Application of IQCN as a target in the diagnosis and treatment of complete fertilization failure

Abstract

The present invention discloses the use of IQCN as a target in the diagnosis and treatment of complete fertilization failure, wherein the allele mutations of the IQCN are c.1067C>G, c.316A>G and c.1892C>A. In the present invention, the IQCN mutation destroys the function of the IQCN protein, and has a genetic contribution to complete fertilization failure, male infertility and early embryo arrest (including zygotic arrest phenotype). The mutation can destroy the five IQ1 domains of the IQCN protein and cause the loss of the C-terminal sequence, resulting in acrosome defects in human sperm, thereby causing male infertility.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to the application of IQCN as a target in diagnosing and treating complete fertilization failure. Background Art

[0002] In recent years, with the change of living environment and the increase of social pressure, the incidence of infertility has increased year by year. According to statistics from the World Health Organization (WHO), the incidence of infertility is about 10-15%, which is an important factor affecting the reproductive health of couples, of which about 50% is related to male factors. The causes of male infertility are complex. Common causes include congenital or secondary urogenital system abnormalities, malignant tumors, urogenital tract infections, varicocele, endocrine disorders, immune factors, production of reactive oxygen species and sperm DNA damage, etc. However, clinically, there are still about 30-50% of infertile patients whose pathogenesis is unknown and they are often classified as unexplained or idiopathic male infertility. More and more evidence shows that this infertile group is likely to be related to genetic factors.

[0003] Assisted reproductive technology (ART) is an effective method for treating infertility and has helped thousands of families to have their own offspring. At present, most reproductive centers in the country can carry out conventional in vitro fertilization-embryo transfer technology with a stable success rate, but 5%-10% will experience total fertilization failure (TFF). TFF refers to the absence of pronuclear formation in all mature oocytes within 15-18 hours after fertilization by conventional in vitro fertilization (IVF) and intracytoplasmic sperm injection (ICSI), and no cleavage occurs in continued culture. Patients with IVF fertilization failure caused by sperm-egg binding disorders can be improved by implementing ICSI fertilization, but TFF will still occur in about 1%-3% of ICSI cycles. Once TFF occurs, it means the complete termination of the ART process, which brings great economic losses and mental blows to the couple, and also makes it very difficult for doctors to treat infertility. It is particularly important to note that some infertile patients with TFF often show normal results of routine semen analysis. These patients often have defects in sperm function, which is likely caused by genetic factors. Therefore, exploring the genetic defects of TFF caused by sperm factors after ICSI in clinical practice will help to accurately diagnose and evaluate male infertility problems caused by abnormal sperm function.

[0004] Fertilization is a complex multi-step process, including sperm capacitation, sperm-egg recognition, acrosome reaction, crossing the zona pellucida, sperm-egg plasma membrane fusion, oocyte activation, and pronuclear formation and fusion. Abnormalities in any of these steps may result in unfertilized or abnormal fertilization. Compared with IVF, ICSI technology avoids some barriers in the sperm-egg fertilization process, such as acrosome reaction, sperm-zona pellucida fusion, and sperm-egg plasma membrane fusion. It has the advantages of high fertilization rate and is not affected by sperm concentration, morphology, and vitality. Despite this, about 1%-3% of ICSI cycles still have low fertilization rates or even TFF. TFF after conventional IVF is mainly due to failure of sperm-egg recognition or plasma membrane fusion, while the main cause of TFF after ICSI is oocyte activation failure (OAF) or pronuclear formation disorder. It is currently believed that genetic mutations related to genetic factors may be an important cause of TFF after ICSI. Studies have found that mutations in genes such as PATL2, WEE2, TLE6, and TUBBB can cause oocyte abnormalities and TFF, while male-related mutations in genes such as PLCZ1, ACTL7A, and ACTL9 can cause oocyte activation failure and thus TFF after ICSI, but this can only explain about 30% of male-related TFF (excluding spherozoospermia). Therefore, a considerable part of the genetic factors of TFF remain to be elucidated. Summary of the invention

[0005] The purpose of the present invention is to overcome the defects of the prior art and provide the application of IQCN as a target in the diagnosis and treatment of complete fertilization failure.

[0006] The technical solution of the present invention is as follows:

[0007] The invention relates to the use of IQCN as a detection target in the preparation of a kit for diagnosing complete fertilization failure, wherein the allele mutation of the IQCN is at least one of c.2453_2454del, c.3008C>T and c.3374G>A.

