Molecular markers of pig black hair genes and the preparation and application of black-coat Duroc pigs
Through the CRISPR/Cas9 system, allelic replacement of 4 SNP sites was achieved in the Duroc pig MC1R gene, and black haired Duroc pigs were prepared, which solved the problem of difficulty in cultivating black haired pigs in traditional breeding methods, achieved accurate improvement of specific genotypes and phenotypes, and obtained new high-lean-type black haired products.
Patent Information
- Application Number
- CN202210820997.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-13
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2042-07-13
AI Technical Summary
It is difficult to efficiently breed Duroc pigs with black hair in the prior art, and traditional hybrid breeding may change other traits of pigs and cannot achieve accurate improvement of specific genotypes and phenotypes.
By designing the CRISPR/Cas9 system to target the cleavage of Duroc pig MC1R gene, constructing gRNA expression vector and donor donor plasmid, allelic replacement of 4 SNP sites was achieved, cloned pigs expressing the black hairy gene were prepared, and a new black hairy Duroc pig line was cultivated by population succession breeding method.
It has achieved accurate changes in the color of Duroc pigs' hair, obtained a new product that has both black hair and high and lean meat type, shortened breeding time, avoided other trait changes brought about by traditional breeding, and had wide applicability and prospectiveness.
Smart Images

Figure CN115109857B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of biotechnology and animal genetic breeding, and in particular to a pig black hair gene molecular marker and the preparation and application of a black-haired Duroc pig. Background Art
[0002] Animal coat color is a relatively complex genetic trait, and its molecular mechanism is now basically clear. Multiple genes are involved in the formation of animal coat color and pattern. One of the key sites is Extension (E), namely the melanocortin receptor 1 (MC1R) gene. MC1R plays a key role in regulating the synthesis of eumelanin and pheomelanin. Dominant MC1R (such as E, which is prevalent in Chinese black pigs) D1 Genotype) can promote the synthesis of true melanin, resulting in a completely black coat phenotype; while the functionally inactive MC1R (such as the recessive e gene locus) is less effective than E D1 There are multiple SNPs that cause missense mutations, thus causing protein function defects. The inactivation of MC1R promotes the synthesis of pheomelanin, resulting in yellow or red coat phenotypes in animals. Of course, there are other gene loci that also control animal coat color, such as the I locus, which controls the migration and distribution of melanin. Its various different genotypes can cause complex coat color traits such as white, white with black spots, black and white, etc. At the same time, I is compared with E D1 It is dominant, so when I exists, white hair covers up the black hair phenotype, resulting in pure white or mixed colors of hair color traits.
[0003] Because breeding lean pig breeds with black hair characteristics or large-sized pig breeds can generate higher market value, it has certain industrial and social practical significance. Summary of the Invention
[0004] The purpose of the present invention is to provide a molecular marker of Duroc pig black coat gene and its application in the fields of preparing black coat Duroc pig, breeding new black coat Duroc pig strain, genetic improvement of pigs, etc., so as to solve the above problems.
[0005] According to a first aspect of the present invention, a molecular marker for a black coat gene of a Duroc pig is provided, the nucleotide sequence of the molecular marker being shown in SEQ ID No: 5, and the sequence comprising four SNP sites associated with the coat color trait: the first SNP site is indicated by M as a base mutation position, wherein M represents an A / G mutation; the second SNP site is indicated by R as a base mutation position, wherein R represents a C / T mutation; the third SNP site is indicated by S as a base mutation position, wherein S represents a C / T mutation; the fourth SNP site is indicated by K and B as base mutation positions, wherein K represents a G / A mutation and B represents an A / G mutation; when the above-mentioned SNP sites are used to prepare or screen black-coated Duroc pigs, at least one of the SNP sites is required to produce an allelic substitution.
[0006] According to a second aspect of the present invention, there is provided an application of a molecular marker in the preparation of black-coated Duroc pigs, the nucleotide sequence of the molecular marker being shown in SEQ ID No: 5, and the sequence comprising four SNP sites associated with coat color traits: the first SNP site uses M to indicate the base mutation position, wherein M represents an A / G mutation; the second SNP site uses R to indicate the base mutation position, wherein R represents a C / T mutation; the third SNP site uses S to indicate the base mutation position, wherein S represents a C / T mutation; the fourth SNP site uses K and B to indicate the base mutation position, wherein K represents a G / A mutation and B represents an A / G mutation; when the above-mentioned SNP sites are used to prepare or screen black-coated Duroc pigs, at least one of the SNP sites is required to produce an allelic substitution.
