Nucleic acid molecules, kits and detection methods for detecting Klebsiella pneumoniae

Abstract

The present invention relates to the field of microbial detection technology, and in particular to nucleic acid molecules, kits and detection methods for detecting Klebsiella pneumoniae. The nucleic acid molecules for detecting Klebsiella pneumoniae provided by the present invention include a LAMP primer set for detecting Klebsiella pneumoniae, as well as gRNA and ssDNA probes. The above-mentioned nucleic acid molecules in combination with CRISPR-Cas proteins can achieve efficient, specific and sensitive detection of Klebsiella pneumoniae. The present invention also provides a method for detecting Klebsiella pneumoniae based on CRISPR-top technology, with a specificity of up to 100%, which can achieve simple, rapid and accurate detection of Klebsiella pneumoniae.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial detection, and in particular to a nucleic acid molecule, a kit and a detection method for detecting Klebsiella pneumoniae. Background Art

[0002] Klebsiella pneumoniae (K.pneumoniae) is a Gram-negative bacillus and one of the most common pathogens causing respiratory tract infections, especially nosocomial infections. In recent years, with the emergence of multidrug-resistant and highly virulent strains of K.pneumoniae, it has become an important pathogen affecting global public health. The development of rapid, accurate and convenient detection methods is of great significance for the early diagnosis and treatment of K.pneumoniae infections.

[0003] At present, the detection of Klebsiella pneumoniae mainly adopts phenotype-based identification methods, such as biochemical identification, fully automatic bacterial identification system, etc. Matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF MS) is also a common method for identifying Klebsiella pneumoniae. However, these methods are based on bacterial culture, resulting in a long diagnosis time. Nucleic acid detection is the key to early diagnosis and rapid control of the spread of infectious diseases. Some PCR-based molecular diagnostic techniques have been developed for the detection of Klebsiella pneumoniae and have shown good detection effects, but expensive precision instruments are required to perform these tests. In addition, the long reaction time (2-4h) is another limitation of PCR-based detection methods. Isothermal amplification technology is an ideal technology to overcome the shortcomings of PCR-based methods. Loop-mediated isothermal amplification (LAMP) has been widely used in pathogen detection. However, a relatively high rate of false positive results is a disadvantage of LAMP detection.

[0004] In recent years, a number of CRISPR / Cas (Cluster regular Interspaced ShortPalindromic Repeats / CRISPR-associated)-based detection platforms have been developed and have shown high sensitivity and specificity. For example, the DETECTR and HOLMES detection platforms based on CRISPR / Cas12a, and the SHERLOCK detection platform based on CRISPR / Cas13a have single-base specificity and aM-level sensitivity in the detection of multiple pathogens. Compared with PCR-based detection methods, CRISPR-based detection can be performed under constant temperature (even room temperature), thereby reducing dependence on professional instruments and equipment. In addition, CRISPR-based methods usually require a pre-amplification step to improve detection sensitivity, but the CRISPR-based detection step is very short (5-10 minutes), which makes the total detection time of CRISPR-based detection methods close to or even less than that of PCR-based detection methods.

[0005] Currently, most CRISPR-based detection methods include two independent steps, namely (1) pre-amplification of target sequences using amplification techniques such as PCR, loop-mediated isothermal amplification (LAMP), and recombinase polymerase amplification (RPA); and (2) detection of amplicons using the trans-cleavage activity of Cas proteins. Two-step CRISPR detection requires more steps and longer detection time than one-step CRISPR detection. In addition, the opening of the pre-amplification reaction tube also increases the risk of cross-contamination during the detection process. The combination of microfluidic devices with CRISPR / Cas technology and the application of reversible valve auxiliary chips can solve the above problems, but these special devices mean more economic costs, so their application is limited. The Cas12aVDet platform and the opvCRISPR platform have been reported for the detection of mycoplasma and SARS-CoV-2, respectively. These two detection platforms improve the in vitro detection based on CRISPR technology without the need for specialized equipment. In both methods, Cas12a is added inside the reaction tube cap or on the tube wall to avoid inactivation. Although the pre-amplification reaction tube does not need to be opened, centrifugation and mixing steps are still required. In 2021, Li et al. designed a new CRISPR-based detection technology named CRISPR-top (CRISPR-mediated testing in one-pot). This technology combines LAMP with CRISPR / Cas12b-based detection in one tube, and only requires one liquid processing step to achieve detection. Moreover, by modifying the amplification primers, CRISPR-top technology can introduce protospacer adjacent motif (PAM) sites into the target sequence, thereby eliminating the limitation that CRISPR-based detection methods require PAM sites. So far, there is no detection method for Klebsiella pneumoniae based on CRISPR-top technology. Summary of the invention

