaactcag ttcca 25 <210> 165 <211> 25 <212> DNA <213> Artificial Sequence <400> 165 tctttctctt atggctcgtg attct 25 <210> 166 <211> twenty four <212> DNA <213> Artificial Sequence <400> 166 tactagacat acggacggga caag 24 <210> 167 <211> 25 <212> DNA <213> Artificial Sequence <400> 167 tcttccttcg cttgtttgaa tatgg 25 <210> 168 <211> 25 <212> DNA <213> Artificial Sequence <400> 168 ccaattgctc aagtgaaatt tgcaa 25 <210> 169 <211> 27 <212> DNA <213> Artificial Sequence <400> 169 tcttcccaaa gaaaattata attggcg 27 <210> 170 <211> 25 <212> DNA <213> Artificial Sequence <400> 170 gtcacaacaa aatggtaact cgagt 25 <210> 171 <211> 25 <212> DNA <213> Artificial Sequence <400> 171 tcttcacaac catccactca ttttg 25 <210> 172 <211> 25 <212> DNA <213> Artificial Sequence <400> 172 ttagcaaatc gtctcgtatt tgacc 25 <210> 173 <211> 25 <212> DNA <213> Artificial Sequence <400> 173 tcttacttca tgaccacaat gaggt 25 <210> 174 <211> 25 <212> DNA <213> Artificial Sequence <400> 174 atgcttcatt gttgagaaac ccatt 25 <210> 175 <211> 25 <212> DNA <213> Artificial Sequence <400> 175 tctgccctgt cttcttttac aaatg 25 <210> 176 <211> 25 <212> DNA <213> Artificial Sequence <400> 176 catcagatca gtttgtttcg ggaac 25 <210> 177 <211> 25 <212> DNA <213> Artificial Sequence <400> 177 tctgattctg gtttggaact tgatt 25 <210> 178 <211> 25 <212> DNA <213> Artificial Sequence <400> 178 caagattctg tgagtgttca accaa 25 <210> 179 <211> 25 <212> DNA <213> Artificial Sequence <400> 179 tctctagctc cacaccaaag ttaaa 25 <210> 180 <211> 25 <212> DNA <213> Artificial Sequence <400> 180 gaatggaact tcacctgttg cttta 25 <210> 181 <211> 25 <212> DNA <213> Artificial Sequence <400> 181 tctcgttgtt tgttattttt gtgca 25 <210> 182 <211> 25 <212> DNA <213> Artificial Sequence <400> 182 ttcgaacaac ttgttagtga agcaa 25 <210> 183 <211> 26 <212> DNA <213> Artificial Sequence <400> 183 tctcatttag tctccttcaa tgctct 26 <210> 184 <211> 25 <212> DNA <213> Artificial Sequence <400> 184 catttgaaat acgagttcct gggtc 25 <210> 185 <211> 25 <212> DNA <213> Artificial Sequence <400> 185 tctagaattc gacggcgtaa ttttg 25 <210> 186 <211> 24 <212> DNA <213> Artificial Sequence <400> 186 ccttggggtt cgactaattg attc 24 <210> 187 <211> 25 <212> DNA <213> Artificial Sequence <400> 187 tctaaccaac ctcccaaaat acaag 25 <210> 188 <211> 25 <212> DNA <213> Artificial Sequence <400> 188 gttttggatt cctattcagc actcc 25 <210> 189 <211> 25 <212> DNA <213> Artificial Sequence <400> 189 tcgtttgttt gttttcctct tcctt 25 <210> 190 <211> 28 <212> DNA <213> Artificial Sequence <400> 190 agcattgtta tcctaattga tacacagt 28 <210> 191 <211> 25 <212> DNA <213> Artificial Sequence <400> 191 tcgatgaagg attttgatac ctcgt 25 <210> 192 <211> 25 <212> DNA <213> Artificial Sequence <400> 192 cagtactatg cttgctgcta aagtc 25 <210> 193 <211> 25 <212> DNA <213> Artificial Sequence <400> 193 tccttgtcag atacacaaaa cccta 25 <210> 194 <211> 25 <212> DNA <213> Artificial Sequence <400> 194 gttgatgaga atatcaatac gccgg 25 <210> 195 <211> 25 <212> DNA <213> Artificial Sequence <400> 195 tcctatagat ttcggacctc ttgtg 25 <210> 196 <211> 25 <212> DNA <213> Artificial Sequence <400> 196 ggacccaaca attctacttc agttg 25 <210> 197 <211> 25 <212> DNA <213> Artificial Sequence <400> 197 tccgtttagg atttcaggtc tcttt 25 <210> 198 <211> 25 <212> DNA <213> Artificial Sequence <400> 198 accaacctac actcatttta aacca 25 <210> 199 <211> 25 <212> DNA <213> Artificial Sequence <400> 199 tccctctaag acatctctct acaca 25 <210> 200 <211> 25 <212> DNA <213> Artificial Sequence <400> 200 acaatccaag tgtttcaact tttca 25 <210> 201 <211> 25 <212> DNA <213> Artificial Sequence <400> 201 tccccatgtttttcaattga tgtga 25 <210> 202 <211> 25 <212> DNA <213> Artificial Sequence <400> 202 tccgattgta tctccccatc cttat 25 <210> 203 <211> 25 <212> DNA <213> Artificial Sequence <400> 203 tcccatccac gcattctcta aataa 25 <210> 204 <211> 25 <212> DNA <213> Artificial Sequence <400> 204 atagagatct gataagctgg aaggc 25 <210> 205 <211> 25 <212> DNA <213> Artificial Sequence <400> 205 tcccacacca atcaatttca agaac 25 <210> 206 <211> 25 <212> DNA <213> Artificial Sequence <400> 206 tctgttctgg agtgtatcaa actcc 25 <210> 207 <211> 26 <212> DNA <213> Artificial Sequence <400> 207 tccattttca caactttttg catagg 26 <210> 208 <211> 25 <212> DNA <213> Artificial Sequence <400> 208 catttgaggt aagaattcct tgggc 25 <210> 209 <211> 25 <212> DNA <213> Artificial Sequence <400> 209 tccattgaca gaaccataac cttct 25 <210> 210 <211> 25 <212> DNA <213> Artificial Sequence <400> 210 gaactcaccg gatctatcac tgtta 25 <210> 211 <211> 27 <212> DNA <213> Artificial Sequence <400> 211 tccatgtgtt tcaacttttc aatacct 27 <210> 212 <211> 25 <212> DNA <213> Artificial Sequence <400> 212 ccacttctct ctagaaacct gtaga 25 <210> 213 <211> 24 <212> DNA <213> Artificial Sequence <400> 213 tccatggacc aaaggttatt aggg 24 <210> 214 <211> 25 <212> DNA <213> Artificial Sequence <400> 214 tggtaaatgc ggtggatatg tagat 25 <210> 215 <211> 25 <212> DNA <213> Artificial Sequence <400> 215 tccagacatt tcttaatctc ttgca 25 <210> 216 <211> 25 <212> DNA <213> Artificial Sequence <400> 216 gttatccgag agaaagccta ggaag 25 <210> 217 <211> 25 <212> DNA <213> Artificial Sequence <400> 217 tccactattg tctgcattaa ggcta 25 <210> 218 <211> 25 <212> DNA <213> Artificial Sequence <400> 218 tgttaatgga aaaagaggaa ggctg 25 <210> 219 <211> 25 <212> DNA <213> Artificial Sequence <400> 219 tccacaaaac ctatttcttc tacca 25 <210> 220 <211> 27 <212> DNA <213> Artificial Sequence <400> 220 cgtcaatcct aaactaattt gggtagc 27 <210> 221 <211> 25 <212> DNA <213> Artificial Sequence <400> 221 tccaaatttc tacatgcact tgtca 25 <210> 222 <211> 25 <212> DNA <213> Artificial Sequence <400> 222 tatagttaag gccaagggag agaag 25 <210> 223 <211> 25 <212> DNA <213> Artificial Sequence <400> 223 tccaaacaca actccaattt ccaaa 25 <210> 224 <211> 25 <212> DNA <213> Artificial Sequence <400> 224 tttcatttct tggtgcctat gcttt 25 <210> 225 <211> 25 <212> DNA <213> Artificial Sequence <400> 225 tcatttctac atcacacccc ttctc 25 <210> 226 <211> 25 <212> DNA <213> Artificial Sequence <400> 226 ctttgggtgg agatacttca cttga 25 <210> 227 <211> 25 <212> DNA <213> Artificial Sequence <400> 227 tcatgtaggt agagcatatg cacaa 25 <210> 228 <211> 25 <212> DNA <213> Artificial Sequence <400> 228 tggctttcat aacaatgaca actcc 25 <210> 229 <211> 26 <212> DNA <213> Artificial Sequence <400> 229 tcatgggtaa aacctttagt agagct 26 <210> 230 <211> 25 <212> DNA <213> Artificial Sequence <400> 230 actattcgag tattgagatg gaacc 25 <210> 231 <211> 25 <212> DNA <213> Artificial Sequence <400> 231 tcatcccata ttacagtttc accga 25 <210> 232 <211> 25 <212> DNA <213> Artificial Sequence <400> 232 cggtctactt gagttggact ttgat 25 <210> 233 <211> 25 <212> DNA <213> Artificial Sequence <400> 233 tcatatagccgaccctaagttgttt 25 <210> 234 <211> 25 <212> DNA <213> Artificial Sequence <400> 234 tccggaatgt tatgtggtag aatga 25 <210> 235 <211> 25 <212> DNA <213> Artificial Sequence <400> 235 tcaggtttgc atattaactg gaaca 25 <210> 236 <211> 25 <212> DNA <213> Artificial Sequence <400> 236 atgaatttgg gccaaacttg atgat 25 <210> 237 <211> 25 <212> DNA <213> Artificial Sequence <400> 237 tcagacaaac acatctgcat acaac 25 <210> 238 <211> 25 <212> DNA <213> Artificial Sequence <400> 238 taccgtatac aagctgaaca tcagg 25 <210> 239 <211> 25 <212> DNA <213> Artificial Sequence <400> 239 tcacttcctc aatagaagga tgctt 25 <210> 240 <211> 25 <212> DNA <213> Artificial Sequence <400> 240 tacactgagg gggataaaaa cactg 25 <210> 241 <211> 25 <212> DNA <213> Artificial Sequence <400> 241 tcaccttgaa ggaaccaatt tcatg 25 <210> 242 <211> 25 <212> DNA <213> Artificial Sequence <400> 242 gctagcctct tttatttcaa aggca 25 <210> 243 <211> 25 <212> DNA <213> Artificial Sequence <400> 243 tcaccccaaa tcgaccagaa atata 25 <210> 244 <211> 25 <212> DNA <213> Artificial Sequence <400> 244 ttgggtcttc atcatatata cgccc 25 <210> 245 <211> 25 <212> DNA <213> Artificial Sequence <400> 245 tcaccaagtt attgtctcat ttggt 25 <210> 246 <211> 25 <212> DNA <213> Artificial Sequence <400> 246 atccaagaat acctcgagag tgatc 25 <210> 247 <211> 25 <212> DNA <213> Artificial Sequence <400> 247 tcaattgcga gaacaagaat accag 25 <210> 248 <211> 25 <212> DNA <213> Artificial Sequence <400> 248 ccgtcatatg tctagaacac tcact 25 <210> 249 <211> 25 <212> DNA <213> Artificial Sequence <400> 249 tcaattcaca tctatgagcg aggat 25 <210> 250 <211> 25 <212> DNA <213> Artificial Sequence <400> 250 tcaaatttgg atcttgacat gtcgg 25 25<210> 251 25<211> 25 25<212> DNA 25<213> Artificial Sequence 25<400> 251 25tcaaacggta atcttaacca gctct 25 25<210> 252 25<211> 25 25<212> DNA 25<213> Artificial Sequence 25<400> 252 25gctatatagc cataagagcc tgcta 25 25<210> 253 25<211> 25 25<212> DNA 25<213> Artificial Sequence 25<400> 253 25tatttagagc ctgtttggaa agcca 25 25<210> 254 25<211> 25 25<212> DNA 25<213> Artificial Sequence 25<400> 254 25tggaaaacag gtgaaattac ccatt 25 25<210> 255 25<211> 25 25<212> DNA 25<213> Artificial Sequence 25<400> 255 25tatgttactt gctggaaggt ggtta 25 25<210> 256 25<211> 25 25<212> DNA <213> Artificial Sequence <400> 256 gaacacacaa atgcatcagt cagta 25 <210> 257 <211> 25 <212> DNA <213> Artificial Sequence <400> 257 tatgccatat caaatgtaca aggcc 25 <210> 258 <211> 25 <212> DNA <213> Artificial Sequence <400> 258 agagctccat ttatttaggg cgata 25 <210> 259 <211> 25 <212> DNA <213> Artificial Sequence <400> 259 tatgagccgt aaaacaccag aaaac 25 <210> 260 <211> 25 <212> DNA <213> Artificial Sequence <400> 260 ctgagtgtgt cgatgatatt gcttc 25 <210> 261 <211> 25 <212> DNA <213> Artificial Sequence <400> 261 tatcgtttcg ctactgagga tagag 25 <210> 262 <211> 25 <212> DNA <213> Artificial Sequence <400> 262 cgactatgac cactaacaat ccagt 25 <210> 263 <211> 25 <212> DNA <213> Artificial Sequence <400> 263 tatcaactgc atcgtaatca actgc 25 <210> 264 <211> 25 <212> DNA <213> Artificial Sequence <400> 264 atcatttctt cagggattgt ggtgc 25 <210> 265 <211> 25 <212> DNA <213> Artificial Sequence <400> 265 tatatggcct actctctgac tgcta 25 <210> 266 <211> 25 <212> DNA <213> Artificial Sequence <400> 266 atcatgagca gaaacaaggt tcttg 25 <210> 267 <211> 25 <212> DNA <213> Artificial Sequence <400> 267 tataacggcc aggttttcat aggaa 25 <210> 268 <211> 25 <212> DNA <213> Artificial Sequence <400> 268 gaccatgat caatgccaca actaa 25 <210> 269 <211> 25 <212> DNA <213> Artificial Sequence <400> 269 tataacattg cctccctctg aaagg 25 <210> 270 <211> 25 <212> DNA <213> Artificial Sequence <400> 270 gtagacttca ctgaaaaagc