A method of preparing a site-directed modified long-chain RNA
By using a precise assembly and ligation method to prepare long RNA, the problems of low yield, high error rate and difficulty in site-directed modification of long RNA synthesis in existing technologies are solved, realizing low-cost and high-efficiency long RNA synthesis and modification, which is suitable for large-scale production.
Patent Information
- Application Number
- CN202180001879.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2021-02-10
- Filing Date
- 2021-06-04
- Publication Date
- 2026-04-28
- Estimated Expiration
- 2041-06-04
AI Technical Summary
Existing technologies struggle to achieve site-specific modification and efficient synthesis of long RNAs, especially when the synthesis length exceeds 60 nt. Existing methods suffer from low yield, high error rate, and inability to achieve site-specific modification.
By employing a precise assembly and ligation method, a double-stranded assembly with a hairpin structure is formed by synthesizing nucleic acid fragments of the first and second strands. Long-chain RNA is prepared using annealing and ligation steps, avoiding dependence on RNA polymerase and achieving precise insertion of modified bases at specific sites.
It enables the efficient synthesis of long RNA chains, with low cost, low difficulty, high yield and high accuracy, suitable for large-scale production, and allows for modification at any site, improving the structural stability and biological function of RNA.
Smart Images

Figure CN115210372B_ABST
Abstract
Description
Technical Field
[0001] This disclosure pertains to the fields of molecular biology and synthetic biology. Specifically, this disclosure relates to a method for preparing long RNA and the long RNA prepared therefrom. Background Technology
[0002] In recent years, mRNA-based immunotherapy has gradually gained application in hereditary metabolic diseases. [1,2] Tumor treatment [3-5] Antiviral treatment [6,7] RNA has demonstrated remarkable application potential in biomedical fields such as regenerative medicine, with several mRNA-based anti-tumor drugs already reported. Furthermore, RNA technologies such as siRNA, miRNA, long non-coding RNA (lncRNA), RNA aptamers, and ribozymes are developing rapidly, and RNA is receiving increasing attention in biology. With the continuous expansion of RNA applications in biological research, drug development, and clinical practice, higher demands are being placed on the quality of RNA synthesis.
[0003] Currently, unmodified RNA shows great promise in the biomedical field. However, its low stability within biological systems greatly limits its practical therapeutic applications. Studies have shown that chemical modifications (such as base modifications) are crucial. [8] ribose modification [9] Modification with phosphate backbone
[10] The introduction of [various substances] can inhibit RNA from being recognized by nucleases and the immune system, thereby improving its stability in vivo, reducing immunogenicity, and enabling it to exhibit superior therapeutic effects. [6,11] .
[0004] Currently, RNA synthesis methods include solid-phase synthesis, in vitro transcription, and rolling circle transcription (RCT). Among these, solid-phase synthesis (phosphamide method) is the most widely used method, typically capable of large-scale synthesis of short RNA chains of 60 nt and below.
[12] Furthermore, it is suitable for precise modification of any site in RNA. However, when synthesizing target RNAs with longer sequences, the yield of solid-phase synthesis decreases exponentially with increasing sequence length, while the error rate increases rapidly. Therefore, although there have been reports of synthesizing 110nt RNA sequences via solid-phase RNA synthesis...
[13] However, the RNA synthesized using chemical synthesis methods with a certain yield is still generally around 60 nt in length.
[12] Currently, the longest commercially available single-stranded RNA synthesis can reach 120 nt, but for RNA sequences containing site-specific modifications within the sequence (i.e., on bases other than the two bases at the 5' and 3' ends), the maximum is only 60 nt.
[0005] For longer RNAs, in vitro transcription is currently the primary method for their preparation. Long single-stranded RNAs are obtained by transcribing double-stranded DNA templates with promoters using T7, T3, or SP6 RNA polymerases. This method yields a large quantity of RNA product, and the transcription length is not limited, making it suitable for the synthesis of long RNAs.
[14] For example, Bieker, etc.
[15] Transcription of 5S DNA was first achieved in 1984 based on RNA polymerase III. However, in vitro transcription is highly dependent on RNA polymerase and can only be achieved through enzyme engineering.