[0006] The present invention aims to provide a group of nucleic acid molecules for detecting Klebsiella pneumoniae, and a kit comprising the nucleic acid molecules. The present invention also provides a method for detecting Klebsiella pneumoniae based on CRISPR-top technology.

[0007] Specifically, the present invention provides the following technical solutions:

[0008] In a first aspect, the present invention provides a LAMP primer set for detecting Klebsiella pneumoniae, wherein the primer set comprises primers having nucleotide sequences as shown in SEQ ID NO. 1-5.

[0009] The nucleotide sequence of each primer in the above LAMP primer set is as follows (5'-3'):

[0010] Upstream external primer Kp1-F3 (SEQ ID NO.1):

[0011] GCTGTTTGTTATCTTTATGTCG;

[0012] Downstream external primer Kp1-B3 (SEQ ID NO.2):

[0013] CATCCACATTTGCAGCATAT;

[0014] Upstream internal primer Kp1-FIP (SEQ ID NO.3):

[0015] TGGGGTTATCGATTTTGAACTGATT-TTC-GGCGAACATCCATTTTGAC;

[0016] Downstream internal primer Kp1-BIP (SEQ ID NO.4):

[0017] ACAAAAACACCAGTGTAGGGC-GATTCTGTTTTACTCAGTGACAAT;

[0018] Upstream loop primer Kp1-LF (SEQ ID NO.5):

[0019] CAGATTCTTCCGTACCCGC.

[0020] The LAMP primer set for Klebsiella pneumoniae detection described above is suitable for CRISPR-top technology. The present invention finds that due to the Cas protein reaction involved in CRISPR-top technology, many LAMP primers directly designed using primer design software are not suitable for CRISPR-top detection. Therefore, the present invention adjusts and optimizes the primer sequence in combination with the detection strategy of CRISPR-top technology. The above-mentioned LAMP primer set is obtained by continuous optimization and screening of the present invention, and can achieve higher amplification efficiency, sensitivity and specificity, and is suitable for CRISPR-top detection method. Moreover, a PAM site is added inside the Kp1-FIP primer, and the PAM site can be introduced into the amplification product by amplification for recognition by the CRISPR-Cas protein / gRNA complex, and the CRISPR reaction can be achieved without the PAM site in the target sequence.

[0021] In a second aspect, the present invention provides a set of nucleic acid molecules for detecting Klebsiella pneumoniae, wherein the nucleic acid molecules comprise the above-mentioned LAMP primer set for detecting Klebsiella pneumoniae, as well as gRNA and ssDNA probes;

[0022] Wherein, the gRNA targets a DNA fragment of the rcsA gene of Klebsiella pneumoniae, and the DNA fragment is amplified using the LAMP primer set;

[0023] The ssDNA probe is a single-stranded DNA that conforms to the trans-cleavage principle of Cas12 protein.

[0024] Preferably, the nucleotide sequence of the gRNA is as shown in SEQ ID NO. 6. The gRNA can efficiently guide the CRISPR-Cas protein to recognize the target sequence, which is beneficial to improve the cutting efficiency of the CRISPR reaction, thereby improving the specificity and sensitivity of the detection.

[0025] The ssDNA probe described above is preferably a single-stranded DNA that conforms to the trans-cleavage principle of Cas12b protein. More preferably, it is a single-stranded DNA consisting of multiple Ts or a length of more than or equal to 5nt consisting of multiple Ts and A.

[0026] Preferably, the nucleotide sequence of the ssDNA probe is shown in SEQ ID NO.7.

[0027] To facilitate detection, the 5' end and 3' end of the ssDNA probe are labeled with a fluorescent group and a quencher group, respectively, or the 5' end and 3' end of the ssDNA probe are labeled with a fluorescent group and biotin, respectively.