accat 25 <210> 271 <211> 25 <212> DNA <213> Artificial Sequence <400> 271 tagttgatttttgggtaaac ggacc 25 <210> 272 <211> 25 <212> DNA <213> Artificial Sequence <400> 272 tagcttgacc ttgaacattt gtgac 25 <210> 273 <211> 25 <212> DNA <213> Artificial Sequence <400> 273 taggtagggt cagttctacg aatct 25 <210> 274 <211> 25 <212> DNA <213> Artificial Sequence <400> 274 tcgaatccga tcaaaaatgg ctatg 25 <210> 275 <211> 25 <212> DNA <213> Artificial Sequence <400> 275 tagggtggct ttgtataatg ggatt 25 <210> 276 <211> 25 <212> DNA <213> Artificial Sequence <400> 276 catgtacaga aaacatgtcc acaca 25 <210> 277 <211> 25 <212> DNA <213> Artificial Sequence <400> 277 taggaagtgt gattcattta gggca 25 <210> 278 <211> 25 <212> DNA <213> Artificial Sequence <400> 278 tgcttttgta tatgaatgga ctggc 25 <210> 279 <211> 25 <212> DNA <213> Artificial Sequence <400> 279 tagcttcgag tttcgggaat tatga 25 <210> 280 <211> 25 <212> DNA <213> Artificial Sequence <400> 280 actggatttg aatgaaacaa ggctt 25 <210> 281 <211> 25 <212> DNA <213> Artificial Sequence <400> 281 tagcagaaag tgactcaaaa ctcct 25 <210> 282 <211> 25 <212> DNA <213> Artificial Sequence <400> 282 tcatgagtcc cttaacttct gaagg 25 <210> 283 <211> 25 <212> DNA <213> Artificial Sequence <400> 283 tagatttgac cgcaaccata gatca 25 <210> 284 <211> 25 <212> DNA <213> Artificial Sequence <400> 284 tgctatcagg ttgatccagt ctaag 25 <210> 285 <211> 25 <212> DNA <213> Artificial Sequence <400> 285 tactgttggt tccggctatt cttta 25 <210> 286 <211> 25 <212> DNA <213> Artificial Sequence <400> 286 gcgttagtct actcataatg cgaac 25 <210> 287 <211> 25 <212> DNA <213> Artificial Sequence <400> 287 tacggagttg caactatcca ttaca 25 <210> 288 <211> 25 <212> DNA <213> Artificial Sequence <400> 288 agtataaaaa ccaaaactcg gcctg 25 <210> 289 <211> 25 <212> DNA <213> Artificial Sequence <400> 289 tacggaagca tgagaagaaa tacct 25 <210> 290 <211> twenty two <212> DNA <213> Artificial Sequence <400> 290 taagcgcatc ggctactaca tt 22 <210> 291 <211> 25 <212> DNA <213> Artificial Sequence <400> 291 taccgatcat tccacaagag tcaat 25 <210> 292 <211> 25 <212> DNA <213> Artificial Sequence <400> 292 cattgctaca taccttatcg tgagc 25 <210> 293 <211> 25 <212> DNA <213> Artificial Sequence <400> 293 tacccttgta cgaacgaatt taggt 25 <210> 294 <211> 25 <212> DNA <213> Artificial Sequence <400> 294 ggatggatac gacgacctaa atgta 25 <210> 295 <211> 25 <212> DNA <213> Artificial Sequence <400> 295 taccactaca ttctgagact caacc 25 <210> 296 <211> 25 <212> DNA <213> Artificial Sequence <400> 296 cgtatgactt gattgggttg ttctc 25 <210> 297 <211> 25 <212> DNA <213> Artificial Sequence <400> 297 taatccctca ccctaagaat aacgc 25 <210> 298 <211> 26 <212> DNA <213> Artificial Sequence <400> 298 tgtaaaccta ctctctcgtg aaaaga 26 <210> 299 <211> 25 <212> DNA <213> Artificial Sequence <400> 299 taataccttg tctaataggc acgca 25 <210> 300 <211> 25 <212> DNA <213> Artificial Sequence <400> 300 actcgtactt ctatgctgat ggtac 25 <210> 301 <211> 25 <212> DNA <213> Artificial Sequence <400> 301 taagttcttc aagcagtggt actca 25 <210> 302 <211> 25 <212> DNA <213> Artificial Sequence <400> 302 tgctgttatc tcttccgatc tttca 25 <210> 303 <211> 26 <212> DNA <213> Artificial Sequence <400> 303 taagcagaaa gagttgaatt tggggt 26 <210> 304 <211> 25 <212> DNA <213> Artificial Sequence <400> 304 tactcgaact cctaggctag ctaac 25 <210> 305 <211> 25 <212> DNA <213> Artificial Sequence <400> 305 taaacaggat acagagcttt tggga 25 <210> 306 <211> 25 <212> DNA <213> Artificial Sequence <400> 306 attcagctga tcacaagaaa gttgc 25 <210> 307 <211> 25 <212> DNA <213> Artificial Sequence <400> 307 gtttctcaag catgctctaa cttct 25 <210> 308 <211> 25 <212> DNA <213> Artificial Sequence <400> 308 cttgtggtgt tgggatgtaa attga 25 <210> 309 <211> 25 <212> DNA <213> Artificial Sequence <400> 309 gtttatcttt ggacggttcc gaatt 25 <210> 310 <211> 25 <212> DNA <213> Artificial Sequence <400> 310 acccgtcatt atcttaacct tgtga 25 <210> 311 <211> 25 <212> DNA <213> Artificial Sequence <400> 311 gttcggaact caacttttgc aaaaa 25 <210> 312 <211> 25 <212> DNA <213> Artificial Sequence <400> 312 catttccaag ttggggattt ggtac 25 <210> 313 <211> 25 <212> DNA <213> Artificial Sequence <400> 313 gtgtctaaac cagcttaaga gacca 25 <210> 314 <211> 25 <212> DNA <213> Artificial Sequence <400> 314 ttagtctcga gatacttggt gcttt 25 <210> 315 <211> 25 <212> DNA <213> Artificial Sequence <400> 315 gtgtcggcta atattcttgt tctgg 25 <210> 316 <211> 25 <212> DNA <213> Artificial Sequence <400> 316 aattgaaaca tccccttttc cagtc 25 <210> 317 <211> 25 <212> DNA <213> Artificial Sequence <400> 317 gtgtagaaag aacagttgat gtgca 25 <210> 318 <211> 25 <212> DNA <213> Artificial Sequence <400> 318 gtggagatag attcagttgc tctct 25 <210> 319 <211> 25 <212> DNA <213> Artificial Sequence <400> 319 gtggtttgac tgttatgttt gttgc 25 <210> 320 <211> 25 <212> DNA <213> Artificial Sequence <400> 320 ggaattttta tagggtagct tgggc 25 <210> 321 <211> 25 <212> DNA <213> Artificial Sequence <400> 321 gtggttgact ttgatgattt ggcta 25 <210> 322 <211> 25 <212> DNA <213> Artificial Sequence <400> 322 agttgatcaa tccactgttg caatt 25 <210> 323 <211> 25 <212> DNA <213> Artificial Sequence <400> 323 gtggtggaat ggttaagatc tttcc 25 <210> 324 <211> 25 <212> DNA <213> Artificial Sequence <400> 324 tttcgaaggc gtgatattga tcatc 25 <210> 325 <211> 25 <212> DNA <213> Artificial Sequence <400> 325 gtggcgaaga gaagctatca ataat 25 <210> 326 <211> 25 <212> DNA <213> Artificial Sequence <400> 326 attcctctgt acttgttctt cctcg 25 <210> 327 <211> 25 <212> DNA <213> Artificial Sequence <400> 327 gtggcattac ccaatagagt tcatg 25 <210> 328 <211> 25 <212> DNA <213> Artificial Sequence <400> 328 ctagccttgg aagttgattt ggaag 25 <210> 329 <211> 26 <212> DNA <213> Artificial Sequence <400> 329 gtgagatgaa aacgtgaaat gaaagg 26 <210> 330 <211> 27 <212> DNA <213> Artificial Sequence <400> 330 acatgttttg catatttcca tacaagt 27 <210> 331 <211> 25 <212> DNA <213> Artificial Sequence <400> 331 gtcttagagt tggaccccta agttc 25 <210> 332 <211> 25 <212> DNA <213> Artificial Sequence <400> 332 ttcaagcata ggggattgaa tctca 25 <210> 333 <211> 25 <212> DNA <213> Artificial Sequence <400> 333 gtctactacc acttcttcac acagt 25 <210> 334 <211> 25 <212> DNA <213> Artificial Sequence <400> 334 ctcttcaaga gtgtgaggta tccaa 25 <210> 335 <211> 25 <212> DNA <213> Artificial Sequence <400> 335 gtcctatgacccctttggacttaat 25 <210> 336 <211> 25 <212> DNA <213> Artificial Sequence <400> 336 tcttgttcat gccattggat caaaa 25 <210> 337 <211> 25 <212> DNA <213> Artificial Sequence <400> 337 gtcatgaaaa aggggggattg agaag 25 <210> 338 <211> 25 <212> DNA <213> Artificial Sequence <400> 338 agacggtgat tacacgtatc agaat 25 <210> 339 <211> 25 <212> DNA <213> Artificial Sequence <400> 339 gtattgggtg gtttagaaat gggtc 25 <210> 340 <211> 25 <212> DNA <213> Artificial Sequence <400> 340 gagcattttc ctggacttta ttgct 25 <210> 341 <211> 25 <212> DNA <213> Artificial Sequence <400> 341 gtaggagtgg gagatcattt caaga 25 <210> 342 <211> 25 <212> DNA <213> Artificial Sequence <400> 342 acgcataaat aacacagtga tccac 25 <210> 343 <211> 25 <212> DNA <213> Artificial Sequence <400> 343 gtagaaaaga ggcccaagaa atgtc 25 <210> 344 <211> 25 <212> DNA <213> Artificial Sequence <400> 344 agggtctatc ggaaacaaac tatca 25 <210> 345 <211> 25 <212> DNA <213> Artificial Sequence <400> 345 gtacgaggat cccatgctag tttat 25 <210> 346 <211> 25 <212> DNA <213> Artificial Sequence <400> 346 ctttcttcat tccattccac caaca 25 <210> 347 <211> 24 <212> DNA <213> Artificial Sequence <400> 347 gtacatacat atgggcatgg aggg 24 <210> 348 <211> 28 <212> DNA <213> Artificial Sequence <400> 348 tggcctacac atgatttcta aatgttaa 28 <210> 349 <211> 25 <212> DNA <213> Artificial Sequence <400> 349 gtacagttgt aaaattccgg ctcaa 25 <210> 350 <211> 25 <212> DNA <213> Artificial Sequence <400> 350 agttttccag cttgtgttca ttttg 25 <210> 351 <211> 25 <212> DNA <213> Artificial Sequence <400> 351 gtacagcggg atgattcttc aaaat 25 <210> 352 <211> 25 <212> DNA <213> Artificial Sequence <400> 352 ctgtatgggt ctgttacaat gcaag 25 <210> 353 <211> 25 <212> DNA <213> Artificial Sequence <400> 353 gtaaatgtct gagatttgtc acccc 25 <210> 354 <211> 25 <212> DNA <213> Artificial Sequence <400> 354 tttgttggag agataggatagatgt 25 <210> 355 <211> 25 <212> DNA <213> Artificial Sequence <400> 355 ggttgttaac aaagagtata tccgt 25 <210> 356 <211> 25 <212> DNA <213> Artificial Sequence <400> 356 gaggttcaaa acaattcatt gcaat 25 <210> 357 <211> 25 <212> DNA <213> Artificial Sequence <400> 357 ggttcaccca tttacaaaag ggtag 25 <210> 358 <211> 25 <212> DNA <213> Artificial Sequence <400> 358 tgaagcccta atcatgcttc ttcta 25 <210> 359 <211> 25 <212> DNA <213> Artificial Sequence <400> 359 ggtgcttaaa atttgtggga attgg 25 <210> 360 <211> 25 <212> DNA <213> Artificial Sequence <400> 360 tgtcgaatct aggatcaagt aggac 25 <210> 361 <211> 25 <212> DNA <213> Artificial Sequence <400> 361 ggtcgtctaa tgggatcagt atcat 25 <210> 362 <211> 25 <212> DNA <213> Artificial Sequence <400> 362 catgaatagc aatcatcgga accaa 25 <210> 363 <211> 24 <212> DNA <213> Artificial Sequence <400> 363 ggtccaaatc ctgttacgac attg 24 <210> 364 <211> 25 <212> DNA <213> Artificial Sequence <400> 364 tggctaagca ggtattcatc ttagc 25 <210> 365 <211> 25 <212> DNA <213> Artificial Sequence <400> 365 gggtgggttt cagatcagtt ttata 25 <210> 366 <211> 25 <212> DNA <213> Artificial Sequence <400> 366 aaggccaact ccaattcttc aaaat 25 <210> 367 <211> 25 <212> DNA <213> Artificial Sequence <400> 367 gggtcgtgac aaaatatgag gttac 25 <210> 368 <211> 25 <212> DNA <213> Artificial Sequence <400> 368 gggcctcctc taaaatcata tacca 25 <210> 369 <211> 25 <212> DNA <213> Artificial Sequence <400> 369 gggtccctaa gcacagaaaa tatct 25 <210> 370 <211> 25 <212> DNA <213> Artificial Sequence <400> 370 accaaatctg aaaactaaaa cccat 25 <210> 371 <211> 25 <212> DNA <213> Artificial Sequence <400> 371 gggtatgatg ttgttgttgc tgttt 25 <210> 372 <211> 25 <212> DNA <213> Artificial Sequence <400> 372 actgaatact gtaagttgga gctga 25 <210> 373 <211> 25 <212> DNA <213> Artificial Sequence <400> 373 gggtatctat ggctagggat caatc 25 <210> 374 <211> 25 <212> DNA <213> Artificial Sequence <400> 374 aggatgcttt ctctaaacta tgcca 25 <210> 375 <211> 25 <212> DNA <213> Artificial Sequence <400> 375 ggggtattgc gagttataag atcct 25 <210> 376 <211> 25 <212> DNA <213> Artificial Sequence <400> 376 caggtttatc ctatatgggt tcggt 25 <210> 377 <211> 25 <212> DNA <213> Artificial Sequence <400> 