[0008] In a preferred embodiment of the present invention, the IQCN allele mutation is a homozygous mutation c.2453_2454del.

[0009] In a preferred embodiment of the present invention, the allele mutations of IQCN are heterozygous mutations c.3008C>T and c.3374G>A.

[0010] A kit for diagnosing complete fertilization failure comprises a reagent capable of detecting whether IQCN has a gene mutation, wherein the allele mutation of IQCN is at least one of c.2453_2454del, c.3008C>T and c.3374G>A.

[0011] In a preferred embodiment of the present invention, the IQCN allele mutation is a homozygous mutation c.2453_2454del.

[0012] In a preferred embodiment of the present invention, the allele mutations of IQCN are heterozygous mutations c.3008C>T and c.3374G>A.

[0013] In a preferred embodiment of the present invention, the reagent capable of detecting whether IQCN has a gene mutation comprises a reagent for detecting whether IQCN has a gene mutation by PCR.

[0014] A drug for treating complete fertilization failure, comprising an agent capable of treating an allele mutation of IQCN, wherein the allele mutation of IQCN is at least one of c.2453_2454del, c.3008C>T and c.3374G>A.

[0015] In a preferred embodiment of the present invention, the agent capable of treating the allele mutation of IQCN comprises an antagonist substance of the allele mutation of IQCN.

[0016] In a preferred embodiment of the present invention, a pharmaceutically acceptable excipient is also included.

[0017] The beneficial effects of the present invention are as follows: in the present invention, the IQCN mutation destroys the function of the IQCN protein and has a genetic contribution to complete fertilization failure, male infertility and early embryo arrest (including zygotic arrest phenotype). The mutation can destroy the five IQ1 domains of the IQCN protein and cause the loss of the C-terminal sequence, resulting in acrosome defects in human sperm, thereby causing male infertility. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1This is a diagram showing the identification results of IQCN biallelic mutations in patients with complete fertilization failure in Example 1 of the present invention. Wherein, (A) normal oocytes cannot be fertilized by sperm from patients through IVF and (R-ICSI). Two pronuclei and two polar bodies (arrows) can be seen in normal fertilized oocytes, while only one polar body (arrow) can be seen in unfertilized oocytes. Scale bar, 10 μm; (B) Pedigree and Sanger sequencing verification results of IQCN in 3 patients with complete fertilization failure: solid black squares represent affected individuals, and arrows represent mutation sites. The AG nucleotide was deleted in a homozygous state in the affected individuals of Family 1 and Family 2, respectively. Abbreviations: WT: wild type, MT: mutant; (C) Position and conservation analysis of variants detected in IQCN: Alignment of eight species shows conservation of missense sequence variants. According to sequence alignment, amino acid positions p.S1003 and p.R1125 are both highly conserved. The positions of these two missense variants are indicated in the protein structure of IQCN. The dark boxes are IQ domains. There are six IQ domains in the wild-type protein of IQCN. The newly formed IQCN truncated protein p.Q818Rfs*9 is shown, which loses five IQ domains at the C-terminus of the IQCN protein. All domains and regions are described by the Uniprot server.

[0019] Figure 2 The results of the patients carrying IQCN mutations in Example 1 of the present invention showing complete fertilization failure and sperm acrosome defects. Among them, (A) Comparison of sperm morphology from fertile normal controls and patients with biallelic IQCN mutations: sperm from the fertile control group showed normal head shape, while sperm from males with biallelic IQCN variants showed conical sperm heads, scale bar: 10 μm; (B) Ultrastructure of sperm determined by SEM from fertile normal controls and patients with biallelic IQCN variants: sperm from males carrying biallelic IQCN variants showed conical sperm heads with longer major axes and shorter minor axes. (C) Ratio of major axis length to minor axis length in sperm from fertile normal controls and patients with biallelic IQCN variants; (D) Ultrastructure of sperm from fertile normal controls and patients with biallelic IQCN variants detected by TEM: in fertile normal controls, arrows point to normal acrosomes in sperm, in patients with biallelic IQCN variants, arrows point to broken acrosomes, and in the two right images, no acrosomes were found in the patient's sperm, scale bars: 500 nm and 1 μm.