[0007] In certain embodiments, the above application includes that when preparing black-coated Duroc pigs, all four SNP sites produce allelic substitutions: the first SNP site is A replacing G, the second SNP site is C replacing T, the third SNP site is C replacing T, and the fourth SNP site is G replacing A and A replacing G.
[0008] In certain embodiments, the above application also includes that the allelic substitution comprises at least 3 SNP monoallelic substitutions.
[0009] According to a third aspect of the present invention, a method for preparing a black-coated Duroc pig is provided, the method comprising the following steps:
[0010] 1) Design a CRISPR / Cas9 system for targeting the Duroc pig MC1R gene, identifying the cleavage site GGTGTCCAGCCTCTGCTTCC, and construct a gRNA expression vector MC1R-gRNA_Cloning Vector;
[0011] 2) constructing a donor plasmid containing four SNP molecular markers, the nucleotide sequences of the four SNP molecular markers are shown in SEQ ID No: 5, and the sequence includes four SNP sites associated with coat color traits: the first SNP site is indicated by M to indicate the base mutation position, wherein M represents an A / G mutation; the second SNP site is indicated by R to indicate the base mutation position, wherein R represents a C / T mutation; the third SNP site is indicated by S to indicate the base mutation position, wherein S represents a C / T mutation; the fourth SNP site is indicated by K and B to indicate the base mutation position, wherein K represents a G / A mutation and B represents an A / G mutation; when the above SNP sites are used to prepare or screen black-coated Duroc pigs, at least one of the SNP sites is required to produce an allelic substitution;
[0012] 3) Co-transfect the gRNA expression vector MC1R-gRNA_Cloning Vector, donor plasmid, and hCas9 plasmid into Duroc porcine fibroblasts;
[0013] 4) screening for positive Duroc porcine fibroblasts with monoallelic or biallelic mutations at the four SNP sites on the MC1R gene as described above;
[0014] 5) The positive cells screened in step 4) are used as nuclear donor cells for somatic cell cloning to prepare cloned pigs. The obtained positive cloned pigs are black-coated Duroc pigs that can express the black coat gene.
[0015] In certain embodiments, the nucleotide sequence of the gRNA expression vector MC1R-gRNA_Cloning Vector in the above preparation method is shown as SEQ ID No: 2; the nucleotide sequence of the donor plasmid is shown as SEQ ID No: 3.
[0016] According to a fourth aspect of the present invention, a Duroc pig black coat gene is provided, the nucleotide sequence of the gene is shown in SEQ ID No: 9, and the sequence contains allelic substitutions of four SNP sites: the first SNP site is A replacing G, the second SNP site is C replacing T, the third SNP site is C replacing T, and the fourth SNP site is G replacing A and A replacing G.
[0017] According to the fifth aspect of the present invention, a method for breeding a new strain of black-coated Duroc pigs is provided, wherein the method comprises the following steps: using the prepared black-coated Duroc pigs expressing the black coat gene as F0 generation sows for expansion and breeding, and utilizing the group successive breeding method to breed the new strain of black-coated Duroc pigs.
[0018] According to a sixth aspect of the present invention, there is provided a method for genetic improvement of pigs, the method comprising the following steps:
[0019] The prepared black-haired Duroc pig individuals expressing the black coat gene are used as the father or mother to breed the F1 generation with wild-type Duroc pigs of the same breed, and the homozygous individuals with double allelic substitution of the four SNP sites in the F1 generation are screened and hybridized with the father or mother of the homozygous family of the F0 generation of other breeds to obtain the F2 generation, and form a new breeding group, so as to obtain the dominant genotype of black coat and the dominant lean meat trait genotype of Duroc pig in the existing pig breeds, thereby achieving the purpose of genetic improvement of the existing pig breeds.
[0020] Beneficial effects of the present invention:
[0021] 1. We have obtained four SNPs that affect the coat color of Duroc pigs. In particular, by point mutation of these four SNP sites, we can obtain black-coated Duroc pigs.