377 ggggagcatg ttaccattct aactt 25 <210> 378 <211> 25 <212> DNA <213> Artificial Sequence <400> 378 taaacttagt aagaattggg cgggt 25 <210> 379 <211> 25 <212> DNA <213> Artificial Sequence <400> 379 gggatatctt ggtctattcc atccc 25 <210> 380 <211> 25 <212> DNA <213> Artificial Sequence <400> 380 gataacagtg gcagttgaac taagg 25 <210> 381 <211> 25 <212> DNA <213> Artificial Sequence <400> 381 ggctcttcta cttgactctt gtaca 25 <210> 382 <211> 25 <212> DNA <213> Artificial Sequence <400> 382 tcatctccta aactcaacac acctt 25 <210> 383 <211> 25 <212> DNA <213> Artificial Sequence <400> 383 ggcccattca taagacggta tagat 25 <210> 384 <211> 25 <212> DNA <213> Artificial Sequence <400> 384 taccttgagt ttattgcctc cagaa 25 <210> 385 <211> 25 <212> DNA <213> Artificial Sequence <400> 385 ggccagttaa cattgatctt gtctt 25 <210> 386 <211> 25 <212> DNA <213> Artificial Sequence <400> 386 tggaaagaga atccaaccca cataa 25 <210> 387 <211> 25 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 387 ggcatgagtg ttgatagtca gaaga 25 <210> 388 <211> 25 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 388 gagaaattgg ttaaggggat ggttc 25 <210> 389 <211> 25 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 389 ggcatcctca catctatttt tggag 25 <210> 390 <211> 25 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 390 ttagtgtgag gtccaagtct acatg 25 <210> 391 <211> 24 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 391 ggatttttcg gagcggtggt atat 24 <210> 392 <211> 25 <212> DNA <213> Artificial Sequence <400> 392 ctcaaccaca ctattctgcc attac 25 <210> 393 <211> 25 <212> DNA <213> Artificial Sequence <400> 393 ggatgaattc acacctaatg acagt 25 <210> 394 <211> 26 <212> DNA <213> Artificial Sequence <400> 394 acatgctttc tcccatcaat tctatt 26 <210> 395 <211> 24 <212> DNA <213> Artificial Sequence <400> 395 ggatccggtc atcctcgata tatg 24 <210> 396 <211> 25 <212> DNA <213> Artificial Sequence <400> 396 gtccattttc gagatgaagg gattc 25 <210> 397 <211> 26 <212> DNA <213> Artificial Sequence <400> 397 ggagttcaat gtgatcaata tcgtga 26 <210> 398 <211> 25 <212> DNA <213> Artificial Sequence <400> 398 tatgtttcaa cagatggatc cgatg 25 <210> 399 <211> 25 <212> DNA <213> Artificial Sequence <400> 399 ggaacttccc cttatatggt gctat 25 <210> 400 <211> 25 <212> DNA <213> Artificial Sequence <400> 400 atagcaagac atcatcacct tctga 25 <210> 401 <211> 25 <212> DNA <213> Artificial Sequence <400> 401 gctttcaact tcaaacataa tgcca 25 <210> 402 <211> 25 <212> DNA <213> Artificial Sequence <400> 402 tgactgtagc aatacattaa gggct 25 <210> 403 <211> 25 <212> DNA <213> Artificial Sequence <400> 403 gcttgtagct tgtagaaatg tgtgt 25 <210> 404 <211> 25 <212> DNA <213> Artificial Sequence <400> 404 gcctagtcaa atcaaaggcc aataa 25 <210> 405 <211> 25 <212> DNA <213> Artificial Sequence <400> 405 gcttccttat cgtctgattt ttgct 25 <210> 406 <211> 25 <212> DNA <213> Artificial Sequence <400> 406 gccgaccttc attatcattt tgagt 25 <210> 407 <211> 25 <212> DNA <213> Artificial Sequence <400> 407 gctgtgtttt gggatgtgat tagaa 25 <210> 408 <211> 25 <212> DNA <213> Artificial Sequence <400> 408 ggaaccaaac gtataagaag ggttg 25 <210> 409 <211> 25 <212> DNA <213> Artificial Sequence <400> 409 gctgcagggg aattttatga tcaaa 25 <210> 410 <211> 25 <212> DNA <213> Artificial Sequence <400> 410 tacaagagtc aaaaggtgga gctta 25 <210> 411 <211> 25 <212> DNA <213> Artificial Sequence <400> 411 gctcctaacc agcaactaaa tgatc 25 <210> 412 <211> 25 <212> DNA <213> Artificial Sequence <400> 412 aaaaagctaa ggcccctcat taaag 25 <210> 413 <211> 25 <212> DNA <213> Artificial Sequence <400> 413 gctatctcag tccctttatc ccatt 25 <210> 414 <211> 25 <212> DNA <213> Artificial Sequence <400> 414 ttggcctgag agtaagttct aactg 25 <210> 415 <211> 26 <212> DNA <213> Artificial Sequence <400> 415 gctaatctcc gaagtgtttt cttctt 26 <210> 416 <211> 25 <212> DNA <213> Artificial Sequence <400> 416 ccggacaaga attacataga tccca 25 <210> 417 <211> 26 <212> DNA <213> Artificial Sequence <400> 417 gctaacacct ctaactcctt agatca 26 <210> 418 <211> 25 <212> DNA <213> Artificial Sequence <400> 418 tgaccacgac tccgattaaa tgtag 25 <210> 419 <211> 25 <212> DNA <213> Artificial Sequence <400> 419 gcgagtggac aatacaaaag aagaa 25 <210> 420 <211> 25 <212> DNA <213> Artificial Sequence <400> 420 gaattcatag caaacgggaa ggaat 25 <210> 421 <211> 25 <212> DNA <213> Artificial Sequence <400> 421 gcctggtact aaatgtgtct tccta 25 <210> 422 <211> 25 <212> DNA <213> Artificial Sequence <400> 422 tcacacacac aaacatgcgt attaa 25 <210> 423 <211> 25 <212> DNA <213> Artificial Sequence <400> 423 gcctacagcc acaattacag aaatt 25 <210> 424 <211> 25 <212> DNA <213> Artificial Sequence <400> 424 gcgagtttta aacgaaacaa atcga 25 <210> 425 <211> 25 <212> DNA <213> Artificial Sequence <400> 425 gccgatggta cttacattat tcgtt 25 <210> 426 <211> 25 <212> DNA <213> Artificial Sequence <400> 426 agaagagagt agaagcggga aaaat 25 <210> 427 <211> 25 <212> DNA <213> Artificial Sequence <400> 427 gcccctttgt attaagcata acaca 25 <210> 428 <211> 25 <212> DNA <213> Artificial Sequence <400> 428 gtggagcaag tatgtagtaa ctgct 25 <210> 429 <211> 25 <212> DNA <213> Artificial Sequence <400> 429 gcccaacagt gtcgaatttc taaat 25 <210> 430 <211> 25 <212> DNA <213> Artificial Sequence <400> 430 tgtattgcac aactaaaact ccagg 25 <210> 431 <211> 25 <212> DNA <213> Artificial Sequence <400> 431 gccagatttg aactctgcta atctc 25 <210> 432 <211> 25 <212> DNA <213> Artificial Sequence <400> 432 ctgcatggaa gtgtttaaca acaac 25 <210> 433 <211> 25 <212> DNA <213> Artificial Sequence <400> 433 gcatacatga aattggaatt cccct 25 <210> 434 <211> 25 <212> DNA <213> Artificial Sequence <400> 434 tagcttgctc acatctcgac taatt 25 <210> 435 <211> 25 <212> DNA <213> Artificial Sequence <400> 435 gcatacatac aaaagacacc ctacg 25 <210> 436 <211> 25 <212> DNA <213> Artificial Sequence <400> 436 tcaaaatgat caccatgaac gaatt 25 <210> 437 <211> 25 <212> DNA <213> Artificial Sequence <400> 437 GCAAGCCACT TTCACCTGAA TATAA 25 <210> 442 <210> 438 <211> 25 <212> DNA <213> Artificial Sequence <400> 438 CAGACACCAA TATTCCTAAG TTTT 25 <210> 439 <211> 25 <212> DNA <213> Artificial Sequence <400> 439 GCACCTTCCC TCACTACTTC TAAGTT 25 <210> 440 <211> 25 <212> DNA <213> Artificial Sequence <400> 440 TCATTTCAGG TTGCATTGAC AGAAA 25 <210> 441 <211> 25 <212> DNA <213> Artificial Sequence <400> 441 GCAAGCCACT TTCACCTGAA TATAA 25 <210> 442 <211> 25 <212> DNA <213> Artificial Sequence <400> 442 TCTTGGAAAT AGCTTTCTGT CAATGC 25 <210> 443 <211> 25 <212> DNA <213> Artificial Sequence <400> 443 gcaaccttca tctatcatat gccag 25 <210> 444 <211> 25 <212> DNA <213> Artificial Sequence <400> 444 gcatttaggg gtttgggtat tttca 25 <210> 445 <211> 25 <212> DNA <213> Artificial Sequence <400> 445 gcaaacactt ggtactggac ttaaa 25 <210> 446 <211> 25 <212> DNA <213> Artificial Sequence <400> 446 tcattagctg acactagtga tcgtt 25 <210> 447 <211> 25 <212> DNA <213> Artificial Sequence <400> 447 gattacagac aatgttggag ctgtt 25 <210> 448 <211> 25 <212> DNA <213> Artificial Sequence <400> 448 agtcttcgtg catatgagaa atagg 25 <210> 449 <211> 25 <212> DNA <213> Artificial Sequence <400> 449 gatggacacc aatgacacca taatc 25 <210> 450 <211> 27 <212> DNA <213> Artificial Sequence <400> 450 tggttaagat tgaatatgcc aagttgt 27 <210> 451 <211> 25 <212> DNA <213> Artificial Sequence <400> 451 gatgctgaaa aagtaccatg gtgat 25 <210> 452 <211> 26 <212> DNA <213> Artificial Sequence <400> 452 ttcttcatta gtctattcgt tgtacg 26 <210> 453 <211> 25 <212> DNA <213> Artificial Sequence <400> 453 gatgaatcat atgggatgtt cgtgg 25 <210> 454 <211> 25 <212> DNA <213> Artificial Sequence <400> 454 cgtaggtttt atgtgaccca tgatg 25 <210> 455 <211> 25 <212> DNA <213> Artificial Sequence <400> 455 gatatttttc caaaggctga cacct 25 <210> 456 <211> 25 <212> DNA <213> Artificial Sequence <400> 456 gaaggaccaa taccacatat gagga 25 <210> 457 <211> 25 <212> DNA <213> Artificial Sequence <400> 457 gagtgttcct tttcagtttc ctcag 25 <210> 458 <211> 25 <212> DNA <213> Artificial Sequence <400> 458 gcaccatgat agaacaactt taccc 25 <210> 459 <211> 25 <212> DNA <213> Artificial Sequence <400> 459 gagtcctttt ggttttgtca gtgat 25 <210> 460 <211> 25 <212> DNA <213> Artificial Sequence <400> 460 taggggaatg taactttgtg acact 25 <210> 461 <211> 25 <212> DNA <213> Artificial Sequence <400> 461 gaggtttgtt tgagaatcga atggt 25 <210> 462 <211> 25 <212> DNA <213> Artificial Sequence <400> 462 cttctacgca caacccttta acaat 25 <210> 463 <211> 25 <212> DNA <213> Artificial Sequence <400> 463 gaggcattgg aagcaattct tatgg 25 <210> 464 <211> 25 <212> DNA <213> Artificial Sequence <400> 464 gcactacttt ggtggttcat caatt 25 <210> 465 <211> 25 <212> DNA <213> Artificial Sequence <400> 465 gaggaagcgg aattaggagt agaat 25 <210> 466 <211> 25 <212> DNA <213> Artificial Sequence <400> 466 ttgaacaact ctgcaagaaa tggaa 25 <210> 467 <211> 25 <212> DNA <213> Artificial Sequence <400> 467 gaggaaagag tttgaaggtg attga 25 <210> 468 <211> 29 <212> DNA <213> Artificial Sequence <400> 468 agaaacttaa aacaaatttg tgaaggact 29 <210> 469 <211> 25 <212> DNA <213> Artificial Sequence <400> 469 gagctctttg atcctccttt gtttg 25 <210> 470 <211> 25 <212> DNA <213> Artificial Sequence <400> 470 cccatccacc attgttcaaa tttga 25 <210> 471 <211> 25 <212> DNA <213> Artificial Sequence <400> 471 gagcagttac tttggtttac catgt 25 <210> 472 <211> 25 <212> DNA <213> Artificial Sequence <400> 472 ctgtaagttt ggcctgcaat attga 25 <210> 473 <211> 25 <212> DNA <213> Artificial Sequence <400> 473 gagcactaaa ggagaagatg atcca 25 <210> 474 <211> 25 <212> DNA <213> Artificial Sequence <400> 474 ccaatccacttttgcagtcagtatt 25 <210> 475 <211> 25 <212> DNA <213> Artificial Sequence <400> 475 gagaaatttg aagcgctagt taggg 25 <210> 476 <211> 25 <212> DNA <213> Artificial Sequence <400> 476 gatggcctta gtagctcaaa atagc 25 <210> 477 <211> 25 <212> DNA <213> Artificial Sequence <400> 477 gagaaataca gctactagcc agagg 25 <210> 478 <211> 25 <212> DNA <213> Artificial Sequence <400> 478 tgcttgctcc ttatattcca aagtg 25 <210> 479 <211> 24 <212> DNA <213> Artificial Sequence <400> 479 gagaaactca taatggcctt cgtg 24 <210> 480 <211> 25 <212> DNA <213> Artificial Sequence <400> 480 ggcatttttg tgtggattat aaggc 25 <210> 481 <211> 25 <212> DNA <213> Artificial Sequence <400> 481 gacttgtaag gtgtctgttg aagtg 25 <210> 482 <211> 25 <212> DNA <213> Artificial Sequence <400> 482 ctccactact ttgtttttgt ttgcg 25 <210> 483 <211> 25 <212> DNA <213> Artificial Sequence <400> 483 