[0020] Figure 3 The expression of Iqcn in the mouse during spermatogenesis in Example 1 of the present invention, and the homozygous Iqcn - / -Mouse. (A) Mouse Iqcn is expressed during spermatogenesis after P20, and Actb is a reference protein; (B) Iqcn - / - Generation of mice for sgRNA design targeting the Iqcn locus via CRISPR-Cas9; (C) Genotyping to identify Iqcn - / - Mouse, 198bp PCR product indicates Iqcn allele variation, 338bp PCR product indicates IqcnWT allele; (D) WT and Iqcn at two months old - / - The testes of male mice are of similar size; (E) Two-month-old WT and Iqcn - / - Testis weights of male mice were comparable; (F) WT and Iqcn - / - HE staining of the testis, head and cauda equina of male mice, WT and Iqcn - / - There were no significant pathological differences between male mice.

[0021] Figure 4 Iqcn in Example 1 of the present invention - / - Characterization diagram of male mice. Among them, (A) from WT and Iqcn - / - PAS staining of spermatids in stages I-XII of male mouse testis: WT and Iqcn - / - There was no obvious pathological difference in male mice observed with naked eyes; (B) WT and Iqcn - / - Peanut agglutinin (PNA) staining of sperm acrosome in male mice, scale bar: 5 μm; (C) Coomassie brilliant blue staining shows the changes of sperm acrosome before and after capacitation; (D) WT and Iqcn - / - Immunofluorescence staining of Iqcn in spermatozoa of male mice using anti-Iqcn (red) antibody and PNA (green), and the nuclei of spermatozoa were labeled with DAPI (blue). Scale bar: 10 μm; (E) WT and Iqcn - / - Immunofluorescence staining of PLCZ1 in male mouse sperm: anti-PLCZ1 (red) antibody and PNA (green) were used, the sperm nucleus was labeled with DAPI (blue), and the staining of PLCZ1 in the sperm flagellum was non-specific. Scale bar: 10 μm.

[0022] Figure 5 The results of the separation of acrosome and nuclear membrane of homozygous Iqcn knockout mice in Example 1 of the present invention are shown in Figure 1. - / - Morphology of male mouse sperm: WT sperm exhibited normal head shape, while Iqcn - / - Spermatozoa from male mice show sperm head defects, scale bar: 10 μm; (B) WT and Iqcn - / -Sperm ultrastructure of male mice detected by SEM: The acrosome morphology of WT sperm is sickle-shaped, while Iqcn - / - Male mouse spermatozoa have a shorter hook margin, lack a sharp tip, and some Iqcn - / - The sperm head twists toward the flagellum, the arrow points to the hook edge of the sperm, scale bar: 1 μm; (C) TEM detection of WT and Iqcn - / - Ultrastructure of spermatozoa in male mouse ejaculate: Iqcn - / - No acrosome was found in the sperm ejaculated by male mice, or only a small amount of acrosome detached from the nuclear membrane was found. Ac: acrosome, scale bar: 500nm and 1μm; (D) TEM detection of WT and Iqcn - / - Ultrastructure of spermatozoa in male mouse epididymis: Iqcn - / - The acrosome is visible in the epididymal sperm of male mice, but it is separated from the nuclear membrane. The arrow points to the acrosome. Scale bars: 500nm and 1μm; (E) WT and Iqcn - / - Acrosome biogenesis in male mouse sperm cells: includes three stages of acrosome biogenesis, namely the cap stage, acrosome stage and maturation stage. Scale bars: 500nm, 1μm and 2μm. DETAILED DESCRIPTION

[0023] The technical solution of the present invention is further illustrated and described below through specific implementation modes in combination with the accompanying drawings.

[0024] Example 1

[0025] 1. Materials and Methods

[0026] 1. Research subjects

[0027] In this embodiment, two infertile men with fertilization failure were recruited from the Department of Andrology, Women and Children's Hospital, Affiliated to Xiamen University Medical College (Xiamen, Fujian, China), and one infertile man with fertilization failure was recruited from the Department of Reproductive Medicine, Yantai Yuhuangding Hospital, Affiliated to Qingdao University (Yantai, Shandong, China). The chromosome karyotype of each patient was normal 46, XY, and no microdeletion was found in the Y chromosome. The physical examination of each patient showed that the male external genitalia developed normally, the size of the bilateral testicles was normal, and the bilateral spermatic veins were palpated without abnormality.

