Transcription factor CsHsf24 and its application in regulating flavonoid biosynthesis in tea plants

Abstract

The present invention provides a transcription factor CsHsf24 and its application in promoting the synthesis and regulation of tea flavonoids. The nucleotide sequence of the transcription factor CsHsf24 is shown in SEQ ID NO.2 and belongs to the field of genetic engineering technology. The present invention verifies that CsHsf24 binds to the promoter of flavonoid-3'5'-hydroxylase through yeast single hybrid point-to-point experiment, activates the expression of CsF3'5'H1 gene, and then promotes the increase in the content of substances such as catechins and flavonols. It has been verified that the expression of CsHsf24 gene of tea tree is positively correlated with the content of flavonoid substances. The CsHsf24 gene is overexpressed using genetic transformation technology, which significantly promotes the accumulation of flavonoids and improves the quality of tea leaves. The CsHsf24 gene can be used as an important candidate gene for genetic engineering and improved breeding of tea trees.

Description

Technical Field

[0001] The present invention relates to the fields of plant molecular biotechnology and genetic engineering technology, and specifically to the transcription factor CsHsf24 and its application in regulating the synthesis of flavonoids in tea trees. Background Art

[0002] The tea tree (Camellia sinensis (L.) O. Kuntze) originated in Guizhou Province, my country. It belongs to the genus Camellia (Camellia L.) of the family Theaceae. It is a shade-loving, moisture-loving, warm-loving, cold-averse plant. Tea leaves are rich in tea polyphenols, vitamins, amino acids, and other ingredients, and have various pharmacological properties, including antibacterial, antioxidant, blood circulation-promoting, cholesterol-lowering, and cancer-preventing properties. Flavonoids participate in the formation and development of flowers, fruits, and seeds in plants, as well as other functions, such as antioxidant activity, UV protection, and resistance to biotic and abiotic insults such as plant pathogens. Currently, the most studied flavonoids include rutin, catechin, quercetin, fusinolide, and citrus flavonoids. Therefore, identifying the transcription factors involved in the regulation of flavonoid biosynthesis is of great biological and industrial significance.

[0003] The flavonoid biosynthesis pathway involves multiple enzymes, but the enzyme involved in flavonoid B-ring hydroxylation is tea plant flavonoid-3'5'-hydroxylase (F3'5'H). The F3'5'H gene is the only known enzyme in the cytochrome P450 family that catalyzes B-ring 5' hydroxylation. F3'5'H genes have been cloned and functionally characterized in plants such as petunia, potato, grape, tomato, snapdragon, and cineraria. F3'5'H gene expression is regulated by transcription factors. Transcription factors are a class of trans-acting factors that typically bind to cis-acting elements in target gene promoters to regulate target gene expression. Currently, studies have revealed that MYB, bHLH, WD40, and WRKY transcription factors are primarily involved in regulating flavonoid biosynthesis. Heat shock transcription factors (Hsfs) have been less studied in the flavonoid biosynthesis pathway and have not been reported in the tea plant flavonoid biosynthesis pathway. Hsf transcription factors are primarily concentrated in the model plants Arabidopsis thaliana and tobacco, both of which are studied in response to heat stress. The upstream regulatory factors that regulate flavonoid biosynthesis in tea plants remain unclear. For example, the transcription factors that regulate flavonoid biosynthesis in tea plants have not yet been identified. Consequently, research on the promoter activation and effects of Hsf transcription factors is even more limited. Summary of the Invention

[0004] The purpose of the present invention is to provide a transcription factor CsHsf24 involved in the regulation of tea plant flavonoid synthesis, and the transcription factor CsHsf24 can promote the biosynthesis of flavonoids.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The amino acid sequence of the transcription factor CsHsf24 protein is shown in SEQ ID No. 3.

[0007] The transcription factor CsHsf24 gene encodes the above protein.

[0008] The nucleotide sequence of the above gene is shown in SEQ ID No.2.

[0009] Application of the transcription factor CsHsf24 gene in promoting the regulation of plant flavonoid synthesis.

[0010] Application of the transcription factor CsHsf24 gene in genetic engineering breeding for improving tea quality.

[0011] The nucleotide sequence of the transcription factor CsHsf24 is shown in SEQ ID No. 2.

[0012] The application is that the transcription factor CsHsf24 binds to the promoter of the flavonoid-3'5'-hydroxylase (F3'5'H1) gene involved in flavonoid synthesis, thereby activating the expression of the F3'5'H1 gene, thereby increasing the flavonoid content.

[0013] The application is to construct a recombinant vector of the transcription factor CsHsf24, and to transfer the vector into plants to jointly regulate flavonoid synthesis with F3'5'H1 to increase the flavonoid content.

[0014] The recombinant vector uses pSH737-35S as the original vector, and inserts the transcription factor CsHsf24 into the multiple cloning site of pSH737-35S.

[0015] Preferably, the transcription factor CsHsf24 is inserted between the Xba I and Kpn I restriction sites on the original vector pSH737-35S.

[0016] The recombinant vector was prepared by the following method: using tea plant leaf cDNA as a template and combining with a primer pair to obtain a PCR product of CsHsf24; pSH737-35S was double-digested with Xba I and Kpn I, recovered and ligated to obtain a recombinant vector named CsHsf24-pSH737-35S, and the primer pair was primer F: CACAACAACTTCTCCAGCTTTG, primer R: CAGCATCTCGTTGTCTCTCTTC.

[0017] The plant is tea tree or tobacco.

[0018] Beneficial effects of the present invention: The present invention provides the discovery of a transcription factor CsHsf24, which has an HSF domain but can participate in the regulation of tea flavonoid synthesis. The CsHsf24 has the nucleotide sequence shown in SEQ ID No. 2 and encodes a protein composed of 289 amino acids. In the present invention, the transcription factor CsHsf24 can bind to the flavonoid-3'5'-hydroxylase gene promoter, activate the expression of the F3'5'H1 gene, and thereby promote the accumulation of tea flavonoid content. It has been verified that overexpressing the CsHsf24 gene using genetic transformation technology can increase the content of tea flavonoid substances. This shows that the CsHsf24 can significantly promote the biosynthesis of tea flavonoids and improve the quality of tea leaves. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Colony PCR results for the bait plasmid pHIS2-F3'5'H1

[0020] Lanes 1-4 are the amplified products of four randomly picked pHIS2-F3'5H1 colonies, M is a DNA marker, and the bands from top to bottom are: 5k; 3k; 2k; 1k; 750bp; 500bp; 250bp; 100bp

[0021] Figure 2 is the result of bait vector self-activation detection,

[0022] Figure 3 is the library screening efficiency,

[0023] Figure 4 For positive clone HIS reporter gene detection,

[0024] Figure 5 is the hydrophilicity and hydrophobicity of CsHsf24 protein,

[0025] Figure 6 To predict the tertiary structure of CsHsf24 gene,

[0026] Figure 7 Prediction of conserved domains of CsHsf24 gene,

[0027] Figure 8 It indicates the interaction detection between CsHsf24 transcription factor and CsF3'5'H1 promoter;

[0028] Figure 9 Indicates the subcellular localization of CsHsf24 gene protein in tobacco leaf cells,

[0029] From left to right, they are GFP-K / Hsf24 target protein fluorescence channel, cell nucleus fluorescence channel, bright field, and overlay image;

[0030] Figure 10 Construction diagram of the pSH737-35S-CsHsf24 plant overexpression vector.

