A sgRNA for a Sec1 gene knockout mouse model, its construction method and its application
The Sec1 gene knockout mouse model was constructed using CRISPR-Cas9 technology, which solved the technical bottleneck in the study of Sec1 gene function, provided a tool for studying the role of Sec1 gene in mammalian reproductive system development and cell adhesion, and revealed the function and mechanism of Sec1 gene.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-01-06
- Publication Date
- 2026-03-13
AI Technical Summary
The lack of effective Sec1 gene knockout mouse models in current technologies limits research on the function and mechanism of the Sec1 gene, particularly in the exploration of mammalian reproductive system development and cell adhesion.
Using CRISPR-Cas9 gene knockout technology, sgRNA targeting the Sec1 gene was designed and injected into mouse zygotes along with Cas9 nuclease. A Sec1 gene knockout mouse model was constructed through gene editing, and homozygous offspring were obtained by PCR identification and screening.
A Sec1 gene knockout mouse model was provided to study the effects of the Sec1 gene on cell adhesion, individual phenotype, and reproductive capacity, revealing the function and mechanism of the Sec1 gene in mammals and providing a basis for research on related diseases.
Smart Images

Figure CN115058418B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to an sgRNA for a Sec1 gene knockout mouse model, its construction method, and its application. Background Technology
[0002] The Sec1 gene is one of three genes in mice that encode galactose 2-L-focusyltransferase, also known as Fut3 and Fut10. These genes differ in developmental and tissue-specific expression (REF). This gene is predicted to encode a type II membrane protein anchored in the Golgi apparatus, controlling the final step in the generation of α(1,2)-focused carbohydrates by adding a terminal focus to the α(1,2) junction. The biological functions of focus-pointed carbohydrates are thought to be involved in cell adhesion and interactions with microorganisms.
[0003] The Sec1, Fut1, and Fut2 genes encode α1,2-fucosyltransferases (α2FTS), enzymes involved in the biosynthesis of α2-fucosyl glycans in mammalian gene tissues. Previous studies have shown that fucosylated glycans are involved in numerous biological and pathological processes, including signal transduction, host-microbe interactions, tissue development, cancer progression, and the synthesis of ABH and Lewis tissue serogroup antigens. Furthermore, extensive gene conversion of Fut1, Fut2, and Sec1 has been identified in mammals.
[0004] Studies in pigs have shown that FUT3 can initiate epithelial-mesenchymal transition and promote colorectal cancer metastasis by influencing P38 signaling and the TGF-β / Smad pathway through TβR (mainly TβI) fucosylation modification. Downregulation of FUT3 reduces the expression of fucosylated antigen (Ley), promoting cell adhesion.
[0005] Related studies in humans have shown that the FUT3 gene encodes α-(1,3 / 4)fucosyltransferase, which is essential for the synthesis of Lewis tissue blood types. Simultaneously, similar to FUT2, FUT3 gene polymorphisms have been revealed to influence Helicobacter pylori infection. Furthermore, research on the FUT3 gene in intestinal diseases (Hu et al., 2014; Duell et al., 2015; DoNascimento et al., 2019) has also included studies focusing on the impact of FUT3 on tumor markers, its prognostic role in cancer, and related cancer cell movement mechanisms. Summary of the Invention
[0006] The purpose of this invention is to provide a method for constructing a Sec1 gene knockout mouse model, which designs a Sec1 gene knockout mouse model based on CRISPR-Cas9 gene knockout technology.- / - A mouse model is used to provide new evidence for the study. To achieve the above objectives, the present invention provides the following solution:
[0007] An sgRNA for constructing a Sec1 gene knockout mouse model includes an sgRNA targeting the 61st base of exon 4 of the Sec1 gene and an sgRNA targeting the 1270th base of exon 4 of the Sec1 gene.
[0008] The sgRNA sequence targeting the 61st base of exon 4 of the Sec1 gene is as follows:
[0009] gRNA1: CCTCTCTTCGTGATTTTCGTGG;
[0010] The sgRNA sequence targeting exon 4 at nucleotide 1270 of the Sec1 gene is as follows:
[0011] gRNA2: GGCCTACCATTCGCTGCATCTGG.