[0028] Preferably, the fluorescent group is any one selected from FAM, FITC, HEX, Texas Red, CY5, TET, JOE, and CY3; and the quenching group is any one selected from BHQ1, BHQ2, and BHQ3.

[0029] In some embodiments of the present invention, the 5' end of the ssDNA probe is labeled with a fluorescent group (FAM), and the 3' end is labeled with a quencher group (BHQ1).

[0030] In some embodiments of the present invention, the 5' end of the ssDNA probe is labeled with a fluorescent group (FAM or FITC), and the 3' end is labeled with biotin.

[0031] In a third aspect, the present invention provides a kit, comprising the nucleic acid molecule and CRISPR-Cas protein for detecting Klebsiella pneumoniae as described above;

[0032] Wherein, the CRISPR-Cas protein has the activity of cutting ssDNA or ssRNA.

[0033] Active CRISPR-Cas proteins capable of cleaving ssDNA or ssRNA include but are not limited to Cas12 protein and Cas13 protein.

[0034] The Cas12 protein is preferably Cas12b protein.

[0035] Preferably, the CRISPR-Cas protein is AapCas12b.

[0036] To facilitate detection, the kit further comprises one or more selected from LAMP reaction buffer, Bst 2.0 DNA polymerase, CRISPR reaction buffer and water.

[0037] Preferably, the CRISPR reaction buffer is a Cas12b reaction buffer.

[0038] In a fourth aspect, the present invention provides use of the above-mentioned LAMP primer set, nucleic acid molecule or kit for detecting Klebsiella pneumoniae in detecting Klebsiella pneumoniae.

[0039] Preferably, the Klebsiella pneumoniae detection is for non-diagnostic purposes.

[0040] In a fifth aspect, the present invention provides a method for detecting Klebsiella pneumoniae for non-diagnostic purposes based on CRISPR-top technology, wherein the method uses the above-mentioned kit for detection, comprising: mixing CRISPR-Cas protein, gRNA, and CRISPR reaction buffer, and reacting to obtain a CRISPR-Cas protein / gRNA complex;

[0041] The LAMP primer set, Bst 2.0 DNA polymerase, LAMP reaction buffer, CRISPR-Cas protein / gRNA complex, ssDNA probe and DNA of the sample to be tested were mixed and then subjected to CRISPR-top reaction under constant temperature conditions.

[0042] Preferably, the CRISPR-Cas protein / gRNA complex is prepared by mixing Cas12b and gRNA in a molar ratio of (0.5-1):1 with Cas12b reaction buffer, and incubating at 35-40°C for 5-20 minutes.

[0043] Further preferably, the CRISPR-Cas protein / gRNA complex is prepared by mixing Cas12b and gRNA in a molar ratio of 0.75:1 with Cas12b reaction buffer and incubating at 37°C for 10 minutes.

[0044] Preferably, in the CRISPR-top reaction system, the concentration of primers with nucleotide sequences such as those shown in SEQ ID NOs. 3 and 4 is 0.4 to 1.2 μM, the concentration of primers with nucleotide sequences such as those shown in SEQ ID NOs. 5 is 0.2 to 0.6 μM, and the concentration of primers with nucleotide sequences such as those shown in SEQ ID NOs. 1 and 2 is 0.1 to 0.3 μM.

[0045] In the CRISPR-top reaction system, the concentration of the ssDNA probe is 1.2 to 6 μM.

[0046] Further preferably, in the CRISPR-top reaction system, the concentration of the primers with nucleotide sequences such as SEQ ID NO.3 and 4 is 0.5-0.55 μM, the concentration of the primers with nucleotide sequences such as SEQ ID NO.5 is 0.25-0.3 μM, and the concentration of the primers with nucleotide sequences such as SEQ ID NO.1 and 2 is 0.12-0.15 μM. In the CRISPR-top reaction system, the concentration of the ssDNA probe is 1.5-2.5 μM.

[0047] In some embodiments of the present invention, a 25 μL CRISPR-top reaction system includes the following components: 12.5 μL 2×LAMP reaction buffer, 1 μL Bst 2.0 DNA polymerase (8U), 0.4 μL LAMP primer premix (containing primers shown in SEQ ID NO.1-5), 3.5 μL Cas12b / gRNA complex, 0.5 μL ssDNA fluorescent probe (100 μM), 1 μL DNA template, and deionized water (DW) is added to the total volume to 25 μL.