[16] Add a certain proportion of modified base monomers [8] Methods such as [list of methods] can be used to insert modifying bases into sequences. However, this method of adding modifying bases during in vitro transcription cannot achieve precise modification of specific sites due to the non-selectivity of enzymes at the site; it can only control the overall modification ratio. The resulting RNA sequence containing modified bases is a mixture of multiple sequences at the molecular level, which hinders in-depth research on the specific chemical modification effects in biomedicine. RCT can also synthesize long RNA chains, but this method is generally used to synthesize continuous repetitive sequences.
[17] Its application scope is more limited, and it also suffers from the problem of not being able to achieve site-specific insertion of modified bases in the sequence.
[18] Therefore, there is an urgent need to develop new RNA synthesis methods that can achieve stable, large-scale production of long RNA and meet the requirements for precise insertion of specific modified bases in RNA.
[0006] Through a search, we found in recently published patent literature that patent CN103993002A discloses a new process for the large-scale synthesis of long-chain RNA drugs. The specific steps include: first, designing a double-stranded DNA transcription template; second, template preparation; third, template purification; fourth, in vitro transcription; fifth, RNA product purification; and sixth, detection of the purity of the purified RNA. While this process achieves large-scale synthesis of long-chain RNA drugs, it still falls under the traditional molecular biology process: based on a DNA template, transcription is performed in vitro using RNA polymerase, followed by purification to obtain 30-200 nt RNA single strands. The method described in this patent does not involve the preparation of RNA containing non-natural modified bases, and as the principle described above indicates, this method cannot achieve the preparation of long RNA chains containing modified bases at specific sites.
[0007] Cited references:
[0008] [1] Jiang L., Berraondo P., Jerico D., et al. Systemic messenger RNA as an etiological treatment for acute intermittent porphyria. Nat. Med. 2018, 24(12), 1899 - 1909.
[0009] [2] Puy H., Deybach J.C. and Gouya L. Systemic administered mRNA as therapy for metabolic diseases. Trends Mol. Med. 2019, 25(1), 3 - 5.
[0010] [3] Verbeke R., Lentacker I., Breckpot K., et al. Broadening the message: A nano - vaccine co - loaded with messenger rna and alpha - galcer induces antitumor immunity through conventional and natural killer T cells. ACS Nano 2019, 13(2), 1655 - 1669.
[0011] [4] Haabeth O.A.W., Blake T.R., McKinlay C.J., et al. MRNA vaccination with charge - altering releasable transporters elicits human T cell responses and cures established tumors in mice. Proc Natl Acad Sci U S A 2018, 115(39), E9153 - E9161. <s
[0012] [5]Sahin U.,Derhovanessian E.,Miller M.,et al.Personalized RNAmutanome vaccines mobilize poly-specific therapeutic immunity againstcancer.Nature 2017,547(7662),222-226.
[0013] [6]Richner J.M.,Himansu S.,Dowd K.A.,et al.Modified mRNA vaccinesprotect against zika virus infection.Cell 2017,168(6),1114-1125.
[0014] [7]Richner J.M.,Jagger B.W.,Shan C.,et al.Vaccine mediated protectionagainst Zika virus-induced congenital disease.Cell 2017,170(2),273-283.
[0015] [8]Kormann M.S.D.,Hasenpusch G.,Aneja M.K.,et al.Expression oftherapeutic proteins after delivery of chemically modified mRNA inmice.Nat.Biotechnol.2011,29(2),154-157.
[0016] [9]Butora G.,Kenski D.M.,Cooper A.J.,et al.Nucleoside optimizationfor RNAi:Ahigh-throughput platform.J.Am.Chem.Soc.2011,133(42),16766-16769.
[0017]
[10] Chang W.S.,Pei Y.,Guidry E.N.,et al.Systematic chemicalmodifications of single stranded sirnas significantly improved ctnnb1 mrRNAsilencing.Bioorg.Med.Chem.Lett.2016,26(18),4513-4517.
[0018]
[11] Krienke C.,Kolb L.,Diken E.,et al.A noninflammatory mRNA vaccinefor treatment of experimental autoimmune encephalomyelitis.Science 2021,371(6525),145-153.
[0019]
[12] Flamme M.,McKenzie L.K.,Sarac I.,et al.Chemical methods for themodification of RNA.Methods 2019,161,64-82.
[0020]
[13] Shiba Y.,Masuda H.,Watanabe N.,et al.Chemical synthesis of a verylong oligoribonucleotide with 2-cyanoethoxymethyl(cem)as the 2'-o-protectinggroup:Structural identification and biological activity of a synthetic 110merprecursor-microrna candidate.Nucleic Acids Res.2007,35(10),3287-3296.