[0012] The present invention also provides a gene knockout vector, wherein the above-mentioned double sgRNA is recombined into an expression vector to obtain a gene knockout vector.
[0013] This invention also provides a method for constructing a Sec1 gene knockout mouse model. The above-mentioned sgRNA and Cas9 nuclease mRNA are transcribed in vitro and injected together into mouse zygotes. The zygotes are then transplanted into pseudopregnant mice to obtain chimeric F0 generation mice. The F0 generation mice are identified by PCR. Positive F0 generation mice are mated with wild-type mice to obtain F1 generation mice with stable genotypes. Homozygous offspring with Sec1 gene knockout are selected as Sec1 gene knockout mouse models.
[0014] The present invention also provides a Sec1 gene knockout mouse model, which is constructed by the above method.
[0015] The identification method for the Sec1 gene knockout mouse model and the primer sequences for identifying the mouse genotype are as follows:
[0016] F1: 5'- AGGTGACAGAAAGATTCAGAGGTAC-3'
[0017] R1: 5'- GAGTGAGTGTGAGTGTGCTAGAAAC-3'
[0018] F1: 5'- AGGTGACAGAAAGATTCAGAGGTAC-3'
[0019] R2: 5'-AGTGCAAACAGCGTGGCATATTC-3'.
[0020] Furthermore, wild-type individuals produced 1765 / 446 bp PCR products, homozygous knockout mice produced only 555 bp PCR products, and heterozygous individuals produced three different products.
[0021] Furthermore, genomic DNA was extracted from the rat's tail and toes and used as templates for PCR identification.
[0022] Furthermore, the PCR reaction system is as follows:
[0023] .
[0024] Furthermore, the PCR reaction conditions are as follows:
[0025] .
[0026] The present invention also provides the application of the above-mentioned Sec1 gene knockout mouse model in the preparation of drugs targeting the reduction of sperm quality in male mammals.
[0027] The Sec1 gene (NCBI reference column: NM_001271578; Ensembl: ENSMUSG00000040364) is located on mouse chromosome 7. Four exons were identified: the ATG start codon is in exon 3, and the TAG stop codon is in exon 4 (transcript: ENSMUST00000040636). Therefore, the coding region of Sec1 includes exon 3 and exon 4. Two pairs of cas9n double-nicking nucleases were designed to target the Sec1 gene, with target sequences located in exon 4, resulting in a knockout length of 1210 bp. Cas9 and gRNA were co-injected into fertilized eggs to produce knockout mice. F0 generation mice were crossed with wild-type mice to obtain the F1 generation Sec1 gene knockout mouse model. Exon 4 was selected as the target site. Cas9 and gRNA were co-injected into fertilized eggs to produce KO mice. Genotyping of pups was performed by PCR, followed by sequencing analysis. Exon 4 begins at approximately 8.4% of the coding region. Exon 4 covers 91.69% of the coding region. The effective knockout region size is ~1068 bp. No other known genes are present in the knockout region. This invention provides an sgRNA for constructing a Sec1 gene knockout mouse model, wherein the sgRNA action site is located at nucleotides 61 and 1270 of exon 4. Further, the sgRNA sequence at nucleotide 61 of exon 4 is as follows:
[0028] gRNA1: CCTCTTCTTCGTGATTTTCGTGG;
[0029] The sequence of the sg RNA designed at the 1270th base of exon 4 is as follows:
[0030] gRNA2: GGCCTACCATTCGCTGCATCTGG.
[0031] This invention also provides a method for constructing a Sec1 gene knockout mouse model, the method being based on CRISPR-Cas9 gene knockout technology, and the method comprising the following steps:
[0032] Step 1: Design sgRNAs that target the Sec1 gene to be knocked out in mice;
[0033] Step 2: After in vitro transcription of sgRNA and Cas9 nuclease mRNA, they were injected together into mouse zygotes. The zygotes were then transplanted into pseudopregnant mice to obtain chimeric F0 generation mice. The F0 generation mice were identified by PCR. Positive F0 generation mice were mated with wild-type mice to obtain F1 generation mice with stable genotypes. Homozygous offspring with Sec1 gene knockout were selected as Sec1 gene knockout mouse models.