[0031] Figure 11 This is the GUS staining picture of the CsHsf24 overexpression vector callus.

[0032] Figure 12 PCR identification of calli overexpressing CsHsf24 vector.

[0033] Figure 13 To determine the catechin content in transgenic tea plant callus,

[0034] Figure 14 is the flavonol content of transgenic tea plant callus,

[0035] Figure 15 For GUS staining and PCR identification of transgenic tobacco,

[0036] Wherein: A: GUS histochemical staining identification of transgenic tobacco; B: PCR identification of transgenic tobacco; M: Maker; P: plasmid positive control;

[0037] 1, 2, 3, 5, 7, 8, 10, 12: positive plants); WT: wild-type plants

[0038] Figure 16 It is the flavonoid content of genetically modified tobacco. DETAILED DESCRIPTION

[0039] The present invention is further described in detail with reference to the embodiments.

[0040] The culture medium involved in the present invention is:

[0041] 1) LB medium: 10g / L tryptone + 10g / L sodium chloride + 5g / L yeast extract + 7.5g / L agar powder

[0042] 2) YPDA medium: 1% Yeast extract, 2% Tryptone, 2% Glucose, 0.02% Adenine.

[0043] 3) Yeast defect screening medium:

[0044] Refer to Clontech's PT3024-1 / Yeast Protocols Handbook. The various culture media are represented by the following symbols:

[0045] SD-T: -trp; SD-TH: -trp,-his; SD-THA: -trp,-his,-ade;

[0046] SD-L: -leu; SD-LH: -leu,-his; SD-LHA: -leu,-his,-ade;

[0047] SD-TL: -trp,-leu; SD-TLH: -trp,-leu,-his; SD-TLHA: -trp,-leu,-his,-ade.

[0048] Yeast defective medium: 8g / L SD-T / SD-TL / SD-TLH + 20g / L agar powder + 40g / L glucose

[0049] 4) YEP solid medium: 10g / L peptone + 10g / L yeast extract + 5g / L sodium chloride + 7.5g / L agar powder

[0050] 5) YEP liquid medium: 10g / L yeast extract + 10g / L peptone + 5g / L sodium chloride

[0051] 6) Tobacco co-cultivation medium: 4.432g / L MS + 1.0mg / L 6-BA + 0.1mg / L NAA + 30g / L sucrose + 7.5g / L agar powder

[0052] 7) Tobacco screening medium: 4.432g / L MS + 1.0mg / L 6-BA + 0.1mg / L NAA + 30g / L sucrose + 7.5g / L agar powder + 100mg / L timentin + 100mg / L kanamycin

[0053] 8) Tobacco rooting medium: 2.216g / L MS + 20g / L sucrose + 7.5g / L agar powder + 100mg / L timentin + 100mg / L kanamycin

[0054] 9) Tea tree co-cultivation medium: 4.432g / L MS + 30g / L sucrose + 0.5mg / L 6-BA + 1.0mg / L NAA + 7.5g / L agar powder

[0055] 10) Tea callus screening medium: 4.432 g / L MS + 30 g / L sucrose + 0.5 mg / L 6-BA + 1.0 mg / L NAA + 7.5 g / L agar powder + 200 mg / L timentin + 30 mg / L kanamycin

[0056] The present invention successfully obtained a bait strain by constructing a pHIS2-F3'5'H1 bait expression vector containing the CsF3'5'H1 gene promoter (SEQ ID NO. 1) and transforming the Y187 yeast strain. Twenty-three positive clones were screened from CsF3'5'H1 using a yeast one-hybrid assay, and a tea plant CsHsf24 transcription factor was identified by testing the positive clones.

[0057] The present invention provides a transcription factor CsHsf24 involved in the regulation of tea plant flavonoid synthesis. The nucleotide sequence of the CsHsf24 is shown in SEQ ID No. 2. The transcription factor CsHsf24 belongs to the HSF family.

[0058] In the present invention, the PCR amplification template of CsHsf24 is preferably tea plant cDNA; the tea plant cDNA is preferably synthesized by reverse transcription of tea plant total RNA; the present invention has no special requirements for the synthesis method of tea plant cDNA, and conventional plant cDNA synthesis methods in the art can be used. In the specific implementation process of the present invention, the TAKARA kit is used for synthesis.

[0059] The present invention provides a protein encoded by the transcription factor CsHsf24 described in the above scheme, the amino acid sequence of the protein is shown in SEQ ID No. 3; the protein contains 289 amino acids; the protein has an HSF domain between amino acids 7 and 99.

[0060] The present invention also provides a recombinant vector of the transcription factor CsHsf24; the recombinant vector preferably uses pSH737-35S as the original vector, and inserts the transcription factor CsHsf24 into the multiple cloning site of pSH737-35S; preferably, the CsHsf24 is inserted between the Xba I and Kpn I restriction sites on the original vector pSH737-35S.

[0061] In the present invention, the recombinant vector is preferably prepared by the following method: using cDNA as a template and combining a primer pair to obtain a PCR product of CsHsf24; pSH737-35S is double-digested with Xba I and Kpn I, recovered and ligated to obtain CsHsf24-pSH737-35S, wherein the primer pair is primer F: CACAACAACTTCTCCAGCTTTG, primer R: CAGCATCTCGTTGTCTCTCTTC.

[0062] The present invention also provides a recombinant microorganism comprising the recombinant vector described in the above scheme; the recombinant microorganism preferably uses Agrobacterium as the original microorganism, and the recombinant vector CsHsf24-pSH737-35S is transferred into the Agrobacterium; the present invention has no special restrictions on the method of transfer, and conventional transformation methods in the art can be used. In the specific implementation of the present invention, the freeze-thaw method is used for transformation.

[0063] In the present invention, the transcription factor CsHsf24 can bind to the promoter of the flavonoid-3'5'-hydroxylase (F3'5'H1) gene involved in the synthesis of tea flavonoids, thereby activating the expression of the CsF3'5'H1 gene.

[0064] The present invention also provides the application of the transcription factor CsHsf24 described in the above scheme in tea tree breeding; the application is preferably the application of the transcription factor CsHsf24 in genetic engineering breeding for improving tea quality.

[0065] The transcription factor CsHsf24 of the present invention is transformed into tobacco and can also activate the expression of the F3'5'H1 gene in tobacco.

[0066] The following is a detailed description of the transcription factor CsHsf24 involved in the regulation of tea flavonoid synthesis and its application provided by the present invention in conjunction with the examples, but they should not be understood as limiting the scope of protection of the present invention.