[0048] In the method described above, the constant temperature condition for the CRISPR-top reaction is 53° C. to 58° C., preferably 56° C. The reaction time is preferably 0.8-2 h.

[0049] During the CRISPR-top reaction, the test results can be obtained by detecting the fluorescence signal (including but not limited to a fluorescence quantitative PCR instrument), or, after the reaction is completed, the test results can be obtained through a lateral flow biosensor (CRISPR test strip) or a fluorescence reading method (including but not limited to an ELISA reader, blue light / ultraviolet light irradiation and other instruments and methods).

[0050] When the two ends of the ssDNA probe are labeled with a fluorescent group and a quenching group, the results are obtained by detecting the fluorescence signal, and a variety of instruments can be used to read the results, including but not limited to real-time fluorescence quantitative PCR instruments and enzyme markers that can read fluorescence; the results can also be read by irradiation with blue light / ultraviolet light.

[0051] When one end of the ssDNA probe is labeled with a fluorescent group (FAM / FITC) and the other end is labeled with biotin, a lateral flow biosensor (CRISPR test strip) can be used to read the results.

[0052] The beneficial effects of the present invention are as follows: the present invention provides a LAMP primer set, a nucleic acid molecule and a kit for detecting Klebsiella pneumoniae, which can realize efficient, specific and sensitive detection of Klebsiella pneumoniae. The present invention establishes a method for detecting Klebsiella pneumoniae based on one-step CRISPR technology (CRISPR-top), and the specificity can reach 100%. Compared with culture-based identification methods (such as biochemical identification and MALDI-TOF MS, etc.), the detection method of the present invention takes less time; compared with PCR-based molecular detection, the detection method of the present invention can be carried out under isothermal conditions, reducing dependence on professional instruments; compared with isothermal amplification methods (such as loop-mediated isothermal amplification, recombinase polymerase amplification, etc.), the detection method of the present invention eliminates false positive results caused by nonspecific amplification and has higher specificity; compared with other CRISPR-based detection methods, the detection method of the present invention does not rely on special devices, does not require redundant operations, is simple and quick to operate, and can realize simple, rapid and accurate detection of Klebsiella pneumoniae. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 Schematic diagram of the design positions of primer set Kp1-Kp3 and gRNA in Example 1 of the present invention, wherein the left and right arrows represent the positive strand and the complementary strand, respectively.

[0054] Figure 2 This is the screening result of the LAMP primer set in Example 1 of the present invention.

[0055] Figure 3 This is the screening result of the optimal addition amount of the primer premix in Example 2 of the present invention.

[0056] Figure 4 This is the screening result of the optimal working concentration of the fluorescent probe in Example 2 of the present invention.

[0057] Figure 5 This is the optimal reaction temperature screening result in Example 2 of the present invention.

[0058] Figure 6 It is the specificity of CRISPR-top detection of Klebsiella pneumoniae in Example 3 of the present invention, wherein PC, positive control; NC, negative control; 1-41, non-Klebsiella pneumoniae; 42-105, clinical strains of Klebsiella pneumoniae.

[0059] Figure 7It is the lower limit of detection (LOD) of the Klebsiella pneumoniae CRISPR-top detection in Example 3 of the present invention when the reaction time is 60 minutes.

[0060] Figure 8 It is the lower limit of detection (LOD) of the Klebsiella pneumoniae CRISPR-top detection in Example 3 of the present invention when the reaction time is 100 minutes.

[0061] Fig. 9 This is an evaluation of the effects of CRISPR-top detection and LAMP detection of Klebsiella pneumoniae in clinical specimen detection in Example 4 of the present invention, wherein PC, positive control; NC, negative control; S1-58, 58 clinical samples; *, false positive result; #, false negative result. DETAILED DESCRIPTION

[0062] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention.