[0034] Beneficial effects
[0035] This study established Sec1 knockout mice and tracked the traits of Sec1- / - and Sec1+ / + mice. Fecal samples from Sec1- / - and Sec1+ / + mice were compared and analyzed to understand the impact of Sec1 gene knockout on individual mice and its relationship with phenotypic differences. The aim was to reveal whether Sec1 gene knockout affects individual phenotypes and to provide relevant evidence and animal models for research on the function and mechanism of the Sec1 gene. The Sec1 gene knockout mouse model provided by this invention can be applied to investigate cell adhesion, the impact on individual phenotypes, the regulation of gene-related hosts, and the effects on mouse reproductive capacity, such as testicular development. Attached Figure Description
[0036] Figure 1 For Sec1 - / - Design and identification of mouse models, schematic diagram of sgRNA design and knockout strategy;
[0037] Figure 2 A. Agarose gel electrophoresis was used to identify the mouse tail genotype, which was wild-type, homozygous, and heterozygous (Note: 1765bp was not visible due to insufficient amplification); B. Western blot analysis was used to analyze the knockout effect of the Sec1 gene in mouse testicular tissue.
[0038] Figure 3The mRNA expression level of Sec1 in various tissues of six-week-old wild-type mice was detected using Q-PCR.
[0039] Figure 4 The expression of the Sec1 gene in various tissues of 0-week-old wild-type C57 mice is shown in the following order: heart, liver, spleen, lung, kidney, duodenum, and testis.
[0040] Figure 5 The expression of the Sec1 gene in various tissues of 3-week-old wild-type C57 mice: heart, liver, spleen, lung, kidney, duodenum, and testis, in that order.
[0041] Figure 6 The expression of the Sec1 gene in the reproductive system and sperm of six-week-old wild-type C57 mice;
[0042] Figure 7 For A is Sec1 - / - and Sec1 + / + Changes in body weight of mice at 6, 12, and 18 weeks of age, where B represents Sec1. - / - and Sec1 + / + Changes in abdominal fat mass in mice;
[0043] Figure 8 For Sec1 - / - and Sec1 + / + Histological section of the testis;
[0044] Figure 9 For Sec1 - / - and Sec1 + / + Detection of mouse sperm motility, motility rate, linear rate, curvilinear rate, and path rate. Detailed Implementation
[0045] The technical solution of the present invention will now be specifically described by way of embodiments, but it should not be regarded as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the present invention.
[0046] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified. Construction of the Sec1 gene knockout mouse model was carried out.
[0047] Analysis of the transcript, domains, and regulatory regions of the mouse Serac1 gene revealed that the Sec1 gene (NCBI reference sequence: NM_001271578; Ensemble: ENSMUSG00000040364) is located on mouse chromosome 7. Four exons were identified: the ATG start codon in exon 3 and the TAG stop codon in exon 4 (transcript: ENSMUST00000040636). Exon 4 was selected as the target site. Cas9 and gRNA were co-injected into fertilized eggs to induce KO mouse production. Genotyping of pups was performed by PCR, followed by sequencing analysis. Exon 4 begins at approximately 8.4% of the coding region. Exon 4 covers 91.69% of the coding region. The effective KO region size is ~1068 bp. No other known genes are present in the KO region. Therefore, the sgRNA was designed for these two regions, and the sgRNA sequence is as follows:
[0048] gRNA1: CCTCTTCTTCGTGATTTTCGTGG;
[0049] gRNA2: GGCCTACCATTCGCTGCATCTGG.
[0050] 2. After in vitro transcription of sgRNA and Cas9 nuclease mRNA, they were injected together into mouse zygotes, and then the zygotes were transplanted into pseudopregnant mice to obtain chimeric F0 generation. The F0 generation was identified by PCR, and positive F0 generation mice were mated with wild-type mice to obtain F1 generation mice with stable genotypes. Homozygous offspring with Sec1 gene knockout were screened to serve as Sec1 gene knockout mouse models.