[0067] Example 1 Screening of CsF3'5'H1 Gene Promoter-Interacting Transcription Factors

[0068] (1) Experimental methods

[0069] 1. Construction of CsF3'5'H1 gene promoter sequence bait vector

[0070] To construct the CsF3'5'H1 gene promoter sequence (SEQ ID No. 1) into the yeast one-hybrid bait vector pHIS2, the target gene-containing vector pMD18-T-F3'5'H1 (complete gene synthesis performed by Shanghai Huajin Biotechnology Co., Ltd. and loaded into the pMD18-T vector) was digested to obtain the cloned fragment. This fragment was then ligated into the yeast one-hybrid bait vector pHIS2, which had been digested with the corresponding enzymes. The fragment and vector were digested with Eco RI and Sac I (TAKARA endonucleases), and the digested products were recovered using a gel recovery kit (Axygen). The fragment and vector were ligated using a DNA Ligation Kit (TOYOBO). After bait vector construction, the fragments were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing verification. The reaction systems and conditions are shown in Table 1.

[0071] Table 1 Enzyme digestion and ligation reaction system

[0072]

[0073] 2. Preparation of Competent Yeast and Transformation

[0074] 1) Preparation of competent yeast:

[0075] a) Inoculate a single colony of Y187 yeast from a YPDA plate into 4 ml of YPDA liquid medium. Incubate in a constant temperature incubator at 30°C and 225 rpm with shaking for 18-20 hours until the OD600 of the culture is greater than 1.5, generally around 4.

[0076] b) Transfer the cultured YDPA medium to 50 ml of YPDA liquid medium to an initial OD600 of 0.2. Then, incubate the culture in a constant temperature incubator at 30°C and 225 rpm with shaking for 4-5 hours until the OD600 of the culture reaches 0.6.

[0077] c) The cultured yeast was collected by centrifugation at room temperature, 1000 g, and 5 min.

[0078] d) Resuspend the collected cells in 20 ml of sterile water and centrifuge at room temperature, 1000 rpm, for 5 min, to collect the cells and discard the supernatant.

[0079] e) Resuspend the cells in 5 ml of 0.1 M LiOAc and centrifuge at room temperature, 1000 rpm, for 5 min, to collect the cells and discard the supernatant.

[0080] f) Resuspend the cells in 500 μl of 0.1 M LiOAc and dispense into 1.5 ml microcentrifuge tubes. Add 50 μl of liquid to each microcentrifuge tube, which is the competent yeast Y187.

[0081] 2) Transformation of yeast bait strains:

[0082] a) To the 1.5 ml microcentrifuge tube containing the competent yeast from the previous step, add 240 μl of 50% PEG 3350, 36 μl of 1 M LiOAc, 5 μl of salmon sperm DNA (10 mg / ml), and 5 μl of plasmid DNA (300 ng / μl), sequentially. After gently pipetting with a pipette, shake vigorously on a shaker until all reagents and the bacterial solution are thoroughly mixed. Shake for approximately 1 minute.

[0083] b) Incubate in a 30°C water bath for 30 min.

[0084] c) Heat shock in a 42°C water bath for 25 min.

[0085] d) Resuscitate in a 30°C water bath for 1 h.

[0086] e) Harvest the bacteria by centrifugation at room temperature, 700 rpm, 5 min, and discard the supernatant.

[0087] f) Add 200 μl of sterile water to each transformed centrifuge tube and gently pipette to gently suspend and mix the bacterial solution, and then spread it onto SD-T defect plates.

[0088] g) Culture the cells in a constant temperature incubator at 30°C for 3-4 days.

[0089] 3) The transformation method for negative and positive controls is the same as that for yeast bait strains, except that AD and BD plasmids are added simultaneously and the corresponding defective plates are coated. The plasmid information, transformation plates, and detection plates are shown in Table 2.

[0090] Table 2 Yeast transformation reaction

[0091]

[0092] Note: Plasmids pHIS2, p53HIS2, and pGAD53m were purchased from Shanghai Haike Biotechnology Co., Ltd.

[0093] 3. Self-activation detection

[0094] Three single colonies were randomly selected from each of the F3'5'H1 gene promoter, negative control, and positive control transformation reaction plates. These were diluted with sterile water and plated onto SD-TLH-deficient plates containing no His, 50 mM 3AT, or 100 mM 3AT. The plates were then incubated at 30°C for 3 days. The growth of the colonies on each plate was recorded by photographing the plate.

[0095] 4. Yeast One-Hybrid Screening Library

[0096] The yeast one-hybrid library was constructed from tea plant leaves. Competent yeast strains were prepared using Y187 yeast transformants containing the correct pHIS2 bait plasmid. The constructed library plasmid, pGADT7 (purchased from Shanghai Haike Biotechnology Co., Ltd.), was then transformed into these three competent yeast strains and plated onto SD-TLH-deficient medium supplemented with 50 mM 3AT. The specific transformation method for the library DNA is as follows:

[0097] a) Pick the monoclonal bacteria that grow normally on the SD-T plate and inoculate them into 50 ml of liquid SD-T medium. Then, incubate the culture in a constant temperature incubator at 30°C and 225 rpm with shaking for 18 hours.

[0098] b) Transfer 50 ml of SD-T liquid medium containing normal bacterial growth to 500 ml of YPDA liquid medium to an initial OD600 of 0.2. Incubate in a constant temperature incubator at 30°C and 225 rpm with shaking for 4-5 hours until the OD600 reaches 0.6.

[0099] c) Centrifuge the cultured yeast to collect the yeast and discard the supernatant. Centrifugation conditions: room temperature, 1000 rpm, 5 min.

[0100] d) Resuspend the collected cells in 30 ml of sterile water and centrifuge at room temperature, 1000 rpm, for 5 min, to collect the cells and discard the supernatant.

[0101] e) Resuspend the collected cells in 20 ml of 0.1 M LiOAc and centrifuge at room temperature at 1000 rpm for 5 min to collect the cells and discard the supernatant.

[0102] f) Resuspend the collected cells in 10 ml of 0.1 M LiOAc and centrifuge to collect the cells. Discard the supernatant. Centrifuge at room temperature, 1000 rpm, for 5 minutes. This will now make the Y187 yeast containing the correct pHIS2 bait plasmid competent.

[0103] g) To the centrifuge tube containing the competent yeast, add 9.6 ml of 50% PEG 3350, 1.44 ml of 1 M LiAc, 3 mg of single-stranded salmon sperm DNA, and 25 μg of library plasmid DNA. Gently pipette and shake vigorously on a shaker until all reagents and the bacterial solution are thoroughly mixed. Shake for approximately 1 minute.

[0104] h) Incubate in a 30°C water bath for 30 min.

[0105] i) Heat shock in a 42°C water bath for 25 min.

[0106] j) Resuscitate in a 30°C water bath for 1 h.

[0107] k) Centrifuge the yeast culture and collect the yeast, discarding the supernatant. Centrifuge at room temperature, 1000 rpm, for 5 minutes. Add 8 ml of sterile water to each transformed centrifuge tube and gently pipette to gently resuspend and mix the culture. Take 20 μl of the culture and make serial dilutions to spread on four SD-TL efficiency plates. Spread 200 μl of the culture on SD-TLH-deficient plates supplemented with 50 mM 3-AT, for a total of 40 plates.