[0028] 2. WES and computational bioinformatics analysis

[0029] The genomic DNA of each patient was extracted from the whole peripheral blood sample using QIA ampDNA Blood Kit (Qiagen, Valencia, CA, USA). WES was performed as Pathogenic Variants in ACTRT1 Cause Acephalic Spermatozoa Syndrome. (Front Cell Dev Biol 9, 676246.10.3389 / fcell.2021.676246.). Sanger sequencing was performed to verify the sequence variation in the individual. The primers for PCR and sequencing are listed in Table 1 below.

[0030] Table 1

[0031]

[0032] 3. Experimental animals

[0033] Mice were housed at the National Institute of Biological Sciences in accordance with the Ministry of Health's national guidelines for the housing and care of laboratory animals. All experiments were approved by the National Institute of Biological Sciences Institutional Animal Care and Use Committee.

[0034] 4. Analysis of human and mouse semen parameters

[0035] Routine semen analysis was performed on each of the above patients according to the guidelines of the World Health Organization Laboratory Manual for the Examination and Processing of Human Semen (Fifth Edition). Semen volume, sperm concentration, total motility, and percentage of normal sperm were analyzed during routine examination. Hematoxylin and eosin (H&E) staining was performed to evaluate sperm morphology.

[0036] Sperm was obtained from wild type (WT) or Iqcn - / - The caudal epididymis of males (10-12 weeks). Specifically, each caudal epididymis was placed in 300 μL of human tubal fluid (HTF) medium and capacitation was performed at 37°C for 30 min. The cells were first fixed with 2% paraformaldehyde (PFA), then stained with G250 for 5-10 minutes, washed and observed under a microscope for sperm morphology analysis. Semen characteristics were analyzed using a computer-assisted sperm analysis (CASA) system (Version.12 CEROS, Hamilton Thome Research).

[0037] 5. Scanning electron microscopy and transmission electron microscopy

[0038] Methods for preparing human and mouse semen samples for SEM and TEM refer to TBC1D21 is an essential factor for sperm mitochondrial sheath assembly and male fertility. (BiolReprod.10.1093 / biolre / ioac069.).

[0039] For SEM, spermatozoa were fixed in 4% paraformaldehyde overnight at 4 °C. The samples were then placed on coverslips coated with poly-L-lysine and air-dried. Subsequently, the coverslips were dehydrated through an ethanol concentration gradient at room temperature, coated with gold particles, and observed with a Zeiss EVO LS10 SEM.

[0040] For TEM, samples including testes, seminiferous tubules and spermatids were fixed with 2.5% glutaraldehyde (G5882, Sigma-Aldrich, USA), then treated with 1% OSO4 for 1 h, and then treated with 2% uranyl acetate overnight at 4 °C. Subsequently, dehydration was performed using a series of gradient acetone solutions by gradually decreasing the temperature. Then, the samples were infiltrated and embedded in Epon 812. The resulting ultrathin (90 nm thick) sections were stained with 3% uranyl acetate and lead citrate before TEM, and then observed by transmission electron microscopy using a Philips FEI Tecnai G2 Spirit with an accelerating voltage of 120 kV.

[0041] 6. Construction of Iqcn-Knockout (KO) mouse model using CRISPR / Cas9

[0042] Iqcn KO(Iqcn - / - ) mice were generated by co-microinjection of in vitro translated Cas9 protein and gRNA into C57BL / 6 fertilized eggs. C57BL / 6 wild-type (WT) mice were purchased from Beijing Vita River Laboratory Animal Technology Co., Ltd. - / - The gRNA sequences for mouse are ccccggaggtggtctccatccac (SEQ ID NO.07) and gggagtctgtcggtggcgtgggg (SEQ ID NO.08).

[0043] 7. Fertility Assessment

[0044] Fertility was assessed by mixing WT females with Iqcn in a 2:1 ratio. - / - WT male mice (n=6) were caged for more than three months. Successful mating was verified by the presence of a vaginal plug after coitus, after which the mice were caged individually and embryos or pups at the 2-cell stage were analyzed.