[0051] Figure 1 For Sec1 - / - The design and identification of the mouse model, along with a schematic diagram of the sg RNA design and knockout strategy, are shown in the figure. As can be seen from the figure, the target sequences of the two pairs of cas9n double-cutting nucleases designed for the Sec1 gene are located on exon 4, with a knockout length of 1210 bp. This invention utilizes the Sec1 gene knockout animal model constructed above for subsequent experiments.
[0052] I. Mouse Genotyping:
[0053] The mice used were of the C57BL / 6J strain. After obtaining the knockout mice, their genotypes were identified. Genomic DNA was extracted from the tails and toes of the mice and used as templates for PCR identification.
[0054] PCR reaction system:
[0055]
[0056] PCR reaction conditions:
[0057]
[0058] Amplification primers:
[0059] Forward primer (F1): 5'-AGGTGACAGAAAGATTCAGAGGTAC-3';
[0060] Reverse primer (R1): 5'-GAGTGAGTGTGAGTGTGCTAGAAAC-3';
[0061] Forward primer (F1): 5'-AGGTGACAGAAAGATTCAGAGGTAC-3';
[0062] Reverse primer (R2): 5'-AGTGCAAACAGCGTGGCATATTC-3'.
[0063] 1.1 Experimental Materials
[0064] DNA gel extraction kit (Axygen Biosciences, Union City, CA, USA), RNAsimple total RNA extraction kit, blood / tissue / cell DNA extraction kit, endotoxin-free plasmid mini-prep kit; AceQ qPCR SYBR Green Master Mix kit purchased from Vazyme (Nanjing, China); [α- 32P]CTP was purchased from PerkinElmer; the Riboprobe in vitro transcription labeling system was purchased from Promega; E. coli antibody was purchased from GeneTeX (USA); the secondary antibody anti-rabbit IgG was purchased from R&D Systems (USA); T4 DNA ligase and other enzymes were purchased from New England Biolabs (NEB) (USA); tryptone, yeast extract, sodium chloride, isopropanol, chloroform, anhydrous ethanol, DEPC water (diethyl pyrocarbonate), EDTA agarose, 10× MOPS gel electrophoresis buffer, and 20× SSC buffer were purchased from Shanghai Sangon Biotech Co., Ltd. Sec1 antibody was purchased from LifeSpan Biosciences. The whole protein extraction kit and BCA protein content detection kit were purchased from Nanjing Kaiji Biotechnology Development Co., Ltd.; 5×SDS-PAGE protein loading buffer, 1OxTris-glycine protein electrophoresis buffer, electrotransfer buffer, WB washing buffer, WB blocking buffer, antibody dilution buffer, ECL detection kit, etc. were purchased from Nanjing Xianyixing Biotechnology Co., Ltd.; and the molecular weight of the stained proteins was purchased from Thermo Fisher Scientific.
[0065] 1.2 Extraction and quality testing of RNA from tissues and cells
[0066] Total RNA was extracted from intestinal tissues of Sutai pigs and Meishan pigs, cells infected with bacteria and LPS-induced cells, and cells before and after lncRNA-FUT3-AS1 silencing, strictly following the kit instructions. Specific steps are as follows:
[0067] 1.2.1 RNA Extraction
[0068] (1) For tissues, take 50-100 mg of tissue sample and put it into a 5 mL centrifuge tube, add 1 mL of lysis buffer RZ, place it on ice, and homogenize the tissue using a German FLUKO homogenizer to ensure sufficient tissue lysis. Then quickly transfer it to a pre-cooled 1.5 mL enzyme-free Ep tube. For cells, centrifuge the collected cells to remove the supernatant, and add 1 mL of lysis buffer RZ directly.
[0069] (2) The tissue homogenate was allowed to stand at room temperature for 5 min to allow the nucleic acid and protein complexes to completely separate. 200 μL of chloroform was added, the mixture was vortexed for 15 s, left at room temperature for 3 min, and then centrifuged at 12000 rpm for 10 min at 4 ℃. The aqueous phase was then transferred to a new enzyme-free tube.