[0021]
[14] Lassar A.B.,Martin P.L.and Roeder R.G.Transcription of class IIIgenes:formation of preinitiation complexes.Science 1983,222(4625),740-748.
[0022]
[15] Bieker JJ,Martin PLand Roeder RGFormation of a rate-limiting intermediate in 5S RNA gene-transcription. Cell 1985,40(1),119-127.
[0023]
[16] Milisavljevic N.,Perlikova P.,Pohl R.,et al.Enzymatic synthesis of base-modified RNA by T7 RNA polymerase.A systematic study and comparison of 5-substituted pyrimidine and 7-substituted 7-deazapurine nucleosidetriphosphates as substrates.Org.Biomol.Chem.2018,16(32),5800-5807.
[0024]
[17] Lee JH, Ku SH, Kim MJ, et al. Rolling circle transcription-based polymeric siRNA nanoparticles for tumor-targeted delivery. J. ControlledRelease 2017, 263, 29-38.
[0025]
[18] Jang M.,Kim JH,Nam HY,et al.Design of a platform technology for systemic delivery of siRNA to tumors using rolling circletranscription.Nat.Commun.2015,6,7930. Summary of the Invention
[0026] The problem the invention aims to solve
[0027] Due to the limitations of current technology, it is currently difficult to synthesize long RNAs containing modifying groups at specific sites.
[0028] In some embodiments, this disclosure provides a method for preparing long RNA chains that, based on a precise assembly and ligation process, can synthesize long RNA chains with arbitrary sequences in the range of 60 nt or more, particularly 60-1000 nt.
[0029] In other embodiments, the methods disclosed herein can be used to prepare long RNAs that can be precisely modified at any site, overcoming the current technical barrier that prevents the synthesis of long RNAs with precise site modification.
[0030] In other embodiments, the method disclosed herein can be used to prepare single-stranded long RNA, and the prepared single-stranded long RNA can contain modifying groups at any site, which has the advantages of low synthesis difficulty, high accuracy and low cost.
[0031] Solution for solving the problem
[0032] This disclosure provides a method for preparing long RNA, which includes the following steps:
[0033] Synthesis steps: Synthesize a first-strand nucleic acid fragment group and a second-strand nucleic acid fragment group, wherein the first-strand nucleic acid fragment group consists of RNA fragments and the second-strand nucleic acid fragment group consists of at least one of RNA fragments and DNA fragments;
[0034] The first strand's nucleic acid fragment group includes RNA fragment group a and optional RNA fragment group b; the second strand's nucleic acid fragment group includes nucleic acid fragment group c and optional nucleic acid fragment group d; the RNA fragment group a includes RNA fragment n. i and RNA fragment n i+1 The nucleic acid fragment group b includes RNA fragment x ii and RNA fragment x ii+1 The nucleic acid fragment group c includes nucleic acid fragment m. i The nucleic acid fragment group d includes nucleic acid fragment y ii and nucleic acid fragments y ii+1 At least one of them, i and ii are independent integers selected from 1 or above;
[0035] Among them, nucleic acid fragment m i The 5' end sequence and RNA fragment n i+1 The 5' end sequence is complementary, and the nucleic acid fragment m i The 3' end sequence and RNA fragment n i The 3' end sequence is complementary; RNA fragment x ii and RNA fragment x ii+1 Partial base complementarity forms a hairpin structure with a 5' extension arm and a 3' extension arm, wherein the 5' extension arm sequence is related to the nucleic acid fragment y. iiThe 5' end sequence is complementary to the 3' extension arm sequence and the nucleic acid fragment y ii+1 The 3' end sequence is a complementary sequence;
[0036] Annealing step: The nucleic acid fragment group of the first strand and the nucleic acid fragment group of the second strand are mixed in the same reaction system and annealed to form a double-stranded assembly precursor; wherein, there is a connection between two adjacent nucleic acid fragments in the first strand and there is a connection between two adjacent nucleic acid fragments in the second strand; the connection between adjacent nucleic acid fragments in the first strand and the connection between adjacent nucleic acid fragments in the second strand are staggered.
[0037] Ligation step: Connect the linker of the first strand to obtain a double-stranded assembly formed by the complementarity of continuous single-stranded RNA and fragmented single-stranded nucleic acid strands.