gaccaaaaca aatgtaacac aaggc 25 <210> 484 <211> 25 <212> DNA <213> Artificial Sequence <400> 484 ctgcacacaa atcccagaaa atttc 25 <210> 485 <211> 25 <212> DNA <213> Artificial Sequence <400> 485 gacagttgtc aaattcgtga tttcg 25 <210> 486 <211> 25 <212> DNA <213> Artificial Sequence <400> 486 tcgaaccgaa ctgtgagtaa cttta 25 <210> 487 <211> 24 <212> DNA <213> Artificial Sequence <400> 487 gacaaggctt gttgtggata gttc 24 <210> 488 <211> 25 <212> DNA <213> Artificial Sequence <400> 488 acaacatagc aaataaggcg acaat 25 <210> 489 <211> 25 <212> DNA <213> Artificial Sequence <400> 489 gacaacccca atgttacagt gaaat 25 <210> 490 <211> 28 <212> DNA <213> Artificial Sequence <400> 490 aaattcataa ctatttgtac cataccga 28 <210> 491 <211> 25 <212> DNA <213> Artificial Sequence <400> 491 gaattggagt atgcggagtg cttag 25 <210> 492 <211> 25 <212> DNA <213> Artificial Sequence <400> 492 tcgttacctt gttcgattaa tggca 25 <210> 493 <211> 25 <212> DNA <213> Artificial Sequence <400> 493 gaattcggtg cttacaaatt cctga 25 <210> 494 <211> 25 <212> DNA <213> Artificial Sequence <400> 494 agcaacttcc atcccatct tcaata 25 <210> 495 <211> 25 <212> DNA <213> Artificial Sequence <400> 495 gaattcaact aagcttacac ccaca 25 <210> 496 <211> 25 <212> DNA <213> Artificial Sequence <400> 496 tcacagatgt gccaatgtga ttatg 25 <210> 497 <211> 25 <212> DNA <213> Artificial Sequence <400> 497 gaagtagaga gcataactgt acggt 25 <210> 498 <211> 25 <212> DNA <213> Artificial Sequence <400> 498 ttttggtgta tcagagaatg cccta 25 <210> 499 <211> 23 <212> DNA <213> Artificial Sequence <400> 499 gaagtactgt gtgcaaccca aag 23 <210> 500 <211> 25 <212> DNA <213> Artificial Sequence <400> 500 tggaatttcc atgaaacgca aacta 25 <210> 501 <211> 25 <212> DNA <213> Artificial Sequence <400> 501 gaacttctca gtttgcagat gatcc 25 <210> 502 <211> 25 <212> DNA <213> Artificial Sequence <400> 502 gaaagtagct tttgggctag agttc 25 <210> 503 <211> 25 <212> DNA <213> Artificial Sequence <400> 503 ctttgatgct catccatctc caatc 25 <210> 504 <211> 25 <212> DNA <213> Artificial Sequence <400> 504 ggtactacag tcaatgattg aagca 25 <210> 505 <211> 25 <212> DNA <213> Artificial Sequence <400> 505 ctttagtttc tgtagttccc cggta 25 <210> 506 <211> 25 <212> DNA <213> Artificial Sequence <400> 506 tgagatttgt atgtcggaat agaga 25 <210> 507 <211> 25 <212> DNA <213> Artificial Sequence <400> 507 ctttagtcga catgtacggg aaatg 25 <210> 508 <211> 24 <212> DNA <213> Artificial Sequence <400> 508 taacacgaaa cggccttaga aaac 24 <210> 509 <211> 25 <212> DNA <213> Artificial Sequence <400> 509 ctttaacctg ttcttaaccc accac 25 <210> 510 <211> 25 <212> DNA <213> Artificial Sequence <400> 510 ggtcggttag cttttggtat ctttc 25 <210> 511 <211> 25 <212> DNA <213> Artificial Sequence <400> 511 ctggaatttc cctcacaact gattc 25 <210> 512 <211> 25 <212> DNA <213> Artificial Sequence <400> 512 ccatggtttt gggattatgg tatgt 25 <210> 513 <211> 25 <212> DNA <213> Artificial Sequence <400> 513 ctgcttccaa ccaattgttt tgaag 25 <210> 514 <211> 25 <212> DNA <213> Artificial Sequence <400> 514 atttaccttt agcgcaaaga aacca 25 <210> 515 <211> 25 <212> DNA <213> Artificial Sequence <400> 515 ctgcaacggt caaagctata ttagg 25 <210> 516 <211> 25 <212> DNA <213> Artificial Sequence <400> 516 taggattttt gggtgaaaac tggtg 25 <210> 517 <211> 25 <212> DNA <213> Artificial Sequence <400> 517 ctgaactact tggatcaatc agcac 25 <210> 518 <211> 25 <212> DNA <213> Artificial Sequence <400> 518 caagtgatcc acatgattat agggg 25 <210> 519 <211> 25 <212> DNA <213> Artificial Sequence <400> 519 ctctttgact gattatttga gggcg 25 <210> 520 <211> 25 <212> DNA <213> Artificial Sequence <400> 520 ttaagatcgt ccaaagcaac ttctg 25 <210> 521 <211> 25 <212> DNA <213> Artificial Sequence <400> 521 ctcttcatct gctctatcca tgtga 25 <210> 522 <211> 25 <212> DNA <213> Artificial Sequence <400> 522 tcttcgatta tgtttacctg cctca 25 <210> 523 <211> twenty four <212> DNA <213> Artificial Sequence <400> 523 ctctgcaaac acactttctt cctc 24 <210> 524 <211> 25 <212> DNA <213> Artificial Sequence <400> 524 gatgttaatg aaggtgatgc tgctc 25 <210> 525 <211> 25 <212> DNA <213> Artificial Sequence <400> 525 ctctccttca aatccttcaa aaccc 25 <210> 526 <211> 25 <212> DNA <213> Artificial Sequence <400> 526 aagaaagagt tgccagtgat tgatg 25 <210> 527 <211> 25 <212> DNA <213> Artificial Sequence <400> 527 ctcctgattc tgcgataatg ctttt 25 <210> 528 <211> 25 <212> DNA <213> Artificial Sequence <400> 528 taatcaaaca actcgtctcc gatct 25 <210> 529 <211> 25 <212> DNA <213> Artificial Sequence <400> 529 ctcatccaaa cactacaaaa tggct 25 <210> 530 <211> 25 <212> DNA <213> Artificial Sequence <400> 530 attctggctc acttttcatg tatgg 25 <210> 531 <211> 24 <212> DNA <213> Artificial Sequence <400> 531 ctcagtgacc tcgttcaaag tttc 24 <210> 532 <211> 25 <212> DNA <213> Artificial Sequence <400> 532 aaaggtacaa caatccgtct atcgt 25 <210> 533 <211> 25 <212> DNA <213> Artificial Sequence <400> 533 ctcaacacgg ttttcttgta caaga 25 <210> 534 <211> 25 25<212> DNA 25<213> Artificial Sequence 25<400> 534 25aaggacctga taagctgtta ttcca 25 25<210> 535 25<211> 25 25<212> DNA 25<213> Artificial Sequence 25<400> 535 25ctatttcatg cagcctgctg aatac 25 25<210> 536 23<211> 23 23<212> DNA 23<213> Artificial Sequence 23<400> 536 23cacaatcaat ctcttccccc gaa 23 23<210> 537 25<211> 25 25<212> DNA 25<213> Artificial Sequence 25<400> 537 25ctattcaaat ctcgggttca tgtcc 25 25<210> 538 25<211> 25 25<212> DNA 25<213> Artificial Sequence 25<400> 538 25tccaccctgc tgttgaatta tctta 25 25<210> 539 25<211> 25 25<212> DNA 25<213> Artificial Sequence 25<400> 539 25ctattagcgt atcgagattt gggga 25 <210> 540 <211> 25 <212> DNA <213> Artificial Sequence <400> 540 ggctgctttt catttatagt cacgt 25 <210> 541 <211> 25 <212> DNA <213> Artificial Sequence <400> 541 ctatgctcag ggttcttcag gatta 25 <210> 542 <211> 25 <212> DNA <213> Artificial Sequence <400> 542 tgccaatccc agaaaactac taact 25 <210> 543 <211> 25 <212> DNA <213> Artificial Sequence <400> 543 ctagtgtgat aggagacacc aagag 25 <210> 544 <211> 25 <212> DNA <213> Artificial Sequence <400> 544 tacaccatct cttttattca cgggt 25 <210> 545 <211> 25 <212> DNA <213> Artificial Sequence <400> 545 ctacttcttc tccttcccag acaaa 25 <210> 546 <211> 25 <212> DNA <213> Artificial Sequence <400> 546 aaaatacccc tattacccga actcg 25 <210> 547 <211> 25 <212> DNA <213> Artificial Sequence <400> 547 ctacggaatc ttacctcaga tcacg 25 <210> 548 <211> 28 <212> DNA <213> Artificial Sequence <400> 548 aggaggagtt cataaatact cttcttgt 28 <210> 549 <211> 25 <212> DNA <213> Artificial Sequence <400> 549 ctaatgcaag ggaattggtt atgct 25 <210> 550 <211> 25 <212> DNA <213> Artificial Sequence <400> 550 ccctccgaaa tatttttgta acggt 25 <210> 551 <211> 25 <212> DNA <213> Artificial Sequence <400> 551 ctaaatccga tccaacccaa cattc 25 <210> 552 <211> 25 <212> DNA <213> Artificial Sequence <400> 552 gagcaacagt agaagcaatt ttcct 25 <210> 553 <211> 25 <212> DNA <213> Artificial Sequence <400> 553 cgttgagtaa tattgtgcca tctca 25 <210> 554 <211> 25 <212> DNA <213> Artificial Sequence <400> 554 aaaaccagct actcggattg aaaag 25 <210> 555 <211> 25 <212> DNA <213> Artificial Sequence <400> 555 cgtccccaag cctatattac aagtt 25 <210> 556 <211> 25 <212> DNA <213> Artificial Sequence <400> 556 GATGCTCACATGTGCTAAAACTGA 25 <210> 557 <211> 25 <212> DNA <213> Artificial Sequence <400> 557 CGTAGATCCATGGAAAGTTTATGGG 25 <210> 558 <211> 25 <212> DNA <213> Artificial Sequence <400> 558 TTCTTTCATCCCATTCCACCAATAGT 25 <210> 559 <211> 25 <212> DNA <213> Artificial Sequence <400> 559 CGGTTCTGGTC TAATCCATTCAAAA 25 <210> 560 <211> 25 <212> DNA <213> Artificial Sequence <400> 560 AGTTGCTCCGAGATTTCCTTAGAGT 25 <210> 561 <211> 25 <212> DNA <213> Artificial Sequence <400> 561 CGGGAGTCTGAGATAGTGATGAATT 25 <210> 562 <211> 25 <212> DNA <213> Artificial Sequence <400> 562 aagcaattcc tcttttgaac aacct 25 <210> 563 <211> 25 <212> DNA <213> Artificial Sequence <400> 563 cggatcggat catcttgaga cttaa 25 <210> 564 <211> 25 <212> DNA <213> Artificial Sequence <400> 564 caagataaga gaatccgtca cagga 25 <210> 565 <211> 25 <212> DNA <213> Artificial Sequence <400> 565 cggataattg ccagaggttt gaaac 25 <210> 566 <211> 25 <212> DNA <213> Artificial Sequence <400> 566 tcctctcaat ttctcgttcg gtaat 25 <210> 567 <211> 25 <212> DNA <213> Artificial Sequence <400> 567 cggagcatat ctagccagtg aatta 25 <210> 568 <211> 25 <212> DNA <213> Artificial Sequence <400> 568 cctctgatac tgaatctgca gagtt 25 <210> 569 <211> 25 <212> DNA <213> Artificial Sequence <400> 569 cggacctttc aagaactagt tttcc 25 <210> 570 <211> 25 <212> DNA <213> Artificial Sequence <400> 570 agcaactgtt cacttattcc ttgtg 25 <210> 571 <211> 25 <212> DNA <213> Artificial Sequence <400> 571 cgctattatc ttaacactgc caagg 25 <210> 572 <211> 25 <212> DNA <213> Artificial Sequence <400> 572 acaagtttct ttccctgttt gaacc 25 <210> 573 <211> 25 <212> DNA <213> Artificial Sequence <400> 573 cgcaattata cccctcttga aactc 25 <210> 574 <211> 25 <212> DNA <213> Artificial Sequence <400> 574 tacagctctc atttgaaaga gggaa 25 <210> 575 <211> 25 <212> DNA <213> Artificial Sequence <400> 575 cgcaagttaa ggtagacaag ttgat 25 <210> 576 <211> 25 <212> DNA <213> Artificial Sequence <400> 576 gaccaaacat caggagcttc taaag 25 <210> 577 <211> 25 <212> DNA <213> Artificial Sequence <400> 577 cgatatgttt cctcaatcgt agtgc 25 <210> 578 <211> 25 <212> DNA <213> Artificial Sequence <400> 578 gtaacccatt ttgtcccgac taaaa 25 <210> 579 <211> 25 <212> DNA <213> Artificial Sequence <400> 579 cgacaccata aatcttctgc ttctc 25 <210> 580 <211> 25 <212> DNA <213> Artificial Sequence <400> 580 gaatttcaaa gtcttggttc cagcg 25 <210> 581 <211> 25 <212> DNA <213> Artificial Sequence <400> 581 ccttttcatc ccttaataac tgccc 25 <210> 582 <211> 25 <212> DNA <213> Artificial Sequence <400> 582 gtatgatgac tagcaggatg agtgg 25 <210> 583 <211> 25 <212> DNA <213> Artificial Sequence <400> 583 ccttcaattt agtcggtgcc atatg 25 <210> 584 <211> 25 <212> DNA <213> Artificial Sequence <400> 584 cttcgcttag agtggatagg tactc 25 <210> 585 <211> 25 <212> DNA <213> Artificial Sequence <400> 585 cctgggaact gattcttttg ttgat 25 <210> 586 <211> 27 <212> DNA <213> Artificial Sequence <400> 586 acaaacaaac tcaaaggaaa agaaaca 27 <210> 587 <211> 25 <212> DNA <213> Artificial Sequence <400> 587 cctccttgat gatatcccaa caaga 25 <210> 588 <211> 25 <212> DNA <213> Artificial Sequence <400> 588 agaaactggc ttgaagaaaa ggaag 25 <210> 589 <211> 25 <212> DNA <213> Artificial Sequence <400> 589 cctccacagg aattatctct