[0063] The reagents and instruments used in the following examples are as follows: Wizard genomic DNA purification kit was purchased from Promega, USA, for DNA nucleic acid extraction. DNA isothermal amplification kit and AapCas12b nuclease (containing Cas12b reaction buffer) were purchased from Huidexin Biotechnology (Tianjin) Co., Ltd. Nanodrop LITE microspectrophotometer and constant temperature metal bath are produced by Beijing Thermo Fisher Scientific Co., Ltd. LAMP primers and single-stranded DNA fluorescent probes (ssDNA probes) are synthesized and purified by Shanghai Shenggong Biotechnology Co., Ltd., and the purification method is HPLC; guide RNA (guide RNA, gRNA) is synthesized and purified by Nanjing GenScript Biotechnology Co., Ltd., and the purification method is HPLC. A real-time fluorescence quantitative PCR instrument (QuantStudio 6 Flex) is used as a fluorescence reader.

[0064] In the following examples, the strains and DNA templates used were prepared as follows: The Klebsiella pneumoniae reference strain ATCC700603 was selected to establish the Klebsiella pneumoniae CRISPR-top detection method. 64 clinical isolates of Klebsiella pneumoniae collected from two tertiary hospitals in China and 41 strains of non-Klebsiella pneumoniae were used to test the specificity of the detection. All strains used were identified by MALDI-TOFMS or 16S rDNA sequencing. Before DNA extraction, the strains were stored in 20% (w / v) glycerol broth and frozen at -70°C. The genomic DNA of the strains was extracted using the Wizard Genomic DNA purification kit according to the instructions. In the test of the lower limit of detection, the genomic DNA of the Klebsiella pneumoniae reference strain ATCC 700603 was quantified by the Nanodrop LITE analyzer and serially diluted from 1ng / μL to 1fg / μL at 10-fold intervals.

[0065] Example 1 Design and screening of LAMP primer sets and gRNA

[0066] Based on the sequence of the Klebsiella pneumoniae rcsA gene (GenBank Gene ID: 7946097), the internal primers F3 and B3 and external primers FIP and BIP for LAMP amplification were first designed online using Primer Explorer V5 (http: / / primerexplorer.jp / lampv5e / index.html) software. When designing primers, the parameters such as Tm value, GC content, and primer distance were adjusted and optimized. Among the 1000 primer combinations given by the software, 26 primer combinations targeting different DNA fragments were first selected, these primers were screened, and the primer sequences were adjusted and optimized in combination with the primer dimer (minimum) dG value. After testing and verification, primer combinations that were not suitable for CRISPR-top technology were excluded, and finally 3 sets of primers that were well suitable for CRISPR-top technology (including internal primers F3 and B3 and external primers FIP and BIP) were screened.

[0067] Then, according to the CRISPR-top detection strategy, the loop primer LF / LB was artificially designed at the appropriate position of the three sets of primers to further improve the amplification efficiency, and the standard PAM sequence (TTC) of Cas12b was artificially inserted into the connection region of the FIP primer. Finally, the final three sets (a total of 16) of primer sequences were used to detect the primer secondary structure using Oligo Analyzer version 3.1 (https: / / eu.idtdna.com / calc / analyzer) software to ensure that similar secondary structures that can be recognized by Cas12b will not be formed in theory to cause false positive results.

[0068] The above three sets of primers (Kp1, Kp2, Kp3) were used for LAMP reaction to select the primer combination with the highest amplification efficiency and the best specificity, as follows:

[0069] Using Klebsiella pneumoniae ATCC 700603 genomic DNA (10 ng and 10 pg) as the positive control template and deionized water (DW) as the negative control template, the three sets of primers (Kp1, Kp2, Kp3) shown in Table 1 were used. The binding positions of the three sets of primers are shown in Table 1. Figure 1 The three primer sets were tested under the same reaction conditions, and the amplification products were monitored by a real-time turbidity meter. Figure 2 ), and screened out the primer set Kp1 with the fastest amplification speed and the best specificity, which was used to establish the CRISPR-top detection method for Klebsiella pneumoniae.

[0070] Table 1 Primers, gRNA and probe sequences used in the present invention

[0071]

[0072]

[0073] Note: In Table 1, a: inserted PAM site (TTC) is marked in bold, b: nt, nucleotide.

[0074] In the above screening, the 25 μL LAMP reaction system included 12.5 μL 2× LAMP reaction buffer, 1 μL Bst2.0 DNA polymerase (8U), 0.4 μL LAMP primer premix, 1 μL DNA template, and finally DW was used to supplement the total volume to 25 μL. The LAMP reaction was carried out at 59°C for 1 hour, and the results were read using a real-time turbidometer.