[0038] In some embodiments, according to the method for preparing long RNA as described in this disclosure, the second strand of nucleic acid fragments consists of RNA fragments.
[0039] In some embodiments, according to the method for preparing long RNA as described in this disclosure, the second strand of nucleic acid fragments consists of DNA fragments.
[0040] In some embodiments, according to the method for preparing long RNA as described in this disclosure, the second strand of nucleic acid fragments consists of RNA fragments and DNA fragments.
[0041] In some embodiments, the method for preparing long RNA according to this disclosure further includes the following steps:
[0042] Denaturation step: The double-stranded assembly is denatured to obtain continuous single-stranded RNA;
[0043] Optionally, the method further includes a purification step: purifying the continuous single-stranded RNA from the reaction system.
[0044] In some embodiments, according to the method for preparing long RNA according to this disclosure, the hairpin structure further includes a stem region forming a double-stranded structure and a stem-loop region not forming a double-stranded structure, wherein the 5' end and 3' end of the stem region are respectively connected to the 5' extension arm and the 3' extension arm; preferably, the RNA fragment x ii and RNA fragment x ii+1 The connection point between them is located in the stem area.
[0045] In some embodiments, the method for preparing long RNA according to this disclosure, wherein,
[0046] The RNA fragment n i+1 The 3' end sequence is complementary to or unpaired with the 3' end sequences of other nucleic acid fragments in the nucleic acid fragment group c; or,
[0047] The nucleic acid fragment y ii The 3' end sequence is complementary to or unpaired with the 3' end sequences of other nucleic acid fragments in RNA fragment group a; or,
[0048] The nucleic acid fragment y ii+1 The 5' end sequence is complementary to or unpaired with the 5' end sequences of other nucleic acid fragments in RNA fragment group a;
[0049] Optionally, the RNA fragment n i+1 The 3' end sequence and nucleic acid fragment m i+1 The 3' end sequence is a complementary sequence, and the nucleic acid fragment m i+1 The 5' end sequence is either complementary to or unpaired with other nucleic acid fragments in the nucleic acid fragment group a.
[0050] In some embodiments, the method for preparing long RNA according to this disclosure, wherein the length of the continuous single-stranded RNA is 60 nt or more, preferably 80 nt or more, preferably 100 nt or more, preferably 120 nt or more, preferably 60-1000 nt, preferably 80-600 nt, more preferably 100-400 nt, and most preferably 120-360 nt.
[0051] In some embodiments, the method for preparing long RNA according to this disclosure, wherein the length of any nucleic acid fragment in the first strand nucleic acid fragment group and the second strand nucleic acid fragment group is 8-120 nt, preferably 10-80 nt, more preferably 15-40 nt, and most preferably 20-30 nt.
[0052] In some embodiments, according to the method for preparing long RNA according to this disclosure, the 5' end sequence of any nucleic acid fragment in the first strand's nucleic acid fragment group and the second strand's nucleic acid fragment group is 4 nt or more in length, preferably 4-50 nt, more preferably 6-30 nt, and most preferably 10-20 nt; or,
[0053] The length of the 3' end sequence of any nucleic acid fragment in the first strand nucleic acid fragment group and the second strand nucleic acid fragment group is 4 nt or more, preferably 4-50 nt, more preferably 6-30 nt, and most preferably 10-20 nt.
[0054] In some embodiments, according to the method for preparing long RNA according to this disclosure, any nucleic acid fragment in the first chain nucleic acid fragment group contains a phosphate group at the 5' end and a hydroxyl group at the 3' end; in the ligation step, the phosphate group and hydroxyl group on both sides of the ligation port are linked into a phosphodiester bond;
[0055] Optionally, the adjacent phosphate groups and hydroxyl groups can be linked into phosphodiester bonds by enzyme linkage or chemical linkage.
[0056] In some embodiments, the method for preparing long RNA according to the present disclosure includes a modified base at one or more positions of any nucleic acid fragment in the first chain nucleic acid fragment group and the second chain nucleic acid fragment group, and a base immediately adjacent to the linker is an unmodified base.
[0057] Optionally, the modification is selected from m 6 A、Ψ、m 1 A、m 5 A, ms 2 i 6 A、i 6 A、m 3 C, m 5 C、ac 4 C, m 7 G、m2、2G、m 2 G, m 1 G, Q, m 5 U、mcm 5 U、ncm 5 U、ncm 5 Um, D, mcm 5 s 2 U, Inosine(I), hm 5 C, s 4 U、s 2 U, azobenzene, Cm, Um, Gm, t 6 A, yW, ms 2 t 6 A or its derivatives.