cagat 25 <210> 590 <211> 25 <212> DNA <213> Artificial Sequence <400> 590 acatgatctt aaacaaaaac ggggg 25 <210> 591 <211> 25 <212> DNA <213> Artificial Sequence <400> 591 cctccaattg ggttttatgt tcact 25 <210> 592 <211> 25 <212> DNA <213> Artificial Sequence <400> 592 cttaagcagc tcccatcaca ttttc 25 <210> 593 <211> 25 <212> DNA <213> Artificial Sequence <400> 593 cctacttctt aatacagggt gctca 25 <210> 594 <211> 25 <212> DNA <213> Artificial Sequence <400> 594 gagctaggtc cctaagaaat gcata 25 <210> 595 <211> 25 <212> DNA <213> Artificial Sequence <400> 595 cctaaaagct tggccaaaac tctat 25 <210> 596 <211> 25 <212> DNA <213> Artificial Sequence <400> 596 atgaattcgt aaaacgtgct agagc 25 <210> 597 <211> 25 <212> DNA <213> Artificial Sequence <400> 597 ccggattgct gacttatttg atcag 25 <210> 598 <211> 25 <212> DNA <213> Artificial Sequence <400> 598 attgttcatc aactccatga atgca 25 <210> 599 <211> 25 <212> DNA <213> Artificial Sequence <400> 599 ccgacatttc atattagggt ccgat 25 <210> 600 <211> 25 <212> DNA <213> Artificial Sequence <400> 600 gtaatctgca cgtacctgta tttcg 25 <210> 601 <211> 25 <212> DNA <213> Artificial Sequence <400> 601 ccgacaaatg ctgcattatc tctac 25 <210> 602 <211> 25 <212> DNA <213> Artificial Sequence <400> 602 gtttgtgtgg tagaggtttg aagag 25 <210> 603 <211> 25 <212> DNA <213> Artificial Sequence <400> 603 ccgaaaatgt gttgcatggt ataga 25 <210> 604 <211> 25 <212> DNA <213> Artificial Sequence <400> 604 acacacattc catggttttc attca 25 <210> 605 <211> 25 <212> DNA <213> Artificial Sequence <400> 605 cccgtattca agacatgtaa catgg 25 <210> 606 <211> 25 <212> DNA <213> Artificial Sequence <400> 606 tgaagtttgg tcttgtgaca tcaag 25 <210> 607 <211> 25 <212> DNA <213> Artificial Sequence <400> 607 cccgaatgcc gtcaactaaa ataaa 25 <210> 608 <211> 25 <212> DNA <213> Artificial Sequence <400> 608 ttcgaggtgt aacagtctat taggc 25 <210> 609 <211> 25 <212> DNA <213> Artificial Sequence <400> 609 cccctgaagt aaatacaaca tcagc 25 <210> 610 <211> 25 <212> DNA <213> Artificial Sequence <400> 610 tattgtcaac gtttcttctt tcccg 25 <210> 611 <211> 25 <212> DNA <213> Artificial Sequence <400> 611 cccctctatg gaattgctta ctaat 25 <210> 612 <211> 25 <212> DNA <213> Artificial Sequence <400> 612 gtaatcagtt ctttgttgag ctgct 25 <210> 613 <211> 25 <212> DNA <213> Artificial Sequence <400> 613 cccctcaagt taggaacact aaaga 25 <210> 614 <211> 25 <212> DNA <213> Artificial Sequence <400> 614 caaattgcag caaaccctgt ttatc 25 <210> 615 <211> 25 <212> DNA <213> Artificial Sequence <400> 615 cccaagacca ctaatcctga aaatg 25 <210> 616 <211> 25 <212> DNA <213> Artificial Sequence <400> 616 tcttcattag gcatctaggt gttgt 25 <210> 617 <211> 25 <212> DNA <213> Artificial Sequence <400> 617 ccattgtctt ttgctctctt ttcct 25 <210> 618 <211> 25 <212> DNA <213> Artificial Sequence <400> 618 actctgcaga ctaaatcagc tgtaa 25 <210> 619 <211> 24 <212> DNA <213> Artificial Sequence <400> 619 ccatcttcat actcgaaggc gtaa 24 <210> 620 <211> 29 <212> DNA <213> Artificial Sequence <400> 620 cgattggaag attgaataga aatatgggt 29 <210> 621 <211> 25 <212> DNA <213> Artificial Sequence <400> 621 ccatcaggaa attgctccag ataac 25 <210> 622 <211> 25 <212> DNA <213> Artificial Sequence <400> 622 gtttgccatg gtaagactga gattt 25 <210> 623 <211> 25 <212> DNA <213> Artificial Sequence <400> 623 ccagttgaga tccaagagta ttcct 25 <210> 624 <211> 25 <212> DNA <213> Artificial Sequence <400> 624 aaatgagtca acaggtaaat gcgag 25 <210> 625 <211> 25 <212> DNA <213> Artificial Sequence <400> 625 ccagtcttag ctaaagatca ttcgg 25 <210> 626 <211> 25 <212> DNA <213> Artificial Sequence <400> 626 actcatggac caataatctt acccc 25 <210> 627 <211> 25 <212> DNA <213> Artificial Sequence <400> 627 ccacttatac ggtccgcata tcttt 25 <210> 628 <211> 25 <212> DNA <213> Artificial Sequence <400> 628 tagagaaggg tttttgagct ctcaa 25 <210> 629 <211> 25 <212> DNA <213> Artificial Sequence <400> 629 cccacctcgta aactccccaa ataat 25 <210> 630 <211> 25 <212> DNA <213> Artificial Sequence <400> 630 attgtaagac cattaccagc ctagg 25 <210> 631 <211> 25 <212> DNA <213> Artificial Sequence <400> 631 ccacaaactt ttatccgaac cttgt 25 <210> 632 <211> 25 <212> DNA <213> Artificial Sequence <400> 632 cactaaagac ctactactca cagca 25 <210> 633 <211> 25 <212> DNA <213> Artificial Sequence <400> 633 ccaatagcat acatctccaa cacac 25 <210> 634 <211> 25 <212> DNA <213> Artificial Sequence <400> 634 atggtttaaa atggatggcc tgttt 25 <210> 635 <211> 25 <212> DNA <213> Artificial Sequence <400> 635 ccaagtgttt attataacct gcccc 25 <210> 636 <211> 25 <212> DNA <213> Artificial Sequence <400> 636 acaccggcaa gaaatctaca atttt 25 <210> 637 <211> 25 <212> DNA <213> Artificial Sequence <400> 637 ccaagggctt ttaactttct acaca 25 <210> 638 <211> 25 <212> DNA <213> Artificial Sequence <400> 638 agttcatcta caccgagaaa actca 25 <210> 639 <211> 25 <212> DNA <213> Artificial Sequence <400> 639 ccaaactcat cccgatagta cttca 25 <210> 640 <211> 25 <212> DNA <213> Artificial Sequence <400> 640 aggaccatgt gactattatt agggt 25 <210> 641 <211> 25 <212> DNA <213> Artificial Sequence <400> 641 ccaaaacctc aacttggaatttcct 25 <210> 642 <211> 25 <212> DNA <213> Artificial Sequence <400> 642 tatcttcttg gcaggaatgt ctacg 25 <210> 643 <211> 25 <212> DNA <213> Artificial Sequence <400> 643 catttgcatt gtcttgttct gcaaa 25 <210> 644 <211> 25 <212> DNA <213> Artificial Sequence <400> 644 cttgaattga tggcaaagaa tcgtg 25 <210> 645 <211> 25 <212> DNA <213> Artificial Sequence <400> 645 cattattggg atcatttacc acggg 25 <210> 646 <211> 25 <212> DNA <213> Artificial Sequence <400> 646 agatcctttg gatatgtgac aacag 25 <210> 647 <211> 25 <212> DNA <213> Artificial Sequence <400> 647 catgagacgg taaatacatt cctgc 25 <210> 648 <211> 25 <212> DNA <213> Artificial Sequence <400> 648 agccagagaa gtattagttg ctcaa 25 <210> 649 <211> 25 <212> DNA <213> Artificial Sequence <400> 649 catctggcac tcttcttttt cgatt 25 <210> 650 <211> 25 <212> DNA <213> Artificial Sequence <400> 650 acaaattgaa cacctttttc cctgt 25 <210> 651 <211> 23 <212> DNA <213> Artificial Sequence <400> 651 catctgcaaa ggcttcaaat ggt 23 <210> 652 <211> 25 <212> DNA <213> Artificial Sequence <400> 652 ctgatgcact tagctgcaaa ttgat 25 <210> 653 <211> 25 <212> DNA <213> Artificial Sequence <400> 653 catcaaaggt ctcactacca acttc 25 <210> 654 <211> 25 <212> DNA <213> Artificial Sequence <400> 654 agtgatggat ttcagccatt tagga 25 <210> 655 <211> 25 <212> DNA <213> Artificial Sequence <400> 655 catatgctca gaatccactt gatgc 25 <210> 656 <211> 25 <212> DNA <213> Artificial Sequence <400> 656 ttaaacctat ttgactaggc acgga 25 <210> 657 <211> 25 <212> DNA <213> Artificial Sequence <400> 657 catatctcta atgcgattgt caccg 25 <210> 658 <211> 25 <212> DNA <213> Artificial Sequence <400> 658 tcattctaca acgagttgac atcca 25 <210> 659 <211> 25 <212> DNA <213> Artificial Sequence <400> 659 cagttgctaa gtcaaccctc aattt 25 <210> 660 <211> 24 <212> DNA <213> Artificial Sequence <400> 660 cttcttttgg gttccactag ggtt 24 <210> 661 <211> 25 <212> DNA <213> Artificial Sequence <400> 661 cagtggatag agaatgtcct ttcca 25 <210> 662 <211> 25 <212> DNA <213> Artificial Sequence <400> 662 tacccatgaa gcttgtctaa cacaa 25 <210> 663 <211> 25 <212> DNA <213> Artificial Sequence <400> 663 caggcaccag aaaaatctag tgttt 25 <210> 664 <211> 25 <212> DNA <213> Artificial Sequence <400> 664 cggctagtgt atatggatat gagca 25 <210> 665 <211> 25 <212> DNA <213> Artificial Sequence <400> 665 cagctcatag attgcgttaa tcacc 25 <210> 666 <211> 25 <212> DNA <213> Artificial Sequence <400> 666 ccaatgtaaa aggcgctata tggag 25 <210> 667 <211> 25 <212> DNA <213> Artificial Sequence <400> 667 cacttcaaga tacgcttatc cacac 25 <210> 668 <211> 25 <212> DNA <213> Artificial Sequence <400> 668 gaattgcaaa aggagaaaat cacgg 25 <210> 669 <211> 25 <212> DNA <213> Artificial Sequence <400> 669 cacgtccaaa cacaacttca atttc 25 <210> 670 <211> 25 <212> DNA <213> Artificial Sequence <400> 670 ctaacagaag gagaacattt ggctg 25 <210> 671 <211> 25 <212> DNA <213> Artificial Sequence <400> 671 caccttgcga tgtaagtggt atttc 25 <210> 672 <211> 25 <212> DNA <213> Artificial Sequence <400> 672 cacaacatgt gcacttgtag catat 25 <210> 673 <211> 25 <212> DNA <213> Artificial Sequence <400> 673 cacctgagag ctcacataag tagtt 25 <210> 674 <211> 25 <212> DNA <213> Artificial Sequence <400> 674 atggtcactg aaagagacat cttca 25 <210> 675 <211> 25 <212> DNA <213> Artificial Sequence <400> 675 cacctcaaca gtcaggtttt gtaaa 25 <210> 676 <211> 25 <212> DNA <213> Artificial Sequence <400> 676 cactgtggtt gcccatttat aagaa 25 <210> 677 <211> 25 <212> DNA <213> Artificial Sequence <400> 677 caccattcttttggagatca tgtgt 25 <210> 678 <211> 25 <212> DNA <213> Artificial Sequence <400> 678 ttttgttatg actccgaggg attac 25 <210> 679 <211> 25 <212> DNA <213> Artificial Sequence <400> 679 caccatgtttttacagcatc tcact 25 <210> 680 <211> 25 <212> DNA <213> Artificial Sequence <400> 680 gtaggcaaaa ctttcaggcc ttaac 25 <210> 681 <211> 25 <212> DNA <213> Artificial Sequence <400> 681 caccaaagag aacagacaac ttcat 25 <210> 682 <211> 25 <212> DNA <213> Artificial Sequence <400> 682 ccccacttga atgttactat ttgcc 25 <210> 683 <211> 25 <212> DNA <213> Artificial Sequence <400> 683 cacaaatcca aaatcgagct cacta 25 <210> 684 <211> 25 <212> DNA <213> Artificial Sequence <400> 684 agtttttaac caagtgcacc atcaa 25 <210> 685 <211> 25 <212> DNA <213> Artificial Sequence <400> 685 cacaaagtat tttctcttcg ccagt 25 <210> 686 <211> 25 <212> DNA <213> Artificial Sequence <400> 686 gtctgggtcg ttctgagttt ttatc 25 <210> 687 <211> 25 <212> DNA <213> Artificial Sequence <400> 687 cacaaaccag atatgcacac acata 25 <210> 688 <211> 25 <212> DNA <213> Artificial Sequence <400> 688 ccttaagtga aagcgttgac caata 25 <210> 689 <211> 25 <212> DNA <213> Artificial Sequence <400> 689 caatgggcct taaatgcatt ttcac 25 <210> 690 <211> 25 <212> DNA <213> Artificial Sequence <400> 690 aattattgtc acctggagca attcc 25 <210> 691 <211> 25 <212> DNA <213> Artificial Sequence <400> 691 caatgcactc gagtacattt tgaga 25 <210> 692 <211> 25 <212> DNA <213> Artificial Sequence <400> 692 ctatagcggg cactagaact agaaa 25 <210> 693 <211> 25 <212> DNA <213> Artificial Sequence <400> 693 caagtaatga gccgaggact aaaac 25 <210> 694 <211> 25 <212> DNA <213> Artificial Sequence <400> 694 atactatgtt gctcggattc tccaa 25 <210> 695 <211> 25 <212> DNA <213> Artificial Sequence <400> 695 caaggtcttg tatttgcatg atcca 25 <210> 696 <211> 25 <212> DNA <213> Artificial Sequence <400> 696 ctattttggt