[0108] l) Culture the cells in a constant temperature incubator at 30°C for 3-4 days, observe the transformation results on the SD-TL efficiency plate, and record the transformation efficiency.

[0109] m) Calculate the screening efficiency based on the number of transformants on the efficiency plate.

[0110] n) To eliminate background growth from positive clones, on day 3 of culture, use a homemade flannel copyer to copy-clear the plate onto an SD-TLH-deficient plate supplemented with 50 mM 3-AT. Continue incubation at 30°C for 7-14 days. Select transformant colonies that have regrown on the new plate and inoculate them onto SD-TL-deficient plates for 2-3 days before testing.

[0111] o) After 14 days of culture, positive clone transformants grown on SD-TL-deficient plates were diluted with sterile water and spotted onto SD-TL and SD-TLH-deficient plates supplemented with 300 mM 3-AT to detect His reporter gene expression in positive clones. The plates were cultured in a constant temperature incubator at 30°C for 3-4 days.

[0112] 5. Yeast Positive Clone DNA Extraction and Sequencing

[0113] First, positive clones identified through the His reporter gene assay were inoculated into SD-TL liquid culture medium and cultured in a constant-temperature incubator at 30°C and 225 rpm for 18 hours. The yeast plasmids were then extracted using a yeast miniprep kit (Solarbio). The extracted yeast plasmids were then transformed into fresh competent E. coli Top10 cells for amplification.

[0114] Preparation steps of fresh competent E. coli Top10:

[0115] a) Preparation of seed solution: A single clone of E. coli Top10 growing normally on an LB plate was inoculated into 3 ml of LB liquid medium and cultured overnight in a constant temperature incubator at 37°C and 220 rpm with shaking for 16 h.

[0116] b) Inoculate 1 ml of the cultured seed solution into 100 ml of LB liquid medium and culture in a constant temperature incubator at 37°C and 220 rpm with shaking for 2 hours.

[0117] c) Remove the bacterial suspension from the incubator and wait for it to cool to room temperature before centrifuging to collect the bacteria, or place it on ice for a period of time before centrifuging to collect the bacteria. Discard the supernatant. Centrifugation conditions: 4°C, 5000 rpm, 5 min.

[0118] d) Resuspend the collected cells in 10 ml of 0.1 M MgCl2 and gently pipette to mix thoroughly. Place on ice and incubate for 10 min-1 h.

[0119] e) Collect the bacteria by centrifugation and discard the supernatant. Centrifugation conditions: 4°C, 5000 rpm, 5 min.

[0120] f) Resuspend the collected cells in 4 ml of 0.1 M CaCl2 and gently pipette to mix thoroughly. Place on ice and incubate for 30 minutes. At this point, the competent culture is ready. Aliquot 4 ml of competent culture into 1.5 ml microcentrifuge tubes, with 100 μl of competent culture per tube.

[0121] h) Each yeast-extracted plasmid was transformed with 100 μl of competent medium.

[0122] The colonies containing positive clones screened in E. coli Top10 were transferred to LB liquid culture containing Amp for amplification, and the plasmids were extracted using the Axygen plasmid mini-extraction kit. The plasmids were sent to Wuhan Jinkairui Bioengineering Co., Ltd. for DNA sequencing.

[0123] 6. Bioinformatics Analysis of Positive Clone Sequencing Results

[0124] The positive clone sequences were first aligned to the tea plant gene data using Blast to obtain the complete sequence results. The complete sequences were submitted to the Conserved Domain Database (https: / / www.ncbi.nlm.nih.gov / cdd) and pfam (http: / / pfam.xfam.org / ) for analysis of their conserved domains. The plant TFDB database was then compared to confirm whether they were transcription factors. The ExPASy-ProtParm tool (http: / / www.expasy.org / protparam) was used to analyze and screen the basic physicochemical properties and amino acid composition of the protein.

[0125] (2) Experimental results

[0126] 1. Yeast One-Hybrid Bait Vector Construction

[0127] The plasmid of the CsF3'5'H1 gene promoter and the yeast one-hybrid bait vector pHIS2 were double-digested with Eco RI and SacI, respectively. The digestion products were purified and ligated, and the ligation products were transformed into E. coli competent cells. After activation, they were spread on LB solid medium (containing 30ng / ml Amp), cultured at 37℃ overnight, and single colonies were picked and shaken. The plasmids were extracted and identified by enzyme digestion. Then, positive clones were picked for sequencing. The sequencing results were correct, indicating that the bait vector pHIS2-F3'5'H1 was successfully constructed. pHIS2-F3'5H1 was constructed correctly and subsequent experiments were carried out. The results are as follows Figure 1 shown.

[0128] 2. Decoy sequence self-activation detection

[0129] In order to suppress the background expression activity of the most basic promoter on the pHIS2 plasmid, after the bait vector was introduced into yeast competent cells, three single colonies were randomly picked from the CsF3'5'H1 transformation reaction plate and spread on a plate containing 3-AT but without HIS for culture. The number and growth rate of transformants are shown in Table 3. The results of the transformation plate are shown in Table 3. Figure 2 As shown. As a competitive inhibitor of yeast HIS protein synthesis, 3-AT can be used to inhibit leaky expression of the HIS gene. The HIS reporter gene can activate the positive control. In principle, it will grow normally on the SD-TLH plate with the addition of the 3-AT inhibitor, and the growth rate is basically similar to that without the addition of 3-AT. However, the actual observed growth value is lower than that of the plate without the addition of 3-AT, and as the concentration of 3-AT continues to increase, the growth rate also gradually decreases, but there is still a significant difference from the negative control. Since the HIS reporter gene in the negative control is not activated, its growth rate on the SD-TLH plate with the addition of 3-AT is significantly reduced, and the higher the concentration of 3-AT, the smaller the number of corresponding transformants.

[0130] Table 3 Self-activation detection statistics

[0131]

[0132] The self-activation test results show that the growth of CsF3'5'H1 transformants on SD-TH plates supplemented with 50mmol and 100mmol 3AT was significantly inhibited, with growth rates of 0% in both cases, which was significantly lower than that of the negative control, with no growth at all, indicating that the HIS reporter gene could not be activated. Therefore, this experiment chose to perform yeast one-hybrid screening based on 50mmol 3-AT.

[0133] 3. Yeast One-Hybrid Library Screening

[0134] The library plasmid was transformed into Y187 yeast containing the correct bait plasmid pHIS2-F3'5'H1 vector. A portion of the transformed yeast cell suspension was taken out and diluted 10, 100, and 1000 times respectively, and then coated on the efficiency plate SD-TL. According to the number of transformants on the efficiency plate ( Figure 3 ), the screening efficiency of CsF3'5'H1 gene promoter was calculated to be 5.77×10 4 The remaining yeast cell suspension was applied to SD-TLH + 50 mmol 3-AT plates.