[0075] Guide RNA (gRNA) was artificially designed based on the amplification site of the primer set Kp1 obtained by screening. The sequence of gRNA is shown in Table 1, and the binding position is shown in Figure 1 shown.

[0076] In addition, the sequence of the ssDNA probe was designed and the 5' and 3' ends thereof were labeled with a fluorescent group and a quenching group, respectively. The sequence and labeling are shown in Table 1.

[0077] Example 2 Establishment of a Klebsiella pneumoniae detection method based on CRISPR-top

[0078] 1. Screening of optimal primer concentration for CRISPR-top detection of Klebsiella pneumoniae

[0079] In the reaction system of CRISPR-top detection, 0.3 μL to 0.8 μL (0.1 μL interval) of LAMP primer premix was added to determine the optimal primer concentration for CRISPR-top detection of Klebsiella pneumoniae. The positive template was Klebsiella pneumoniae ATCC 700603, and the negative control was DW.

[0080] The results are as follows Figure 3 As shown, when 0.4 μL of LAMP primer premix (i.e., the working concentrations of FIP and BIP are 0.53 μM, the working concentration of LF is 0.27 μM, and the working concentrations of F3 and B3 are 0.13 μM) is added to the reaction system, the reaction speed is the fastest and the fluorescence value is the highest. Therefore, the detection effect is best at this primer concentration.

[0081] 2. Screening of the optimal working concentration of fluorescent probes for CRISPR-top detection of Klebsiella pneumoniae

[0082] Different volumes of ssDNA fluorescent probe (concentration of 100 μM; added volume 0.3 μL, 0.5 μL, 0.8 μL, 1 μL and 1.5 μL) were added to the reaction system of CRISPR-top detection to determine the optimal working concentration of fluorescent probe in CRISPR-top detection of Klebsiella pneumoniae. Positive control and negative control are the same as above 1.

[0083] The results are as follows Figure 4 As shown, when 0.5 μL ssDNA fluorescent probe (ie, the working concentration is 2 μM) is added, the reaction speed is relatively fast and the fluorescence value is the highest, so it is believed that the detection effect is best at this time.

[0084] 3. Screening of the optimal reaction temperature for CRISPR-top detection of Klebsiella pneumoniae

[0085] The standard Klebsiella pneumoniae CRISPR-top reaction system was used to react at 53°C to 58°C (1°C interval). The positive control and negative control were the same as above 1.

[0086] The results are as follows Figure 5 As shown, when the reaction temperature is 56°C, the reaction time is the fastest and the fluorescence value is relatively high, so 56°C is considered to be the optimal reaction temperature.

[0087] After optimization and screening, the CRISPR-top detection system and reaction conditions for the standard Klebsiella pneumoniae were established as follows:

[0088] Preparation of LAMP primer premix: dilute LAMP primer to 100 μM using DW, 40 μL each of FIP and BIP, 20 μL each of LF and / or LB, and 10 μL each of F3 and B3, and premix.

[0089] Preparation of Cas12b / gRNA complex: 15 pmol of AapCas12b and 2 μL of gRNA (10 μM) were placed in Cas12b reaction buffer and incubated at 37°C for 10 min to form Cas12b / gRNA complex. The complex was used immediately after preparation or stored at 4°C and used within 12 h.

[0090] The total volume of the Klebsiella pneumoniae CRISPR-top reaction system was 25 μL, including: 12.5 μL 2×LAMP reaction buffer, 1 μL Bst 2.0 DNA polymerase (8U), 0.4 μL LAMP primer premix, 3.5 μL Cas12b / gRNA complex, 0.5 μL ssDNA fluorescent probe (100 μM), 1 μL DNA template, and finally deionized water (DW) was used to supplement the total volume to 25 μL. DW was used instead of DNA template for the negative control. The CRISPR-top reaction was monitored by a fluorescence analyzer at a constant temperature of 56°C for 1 h.

[0091] Example 3 Specificity and limit of detection (LOD) of Klebsiella pneumoniae CRISPR-top detection

[0092] In order to test the specificity of the detection method provided by the present invention, DNA was extracted from 64 clinical isolates of Klebsiella pneumoniae and 41 non-Klebsiella pneumoniae strains (Table 2) for detection. The positive control (PC) was Klebsiella pneumoniae ATCC700603, and the negative control (NC) was DW.