acataggctt tcggc 25 <210> 697 <211> 25 <212> DNA <213> Artificial Sequence <400> 697 caaggaacta agtaaggtgg gatga 25 <210> 698 <211> 25 <212> DNA <213> Artificial Sequence <400> 698 attccatact cagcctggaa tcaat 25 <210> 699 <211> 25 <212> DNA <213> Artificial Sequence <400> 699 caacccttta atctgtggta aaccc 25 <210> 700 <211> 25 <212> DNA <213> Artificial Sequence <400> 700 tctagatgga gaaacagtga acagg 25 <210> 701 <211> 25 <212> DNA <213> Artificial Sequence <400> 701 caaagaaaat catggaaggt gtgga 25 <210> 702 <211> 25 <212> DNA <213> Artificial Sequence <400> 702 gctttccata tgctctgaac tacct 25 <210> 703 <211> 25 <212> DNA <213> Artificial Sequence <400> 703 attttctaaa tgtcagtatg cgact 25 <210> 704 <211> 25 <212> DNA <213> Artificial Sequence <400> 704 ggctaggccc atctatcttc taaaa 25 <210> 705 <211> 25 <212> DNA <213> Artificial Sequence <400> 705 atttggtttc ttggagtgca atgat 25 <210> 706 <211> 25 <212> DNA <213> Artificial Sequence <400> 706 ccgtgtaata tcttcccttg ctcta 25 <210> 707 <211> 25 <212> DNA <213> Artificial Sequence <400> 707 atttggtggt actctttcac aatgc 25 <210> 708 <211> 26 <212> DNA <213> Artificial Sequence <400> 708 agaatggtcc ctaaacttat aggagt 26 <210> 709 <211> 25 <212> DNA <213> Artificial Sequence <400> 709 atttgacggg ccatagaatg atcta 25 76<210> 711 77<211> 25 78<212> DNA 79<213> Artificial Sequence 80<400> 711 81tcaactaaag aaagcagatt cacgg 25 82<210> 711 83<211> 25 84<212> DNA 85<213> Artificial Sequence 86<400> 711 87atttccttct tccattgctt ctgtc 25 88<210> 712 89<211> 25 90<212> DNA 91<213> Artificial Sequence 92<400> 712 93gaaacagtat ccactagttg caagg 25 94<210> 713 95<211> 25 96<212> DNA 97<213> Artificial Sequence 98<400> 713 99atttaggttc tatgagtatg gcgct 25 100<210> 714 101<211> 24 102<212> DNA 103<213> Artificial Sequence 104<400> 714 105gcggaatcta gtgcaattcg ttaa 24 106<210> 715 107<211> 25 108<212> DNA 109<213> Artificial Sequence <400> 715 attggacagg aaatgagaga gtcaa 25 <210> 716 <211> 24 <212> DNA <213> Artificial Sequence <400> 716 aatgttggtc aactactgga gagg 24 <210> 717 <211> 25 <212> DNA <213> Artificial Sequence <400> 717 attgctgtcg ataaaacctc aggaa 25 <210> 718 <211> 25 <212> DNA <213> Artificial Sequence <400> 718 aaggtgtccc aaattaaaca gacgt 25 <210> 719 <211> 23 <212> DNA <213> Artificial Sequence <400> 719 attgaggcac ggtggaatca aat 23 <210> 720 <211> 25 <212> DNA <213> Artificial Sequence <400> 720 cacggttgtc ttcaaagtct aatgt 25 <210> 721 <211> 25 <212> DNA <213> Artificial Sequence <400> 721 attgaggatt ggaaaacaaa gtgct 25 <210> 722 <211> 25 <212> DNA <213> Artificial Sequence <400> 722 accactaaca tcaactcaca ttgtt 25 <210> 723 <211> 25 <212> DNA <213> Artificial Sequence <400> 723 attcttgaat gcaacatcca ttggt 25 <210> 724 <211> 27 <212> DNA <213> Artificial Sequence <400> 724 aggcagagac ggatataaag tatatga 27 <210> 725 <211> 25 <212> DNA <213> Artificial Sequence <400> 725 attcatgcag tttgaatgtt gggaa 25 <210> 726 <211> 26 <212> DNA <213> Artificial Sequence <400> 726 acattaggttttggtagagt aggaga 26 <210> 727 <211> 25 <212> DNA <213> Artificial Sequence <400> 727 attcaaatta cagcccctgt cagta 25 <210> 728 <211> 25 <212> DNA <213> Artificial Sequence <400> 728 agaggtctct gcattatcga caaaa 25 <210> 729 <211> 25 <212> DNA <213> Artificial Sequence <400> 729 attagctatt ggaaggccta tcagg 25 <210> 730 <211> 25 <212> DNA <213> Artificial Sequence <400> 730 aaacacctcc atgctttcctttaag 25 <210> 731 <211> 25 <212> DNA <213> Artificial Sequence <400> 731 attaatgaac cacggaaaac aacca 25 <210> 732 <211> 25 <212> DNA <213> Artificial Sequence <400> 732 gtcataattc gagaggctgc aaata 25 <210> 733 <211> 25 <212> DNA <213> Artificial Sequence <400> 733 atgtggctaa tgggagtact catac 25 <210> 734 <211> 25 <212> DNA <213> Artificial Sequence <400> 734 ataccacgca aagaaattct cacaa 25 <210> 735 <211> 25 <212> DNA <213> Artificial Sequence <400> 735 atgtccttac aaagaggtca gagtc 25 <210> 736 <211> 25 <212> DNA <213> Artificial Sequence <400> 736 attaatggag tagcttcact aggca 25 <210> 737 <211> 25 <212> DNA <213> Artificial Sequence <400> 737 atggatgagt tgagtttgat ttgca 25 <210> 738 <211> 25 <212> DNA <213> Artificial Sequence <400> 738 ctcaaatcac gagcactatc tctct 25 <210> 739 <211> 25 <212> DNA <213> Artificial Sequence <400> 739 atgagaacta ggtttgttgg atcga 25 <210> 740 <211> 25 <212> DNA <213> Artificial Sequence <400> 740 gatgctgcta ggtaacacca tttac 25 <210> 741 <211> 25 <212> DNA <213> Artificial Sequence <400> 741 atgaaggatg ccttttatcg gaaac 25 <210> 742 <211> 25 <212> DNA <213> Artificial Sequence <400> 742 gggatagctt gttacatagg cttga 25 <210> 743 <211> 25 <212> DNA <213> Artificial Sequence <400> 743 atcgagccat acagaattct accaa 25 <210> 744 <211> 25 <212> DNA <213> Artificial Sequence <400> 744 tacttggata tgtcctcttt ggctt 25 <210> 745 <211> 25 <212> DNA <213> Artificial Sequence <400> 745 atcccaggtg ttgttatcat gaaga 25 <210> 746 <211> 25 <212> DNA <213> Artificial Sequence <400> 746 taggactcac aacttaccatctcac 25 <210> 747 <211> 25 <212> DNA <213> Artificial Sequence <400> 747 atccagataa cctatctcct gagga 25 <210> 748 <211> 25 <212> DNA <213> Artificial Sequence <400> 748 tgtgtctata tggtttacgt acggt 25 <210> 749 <211> 25 <212> DNA <213> Artificial Sequence <400> 749 atccaaccca tgatctagaa ttggc 25 <210> 750 <211> 26 <212> DNA <213> Artificial Sequence <400> 750 cttatcttgc cgtacatcac acaaaa 26 <210> 751 <211> 25 <212> DNA <213> Artificial Sequence <400> 751 atcatttaaa taccccagtc actgc 25 <210> 752 <211> 25 <212> DNA <213> Artificial Sequence <400> 752 gcagatggcc tcggaaatta gttaa 25 <210> 753 <211> 25 <212> DNA <213> Artificial Sequence <400> 753 atcatctctt tgggctatac ggaaa 25 <210> 754 <211> 25 <212> DNA <213> Artificial Sequence <400> 754 atgaaatcgc atccgtgttg ttaaa 25 <210> 755 <211> 25 <212> DNA <213> Artificial Sequence <400> 755 atcaagtggt tagacaacaa ccaac 25 <210> 756 <211> 25 <212> DNA <213> Artificial Sequence <400> 756 acaaacaggc aaacaattct ctcaa 25 <210> 757 <211> 25 <212> DNA <213> Artificial Sequence <400> 757 atcaagatta acgaaactgt tggca 25 <210> 758 <211> 25 <212> DNA <213> Artificial Sequence <400> 758 ccattgtgag gttttactga tcacc 25 <210> 759 <211> 25 <212> DNA <213> Artificial Sequence <400> 759 atcaagagta cctttgagac aggtc 25 <210> 760 <211> 25 <212> DNA <213> Artificial Sequence <400> 760 ggtctttatc agaacctcca gacat 25 761 25 212 DNA 213 Artificial Sequence 400 761 atcaaaacta agggcaaaag tcagg 25 762 25 212 DNA 213 Artificial Sequence 400 762 gctctaacat tacaaaggca agcaa 25 763 25 212 DNA 213 Artificial Sequence 400 763 atatgtaggg tcaagacacg ttgat 25 764 25 212 DNA 213 Artificial Sequence 400 764 taactacttc tcattcctgg atccg 25 765 25 212 DNA 213 Artificial Sequence 400 765 atatccagcc tttgaaccct cataa 25 766 25 212 DNA <213> Artificial Sequence <400> 766 atgatgactg ccttattgga gatga 25 <210> 767 <211> 25 <212> DNA <213> Artificial Sequence <400> 767 ataggtgcca tacaacgtta gctat 25 <210> 768 <211> 25 <212> DNA <213> Artificial Sequence <400> 768 cgtaatggga aaaggatgta agtcg 25 <210> 769 <211> 25 <212> DNA <213> Artificial Sequence <400> 769 ataggtgcaa ttttaggaga agggt 25 <210> 770 <211> 25 <212> DNA <213> Artificial Sequence <400> 770 tcccgtttca cccattctag taatt 25 <210> 771 <211> 25 <212> DNA <213> Artificial Sequence <400> 771 atagggacaa caatcaaagt acaag 25 <210> 772 <211> 25 <212> DNA <213> Artificial Sequence <400> 772 gttggagaca tcatgtgaat cttca 25 <210> 773 <211> 25 <212> DNA <213> Artificial Sequence <400> 773 atagctagct gtgtgacaaa ctaca 25 <210> 774 <211> 25 <212> DNA <213> Artificial Sequence <400> 774 caaaccttaa ctgaagatgg tca 25 <210> 775 <211> 25 <212> DNA <213> Artificial Sequence <400> 775 atagagtcaa acagagaagg aagga 25 <210> 776 <211> 25 <212> DNA <213> Artificial Sequence <400> 776 ttaagtccaa agcacctatt cagga 25 <210> 777 <211> 25 <212> DNA <213> Artificial Sequence <400> 777 atagagaaag ggggagaggc taaat 25 <210> 778 <211> 25 <212> DNA <213> Artificial Sequence <400> 778 cttagctcaa tggtaaaggg ggata 25 <210> 779 <211> 25 <212> DNA <213> Artificial Sequence <400> 779 ataactctag caccatgcct agatc 25 <210> 780 <211> 26 <212> DNA <213> Artificial Sequence <400> 780 ttttggtata aactgggaga cttttt 26 <210> 781 <211> 25 <212> DNA <213> Artificial Sequence <400> 781 ataacgccta tcaagagtgt cgaac 25 <210> 782 <211> 25 <212> DNA <213> Artificial Sequence <400> 782 ttttcagctg ttatatgggc ttgtc 25 <210> 783 <211> 25 <212> DNA <213> Artificial Sequence <400> 783 ataaatttgg gcaggattct tgcac 25 <210> 784 <211> 25 <212> DNA <213> Artificial Sequence <400> 784 gccaagagtg ttatcggtat ggtta 25 <210> 785 <211> 25 <212> DNA <213> Artificial Sequence <400> 785 agttgtgagg gaagttgaat aagga 25 <210> 786 <211> 25 <212> DNA <213> Artificial Sequence <400> 786 ggccccgtaa aaactaactc ataac 25 <210> 787 <211> 25 <212> DNA <213> Artificial Sequence <400> 787 agttgaagga gtgttgggga aataa 25 <210> 788 <211> 25 <212> DNA <213> Artificial Sequence <400> 788 agaatttcca gtcttgaaca cttgt 25 <210> 789 <211> 25 <212> DNA <213> Artificial Sequence <400> 789 agtctaatgc aatgcagttt gatct 25 <210> 790 <211> 25 <212> DNA <213> Artificial Sequence <400> 790 acaatgtagg ataacagtcc agctt 25 <210> 791 <211> 25 <212> DNA <213> Artificial Sequence <400> 791 agtcggatgg tagttgttct tactt 25 <210> 792 <211> 25 <212> DNA <213> Artificial Sequence <400> 792 cctctcattt tgagcatttg agact 25 <210> 793 <211> 25 <212> DNA <213> Artificial Sequence <400> 793 agtcgaagga acattaatct cctcc 25 <210> 794 <211> 25 <212> DNA <213> Artificial Sequence <400> 794 actatggatt tggagagctg agttt 25 <210> 795 <211> 25 <212> DNA <213> Artificial Sequence <400> 795 agtatggtac cctccaaatt cacat 25 <210> 796 <211> 25 <212> DNA <213> Artificial Sequence <400> 796 tatacactaa gattggcact ggcat 25 <210> 797 <211> 30 <212> DNA <213> Artificial Sequence <400> 797 agtaattgtt taattgaaag ttacgtactt 30 <210> 798 <211> 25 <212> DNA <213> Artificial Sequence <400> 798 ttaacatgaa gtgaaagacg aagcc 25 <210> 799 <211> 25 <212> DNA <213> Artificial Sequence <400> 799 aggtttgatg acttgtggag ataca 25 <210> 800 <211> 25 <212> DNA <213> Artificial Sequence <400> 800 aactttcttt tcgctttgca agtac 25 <210> 801 <211> 25 <212> DNA <213> Artificial Sequence <400> 801 aggttatggc ttacctttta gggtt 25 <210> 802 <211> 25 <212> DNA <213> Artificial Sequence <400> 802 tccttccaac agtctcccat aatac 25 <210> 803 <211> 25 <212> DNA <213> Artificial Sequence <400> 803 aggtaaattt tcagtgttta