[0135] (Calculation: Total number of CsF3'5'H1 transformants = (2686 / 20 + 363 / 2 + 45 / 0.2) × 1 / 3 × 8000 = 1.44 × 106, transformation efficiency = 1.44 × 106 / 25 μg = 5.77 × 104 / μg.)

[0136] After the photocopy was cleared, 46 positive clones of the CsF3'5'H1 gene were picked from the screening plate and transferred to the SD-TL defective plate for further culture for 2-3 days. The 46 positive clones of the CsF3'5'H1 gene grown on the SD-TL defective plate were diluted with sterile water and then spotted onto SD-TL and SD-TLH+300mmol 3-AT defective plates. After constant temperature culture at 30℃ for 4 days, the results were as follows: Figure 4 The results showed that the positive control grew normally on both screening plates without and with 3-AT. However, the negative control, which failed to activate the HIS reporter gene, grew normally on screening plates without 3-AT, but failed to grow or grew poorly on screening plates supplemented with 3-AT and lacking HIS. Therefore, compared to the positive and negative controls, 23 of the 46 positive clones of the CsF3'5'H1 gene transformed cells passed the HIS reporter gene assay. These transformants are numbered: 1, 2, 7, 9, 10, 16, 17, 18, 19, 20, 21, 22, 26, 29, 30, 31, 32, 33, 35, 36, 39, 44, and 46.

[0137] 4. cDNA Sequencing and Bioinformatics Analysis of Positive Clones

[0138] The 23 positive clones of the CsF3'5'H1 gene were sequenced, and finally 15 positive clones of the CsF3'5'H1 gene were obtained (see Table 4). Among them, No. 2 was the heat shock factor protein HSF24 transcription factor, named CsHsf24, and the sequence is shown in SEQ ID No. 2. The NCBI accession number of the CsHsf24 gene is: XP_028114097.1, the homology is 98%, the length is 1201bp, and it consists of 289 amino acids. Bioinformatics analysis found that the predicted atomic composition of the CsHsf24 protein is C 1393 H 2190 N 390 O 461 S8, molecular mass is 32033.53, theoretical isoelectric point (Theoretical pI) is 5.26, the protein contains 40 positively charged amino acid residues (Arg + Lys), 45 negatively charged amino acid residues (Asp + Glu). The maximum hydrophobicity of the protein is 1.422, the minimum is -3.556, and the overall average hydrophilicity coefficient is -0.811. It is predicted that the protein is a hydrophilic protein ( Figure 5 The secondary protein structure prediction showed that the CsHsf24 gene has 101 α-helical amino acids, 52 extended chain amino acids, 27 β-sheet amino acids, and 109 random coil amino acids. Figure 6 It can be seen that the main structures of this gene are α-helix and random coil.

[0139] The conserved domains of No.2 gene were analyzed online using NCBI website. The results showed that No.2 gene belongs to HSF_DNA-bind superfamily and has HSF domain between amino acids 7 and 99 ( Figure 7 ).

[0140] Table 4 Sequencing results of F3'5'H1 gene positive clones

[0141]

[0142] Example 2: Yeast one-hybrid point-to-point verification of transcription factor CsHsf24 and CsF3'5'H1 promoter

[0143] (1) Experimental methods

[0144] The vector used for point-to-point verification was pGADT7 (pGADT7, purchased from Shanghai Haike Biotechnology Co., Ltd.), with resistance as follows: Amp+ was inserted between the 5' EcoR I / 3' Xho I sites of the multiple cloning site. The yeast one-hybrid point-to-point vector was synthesized by Shanghai Haike Biotechnology Co., Ltd.

[0145] The amplification primers used for this gene are shown in Table 5 below:

[0146] Table 5. Names and sequences of primers for amplification of CsHsf24 point-to-point vector construction

[0147]

[0148] The transcription factor constructed from the PGADT7 vector and the promoter from the pHIS2 vector were co-transformed into the yeast strain Y187. The bacterial suspension was diluted and plated onto SD-Trp / -Leu plates, a yeast selective medium. The plates were cultured in a 28°C incubator for 3-4 days. After colonies emerged, individual yeast colonies were picked and transferred to the selective liquid medium SD-Trp / -Leu. The plates were shaken at 28°C, 200 rpm, until the OD value was between 0.8 and 1.0. A 2-μl aliquot was then pipetted onto the defective medium SD-Trp / -Leu / -His+3-AT (50 mM, 100 mM, 150 mM, 200 mM, 250 mM, or 300 mM). The plates were then incubated in a 28°C incubator for 3-4 days to observe yeast growth and analyze the corresponding transcriptional activation.

[0149] (2) Experimental results

[0150] The results are as follows Figure 8 As shown, yeast can still grow on three 3-AT deficient media (50mM, 100mM, 150mM, 200mM, 250mM), indicating that the transcription factor has a transcriptional activation effect on the gene and CsHsf24 binds to the CsF3'5'H1 gene promoter.

[0151] Example 2 Subcellular Localization of Tea Plant CsHsf24 Gene

[0152] (1) Experimental methods

[0153] 1. Experimental Materials

[0154] The tobacco used was sterile seedlings of Nicotiana benthamiana.

[0155] 2. Construction of fusion expression vector

[0156] Primers with restriction enzyme sites were designed based on the CsHsf24 ORF (Table 6). Plasmids were extracted from clones containing the correct CsHsf24 gene ORF. The gene was digested with Kpn I, and the vector was digested with Xba I. The resulting product was ligated to the pCAMBIA1300-35S-GFP vector using T4 DNA ligase. The resulting ligation product was transformed into DH5a competent cells. After PCR amplification, restriction enzyme screening, and sequencing verification, positive clones were screened and plasmids were extracted to obtain the fusion expression vector pCAMBIA1300-CsHsf24-35S-GFP containing GFP and the gene of interest. The subcellular localization vector was synthesized by Wuhan Transduction Biolabs Co., Ltd.

[0157] Table 6 CsHsf24 subcellular localization vector construction amplification primer names and sequences

[0158]

[0159] 3. Tobacco transient transformation steps:

[0160] (1) Shake the successfully detected Agrobacterium culture overnight at 28°C, 200 rpm;

[0161] ⑵ Take 1-1.5ml of bacterial solution and add it to a sterilized 1.5ml centrifuge tube;

[0162] (3) 8000 rpm, 2 min, sediment the bacteria (room temperature), remove the supernatant, add 1 ml of permeate, and suspend the bacteria;

[0163] (4) Repeat step 3 to further remove a small amount of antibiotics;

[0164] 5. Take a small amount of suspended bacterial solution and dilute it 10 times, measure the OD600 value, and multiply it by 10 to obtain the OD600 value of the suspended bacterial solution;

[0165] (6) Determine the titer of the bacterial suspension to the permeate and calculate the dilution factor so that the final bacterial suspension (for infection) is 0.5-5.0 ml and the OD600 is 0.4 (0.1-0.8 as needed, not exceeding 1). Usually 0.5-1.0 ml of the final bacterial suspension is sufficient for infection.