[0058] In some embodiments, the method for preparing long RNA according to the present disclosure includes a modified ribose at one or more positions of any nucleic acid fragment in the first chain's nucleic acid fragment group and the second chain's nucleic acid fragment group, and the ribose at the position immediately adjacent to the junction is unmodified ribose.
[0059] Optionally, the modification is selected from LNA, 2'-OMe, 3'-OMeU, vmoe, 2'-F, or 2'-OBn (2'-O-benzylgroup) or derivatives thereof.
[0060] In some embodiments, the method for preparing long RNA according to the present disclosure includes a modified phosphodiester bond at one or more positions of any nucleic acid fragment in the first chain's nucleic acid fragment group, and an unmodified phosphodiester bond at a position immediately adjacent to the linker.
[0061] Alternatively, one or more positions of any nucleic acid fragment in the second chain's nucleic acid fragment group contain modified phosphodiester bonds, and the phosphodiester bonds immediately adjacent to the linker are unmodified phosphodiester bonds;
[0062] Optionally, the modification is selected from phosphorothioate (PS), nucleotide triphosphate (NTPαS), or derivatives thereof.
[0063] In some embodiments, according to the method for preparing long RNA according to this disclosure, in the annealing step, the nucleic acid fragment group of the first strand and the nucleic acid fragment group of the second strand are incubated and then cooled to form a double-stranded assembly precursor;
[0064] Optionally, the incubation temperature is any temperature between 0 and 100°C, preferably any temperature between 10 and 85°C, more preferably any temperature within the range of 20 and 65°C, and the incubation time is any desired time.
[0065] The cooling rate can be arbitrary, and the temperature can be lowered to any temperature at which the nucleic acid fragments in the reaction system hybridize to form a precursor for a double-stranded assembly.
[0066] In some embodiments, according to the method for preparing long RNA according to this disclosure, in the annealing step, the nucleic acid fragment group of the first strand and the nucleic acid fragment group of the second strand are dissolved in the same solvent to obtain the reaction system.
[0067] In some embodiments, the method for preparing long RNA according to this disclosure is wherein the pH of the reaction system is 3-11, preferably pH 4-10, more preferably pH 5-9, and most preferably pH 6-8.
[0068] In some embodiments, according to the method for preparing long RNA according to this disclosure, in the reaction system, the molar ratio of any two nucleic acid fragments in the first chain nucleic acid fragment group and the second chain nucleic acid fragment group is 1:(0.1-10), preferably 1:(0.5-2), and most preferably 1:1.
[0069] This disclosure also provides a long RNA, wherein the long RNA is prepared by the method according to this disclosure, and the long RNA is a single-stranded long RNA;
[0070] Preferably, the long RNA contains modified bases, ribose, or phosphodiester bonds at one or more locations.
[0071] The effects of the invention
[0072] In some embodiments, the method for preparing long RNA provided in this disclosure can produce long RNA of any sequence. Moreover, the method described in this invention does not require DNA as a template and does not rely on RNA polymerase, etc., and has advantages such as low cost, low synthesis difficulty, high yield, high sequence accuracy, and precise introduction of modifications, making it suitable for large-scale production applications.
[0073] In some embodiments, the method for preparing long RNA provided in this disclosure can prepare long RNA with a hairpin structure to mimic the natural spatial conformation of RNA molecules. This improves the structural stability of long RNA and facilitates the realization of its biological functions.
[0074] In some embodiments, the method for preparing long RNA provided in this disclosure prepares a double-stranded assembly formed by complementary continuous single-stranded RNA and fragmented single-stranded nucleic acid strands. The double-stranded assembly only requires simple denaturation treatment to obtain the target long RNA. For non-target single-stranded nucleic acid strands, they are dispersed in the reaction system as nucleic acid fragments after preparation, without the need for further processing such as shearing or alteration. This effectively simplifies the preparation steps of single-stranded long RNA and improves the preparation efficiency.
[0075] In some embodiments, the method for preparing long RNA provided in this disclosure enables the precise insertion of bases at arbitrary sites, thus solving the problem that current methods for synthesizing long RNA cannot achieve precise modification of specific sites.