[0070] (3) Add 0.5 times the volume of anhydrous ethanol, invert and mix well, transfer the mixture into the adsorption column CR3, and centrifuge at 12000 rpm for 30 s at 4 ℃.
[0071] (4) Add 500 μL of protein removal solution RD to the column, centrifuge at 12000 rpm for 30 s at 4 ℃, and discard the waste liquid.
[0072] (5) Add 500 μL of PW washing solution to the column, let it stand at room temperature for 2 min, centrifuge at 12000 rpm for 30 s at 4 ℃, discard the waste liquid, and repeat this step once.
[0073] (6) Place the adsorption column into the collection tube and centrifuge at 4 ℃ and 12000 rpm for 2 min to remove the liquid remaining.
[0074] (7) Place the adsorption column into a new centrifuge tube, add 30 μL of RNase-Free ddH2O, let it stand at room temperature for 2 min, and centrifuge at 12000 rpm for 2 min at 4 ℃.
[0075] 1.2.2 RNA quality testing
[0076] (1) The concentration of RNA was detected using a NanoDrop 1000 instrument. The A260 / A280 ratio between 1.7 and 2.1 preliminarily indicates that the extracted RNA has high purity and can be used for the next step of the experiment.
[0077] (2) Preparation of 1.2% formaldehyde agarose gel for RNA purity detection: 0.6 g agarose was dissolved in 36 mL sterile water and heated in a microwave oven on medium heat for 2 min. When the temperature of the solution dropped to about 55 °C, 5 mL of 10× MOPS electrophoresis buffer and 9 mL of deionized formamide were added, mixed well, poured into the gel, and left at room temperature until gelation was complete.
[0078] (3) Prepare the RNA denaturation reaction system for loading: 2 μL of 10× MOPS electrophoresis buffer, 10 μL of deionized formamide, 3.6 μL of 37% formaldehyde, 4.4 μL of RNA and 0.2 μL of EB.
[0079] (4) Place the RNA denaturation mixture incubate at 65 °C for 10 min, place the sample on ice to cool for 10 min, and then gently shake the centrifuge tube to let the liquid settle to the bottom.
[0080] (5) Add 2.5 μL of 10× formaldehyde gel loading buffer and gently mix.
[0081] (6) Add an appropriate volume of 1× MOPS buffer to the RNA electrophoresis tank, place the electrophoresis gel into the buffer, and pre-electrophoresis for 5 min. After mixing the RNA denaturation system solution evenly, add it all into the gel wells using a pipette.
[0082] (7) After 40 min at 50 V voltage, carefully observe the RNA bands under ultraviolet light.
[0083] 1.2.3 RNA reverse transcription and quantitative real-time PCR detection
[0084] The RNA obtained in the previous step was reverse transcribed and then subjected to quantitative real-time PCR to detect the expression level of the Sec1 gene in various mouse tissues. The specific steps are as follows:
[0085] 1.2.4 Reverse transcription
[0086] Using tissue and cellular RNA as templates, cDNA synthesis was performed strictly according to the experimental procedures of the first-strand synthesis kit. A genomic DNA removal reaction system was prepared, containing 2 μL of 5× gRNA Buffer per 10 μL of system, with the total RNA volume not exceeding 2000 ng. RNase-free ddH2O was added to bring the final volume to 10 μL. After mixing, the mixture was briefly centrifuged and incubated at 42 °C for 3 min. A reverse transcription system was prepared by adding 2 μL of 10× lnR RT Buffer, 2 μL of lnR RT Enzyme Mix, 2 μL of lnR RT Primer Mix, and 5 μL of RNase-free ddH2O to the above mixture. The reverse transcription program was 42 °C for 15 min, 95 °C for 3 min, and then cooled on ice. The resulting cDNA was used for subsequent experiments or for cryopreservation.