[0166] ⑺ Prepare the final bacterial suspension in a 1.5ml centrifuge tube and let it stand at room temperature for 1 to 3 hours to prepare for infection;

[0167] ⑻ Before infection, place the tobacco under a white fluorescent light for 1 hour to open its stomata;

[0168] (9) Select the third and fourth leaves from the bottom for infection (infect between two leaf veins). Select two leaves from one plant and infect with one bacterial solution.

[0169] ⑽Use a syringe with the needle removed to gently rub the back of the leaf to be rotated (0.5cm 2 ), or pierce it with a small needle to remove its waxy layer;

[0170] ⑾Before infection, mark the area to be transferred with a marker;

[0171] ⑿ Aspirate the final bacterial suspension from step 7 into a 1 ml syringe without a needle;

[0172] ⒀Point the syringe at the area to be transferred on the back of the leaf, press the leaf with one hand, and gently push the piston with the other hand until the liquid spreads, then infect other parts. After infection, circle the infected area with a marker;

[0173] ⒁Then spray the leaves with water, put them in a fresh-keeping bag, put the infected tobacco back into the culture room, and leave it in the dark overnight.

[0174] ⒂Open the fresh-keeping bag on the next day. The expression level is highest 2-3 days after injection.

[0175] ⒃Cut the infected area, tear off the epidermis to prepare slices, and observe under a fluorescence microscope.

[0176] (2) Experimental results

[0177] like Figure 9 As shown, fluorescence signals of PCAMBIA1300-35S-GFP-CsHsf24 fusion protein and empty vector with GFP were detected in the nucleus and cell membrane of tobacco leaf cells, indicating that the CsHsf24 gene was expressed in both the nucleus and cell membrane.

[0178] Example 3 Determination of flavonoid content in transgenic tea callus with CsHsf24 gene

[0179] (1) Experimental methods

[0180] 1. Experimental Materials

[0181] The materials were young stem segments of the "Fuding Dabai" tea tree from the Tea College of Guizhou University, which were used as explants for Agrobacterium-mediated genetic transformation.

[0182] 2. Construction of plant expression vector

[0183] The plant expression vector was constructed by conventional methods. Based on the original vector pSH737, the 35S promoter drove the gene, and the β-glucuronidase gene (B-glucuronidase, GUS) fusion gene was used as a screening marker gene and reporter gene. The pSH737-35S-CsHsf24 plant expression vector was designed and constructed ( Figure 10). Based on the sequencing results, the upstream restriction site was selected as Xba I and the downstream restriction site was selected as Kpn I. CsHsf24 amplification primers containing restriction sites were designed (Table 7). The amplified CsHsf24 and pSH737 were double-digested and purified. The sticky ends were connected using DNA ligase. The recombinant plasmid was transformed into competent Escherichia coli (DH5α). Positive clones were screened using 100 mg / L Kan. The recombinant plasmid was extracted and double-digested using Xba I and Kpn I for verification. Recombinant plasmids with positive restriction enzyme verification results were transformed into competent cells of Agrobacterium strain LBA4404. The plasmid containing the expression vector pSH737-35S-CsHsf24 was transformed into Agrobacterium strain LBA4404 by the freeze-thaw method to prepare an engineered strain. Thaw LBA4404 competent cells stored at -80°C on ice for 10 min; add 5 μL of plasmid DNA to each competent cell, gently flick to mix, and then place on ice for 30 min; quick-freeze in liquid nitrogen for 5 min, and immediately place in a 37°C water bath for 2 min; add 900 μL of 37°C preheated YEP liquid medium, and culture at 28°C, 200 rpm, and shake for 3 h; centrifuge at 4000 × g for 1 min at room temperature, and discard the supernatant; add 100 μL of YEP liquid medium to the bacteria and mix it by pipetting with a pipette tip; take an appropriate amount of bacterial liquid and spread it on a YEP plate culture medium containing 100 mg / L Kan and 20 mg / L Rif, place it upside down in a 28°C constant temperature incubator and culture for 2 days, and store the bacterial liquid at -80°C.

[0184] Table 7 Names and sequences of amplification primers for constructing CsHsf24 plant overexpression vector

[0185]

[0186] 3. Genetic transformation of tea plant stem segments with the tea plant CsHsf24 overexpression vector to form callus

[0187] Young stem segments of sterile tea plantlets were used as explants. These were cut into 0.5 cm segments using a sterile razor blade and immersed in the resuspension for approximately 6-8 minutes, with continuous shaking to ensure full contact between the bacterial solution and the leaves. The tea leaves were removed from the inoculum using tweezers and blotted dry with sterile absorbent paper. The young stem segments were then closely arranged end-to-end in the co-cultivation medium, labeled, sealed with parafilm, and co-cultivated in a dark incubator at 25°C for 2-3 days. A portion of uninfected young stem segments served as controls and remained under the same culture conditions.

[0188] The young stem segments of the co-cultivated sterile tea seedlings were transferred to the screening culture medium (kan 30 mg / L, Tim 200 mg / L) and cultured in a lighted tissue culture room at 25°C; the culture medium was replaced every 14 days. If contaminated, the culture medium was replaced in time; when the tea tree callus grew to about 3-4 cm, it was subjected to GUS staining for identification.

[0189] Cut the transgenic tea plant callus with scissors, cut the removed callus into small pieces, and completely immerse it in GUS staining solution. Place the stain in a 37°C incubator for 24-48 hours. After staining, transfer the callus to different concentrations of ethanol for a gradient elution until the material is completely decolorized. Finally, observe the callus under a stereomicroscope and take a picture. In addition to GUS staining, DNA extraction and PCR analysis are also performed.

[0190] 4. Determination of flavonoid content in tea callus

[0191] After the tea plant stem segments were infected with the CsHsf24 overexpression vector, the culture medium was changed every 14 days. When the calli grew to a relatively swollen state, each callus was collected and withered. After withering, the callus was dried to a constant weight, ground into powder, and stored at low temperature for later use.

[0192] Accurately weigh 0.01 g (accurate to 0.000 1 g) of uniformly ground sample into a 10 mL centrifuge tube. Add 5 mL of 70% methanol-water solution preheated at 70°C. Stir thoroughly with a glass rod to moisten the solution. Immediately transfer the sample to a 70°C water bath and extract for 10 minutes (stirring every 5 minutes). After extraction, cool to room temperature and centrifuge at 3500 rpm for 10 minutes. Transfer the supernatant to a 10 mL volumetric flask. Extract the residue again with 5 mL of 70% methanol-water solution, and repeat the above steps. Combine the extracts, dilute to 10 mL, shake well, filter through a 0.45 μm filter, and set aside. (This extract can be stored at 4°C for up to 24 hours.) Determine by high-performance liquid chromatography according to GB / T 8313-2018.