[0076] In some embodiments, the long RNA provided in this disclosure is prepared by the above-described method for preparing long RNA. It has high sequence accuracy and can achieve precise insertion of modified bases at any site. The obtained long RNA and long RNA containing modified bases have broad application prospects in drug development, clinical treatment and other fields. Attached Figure Description
[0077] Figure 1 A schematic diagram of long RNA assembly is shown;
[0078] Figure 2 This diagram illustrates the assembly of hairpin structures in long RNA.
[0079] Figure 3 A schematic diagram of the assembly of a long RNA chain containing a hairpin structure is shown;
[0080] Figure 4 The results of non-denaturing polyacrylamide gel electrophoresis characterization of the RNA80 / 100 assembly are shown.
[0081] Figure 5 The results of denaturing polyacrylamide gel electrophoresis characterization of 80nt RNA single strands are shown.
[0082] Figure 6 The results of non-denaturing polyacrylamide gel electrophoresis characterization of three double-stranded RNA assemblies, RNA100 / 100, RNA140 / 120, and RNA200 / 180, are shown.
[0083] Figure 7 The results of denaturing polyacrylamide gel electrophoresis characterization of 100nt, 140nt, and 200nt RNA single strands are shown.
[0084] Figure 8 The results of denaturing polyacrylamide gel electrophoresis characterization of a 267 nt RNA single strand are shown.
[0085] Figure 9 The results of denaturing polyacrylamide gel electrophoresis characterization of the 267nt RNA single strand containing site-directed modifications are shown. Detailed Implementation
[0086] The following provides a detailed description of the contents of this disclosure. The description of the technical features described below is based on representative embodiments and specific examples of this disclosure, but this disclosure is not limited to these embodiments and specific examples.
[0087] It should be noted that:
[0088] In this disclosure, the range of values referred to as “value A to value B” refers to the range that includes the endpoint values A and B.
[0089] In this disclosure, unless otherwise stated, "more" in "multiple", "various", "multiple", etc., means a value of 2 or more.
[0090] In this disclosure, the terms “substantially,” “largely,” or “truly” mean that the error is less than 5%, or less than 3%, or less than 1% compared to the relevant perfect or theoretical standard.
[0091] In this disclosure, unless otherwise specified, "%" refers to the percentage content by mass.
[0092] In this disclosure, the word "may" has two meanings: to perform a certain process and not to perform a certain process.
[0093] In this disclosure, "optional" or "optionally" means that the event or situation described below may or may not occur, and the description includes both the scenario in which the event occurs and the scenario in which the event does not occur.
[0094] In this disclosure, although the disclosure supports the definition of the terms "or" and "or" as substitutes and "and / or", the terms "or" and "or" in the claims mean "and / or" unless expressly stated as substitutes or mutually exclusive.
[0095] The term "water" as used in this disclosure includes any feasible type of water such as tap water, deionized water, distilled water, double-distilled water, purified water, and ion-exchanged water.
[0096] In this disclosure, "assembly of double-stranded RNA" and "double-stranded RNA" have the same meaning and can be used interchangeably.
[0097] In this disclosure, the "double-stranded assembly" and "double-stranded assembly precursor" can be formed by the complementarity of continuous single-stranded RNA and fragmented single-stranded RNA, or by the complementarity of continuous single-stranded RNA and fragmented single-stranded DNA, or by the complementarity of continuous single-stranded RNA and fragmented single-stranded nucleic acid strands formed by both RNA and DNA fragments. In other words, the double strands in the "double-stranded assembly" and "double-stranded assembly precursor" in this disclosure are not DNA double strands.
[0098] In this disclosure, a "nick" is a gap that exists between two adjacent nucleotides in a single-stranded nucleic acid chain and is caused by the absence of a phosphodiester bond between the two adjacent nucleotides.