[0022] 2. When specific mutations occur at all four SNP sites, specifically when A replaces G at the first SNP site, C replaces T at the second SNP site, C replaces T at the third SNP site, and G replaces A and A replaces G at the fourth SNP site, Duroc pigs will have black coats.
[0023] 3. This invention, through gene editing, can precisely replace mutations at four SNP sites while preserving other genotypes and phenotypes of the pig, a feat unattainable through traditional crossbreeding. Furthermore, this invention, by altering SNP genotypes through gene editing to obtain pig individuals and populations with specific improved genotypes and phenotypes, is also forward-looking and groundbreaking.
[0024] 4. The present invention obtains SNP genotypes and phenotypes that can express black coat through gene editing, which can greatly shorten the breeding time limit, avoid changes in other traits caused by traditional hybrid breeding, and retain the advantageous traits of Duroc pigs such as high lean meat type to the greatest extent.
[0025] 5. The present invention obtains F0 black-coated Duroc pigs through gene editing and uses them for population breeding, thereby obtaining a new Duroc pig strain with both black coat and high lean meat rate.
[0026] 6. The present invention can accelerate the genetic improvement of other pig breeds by hybridizing the F1 generation of homozygous black-coated Duroc pigs with other pig breeds.
[0027] 7. This gene editing method for changing the coat color of Duroc pigs can also be applied to the improvement of other expected coat colors. For example, based on the predicted dominant and invisibility relationships of coat color loci such as E and I, changes in other coat colors or patterns can also be achieved, and it has wide applicability. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 Schematic diagram of the homologous substitution strategy and vector design for the e allele of MC1R, as well as the genotypes of the four SNPs point mutations;
[0029] Figure 2 Black-coated Duroc pigs with MC1R gene replacement and wild-type red Duroc pigs. DETAILED DESCRIPTION
[0030] The present invention is further described in detail below with reference to the accompanying drawings and specific examples. The examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are commercially available unless otherwise specified.
[0031] Example 1 Construction of Duroc Pig Black Hair Gene Modification System
[0032] By comparing Duroc (recessive e genotype) and native black pigs (dominant E D1 The MC1R gene sequence of the human genotype (genotype) was analyzed, and missense mutations at four SNP molecular marker sites were found: M95V (the first site), P102L (the second site), A164V (the third site), and A243T (the fourth site). The gene sequence is shown in SEQ ID No: 5: The boxes in the sequence represent four SNP sites, among which: the first SNP site uses M to show the base mutation position, where M represents an A / G mutation; the second SNP site uses R to show the base mutation position, where R represents a C / T mutation; the third SNP site uses S to show the base mutation position, where S represents a C / T mutation; the fourth SNP site uses K and B to show the base mutation position, where K represents a G / A mutation and B represents an A / G mutation (in the A / G mutation represented by M in the first SNP site, A represents the mutant base and G represents the original base of the wild-type Duroc pig. The same is true for the other 2nd to 4th SNP sites).
[0033] 1. A CRISPR gRNA was designed to cleave the porcine MC1R locus. The cleavage site was located between the four SNPs to ensure efficient homologous recombination. The designed gRNA recognition site is (SEQ ID No: 1) GGTGTCCAGCCTCTGCTTCC. Complementary single-stranded DNA of the target sequence was synthesized, annealed to form a double strand, and ligated into the gRNA vector gRNA_Cloning Vector (this vector was purchased from addgene #41819 and appropriately modified to introduce two BbsI restriction sites below the U6 promoter of the vector to facilitate ligation of exogenous fragments), forming the gRNA expression vector MC1R-gRNA_Cloning Vector (SEQ ID No: 2).
[0034] 2. Designed a gene sequence that can replace the Duroc pig e locus and has E D1 The donor plasmid (SEQ ID No: 3) contains the MC1R gene sequence with the e-site replaced in the donor plasmid, as shown in SEQ ID No: 4. The 2757-bp sequence covers the entire MC1R coding region and four SNP regions (M95V, P102L, A164V, and A243T) (mutated bases replace the original Duroc pig bases). It also includes approximately 1000 bp of homology arms at each end to improve homologous recombination efficiency. The 2757-bp sequence of the MC1R gene with the e-site replaced was obtained using synthetic methods. To prevent further CRISPR cleavage after recombination and disruption of gene expression, the gRNA recognition region in the donor plasmid was mutated, disrupting gRNA homology without altering amino acid expression. The corresponding gRNA region in the donor plasmid is mutated to (SEQ ID No: 6) GGTGTCCtctCTgTGtTTtCTcG (lowercase letters indicate mutated bases). Finally, the donor plasmid designed and synthesized above (sequence as shown in SEQ ID No: 3) was directly used for transfection in plasmid form. Figure 1 shown.