[0093] To determine the LOD of the K. pneumoniae CRISPR-top assay, 10-fold serial dilutions of K. pneumoniae ATCC 700603 genomic DNA (1 ng / μL to 1 fg / μL) were prepared, using 1 μL of DNA template per reaction.

[0094] Table 2 Information on strains used for specific detection and test results

[0095]

[0096]

[0097] The specificity of the Klebsiella pneumoniae CRISPR-top detection method was tested using the above 64 Klebsiella pneumoniae clinical strains and 41 non-Klebsiella pneumoniae strains. The results are as follows Figure 6 As shown in Table 2 , all Klebsiella pneumoniae (strain numbers 42-105) were positive for Klebsiella pneumoniae CRISPR-top detection, while non-Klebsiella pneumoniae (strain numbers 1-41) were negative.

[0098] The genomic DNA of Klebsiella pneumoniae ATCC 700603 was extracted and quantified using Nanodrop. The DNA concentration was then diluted 10-fold to 1 ng / μL to 1 fg / μL. The LOD of the Klebsiella pneumoniae CRISPR-top method was tested. The results are as follows: Figure 7 and Figure 8 As shown, the LOD of Klebsiella pneumoniae CRISPR-top detection was 1pg genomic DNA when the reaction time was 60 minutes, and the LOD was 10fg genomic DNA when the reaction time was 100 minutes.

[0099] Example 4 Application of Klebsiella pneumoniae CRISPR-top detection in clinical samples

[0100] Sputum samples were collected from 58 patients with clinical symptoms of respiratory tract infection. 1 mL of sputum samples were digested with 4% sodium hydroxide solution, and then DNA was extracted using a DNA purification kit. The Klebsiella pneumoniae CRISPR-top detection method was compared with the LAMP detection method using the same clinical sample DNA template. The LAMP detection method was as follows: 25 μL of LAMP reaction system included 12.5 μL 2×LAMP reaction buffer, 1 μL Bst 2.0 DNA polymerase (8U), 0.4 μL LAMP primer premix, 1 μL DNA template, and finally DW was used to supplement the total volume to 25 μL. The LAMP reaction was carried out at 56°C for 1 hour, and the results were read using a real-time turbidity meter. At the same time, the isolation culture method was used as the gold standard for detecting Klebsiella pneumoniae. The operation method was as follows: 58 sputum specimens were inoculated on Columbia blood agar plates in three zones and cultured at 35°C and 5% CO2 for 72 hours. Single colonies suspected of Klebsiella pneumoniae were selected for identification using MALDI-TOF MS. If Klebsiella pneumoniae was isolated, it was considered that Klebsiella pneumoniae was detected in the sample.

[0101] The results are as follows Fig. 9 As shown in the figure, Klebsiella pneumoniae was successfully isolated from 25 sputum specimens. Comparative analysis showed that the sensitivity of Klebsiella pneumoniae CRISPR-top detection and LAMP detection were 96% (24 / 25) and 92% (23 / 25), respectively; the specificity was 100% (33 / 33) and 81.8% (27 / 33), respectively; the positive predictive value was 100% (24 / 24) and 79.3% (23 / 29), respectively; the negative predictive value was 97.1% (33 / 34) and 93.1% (27 / 29), respectively. It can be seen that Klebsiella pneumoniae CRISPR-top detection has a better detection effect than LAMP detection.