[0087] 1.2.5 Quantitative Real-Time PCR Detection
[0088] Real-time quantitative PCR amplification system 20 µL: cDNA (100~500 ng) 1 µL, upstream and downstream primers (10 µmol•L) -1 0.5 µL each of 50× ROX Reference Dye, 2 µL of Premix, 10 µL of ddH2O, and 6 µL of ddH2O were added. The PCR amplification program was as follows: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 5 s, 60 °C annealing and extension for 32 s, for 40 cycles. After amplification, melting curve analysis was performed using the following program: 95 °C for 15 s, 60 °C for 1 min; 95 °C for 15 s, 60 °C for 15 s. Based on the melting curve having a CT value of (85 ± 0.8) °C, the following parameters were used: CT. m The specificity of the amplification was determined by the primers. Each sample was tested three times, and the average value was taken.
[0089] 1.2.6 Western blot detection of proteins
[0090] 1.2.6.1 Extraction and concentration determination of total protein from tissues
[0091] (1) Use a homogenizer to homogenize the tissue, transfer the homogenized tissue sample to a centrifuge tube, centrifuge at 1000 rpm for 10 min, and discard the supernatant. Add 5 mL of PBS and wash twice, shaking several times each time to remove as much residual culture medium as possible.
[0092] (2) Add 5 μL of 100 mM MPMSF, 10 μL of phosphatase inhibitor and 1 μL of protease inhibitor to each 1 mL of cold Lysis Buffer, mix well and place on ice for several minutes before use.
[0093] (3) After washing the cells, transfer them to a new pre-cooled centrifuge tube and add 1 mL of prepared cold Lysis Buffer.
[0094] (4) Place at 4°C and shake violently for 30 seconds, then place on ice for 4 minutes. Repeat 5 times.
[0095] (5) Centrifuge at 4°C (12000 rpm) for 5 min and collect the supernatant. The supernatant is the extracted whole protein. Store at -70°C for later use.
[0096] (6) The BCA protein concentration assay kit is used to detect the extracted whole protein and standardize the protein level.
[0097] 1.8.3.2 Western blot technique for detecting protein levels
[0098] (1) Preparation of sodium dodecyl sulfate-polyacrylamide gel (SDS-PAG): Prepare 5% stacking gel and 10% separating gel according to the instructions.
[0099] (2) Electrophoresis detection: The protein samples of each group were diluted to the same concentration level with cell lysis buffer. An equal volume of protein solution (about 70 pg) was mixed with protein loading buffer and added to a centrifuge tube. After incubation at 95°C for 5 min, the tube was quickly placed on ice to cool and then loaded onto the gel. Electrophoresis conditions: stacking gel 80V for 20 min; separating gel 100V for 90 min.
[0100] (3) Wet electrotransfer membrane: Take out the gel and place it in the pre-prepared electrotransfer buffer at room temperature for equilibration for 15 min. In addition, put the polyvinylidene fluoride (PVDF) membrane and filter paper into deionized water and electrotransfer buffer respectively, keeping them submerged. Place the bottom electrode (anode) horizontally, and place the filter paper, PVDF membrane, protein gel and filter paper on top. After squeezing out the air bubbles in each layer, place the top electrode (cathode) on the upper filter paper and perform electrotransfer at a constant current of 200 mA for 1 h.
[0101] (4) Sealing: Immerse the transferred PVDF membrane in a sealing solution containing 5% skim milk powder for 1 hour (room temperature), then discard the sealing solution.
[0102] (5) Antibody-target protein specific binding: Add appropriate volumes of blocking buffer and primary antibody Histone H4 (1:500), H4K16acmAb (1:400), H4K12acmAb (1:400), H4K8acmAb (1:400), H4K5acmAh (1:400), FUT3 (1:600), and internal control primary antibody 3-actin (1:4000) dilution buffer to the box. After incubating overnight at 4°C with shaking, wash the PVDF membrane four times (5 min each time) with PBST buffer. Incubate the PVDF membrane and horseradish peroxidase (HRP)-labeled secondary antibody (1:5000) at room temperature with shaking for 1-2 h. Finally, wash four times with PBST buffer (5 min each time).
[0103] (6) Development and imaging: per cm 2 Calculate the required amount of developing solution (0.1 mL) and immerse the PVDF membrane in it. Incubate at room temperature for 1 minute. Carefully wrap the PVDF membrane with plastic wrap (avoiding air bubbles). In a dark room, quickly place the membrane protein onto X-ray film for exposure. Develop and process the film in a film processor.