[0045] 8. IVF and ICSI

[0046] In vitro fertilization (IVF) and intracytoplasmic sperm injection (ICSI) were performed under standard protocols as described previously7. In brief, Iqcn were obtained from 8–10-week-old - / - Sperm was isolated from WT and WT cauda epididymis (n = 3). Oocytes were harvested from 6-week-old female mice (C57BL / 6J background) after injection of pregnant mare serum gonadotropin and human chorionic gonadotropin (Ningbo Sansheng Biotechnology Co., Ltd., Ningbo, China). Cumulus cells and zona pellucida were removed from oocytes by treatment with hyaluronidase (H3757, Sigma-Aldrich, USA) and acid tyrosine solution (MR-004, Sigma-Aldrich, USA), respectively. Different types of oocytes were mixed with Iqcn - / - The cells were incubated with WT sperm for 4-6 h at 37 °C and 5% CO 2 . The number of two-cell embryos was counted at the two-cell or blastocyst stage.

[0047] 9. Statistical analysis

[0048] Statistical analysis was performed using GraphPad Prism 8. Data are expressed as mean ± SEM. The differences between the two groups were statistically analyzed using standard Student's t-test. P values ​​< 0.05 (indicated by * in the figure) and < 0.01 (indicated by ** in the figure) were considered statistically significant.

[0049] 2. Experimental Results

[0050] 1. Identification of biallelic variants in IQCN in men with fertilization failure

[0051] This example firstly studies a close relative family (family 1, Figure 1 A and 1B) found an infertile patient with fertilization failure. During in vitro fertilization (IVF), the patient's sperm was unable to fertilize his wife's oocytes (Table 2). After intracytoplasmic sperm injection (ICSI), most fertilized eggs failed to divide and arrested at the single-cell stage ( Figure 1A, Table 2). With the consent of the patients, whole exome sequencing (WES) was performed on the infertile patients. After a rigorous variation filtering process, a rare truncated homozygous variation c.2453_2454del (p.Q818Rfs*9) was found in IQCN in this example. Subsequently, two infertile patients with fertilization failure and zygotic stagnation in two independent families were recruited (Table 2). The wife of the patient in Family 2 had a history of pregnancy with her ex-boyfriend, which also indicates that male factors may be the main factor leading to fertilization failure and zygotic stagnation. WES also found that II-1 in Family 2 had the same homozygous mutation c.2453_2454del (p.Q818Rfs*9) in IQCN as II-1 in Family 1 ( Figure 1 B). II-1 in family 3 had heterozygous mutations c.3008C>T (p.S1003F) and c.3374G>A (p.R1125H) in IQCN ( Figure 1 B). Sanger sequencing confirmed all variants in each infertile patient and also suggested an autosomal recessive inheritance mode ( Figure 1 B). The allele frequencies of the variants in the population are very low, and their homozygotes do not exist in the genome aggregation database (gnomAD database) (Table 3). The amino acid positions of the two missense variants p.S1003F and p.R1125H show evolutionary conservation ( Figure 1 C). The c.24532454del variant is predicted to produce a truncated p.Q818Rfs*9 protein, which would disrupt the five IQ1 domains of the IQCN protein and result in loss of the C-terminal sequence ( Figure 1 C). This example demonstrates that IQCN contributes genetically to complete fertilization failure, male infertility and early embryonic arrest, including the zygotic arrest phenotype.

[0052] Table 2

[0053]

[0054] R-ICSI, Rescue Intracytoplasmic Sperm Injection

[0055] Table 3

[0056]

[0057] 2. Acrosome ultrastructural defects in males carrying biallelic IQCN variants

[0058] The three individuals with IQCN mutations described above showed normal sperm parameters (Table 4). To study sperm morphology, HE staining, scanning electron microscopy (SEM), and transmission electron microscopy (TEM) were used. The percentage of normal sperm in all three patients was above the reference limit (4%) (Table 4). However, the proportion of cone-headed sperm was increased in these three patients, indicating an increase in the ratio of the major axis length to the minor axis length ( Figure 2 A to 2C). TEM shows that compared with normal sperm, the acrosome of mutant sperm is mostly detached from the nuclear membrane and missing ( Figure 2 D). A few mutant sperm have acrosomes, but the acrosome morphology is abnormal and fragmented ( Figure 2 D). Spermatogonia of patients with IQCN mutations also detach from the nuclear membrane and appear detached and folded ( Figure 2 D) These observations indicate that IQCN mutations cause acrosome defects in human sperm.