cgtgt 25 <210> 804 <211> 25 <212> DNA <213> Artificial Sequence <400> 804 gagtgctgtc ctgcttttgt ttatt 25 <210> 805 <211> 29 <212> DNA <213> Artificial Sequence <400> 805 agggtcaaat atgctcttaa aatatacga 29 <210> 806 <211> 25 <212> DNA <213> Artificial Sequence <400> 806 ccatgcaatt taaaaacatg gtcca 25 <210> 807 <211> 25 <212> DNA <213> Artificial Sequence <400> 807 agggattctt gaagaatggg ttgta 25 <210> 808 <211> 25 <212> DNA <213> Artificial Sequence <400> 808 ttgttttgaa agcaagttcc ttacg 25 <210> 809 <211> 25 <212> DNA <213> Artificial Sequence <400> 809 aggatgtaga tgagcaagat ggaaa 25 <210> 810 <211> 26 <212> DNA <213> Artificial Sequence <400> 810 aagattcttc ttgagttcat gtacaa 26 <210> 811 <211> 25 <212> DNA <213> Artificial Sequence <400> 811 agcttccgaa tgttcaaagt ctaga 25 <210> 812 <211> 25 <212> DNA <213> Artificial Sequence <400> 812 cttgttgaag gacacttagg gtttc 25 <210> 813 <211> 25 <212> DNA <213> Artificial Sequence <400> 813 agctccaaat catgtgtaag gtagt 25 <210> 814 <211> 25 <212> DNA <213> Artificial Sequence <400> 814 aaactaaaac tgcaccaaag tggaa 25 <210> 815 <211> 25 <212> DNA <213> Artificial Sequence <400> 815 agctatcccg acaattaatt cggta 25 <210> 816 <211> 25 <212> DNA <213> Artificial Sequence <400> 816 taacctgagg taagaggatg caaag 25 <210> 817 <211> 25 <212> DNA <213> Artificial Sequence <400> 817 agccaaacta gtcagaaggt aaagt 25 <210> 818 <211> 25 <212> DNA <213> Artificial Sequence <400> 818 tctccacatt aggtaagctt tccaa 25 <210> 819 <211> 25 <212> DNA <213> Artificial Sequence <400> 819 agcaggactt ctggagattt aagtt 25 <210> 820 <211> 25 <212> DNA <213> Artificial Sequence <400> 820 cgaacaagaa agaactagcc tacac 25 <210> 821 <211> 26 <212> DNA <213> Artificial Sequence <400> 821 agcaatatcc atgtaattgt caaagt 26 <210> 822 <211> 25 <212> DNA <213> Artificial Sequence <400> 822 ccgaaaaata ccgaaaccga actta 25 <210> 823 <211> 25 <212> DNA <213> Artificial Sequence <400> 823 agatggcact aagcttgagg taaat 25 <210> 824 <211> 25 <212> DNA <213> Artificial Sequence <400> 824 aagaaagaac tctcagggaa aaggg 25 <210> 825 <211> 25 <212> DNA <213> Artificial Sequence <400> 825 agatcaccgg ttcaactgat tctaa 25 <210> 826 <211> 25 <212> DNA <213> Artificial Sequence <400> 826 aaattccgga gccattcagt ttatc 25 <210> 827 <211> 25 <212> DNA <213> Artificial Sequence <400> 827 agatcaaccc ttaaggagca tgaat 25 <210> 828 <211> 25 <212> DNA <213> Artificial Sequence <400> 828 ggcatctgaa catgtcttca ttgat 25 <210> 829 <211> 25 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 829 agatacaact tgataccaca aacct 25 <210> 830 <211> 25 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 830 ccaataagga gaaggttttg tcagt 25 <210> 831 <211> 25 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 831 agaggctact aatttgagtt gtaga 25 <210> 832 <211> 25 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 832 aaaaatgccg tgttgaatga acatg 25 <210> 833 <211> 25 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 833 agacttacag tgtaatttcc agggt 25 <210> 834 <211> 24 <212> DNA <213> Artificial Sequence <400> 834 gcaaatggac tccagtgaag aaaa 24 <210> 835 <211> 25 <212> DNA <213> Artificial Sequence <400> 835 agacaggtgt atacatgcag aaagt 25 <210> 836 <211> 25 <212> DNA <213> Artificial Sequence <400> 836 acaacctttg acgtgatttt aggtc 25 <210> 837 <211> 25 <212> DNA <213> Artificial Sequence <400> 837 agacaaccat agagcaaaca gaaga 25 <210> 838 <211> 25 <212> DNA <213> Artificial Sequence <400> 838 aacctttgtt tcatataggc ttggc 25 <210> 839 <211> 25 <212> DNA <213> Artificial Sequence <400> 839 agacaaacaa cttagcaaag acgaa 25 <210> 840 <211> 25 <212> DNA <213> Artificial Sequence <400> 840 aagaaagaga gaaaatggca gcaac 25 <210> 841 <211> 25 <212> DNA <213> Artificial Sequence <400> 841 agaagccatt gatctcatcc tacaa 25 <210> 842 <211> 25 <212> DNA <213> Artificial Sequence <400> 842 aaaaagccca attgagctta ggaaa 25 <210> 843 <211> 25 <212> DNA <213> Artificial Sequence <400> 843 agaagataaa atgaagaagc ggcag 25 <210> 844 <211> 25 <212> DNA <213> Artificial Sequence <400> 844 tatcttcagg aaatgtcacc acagt 25 <210> 845 <211> 25 <212> DNA <213> Artificial Sequence <400> 845 agaacatgta gtcgtactcg tttca 25 <210> 846 <211> 25 <212> DNA <213> Artificial Sequence <400> 846 cgggatagga ggtaaactga atctt 25 <210> 847 <211> 26 <212> DNA <213> Artificial Sequence <400> 847 acttttactt gagcttttat gcatgc 26 <210> 848 <211> 25 <212> DNA <213> Artificial Sequence <400> 848 tacatacata gctgtctgga tcaat 25 <210> 849 <211> 25 <212> DNA <213> Artificial Sequence <400> 849 actttcctat ctcagcaatg gagtt 25 <210> 850 <211> 25 <212> DNA <213> Artificial Sequence <400> 850 aagaactaaa acagcttgac agagc 25 <210> 851 <211> 25 <212> DNA <213> Artificial Sequence <400> 851 acttggtagc agtcttattc atgga 25 <210> 852 <211> 25 <212> DNA <213> Artificial Sequence <400> 852 aaaagataaa ccatgacgga ccttg 25 <210> 853 <211> 25 <212> DNA <213> Artificial Sequence <400> 853 acttgcttag cacctgttaa aagtc 25 <210> 854 <211> 25 <212> DNA <213> Artificial Sequence <400> 854 gtgaattctg gttgaactct gtgac 25 <210> 855 <211> 26 <212> DNA <213> Artificial Sequence <400> 855 acttctaaca ttcttggaga tgagga 26 <210> 856 <211> 25 <212> DNA <213> Artificial Sequence <400> 856 caggaagtga gttggaaaag tcaag 25 <210> 857 <211> 25 <212> DNA <213> Artificial Sequence <400> 857 acttcgattt tcgtgtaatg ctgtt 25 <210> 858 <211> 26 <212> DNA <213> Artificial Sequence <400> 858 ccgtcagcta aaataatatg ccctag 26 <210> 859 <211> 25 <212> DNA <213> Artificial Sequence <400> 859 acttcattga ccactagact acacc 25 <210> 860 <211> 25 <212> DNA <213> Artificial Sequence <400> 860 tgaattccga tgtttgtgag ctatg 25 <210> 861 <211> 25 <212> DNA <213> Artificial Sequence <400> 861 actgatacgt gggaaagata atcca 25 <210> 862 <211> 25 <212> DNA <213> Artificial Sequence <400> 862 aagtcaataa acgcatccct gaatt 25 <210> 863 <211> 25 <212> DNA <213> Artificial Sequence <400> 863 actcagtaca tttttcgtac agacc 25 <210> 864 <211> 25 <212> DNA <213> Artificial Sequence <400> 864 aacgtctatg tcaaaaggat ccgta 25 <210> 865 <211> 25 <212> DNA <213> Artificial Sequence <400> 865 actcacaatc acaacaaacc aacat 25 <210> 866 <211> 25 <212> DNA <213> Artificial Sequence <400> 866 gaaaacccaa gggaagtgaa atagg 25 <210> 867 <211> 25 <212> DNA <213> Artificial Sequence <400> 867 acgtaaaaac acgctgcaaa tttac 25 <210> 868 <211> 25 <212> DNA <213> Artificial Sequence <400> 868 gtgaaaattg ttgaccaaac gttga 25 <210> 869 <211> 25 <212> DNA <213> Artificial Sequence <400> 869 acggaacaat tgtttgtctt agaaa 25 <210> 870 <211> 25 <212> DNA <213> Artificial Sequence <400> 870 cccttttctt tgtttactgg gacaa 25 <210> 871 <211> 25 <212> DNA <213> Artificial Sequence <400> 871 acgatcctca ttcaaaaagc gattc 25 <210> 872 <211> 28 <212> DNA <213> Artificial Sequence <400> 872 tcattatttt aggtacatac acctctca 28 <210> 873 <211> 25 <212> DNA <213> Artificial Sequence <400> 873 accgtataag tggtcatata accca 25 <210> 874 <211> 24 <212> DNA <213> Artificial Sequence <400> 874 gtcatgtttg gaaaggtttc gcta 24 <210> 875 <211> 25 <212> DNA <213> Artificial Sequence <400> 875 acccaaaatc ccaacatcaa attga 25 <210> 876 <211> 25 <212> DNA <213> Artificial Sequence <400> 876 gtgcacttgc ttgaaaacat gattt 25 <210> 877 <211> 25 <212> DNA <213> Artificial Sequence <400> 877 accataacaa agctttgaaa cacaa 25 <210> 878 <211> 25 <212> DNA <213> Artificial Sequence <400> 878 tgcattttca gaatggtctt tgttg 25 <210> 879 <211> 25 <212> DNA <213> Artificial Sequence <400> 879 accagtatgaggatcctgtactagt 25 <210> 880 <211> 24 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 880 ctggtacatctttgtcatccctgg 24 <210> 881 <211> 25 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 881 accacgattgttcaagtaaccaaaa 25 <210> 882 <211> 25 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 882 ggaaatgtgagccttctaggaaaag 25 <210> 883 <211> 25 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 883 accacatagaccattgagacatgaa 25 <210> 884 <211> 25 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 884 ttttggatgacaacatagctgcaat 25 <210> 885 <211> 25 <212> DNA <213> Artificial Sequence <400> 885 accaatttcg atcaatcttg aagca 25 <210> 886 <211> 25 <212> DNA <213> Artificial Sequence <400> 886 ggcatccaaa tgtgtatcag attgt 25 <210> 887 <211> 25 <212> DNA <213> Artificial Sequence <400> 887 acattggatc attgtgaacg aagtc 25 <210> 888 <211> 25 <212> DNA <213> Artificial Sequence <400> 888 caaggcttga acgataggat cagat 25 <210> 889 <211> 25 <212> DNA <213> Artificial Sequence <400> 889 acatccgatc ttgacccatt acata 25 <210> 890 <211> 25 <212> DNA <213> Artificial Sequence <400> 890 ttatagtttt gtggtgcatg tcagc 25 <210> 891 <211> 25 <212> DNA <213> Artificial Sequence <400> 891 acatcagcaa tgcaattcag aagaa 25 <210> 892 <211> 25 <212> DNA <213> Artificial Sequence <400> 892 tctattcgtt gtaccaaaaa tcgct 25 <210> 893 <211> 25 <212> DNA <213> Artificial Sequence <400> 893 acagctgtaa cataccaaca agagt 25 <210> 894 <211> 25 <212> DNA <213> Artificial Sequence <400> 894 cgatgttcaa gtttcgggtt cttta 25 <210> 895 <211> 25 <212> DNA <213> Artificial Sequence <400> 895 acagatatag agaagggtga gtcct 25 <210> 896 <211> 25 <212> DNA <213> Artificial Sequence <400> 896 aatttataca tgtcacgacc caacc 25 <210> 897 <211> 25 <212> DNA <213> Artificial Sequence <400> 897 acagaaagtt cgtcattgtc tgaac 25 <210> 898 <211> 25 <212> DNA <213> Artificial Sequence <400> 898 tactccgata tacgattctt gtgca 25 <210> 899 <211> 24 <212> DNA <213> Artificial Sequence <400> 899 acacttgcaa tttcccaact caag 24 <210> 900 <211> 24 <212> DNA <213> Artificial Sequence <400> 900 ttgattataa cttggtgggg gtgg 24 <210> 901 <211> 25 <212> DNA <213> Artificial Sequence <400> 901 acacttcttc tctcaagttc ccatt 25 <210> 902 <211> 25 <212> DNA <213> Artificial Sequence <400> 902 gttccggaac aagttggata aacat 25 <210> 903 <211> 25 <212> DNA <213> Artificial Sequence <400> 903 acaccttttg taaactaaat ggtca 25 <210> 904 <211> 25 <212> DNA <213> Artificial Sequence <400> 904 acatataggg tattgaggtt cgaat 25 <210> 905 <211> 27 <212> DNA <213> Artificial Sequence <400> 905 acaccaaaaa tgtctaaaaa cacaact 27 <210> 906 <211> 25 <212> DNA <213> Artificial Sequence <400> 906 cgctccgatt catgtacatt tttct 25 <210> 907 <211> 25 <212> DNA <213> Artificial Sequence <400> 907 acacatgtca attcaacacc aatga 25 <210> 908 <211> 25 25<212> DNA 25<213> Artificial Sequence 25<400> 908 25tagtaaggtt ggggtgtgac attag 25 25<210> 909 25<211> 25 25<212> DNA 