[0104] like Figure 2 As shown, wild-type individuals' PCR products have two bands at 1765 bp and 446 bp, homozygous knockout mice have only one band at 555 bp, while heterozygous individuals have three bands at 555 bp, 446 bp, and 1765 bp. Based on this principle, we performed karyotype identification on the offspring mice and found that we obtained homozygous sec1 knockout individuals (with only one band at 555 bp). Figure 2 A). Simultaneously, regarding sec1 - / - Testicular tissue from homozygous individuals was analyzed to validate the Sec1 protein, and Sec1 was found to be present. - / - Sec1 protein is hardly expressed in mice. Figure 2 B). Comprehensive Figure 2Based on the results of A and B, we successfully constructed a Sec1 knockout mouse model.
[0105] Meanwhile, we used Q-PCR to detect the expression level of Sec1 mRNA in sexually mature C57 mice (6 weeks old). We found that this gene was highly expressed in the testes at six weeks of age, exhibiting specificity. Figure 3 To investigate the importance of the Sec1 gene in mouse growth, we further examined its expression levels in 0-week-old and 3-week-old wild-type C57 mice. We found that at 0 weeks of age, the gene expression was higher in lung tissue, while expression in the testes was intermediate, with no specific expression. Figure 4 ); and at 3 weeks of age, it is expressed at extremely high levels in the testes, exhibiting specificity ( Figure 5 The expression levels were largely consistent with those observed in tissues from 6-week-old mice. Further investigation into male reproductive function in mice revealed higher expression levels in the testes and sperm of 6-week-old wild-type C57 mice compared to the testes, epididymis, vas deferens, and sperm. Figure 6 Based on this result, we can speculate that the Sec1 gene may play an important role in the reproductive development of male mice.
[0106] Based on the above results of Sec1 gene expression in different tissues and the reproductive system of mice, we recorded Sec1... - / - Knockout mice and Sec1 + / + Wild-type mice at 6 weeks of age (Sec1) + / + vs Sec1 - / - : 17.01±1.7 vs 18.07±1.67), 12 weeks old (Sec1) + / + vs Sec1 - / - : 19.9±1.5 vs 23.6±1.25) and 18 weeks of age (Sec1) + / + vs Sec1 - / - (23.54±1.52 vs 26.8±2.09) Mouse body weight changes were observed starting from 6 weeks of age in Sec1. - / - The body weight of knockout mice was significantly higher than that of Sec1 mice. + / + Wild-type mice (P<0.05) Figure 7 A); Simultaneously, through dissection of 6-week-old Sec1 - / - Knockout mice and Sec1 + / + Wild-type mice were found to have Sec1 - / - Knockout mice showed significant fat accumulation in the abdominal cavity. Figure 7 B); at the same time, we did Sec1 - / - Knockout mice and Sec1 + / +Testicular tissue sections from wild-type mice at 6 weeks of age revealed Sec1... - / - Knockout mice and Sec1 + / + Wild-type mice did not show significant pathological differences at this time. Figure 8 The seminiferous tubules showed no obvious pathological changes. Simultaneously, we examined the sperm and found that sperm motility (Sec1) was... + / + vs Sec1 - / - : 37.0%±3.78% vs 29.2%±4.7%) and survival rate (Sec1) + / + vs Sec1 - / - (51.4%±5.29% vs 40.28%±3.15%) Regarding Sec1 + / + Slightly higher than Sec1 - / - (p>0.05); but in the linear velocity of sperm (Sec1) + / + vs Sec1 - / - : 21.7±0.88 vs 15.46±1.70), curve rate (Sec1) + / + vs Sec1 - / - : 65.22±7.17 vs 31.44±2.04), path rate (Sec1) + / + vs Sec1 - / - (46.12±5.07 vs 22.24±1.45) Sec1 + / + Significantly higher than Sec1 - / - Individuals (p < 0.05) Figure 9 Since higher linear velocity, curvilinear velocity, and path velocity of sperm represent higher sperm quality, and higher values of these indicators indicate higher fertilization capacity, these results demonstrate a significant decrease in sperm quality in male mice after Sec1 knockout.