[0035] Example 2 Preparation of Duroc pig fetal fibroblasts expressing positive black coat gene
[0036] Fetal fibroblasts from 30-day-old Duroc pigs were collected, cultured, and transfected with plasmids via electroporation. The transfected plasmids were a mixture of three plasmids: the MC1R-gRNA_Cloning Vector, a donor plasmid, and an hCas9 plasmid (purchased from addgene #41815). Following transfection, the cells were plated at low density and, 24 hours later, 500 μg / mL G418 was applied for selection to enrich for cells with potential homologous recombination. After 10 days of culture, single-cell clones of appropriate size were formed, at which point they were picked and cultured individually in 48-well plates. After the cells in each well were confluent, 1 / 10 of the cells were lysed with 10 μL of proteinase K. The lysate was used directly as a template for PCR amplification, covering both the donor and non-donor genomic sequences. The MC1R mutation was identified using primers MC1R-genotyping-forward (SEQ ID No: 7): CCTGCACTCGCCCATGTACTACT and MC1R-genotyping-reverse (SEQ ID No: 8): GCCAGAAAGAGGTTGACGTT. The PCR product was 1627 bp in size. The PCR product was sequenced using the MC1R-genotyping-forward primer. Cells with monoallelic or biallelic mutations at the four SNPs were identified as correct mutant clones. The correctly identified cell clones were expanded and cultured, passaged into 24- or 12-well plates until confluent, and frozen for future use. These were the positive MC1R gene-edited porcine fibroblasts. The MC1R gene sequence after mutation modification at the four SNP sites of M95V, P102L, A164V, and A243T contained in the positive cells was shown in SEQ ID No: 9.
[0037] Example 3 Preparation of Black Coat Duroc Pigs
[0038] 1. Oocyte isolation and maturation
[0039] Porcine ovaries were purchased from a slaughterhouse, placed in 37°C saline containing 1% penicillin-streptomycin by volume, and transported to the laboratory within 2 hours. Follicular fluid was aspirated from the follicles using a 10mL syringe and placed in a 50mL centrifuge tube. The tubes were incubated at 37°C in a waterbath for 30 minutes, and the supernatant was removed. The pellet was resuspended in TL-HEPES and incubated for another 15 minutes. This was repeated once. The resuspended fluid was placed in a 60mm dish. Under a stereoscope, dense, uniformly cytoplasmic cumulus cell-oocyte complexes (CC-oocytes) with at least two layers of cumulus were hand-pipetted. The cells were washed three times with maturation medium and transferred to culture droplets (50 CC-oocytes per 500μL droplet) that had been equilibrated in an incubator for 4 hours. The tubes were covered with embryo-grade mineral oil and incubated at 38.5°C in 5% CO₂ for 42 hours. After maturation, the cumulus was removed with DPBS containing 0.5% hyaluronidase, and the oocytes containing the first polar body were selected under a microscope and used as recipients for somatic cell nuclear transplantation.
[0040] 2. Somatic Cell Nuclear Transfer
[0041] The positive MC1R gene-edited pig fibroblasts and in vitro matured oocytes containing the first polar body were simultaneously transferred into a 60mm dish containing multiple micromanipulation droplets. The dish was placed on the hot stage of the micromanipulator, the oocytes were enucleated, and then one donor cell was injected into the perivitelline space. After electric shock fusion, a recombinant embryo was formed.
[0042] 3. Embryo transfer
[0043] After overnight culture, the reconstructed embryos were removed for embryo transfer. Surrogate sows were selected from multiparous sows that were naturally in estrus that day. Embryos were surgically implanted deep into the fallopian tubes, with 200 to 250 reconstructed embryos transferred per sow. Surrogate sows that did not return to estrus underwent their first ultrasound pregnancy test 24 days after embryo transfer. After the pregnancy was detected, surrogate sows were tested weekly for the remaining two weeks before the due date. After a gestation period of approximately 114 days, cloned pigs were delivered naturally or by caesarean section. A summary of the cloned pigs born is shown in Table 1.