[0193] (2) Experimental results

[0194] 1. Genetic transformation of tea plant stem segments with the CsHsf24 overexpression vector and identification

[0195] Cut the overexpressed transgenic tea plant callus with scissors and completely immerse the removed callus in GUS staining solution to stain and decolorize. Then, observe the leaf under a stereo microscope and take pictures. Figure 11 Finally, wild-type calli and GUS histochemically stained positive calli were selected to extract DNA, and PCR amplification was performed using CsHsf24 gene-specific primers. The products were detected by 1% agarose gel ( Figure 12The results showed that the target band was not detected in the wild-type callus, while the expected 351bp target band was detected in three transgenic calli, indicating that the tea plant CsHsf24 gene had been successfully integrated into the tea plant callus genome.

[0196] 2. Determination of flavonoids in transgenic tea plant callus

[0197] The present invention determined eight catechin compounds, namely catechin (C), epicatechin (EC), gallocatechin (GC), epigallocatechin (EGC), catechin gallate (CG), epicatechin gallate (ECG), gallocatechin gallate (GCG), and epigallocatechin gallate (EGCG). Among them, EGCG is a catechin unique to tea, with the highest content, accounting for 40% to 50% of tea polyphenol products, and has the most outstanding antioxidant properties. It is also the final product of flavonoid 3', 5'-hydroxylase (F3'5'H) in the catechin biosynthesis pathway, see Figure 13 . It can be clearly seen from the results that the content of EGCG in the transgenic tea tree callus, the highest content in the overexpression callus is much higher than that in the uninfected. The content of EGC in the transgenic tea tree callus is also higher than that in the WT, and the content of other substances does not change significantly. Other flavonoid substances involved in the flavonoid synthesis pathway, such as rutin, dihydroquercetin, quercetin, dihydromyricetin, and myricetin, were also determined. The results showed that the highest content in the overexpression callus was higher than that in the uninfected ( Figure 14 This indicates that the CsHsf24 transcription factor can work together with the F3'5'H1 gene to promote the synthesis of related products in the synthesis pathway.

[0198] Example 4: Genetic transformation of tobacco with the tea plant CsHsf24 overexpression vector increases the flavonoid content in tobacco

[0199] (1) Experimental methods

[0200] 1. Experimental Materials

[0201] The tobacco used was the "Samsung" sterile tobacco seedlings preserved by our research group.

[0202] 2. Construction of plant expression vector

[0203] The construction method is consistent with that of Example 3.

[0204] 2. Genetic transformation of tobacco with tea plant CsHsf24 overexpression vector

[0205] Referring to the method of Yao Xinzhuan et al., tobacco leaves were used as explants through the Agrobacterium-mediated leaf disc transformation method. The tobacco leaves were genetically transformed with Agrobacterium liquid containing pSH-CsHsf24. After 2 days of co-cultivation, they were transferred to screening medium (Tim, Kan) and cultured for about 14 days. After green callus tissue appeared on the leaf edge, resistant buds were induced by subculture. The resistant buds of about 2 cm were cut off and placed on rooting medium to induce rooting. After the regenerated seedlings grew to 3-6 cm, they were hardened and transplanted into pots for culture. Transgenic regenerated seedlings with kanamycin (Kan) resistance were obtained, and 12 transgenic plants were obtained.

[0206] (2) Experimental results

[0207] CsHsf24 was genetically transformed into tea plant stem segments, and the flavonoid content was measured after callus formation. The flavonoid content was higher than that of the control. It was also genetically transformed into tobacco leaves to obtain 8 transgenic positive plants, and the positive plants obtained (see Figure 15 ) The content of the corresponding flavonoids in tobacco was determined. The results showed that the content of flavonoids in tobacco increased relative to the control content. Figure 16 In general, it shows that the CsHsf24 transcription factor can work together with the F3'5'H gene to promote the synthesis of related products in the synthesis pathway.

[0208] As can be seen from the above examples, the present invention provides a transcription factor CsHsf24 involved in the regulation of flavonoid synthesis in tea plants and its application. CsHsf24 can increase the content of flavonoids in tea plants by transcriptionally activating the expression of CsF3'5'H1.