[0107] Sec1 is one of three genes encoding galactose 2-L-focusyltransferase. This gene is predicted to encode a type II membrane protein anchored in the Golgi apparatus, controlling the final step in the production of α(1,2)-focused carbohydrates by adding a terminal focus to the α(1,2) junction. Combined with its function in mammalian individuals, this further confirms our research into its function in the mammalian reproductive system. With the development of modern society, increasing life pressure and a faster pace of life, male infertility is becoming more prevalent, with many cases exhibiting reduced sperm quality. This phenomenon is receiving increasing attention from society, and national research investment is continuously increasing. Therefore, our constructed Sec1 knockout mouse can be used to explore the developmental mechanisms of the mammalian male reproductive system and its important functions in reproductive health; it can also provide a biological model for targeted drug development, accelerating the development of drugs targeting reduced sperm quality. sequence list <110> Yangzhou University <120> A sgRNA for a Sec1 gene knockout mouse model, its construction method and its application <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty three <212> DNA <213> Artificial Sequence <400> 1 cctcttcttcgtgattttcgtgg 23 <210> 2 <211> twenty three <212> DNA <213> Artificial Sequence <400> 2 ggcctaccattcgctgcatctgg 23 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <400> 3 aggtgacagaaagattcagaggtac 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <400> 4 gagtgagtgtgagtgtgctagaaac 25 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <400> 5 aggtgacagaaagattcagaggtac 25 <210> 6 <211> twenty three <212> DNA <213> Artificial Sequence <400> 6 agtgcaaacagcgtggcatattc 23
Claims
1. A method for constructing a Sec1 gene knockout mouse model, characterized by, The sgRNA and the mRNA of Cas9 nuclease are injected into a mouse fertilized egg after being transcribed in vitro, and then the fertilized egg is transplanted into a pseudopregnant female mouse to obtain a chimeric F0 generation; the F0 generation is identified by PCR, and the positive F0 generation mice are mated with wild type mice to obtain F1 generation mice with stable genotypes, and the homozygous offspring of Sec1 gene knockout are screened as Sec1 gene knockout mouse models; the sgRNA includes sgRNA targeting the 61st base of the 4th exon of the Sec1 gene and sgRNA targeting the 1270th base of the 4th exon of the Sec1 gene; The sgRNA sequence targeting the 61st base of the 4th exon of the Sec1 gene is: gRNA1: CCTCTTCTTCGTGATTTTCGTGG; The sgRNA sequence targeting the 1270th base of the 4th exon of the Sec1 gene is: gRNA2: GGCCTACCATTCGCTGCATCTGG.
2. The method of constructing a Sec1 knockout mouse model according to claim 1, wherein, The primer sequences for identifying the genotype of the mouse are as follows: F1: 5'- AGGTGACAGAAAGATTCAGAGGTAC-3', and R1: 5'- GAGTGAGTGTGAGTGTGCTAGAAAC-3'; F1: 5'- AGGTGACAGAAAGATTCAGAGGTAC-3', and R2: 5'- AGTGCAAACAGCGTGGCATATTC-3'.
3. The method of claim 1, wherein the Sec1 gene knockout mouse model is constructed by the following steps of: The wild type individual has a PCR product of 1765 / 446 bp, the homozygous knockout mouse only has a PCR product of 555 bp, and the heterozygous individual has three products.
4. The method of claim 1, wherein the Sec1 gene knockout mouse model is constructed by the following steps of: Genomic DNA is collected from the tail and toes of the mouse for PCR identification.
5. The method for constructing the Sec1 gene knockout mouse model according to claim 1, characterized in that, The PCR reaction system is as follows: 。 6. The method of claim 1, wherein the Sec1 knockout mouse model is constructed by, The PCR reaction conditions are as follows: 。
Citation Information
Patent Citations
Method of separating nitro compounds from liquids.
US1271578A
Application of FUT3 gene as target spot to improvement of escherichia coli resistance of pigs.
CN113106093A
Method for constructing Serac1 knock out mouse model
CN113249383A