[0102] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements may be made thereto based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention. Sequence Listing <110> Institute of Infectious Disease Prevention and Control, Chinese Center for Disease Control and Prevention <120> Nucleic acid molecules, kits and detection methods for detecting Klebsiella pneumoniae <130> KHP221116376.9 <160> 18 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty two <212> DNA <213> Artificial Sequence <400> 1 gctgtttgtt atctttatgt cg 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 catccacatt tgcagcatat 20 <210> 3 <211> 47 <212> DNA <213> Artificial Sequence <400> 3 tggggttatc gattttgaac tgattttcgg cgaacatcca ttttgac 47 <210> 4 <211> 45 <212> DNA <213> Artificial Sequence <400> 4 acaaaaacac cagtgtaggg cgattctgtt ttactcagtg acaat 45 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <400> 5 cagattcttc cgtacccgc 19 <210> 6 <211> 111 <212> RNA <213> Artificial Sequence <400> 6 gucuagagga cagaauuuuu caacgggugu gccaauggcc acuuuccagg uggcaaagcc 60 cguugagcuu cucaaaucug agaaguggca cggcgaacau ccauuuugac c 111 <210> 7 <211> 10 <212> DNA <213> Artificial Sequence <400> 7 10 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <400> 8 ctatacccgg ttgggattg 19 <210> 9 <211> twenty two <212> DNA <213> Artificial Sequence <400> 9 aatgccatta ctttcatcat ca 22 <210> 10 <211> 42 <212> DNA <213> Artificial Sequence <400> 10 agcactgttg acctcaacga ttcacggggat atctgaccag tc 42 <210> 11 <211> 40 <212> DNA <213> Artificial Sequence <400> 11 gcggatctgc agaaacactg cacgaaacag tcttcattca 40 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <400> 12 tcctgttttt taattcccc 19 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <400> 13 cgtcgtgttg cccggcggt 19 <210> 14 <211> twenty two <212> DNA <213> Artificial Sequence <400> 14 attgtcactg agtaaaacag aa 22 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <400> 15 aggtgatgttttcggtcag 19 <210> 16 <211> 45 <212> DNA <213> Artificial Sequence <400> 16 gctttgatgt tcatttgcgt tgagttctgc tgcaaatgtg gatgg 45 <210> 17 <211> 44 <212> DNA <213> Artificial Sequence <400> 17 aagacggtat cgtcgcataa agaacgatat gataaatcac ctgc 44 <210> 18 <211> 19 <212> DNA <213> Artificial Sequence <400> 18 tgcgaagtac catgcccgg 19

Claims

1. A group of nucleic acid molecules for detecting Klebsiella pneumoniae, characterized in that: The nucleic acid molecule comprises a LAMP primer set for detecting Klebsiella pneumoniae, as well as a gRNA and a ssDNA probe; Wherein, the primer set comprises primers with nucleotide sequences as shown in SEQ ID NO.1-5; The nucleotide sequence of the gRNA is shown in SEQ ID NO.6; The ssDNA probe is a single-stranded DNA that conforms to the trans-cleavage principle of Cas12 protein; The nucleotide sequence of the ssDNA probe is shown in SEQ ID NO.7; the 5' end and 3' end of the ssDNA probe are respectively labeled with a fluorescent group and a quenching group, or the 5' end and 3' end of the ssDNA probe are respectively labeled with a fluorescent group and biotin.

2. A kit, characterized in that: The kit comprises the nucleic acid molecule for detecting Klebsiella pneumoniae and the CRISPR-Cas protein according to claim 1; The CRISPR-Cas protein has the activity of cutting ssDNA or ssRNA.

3. The kit according to claim 2, characterized in that The CRISPR-Cas protein is AapCas12b.

4. The kit according to claim 2 or 3, characterized in that The kit further comprises one or more selected from LAMP reaction buffer, Bst 2.0 DNA polymerase, CRISPR reaction buffer and water.

5. A method for detecting Klebsiella pneumoniae for non-diagnostic purposes based on CRISPR-top technology, characterized in that: The method uses the kit according to any one of claims 2 to 4 for detection, comprising: mixing the CRISPR-Cas protein, gRNA and CRISPR reaction buffer to obtain a CRISPR-Cas protein / gRNA complex through reaction; The LAMP primer set, Bst 2.0 DNA polymerase, LAMP reaction buffer, CRISPR-Cas protein / gRNA complex, ssDNA probe and DNA of the sample to be tested were mixed and then subjected to CRISPR-top reaction under constant temperature conditions.

6. The method according to claim 5, characterized in that In the CRISPR-top reaction system, the concentration of the primers with nucleotide sequences as shown in SEQ ID NO.3 and 4 is 0.4~1.2 μM, the concentration of the primers with nucleotide sequences as shown in SEQ ID NO.5 is 0.2~0.6 μM, the concentration of the primers with nucleotide sequences as shown in SEQ ID NO.1 and 2 is 0.1~0.3 μM; the concentration of the ssDNA probe is 1.2~6 μM.

7. The method according to claim 5 or 6, characterized in that: The constant temperature condition is 53°C to 58°C.

Images