[0059] Table 4

[0060]

[0061] a Reference limits are based on WHO standards

[0062] 3. Iqcn - / - Fertilization failure, male infertility, and zygotic arrest in male mice

[0063] This section uses mouse genetics to study the function of IQCN. Mouse Iqcn is expressed during spermatogenesis but not in early spermatogenesis ( Figure 3 A) To examine how IQCN mutations affect acrosome defects, Iqcn was generated using CRISPR-Cas9 technology. - / - Mouse ( Figure 3 B and C) WT and Iqcn - / - There were no significant differences in testis size or weight between male mice ( Figure 3 D and 3E). HE staining of testis, head and tail showed that WT and Iqcn - / - There was no significant difference in spermatogenesis in male mice ( Figure 3 F) PAS staining at different stages of spermatogenesis revealed that WT and Iqcn - / - There were no significant differences between male and female mice ( Figure 4 A) To detect Iqcn - / - Fertility of mice, male Iqcn - / - Mice were mated with WT mice. We found that Iqcn - / - The mice were infertile (Table 5). Coomassie staining showed that the acrosome morphology changed from sickle shape in WT mice to Iqcn - / - Mouse comma or dot, some Iqcn- / - Mouse head - sperm will turn in the direction of the flagellum ( Figure 5 A) The above findings can also be confirmed by SEM. In addition, SEM also found that Iqen - / - Mouse sperm have a shorter hook edge and no sharp tip ( Figure 5 B) TEM shows the separation of the acrosome and sperm. - / - The nuclear membrane of mouse ejaculate is consistent with that of patient sperm ( Figure 5 C) Iqcn - / - PNA staining of male mouse ejaculated sperm also showed an acrosome defect phenotype ( Figure 4 B) To evaluate capacitation and acrosome reaction, spermatozoa were stained with Coomassie brilliant blue and it was found that the acrosome staining of WT mouse spermatozoa disappeared after acrosome reaction, while Iqcn - / - After the sperm replacement reaction in male mice, the acrosome staining did not completely disappear ( Figure 4 C) In the epididymis, many acrosomes can be found that have fallen off the sperm heads ( Figure 5 D). Immunofluorescence staining showed that Iqcn protein was expressed in the acrosome of WT mice, but not in Iqcn - / - Almost no expression in mice ( Figure 4 D). PLCζ is expressed in the subacrosomal region of the perinuclear membrane in WT mouse spermatozoa, whereas in sperm from Iqcn - / - In mouse sperm, PLCζ is not expressed under the acrosome, but appears as irregular scattered dots in the sperm head ( Figure 4 E). The above data show that Iqen - / - The mice had a phenotype identical to that of patients carrying the IQCN variant. These data confirm that IQCN deficiency causes male infertility through sperm acrosome defects.

[0064] Table 5

[0065]

[0066] The above description is only a preferred embodiment of the present invention, and therefore cannot be used to limit the scope of the present invention. That is, equivalent changes and modifications made according to the patent scope of the present invention and the contents of the specification should still fall within the scope of the present invention. Sequence Listing <110> Xiamen Maternal and Child Health Hospital (Xiamen Eugenics Service Center, Xiamen University Women and Children's Hospital, Xiamen Lin Qiaozhi Women and Children's Hospital) <120> Application of IQCN as a target in the diagnosis of complete fertilization failure <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <400> 1 taacagggtc caaggtgtcc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 aacagagtgc ggagatcctc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 ggatctccgc actctgttgg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 ccttgctggt ctgtggtctc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 acactcctcg gtcattcctc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 gcagcgatgg tcagatactg 20 <210> 7 <211> twenty three <212> DNA <213> Artificial Sequence <400> 7 ccccggaggt ggtctccatc cac 23 <210> 8 <211> twenty three <212> DNA <213> Artificial Sequence <400> 8 gggagtctgt cggtggcgtg ggg 23

Claims

1. Use of a reagent for detecting IQCN allele mutation in the preparation of a kit for diagnosing complete fertilization failure, characterized in that: The IQCN allele mutation is a homozygous mutation c.2453_2454del, or a heterozygous mutation c.3008C>T and c.3374G>A.

2. A kit for diagnosing complete fertilization failure, characterized in that: It includes a reagent capable of detecting whether IQCN has an allele mutation, wherein the allele mutation of IQCN is a homozygous mutation c.2453_2454del, or a heterozygous mutation c.3008C>T and c.3374G>A.

3. The kit according to claim 2, characterized in that: The reagent capable of detecting whether IQCN has an allele mutation includes a reagent for detecting whether IQCN has an allele mutation by PCR.

Images