[0209] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention. Sequence Listing <110> Guizhou University <120> Transcription factor CsHsf24 and its application in regulating flavonoid biosynthesis in tea plants <130> PP22074-GZD <140> 2022106730869 <141> 2022-06-15 <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1966 <212> DNA <213> Camellia sinensis <400> 1 tatgaggtaa tttcatagat gaaagctggc atgaggcaaa attttggtac caaggtaaac 60 atgcccaact taggtttatc atcatattat aagtgtgatc aagtgagaga tgaaggtata 120 agaggtgatc acatcataat atgacggacc ctctcacacc gaatcataac ttgtaaagtg 180 gtgatgtaca aaccttcccc caaaaagttg agaacaatct agaagttgtg tatttgaatt 240 tcaaacacca aatgatataa gtattggtga aaggttatta taaaaggtgg tacctattag 300 tattgagaaa caaactcaat acgtgtgacc attcctaata gccaccatga tgtatataaa 360 tactcatggc aagtgaagtt gcaacccact tgaatcattt tttttttggt ctctcccgga 420 tcctcgattt tctagcataa taaataccct cacggaatta tcgatcttcg ccattgtcag 480 tttctcgttc aatatcacca cccaccacta gtcactatag ctggcgattt tttcagccat 540 ttttcggtg aatttcat taacttctc gagcagtggt ctggcattgg tccgaccatc 600 attaggggt aatctagtga atagtgtgca gttaaaaaat atgtatattg ggttctgaat 660 ttattatttt tatctttttt aagggttctt ctactagggt atgtattata tgcctagtta 720 tgatgtttta tggtttttta tattacattca tattatttt ggttatgact tattatataac 780 ttattgtaca gttaattatg acatcttgtg ttttcattt taattatgat cagagaagtt 840 ttggttatgt ttgaagtgat ctgtgattat gacttttagt tatgacgtgg tatataca 900 cattattgtt attattag ttatgactac aaaattttt attatacct taaatgatat 960 ttggttataa catattgtat ttttttttt agctatgact tgaaaatgat ataattataa 1020 catttggggt attackacacta caacgccag aaaatagat tctttaagtt gtcatcttaa 1080 cttaagagaa tattttaggtt tgataggtta atttttggaac cattttagt aattcgagcc 1140 gttcactttt tatgactcat tgaatagaat attcataca aaaaaaaat CAAAATTT 1200 ggatatcgat aactatatgt ttcaatcata ttgtttttta aaaaatagac aaaaata 1260 attttataca aatataattc aaacatataa ctaacaatat ccgatctttt taagtttttg 1320 catgaatatt ctatttaaca agtattaaaa agtgagtgat tcatattacc aaacctatct 1380 taaaatagac ttaccaaacc caaatatttt ctaagttgag atggtgaact ttaaaaaaaa 1440 acaaacccgt taatgattat tatatacgtg tacgtaaata tgaaaatttt tatgaagcat 1500 cttagactgg tagagaagac tcactggcca gcatgagaag accccacatcag cctcctctgt 1560 ggtaagtgaa catatgtttc ttgaccaacc atatcatcaa actctaatgc aacttaccta 1620 agtagcacat aaaattctta aaaacacaca aacctcaact tttgaaattt tctatttttc 1680 1740 taagaacttt ttttaaaaaa atttcttggg ccttaaaaag agtctaaata gcttaatgat 1800 tgaacttctc gtgataaaaa ttactttttg ttctcaagat atctccactt gaggtaagtc 1860 caactaaat tccataatac ctttggtcac caaatcacta aaatgagagc cctataaact 1920 tcatacctaa caaaccaaa caacacgagc atttggtact caaaac 1966 <210> 2 <211> 1201 <212> DNA <213> Camellia sinensis <400> 2 accccgccgt gaactccata cgaacgtacc agtatcgc tcatatgaca agtttgtaca 120. aaaaagttgg aaattttcca gaacctgctt catctctctc tctctctctg gtggccatcg 180. tgtctcctct gctttttcac aaaaaagagtt tctcctacac acaactcaga atagcaacca aaaacacaca tacacagaga aaaccaagta tagcttgt gtagaaacct agttagtc gtgtcctcaa catacgaga agagataat aatggaga gctaacaaag cgaagcgttc 360. tatcacagat ctggcgcact ctcgagtatt cgtttctggg ttctattgct ggggttggga gttcctcact gctctcttgc tctttagtgg ttccttctaa acaacacaaa aacttgaaca 420 tccccaaaaa caagattagg attattttgg tgattgattg atcgatatat tgattttggtg agtgtgggag atggggcaga ggtcagttcc ggcgccgttt ctcacgaga cgtaccagtt 540 ggtggatgat ccgagcagcg acgacgtcgt gtcgtggaac gaaagcggca cgacctttgt 600. ggtctggaa acagctgatt tcgctaagga tttgttgccc aattacttca agcacacaa cttctctagc tttgttcgcc aacttaacac ctatggcttt cgaaaaactg tgcccgacaa atgggaattt gctaacgaga atttcgtacg aggccaaaaa gagctcctca cgaagatccg tcgccgtaag gcactaacgt catccccggg ccggtggaaa atcccccgcc gcagccgcca 840 tcggcagccc tttcctcgcc gtcgaattcc ggcgaggacc tagggtccac ctccaccttc 900 gtccccggga ttccaagaac gcggggtcgg tggaggctcc gggcggaggg cttatttcg ccgacttgtc ggacgagac agaactgaga gagactcga tgatgctgac ctcggagctc gcgcagacga agagccatgc cgacgagctc atctcttttc cttcaccgag tatgttcaag 1080 gttggcctcc tgattcagat ccaattcgca atccatggct tcacctggtg attgaatttg ccacgtcaga tcggaaacca ctgggatgat gatgatgcac gacgaaatat cctggaagag a 1201 <210> 3 <211> 289 <212> PRT <213> Camellia sinensis <400> 3 Met Gly Gln Arg Ser Val Pro Ala Pro Phe Leu Thr Lys Thr Tyr Gln 1 5 10 15 Leu Val Asp Asp Pro Ser Ser Asp Asp Val Val Ser Trp Asn Glu Ser 20 25 30 Gly Thr Thr Phe Val Val Trp Lys Thr Ala Asp Phe Ala Lys Asp Leu 35 40 45 Leu Pro Asn Tyr Phe Lys His Asn Asn Phe Ser Ser Phe Val Arg Gln 50 55 60 Leu Asn Thr Tyr Gly Phe Arg Lys Thr Val Pro Asp Lys Trp Glu Phe 65 70 75 80 Ala Asn Glu Asn Phe Val Arg Gly Gln Lys Glu Leu Leu Thr Lys Ile 85 90 95 Arg Arg Arg Lys Ala Leu Thr Ser Ser Pro Ala Gly Gly Lys Ser Pro 100 105 110 Ala Ala Ala Ala Ile Gly Ser Pro Ser Ser Pro Ser Asn Ser Gly Glu 115 120 125 Asp Leu Gly Ser Thr Ser Thr Ser Ser Pro Asp Ser Lys Asn Ala Gly 130 135 140 Ser Val Glu Ala Pro Ala Arg Ala Gln Phe Ala Asp Leu Ser Asp Glu 145 150 155 160 Asn Lys Lys Leu Lys Arg Asp Asn Glu Met Leu Thr Ser Glu Leu Ala 165 170 175 Gln Thr Lys Lys Gln Cys Asp Glu Leu Ile Ser Phe Leu Thr Glu Tyr 180 185 190 Val Lys Val Ala Pro Asp Gln Ile Asn Arg Ile Met Leu Thr Cys Asp 195 200 205 Glu Leu Asn Gly Gln Ile Glu Thr Thr Gly Asp Asp Asp Asp Asp Asp 210 215 220 Glu Asn Thr Glu Glu Lys Ser Gly Glu Gly Leu Lys Leu Phe Gly Val 225 230 235 240 Trp Val Asn Gly Asn Lys Lys Lys Arg Gly Arg Asp Glu Lys Leu Gly 245 250 255 Phe Gly Gly Thr Asn Arg Lys Glu Met Lys Thr Val Asp Tyr Asp Asp 260 265 270 Ala Pro Trp Met Lys Ile Ser Thr Ala Pro Gly Glu Thr Gly Lys Val 275 280 285 Cys

Claims

1. Use of a gene encoding a transcription factor CsHsf24 protein in promoting positive regulation of plant flavonoid synthesis, or in genetic engineering breeding for increasing the plant flavonoid content in tea leaves, wherein the amino acid sequence of the transcription factor CsHsf24 protein is shown in SEQ ID No. 3, the plant is tea or tobacco, and the plant flavonoids are rutin, dihydroquercetin, quercetin, dihydromyricetin, or myricetin.

2. The use according to claim 1, characterized in that: The transcription factor CsHsf24 binds to the promoter of the flavonoid-3'5'-hydroxylase gene F3'5'H1 involved in flavonoid synthesis, thereby activating the expression of the F3'5'H1 gene, thereby increasing the flavonoid content; the sequence of the promoter of the flavonoid-3'5'-hydroxylase gene F3'5'H1 is shown in SEQ ID No.

1.

3. The use according to claim 2, characterized in that: A recombinant vector of the transcription factor CsHsf24 is constructed and the recombinant vector is transferred into plants to overexpress the F3'5'H1 gene, thereby increasing the flavonoid content.

4. The use according to claim 3, wherein the recombinant vector uses pSH737-35S as the original vector, and the transcription factor CsHsf24 is inserted into the multiple cloning site of pSH737-35S.

5. The use according to claim 4, wherein the transcription factor CsHsf24 is inserted between the Xba I and Kpn I restriction sites on the original vector pSH737-35S.

6. The use according to claim 5, wherein the recombinant vector is prepared by the following method: using tea plant leaf cDNA as a template, a primer pair is used to obtain a PCR product of CsHsf24; pSH737-35S is double-digested with Xba I and Kpn I, recovered, and ligated to obtain a recombinant vector named CsHsf24-pSH737-35S, and the primer pair is primer F: CACAACAACTTCTCCAGCTTTG, primer R: CAGCATCTCGTTGTCTCTCTTC.

Images