25<213> Artificial Sequence 25<400> 909 25acacaacaat taagggaaca agctt 25 25<210> 910 25<211> 25 25<212> DNA 25<213> Artificial Sequence 25<400> 910 25gaaaggaaag gctcaactgg atttg 25 25<210> 911 25<211> 25 25<212> DNA 25<213> Artificial Sequence 25<400> 911 25acaattctcg agtccgaaaa attcc 25 25<210> 912 25<211> 25 25<212> DNA 25<213> Artificial Sequence 25<400> 912 25tacgaatttc aggtcaagtc attcg 25 25<210> 913 27<211> 27 27<212> DNA 27<213> Artificial Sequence 27<400> 913 27acaattacga tgagctcaat gatataa 27 <210> 914 <211> 25 <212> DNA <213> Artificial Sequence <400> 914 acctctaaac tgacggtaca tgaaa 25 <210> 915 <211> 30 <212> DNA <213> Artificial Sequence <400> 915 acaatacatt attactctct tgacttgtga 30 <210> 916 <211> 28 <212> DNA <213> Artificial Sequence <400> 916 agatttcaca tacttgaatt ctacctcc 28 <210> 917 <211> 25 <212> DNA <213> Artificial Sequence <400> 917 acaagtaaag catggaactc aagtg 25 <210> 918 <211> 25 <212> DNA <213> Artificial Sequence <400> 918 ctgttccaat taaccccatg gaaaa 25 <210> 919 <211> 25 <212> DNA <213> Artificial Sequence <400> 919 acaactactt cgaacgttat tgcag 25 <210> 920 <211> 25 <212> DNA <213> Artificial Sequence <400> 920 tgaatgcagt tgattcatat gtgca 25 <210> 921 <211> 25 <212> DNA <213> Artificial Sequence <400> 921 aatttctccg tcgattttgg tcaaa 25 <210> 922 <211> 25 <212> DNA <213> Artificial Sequence <400> 922 tttgaattcc agctacaaca cttgg 25 <210> 923 <211> 25 <212> DNA <213> Artificial Sequence <400> 923 aattcaattg ttttgactgc tgtgc 25 <210> 924 <211> 25 <212> DNA <213> Artificial Sequence <400> 924 tttgcaactg cttaatcatt ccctt 25 <210> 925 <211> 25 <212> DNA <213> Artificial Sequence <400> 925 aatgtccaca tatcaacaga tgcac 25 <210> 926 <211> 25 <212> DNA <213> Artificial Sequence <400> 926 tctggtttgt gcactgtaaa gaatc 25 <210> 927 <211> 26 <212> DNA <213> Artificial Sequence <400> 927 aatgagtgaa tgtatataga gcctct 26 <210> 928 <211> 25 <212> DNA <213> Artificial Sequence <400> 928 ccccgattac attatggagt gatca 25 <210> 929 <211> 23 <212> DNA <213> Artificial Sequence <400> 929 aatgaggttg aatgactgca agc 23 <210> 930 <211> 25 <212> DNA <213> Artificial Sequence <400> 930 taatgtatct aaccaccctc ttagc 25 <210> 931 <211> 25 <212> DNA <213> Artificial Sequence <400> 931 aatgaagctt cttcctaatg cagtg 25 <210> 932 <211> 25 <212> DNA <213> Artificial Sequence <400> 932 agccacagtc atgctcaata ttcta 25 <210> 933 <211> 25 <212> DNA <213> Artificial Sequence <400> 933 aatcttttgg aattgaccat gtgct 25 <210> 934 <211> 25 <212> DNA <213> Artificial Sequence <400> 934 taattgttcc cgacccaaaa ttctg 25 <210> 935 <211> 25 <212> DNA <213> Artificial Sequence <400> 935 aatcctcctc caaagtttca attgg 25 <210> 936 <211> 25 <212> DNA <213> Artificial Sequence <400> 936 ttggtatgtt agctagacgg ttcaa 25 <210> 937 <211> 25 <212> DNA <213> Artificial Sequence <400> 937 aatattttgc agatacaggt gagcg 25 <210> 938 <211> 25 <212> DNA <213> Artificial Sequence <400> 938 agctgtatgt aacacatgaa agctg 25 <210> 939 <211> 25 <212> DNA <213> Artificial Sequence <400> 939 aatagtcgtt tcctttggtt ccaag 25 <210> 940 <211> 25 <212> DNA <213> Artificial Sequence <400> 940 atttttgttc cttatgtgct tggct 25 <210> 941 <211> 25 <212> DNA <213> Artificial Sequence <400> 941 aataaatcag cagaattttc cgcca 25 <210> 942 <211> 25 <212> DNA <213> Artificial Sequence <400> 942 gatcaaaatc aggctaccat agcga 25 <210> 943 <211> 25 <212> DNA <213> Artificial Sequence <400> 943 aagttcaggg tgatagcatt gtttg 25 <210> 944 <211> 25 <212> DNA <213> Artificial Sequence <400> 944 tcagactttg aagatggaac gagaa 25 <210> 945 <211> 25 <212> DNA <213> Artificial Sequence <400> 945 aagtgaaaaa ccccaatctg tcttc 25 <210> 946 <211> 25 <212> DNA <213> Artificial Sequence <400> 946 aaggcttcac atattgcttg agaag 25 <210> 947 <211> 25 <212> DNA <213> Artificial Sequence <400> 947 aagtcttctcca aaggtcttca caa 25 <210> 948 <211> 25 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 948 tgagtacaactctaggtgta tccct 25 <210> 949 <211> 24 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 949 aagcctagataaaggaggag ggtt 24 <210> 950 <211> 25 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 950 cactgaaattcaacaccaaa gcaag 25 <210> 951 <211> 25 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 951 aagcccctaaaacaaagaat gaact 25 <210> 952 <211> 25 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 952 tgctcttattgtggcgaaga atttt 25 <210> 953 <211> 25 <212> DNA <213> Artificial Sequence <400> 953 aagattaggg atgtggatgt caaga 25 <210> 954 <211> 25 <212> DNA <213> Artificial Sequence <400> 954 gtttaacttt attccatgca cccca 25 <210> 955 <211> 25 <212> DNA <213> Artificial Sequence <400> 955 aagagcatca gagtgaaacc tagtt 25 <210> 956 <211> 25 <212> DNA <213> Artificial Sequence <400> 956 tcgggtttgg ttatgatttg acaag 25 <210> 957 <211> 25 <212> DNA <213> Artificial Sequence <400> 957 aactgcaaca actcattctc taagc 25 <210> 958 <211> 25 <212> DNA <213> Artificial Sequence <400> 958 gatgtatcca ttgccacact aacag 25 <210> 959 <211> 25 <212> DNA <213> Artificial Sequence <400> 959 aactcaccac atgtcttttc tggta 25 <210> 960 <211> 26 <212> DNA <213> Artificial Sequence <400> 960 agaaatgaat gacaaatcga atccca 26 <210> 961 <211> 25 <212> DNA <213> Artificial Sequence <400> 961 aactacgaga aatcatggtt ccaaa 25 <210> 962 <211> 25 <212> DNA <213> Artificial Sequence <400> 962 gaattcacat ggatttagga agggc 25 <210> 963 <211> 25 <212> DNA <213> Artificial Sequence <400> 963 aaccgagtta gaacaatcaa tccac 25 <210> 964 <211> 26 <212> DNA <213> Artificial Sequence <400> 964 accttattta gacttgtgct agggtt 26 <210> 965 <211> 25 <212> DNA <213> Artificial Sequence <400> 965 aaccaagtga tattttgcca tccag 25 <210> 966 <211> 25 <212> DNA <213> Artificial Sequence <400> 966 tcaagaaggt gatctagttc ccatg 25 <210> 967 <211> 25 <212> DNA <213> Artificial Sequence <400> 967 aacataatcc ccaagtaaat cccca 25 <210> 968 <211> 25 <212> DNA <213> Artificial Sequence <400> 968 ttacctgcgg atatgatttt cccat 25 <210> 969 <211> 25 <212> DNA <213> Artificial Sequence <400> 969 aacaccaggt agtatggaaa acttc 25 <210> 970 <211> 25 <212> DNA <213> Artificial Sequence <400> 970 attcggcctc ttttcttaat ttgca 25 <210> 971 <211> 25 <212> DNA <213> Artificial Sequence <400> 971 aaattttgtt gtgtgagtcg attcg 25 <210> 972 <211> 25 <212> DNA <213> Artificial Sequence <400> 972 aagctttgat acagtatacc caccc 25 <210> 973 <211> 25 <212> DNA <213> Artificial Sequence <400> 973 aaattgatac tgaggttgca tgcat 25 <210> 974 <211> 25 <212> DNA <213> Artificial Sequence <400> 974 ctaggcaagt ttactgcaca tttga 25 <210> 975 <211> 25 <212> DNA <213> Artificial Sequence <400> 975 aaatggtgtc tttgccatga aaaac 25 <210> 976 <211> 25 <212> DNA <213> Artificial Sequence <400> 976 taatgcaagt cactctccta cagtc 25 <210> 977 <211> 25 <212> DNA <213> Artificial Sequence <400> 977 aaatagcctt ggaattggat gcaat 25 <210> 978 <211> 25 <212> DNA <213> Artificial Sequence <400> 978 agttaatagt tgtccaaccc gagaa 25 <210> 979 <211> 25 <212> DNA <213> Artificial Sequence <400> 979 aaataatgtg acctacaaaa gccac 25 <210> 980 <211> 25 <212> DNA <213> Artificial Sequence <400> 980 tccgtgttat gtcattcgga ttaac 25 <210> 981 <211> 25 <212> DNA <213> Artificial Sequence <400> 981 aaagtaagga aaaatacacc cccaa 25 <210> 982 <211> 25 <212> DNA <213> Artificial Sequence <400> 982 acctgcactt gctgaattct tttat 25 <210> 983 <211> 25 <212> DNA <213> Artificial Sequence <400> 983 aaagcccatt atcaagaaaa gtgca 25 <210> 984 <211> 25 <212> DNA <213> Artificial Sequence <400> 984 tatatgcttg tccgtccagt ttgta 25 <210> 985 <211> 25 <212> DNA <213> Artificial Sequence <400> 985 aaactgatcc tggatactgt ctgtc 25 <210> 986 <211> 25 <212> DNA <213> Artificial Sequence <400> 986 aactctcaaa attatgcaag agggc 25 <210> 987 <211> 25 <212> DNA <213> Artificial Sequence <400> 987 aaactaccct cattttcaaa ccacc 25 <210> 988 <211> 25 <212> DNA <213> Artificial Sequence <400> 988 ggaattcgag aagatccgga atcta 25 <210> 989 <211> 25 <212> DNA <213> Artificial Sequence <400> 989 aaacaagagg caacataatg ctctt 25 <210> 990 <211> 29 <212> DNA <213> Artificial Sequence <400> 990 tgcaggtgat catctataaa taacaatgg 29 <210> 991 <211> 27 <212> DNA <213> Artificial Sequence <400> 991 aaacaaatac aattctagaa aagaccg 27 <210> 992 <211> 25 <212> DNA <213> Artificial Sequence <400> 992 gaatgagaac tctgcaaaga ggaag 25 <210> 993 <211> 25 <212> DNA <213> Artificial Sequence <400> 993 aaaatcctgc tcggggtcta aatat 25 <210> 994 <211> 25 <212> DNA <213> Artificial Sequence <400> 994 ccagagagat cttaattcca ggcag 25 <210> 995 <211> 25 <212> DNA <213> Artificial Sequence <400> 995 aaaatatgcc gagaaaaggg atgag 25 <210> 996 <211> 25 <212> DNA <213> Artificial Sequence <400> 996 tcgtagaaga gagaagtcac tttcg 25 <210> 997 <211> 29 <212> DNA <213> Artificial Sequence <400> 997 aaaatagctg atggatttgt aataaatgt 29 <210> 998 <211> 25 <212> DNA <213> Artificial Sequence <400> 998 agaagggaaca atagcaaac t agaa 25 <210> 999 <211> 25 <212> DNA <213> Artificial Sequence <400> 999 aaaataatcc gagaagaaca gccag 25 <210> 1000 <211> 25 <212> DNA <213> Artificial Sequence <400> 1000 ggagatgaat aaagaggaca gcttg 25
Claims
1. A multiplex PCR primer composition for wolfberry variety identification, characterized in that: The multiplex PCR primer composition includes 500 pairs of primers, and the nucleotide sequences of the 500 pairs of primers are shown as SEQ ID NO.1 to SEQ ID NO.1000.
2. A kit for identifying wolfberry varieties, characterized in that: The kit comprises the primer composition according to claim 1.
3. Use of the primer composition according to claim 1 or the kit according to claim 2 in authenticity identification of wolfberry varieties.
4. Use of the primer composition according to claim 1 or the kit according to claim 2 in identifying substantially derived varieties of wolfberry.
5. Use of the primer combination according to claim 1 or the kit according to claim 2 in constructing a DNA fingerprint database of wolfberry varieties.
6. Use of the primer combination according to claim 1 or the kit according to claim 2 in the analysis of genetic diversity of wolfberry germplasm resources.
Citation Information
Patent Citations
Core primer group based on Chinese wolfberry variety SSR (Simple Sequence Repeat) marker and application of core primer group
CN114107538A
MNP marker site, primer composition and kit for pear variety identification and application of MNP marker site, primer composition and kit
CN114134243A