[0044]
[0045] Example 4 Identification of the Genotype and Phenotype of Black Duroc Cloned Pigs
[0046] The success of gene editing of cloned pigs is judged by their coat color. The cloned pigs that have undergone successful MC1R gene modification have uniform dark black coats all over their bodies. Figure 2 As shown. The ear skin of cloned pigs was collected and genomic DNA was extracted. The MC1R locus was amplified using the primers in Example 2 to identify the changes in the MC1R genotype. After sequencing, it was found that all black-haired cloned pigs had genotypes with four SNPs replaced, namely ED1 / e MC1R genotype (as shown in Table 2), some black pigs have 4SNPs monoallelic substitution; some black pigs have 3SNPs monoallelic substitution and 1SNP biallelic substitution. This result fully illustrates that E D1 Compared with the dominant epistatic effect of e.
[0047]
[0048] Example 5 Construction of a new strain of black-coated Duroc pigs
[0049] The black-coated cloned pigs tested positive in Example 4 were used as breeding stock and, after sexual maturity, were bred. According to Mendel's laws of inheritance, 75% of the F1 generation piglets born would be dark black, with 25% having a biallelic substitution genotype and 50% having a monoallelic substitution genotype. The black-coated F1 generation pigs with biallelic substitutions of the four SNPs were used as breeding stock and bred with subsequent wild-type Duroc pigs. The resulting F2 generation Duroc pigs would all have a black-coated genotype with a monoallelic substitution of the four SNPs. This significantly shortened the time required to improve the coat color of the Duroc pig population, efficiently producing a population of black-coated Duroc pigs and rapidly establishing a black, lean-meat Duroc pig line.
[0050] Example 6 A method for genetic improvement of pigs
[0051] The black-haired F1 generation pigs with double allelic substitution of 4SNPs obtained in Example 5 are hybridized with the homozygous paternal or dam pigs of other breeds of F0 generation to obtain the F2 generation. In the F2 generation, both the dominant genotype of black coat and the dominant lean meat trait genotype of Duroc pigs can be obtained, and the two dominant traits of other pig breeds can be improved at the same time.
Claims
1. A method for preparing black-coated Duroc pigs, wherein: The preparation method comprises the following steps: 1) Designing a CRISPR / Cas9 system for targeted cleavage of the Duroc pig MC1R gene, recognizing the cleavage site GGTGTCCAGCCTCTGCTTCC, and constructing a gRNA expression vector MC1R-gRNA_Cloning Vector. The nucleotide sequence of the gRNA expression vector MC1R-gRNA_Cloning Vector is shown in SEQ ID No: 2; 2) constructing a donor plasmid, the nucleotide sequence of which is shown in SEQ ID No: 3; 3) Co-transfect the gRNA expression vector MC1R-gRNA_Cloning Vector, donor plasmid, and hCas9 plasmid into Duroc porcine fibroblasts; 4) Screening for positive Duroc pig fibroblasts having monoallelic or biallelic mutations at four SNP sites on the MC1R gene, wherein the nucleotide sequence comprising the four SNP sites is shown in SEQ ID No: 5, wherein the first SNP site in the sequence is indicated by M, where M represents an A / G mutation; the second SNP site is indicated by R, where R represents a C / T mutation; the third SNP site is indicated by S, where S represents a C / T mutation; and the fourth SNP site is indicated by K and B, where K represents a G / A mutation and B represents an A / G mutation; when preparing black-coated Duroc pigs, all four SNP sites produce allelic substitutions: the first SNP site is A for G, the second SNP site is C for T, the third SNP site is C for T, and the fourth SNP site is G for A and A for G; 5) The positive cells screened in step 4) are used as nuclear donor cells for somatic cell cloning to prepare cloned pigs. The obtained positive cloned pigs are black-coated Duroc pigs that can express the black coat gene.
2. A method for breeding a new strain of black-coated Duroc pigs, wherein: The method is to use the black coat Duroc pigs expressing the black coat gene obtained by the preparation method of claim 1 as F0 generation pigs for expansion and breeding, and to cultivate a new black coat Duroc pig breed by using the group successive breeding method.