[0099] First aspect
[0100] The first aspect of this disclosure provides a method for preparing long RNA, comprising the following steps:
[0101] Synthesis steps: Synthesize a first-strand nucleic acid fragment group and a second-strand nucleic acid fragment group, wherein the first-strand nucleic acid fragment group consists of RNA fragments and the second-strand nucleic acid fragment group consists of at least one of RNA fragments and DNA fragments;
[0102] The first strand's nucleic acid fragment group includes RNA fragment group a and optional RNA fragment group b; the second strand's nucleic acid fragment group includes nucleic acid fragment group c and optional nucleic acid fragment group d; the RNA fragment group a includes RNA fragment n. i and RNA fragment n i+1 The nucleic acid fragment group b includes RNA fragment x ii and RNA fragment x ii+1The nucleic acid fragment group c includes nucleic acid fragment m. i The nucleic acid fragment group d includes nucleic acid fragment y ii and nucleic acid fragments y ii+1 At least one of them, i and ii are independent integers selected from 1 or above;
[0103] Among them, nucleic acid fragment m i The 5' end sequence and RNA fragment n i+1 The 5' end sequence is complementary, and the nucleic acid fragment m i The 3' end sequence and RNA fragment n i The 3' end sequence is complementary; RNA fragment x ii and RNA fragment x ii+1 Partial base complementarity forms a hairpin structure with a 5' extension arm and a 3' extension arm, wherein the 5' extension arm sequence is related to the nucleic acid fragment y. ii The 5' end sequence is complementary to the 3' extension arm sequence and the nucleic acid fragment y ii+1 The 3' end sequence is a complementary sequence;
[0104] Annealing step: The nucleic acid fragment group of the first strand and the nucleic acid fragment group of the second strand are mixed in the same reaction system and annealed to form a double-stranded assembly precursor; wherein, there is a connection between two adjacent nucleic acid fragments in the first strand and there is a connection between two adjacent nucleic acid fragments in the second strand; the connection between adjacent nucleic acid fragments in the first strand and the connection between adjacent nucleic acid fragments in the second strand are staggered.
[0105] Ligation step: Connect the linker of the first strand to obtain a double-stranded assembly formed by the complementarity of continuous single-stranded RNA and fragmented single-stranded nucleic acid strands.
[0106] It should be noted that in current RNA synthesis methods, the short fragment annealing and linker ligation method is generally only used for the synthesis of short double-stranded RNA. Patent document CN102876658A discloses a method for large-scale synthesis of long-chain nucleic acid molecules. In the ligation step of short-chain nucleic acid molecule fragments, the small nucleic acid fragment molecules including the purified sequence obtained in step 1 are complementary-paired in solution to form a double strand with a gap in each single strand. Under the action of nucleic acid ligase, the gaps on the two strands are joined to form a long double-stranded assembly. The long double-stranded assembly in a large mixture of products is amplified and purified through a PCR step, finally obtaining a long double-stranded nucleic acid molecule formed by the complementarity of two continuous single strands.
[0107] However, this disclosure found in the study that the above-mentioned method for preparing long double-stranded nucleic acid molecules has at least the following problems: (1) The nucleic acid molecule obtained by the above-disclosed method is a double-stranded structure formed by two continuous long chains. After the double-stranded structure denatures, two continuous long chains are uniformly mixed in the reaction system. Therefore, when it is necessary to prepare single-stranded long nucleic acid molecules, it is impossible to achieve this by simply unwinding the double-stranded structure. In fact, for double-stranded molecules as long as 60 bp, the unwinding temperature is extremely high, and the unwinding process is relatively difficult. Therefore, the preparation of single-stranded long nucleic acid molecules is also difficult to achieve by unwinding double-stranded long nucleic acid molecules. (2) The above-disclosed method does not consider the natural conformation of nucleic acid molecules. For RNA molecules that are prone to forming secondary structures, it is difficult to maintain their natural spatial conformation and their biological function. (3) RNA double strands cannot be directly amplified by PCR. Therefore, the above-disclosed method cannot be directly used for RNA preparation. (4) In the above-disclosed method, the amplification of a small amount of target long double-stranded nucleic acid molecules in the mixed crude product must be achieved through the PCR process. However, the precise site-specific modification in the final product cannot be introduced through the PCR process.
[0108] The preparation method disclosed herein divides long RNA into several short RNA fragments, greatly reducing the difficulty of synthesizing long RNA. In the process of synthesizing long RNA, DNA is not required as a template or RNA polymerase is needed; in some cases, the target sequence itself can even be used as a template without the need to add additional short RNA template groups. This effectively reduces the difficulty of chemical synthesis of long RNA and enables modification of bases, ribose, or phosphodiester bonds at any site in the long RNA, avoiding the problem of site-specific modification that is difficult to achieve with conventional in vitro transcription methods. It has the advantages of low cost, high yield, and high sequence accuracy.
[0109] Furthermore, the preparation method disclosed herein only connects the linkers of the first strand formed by RNA fragments, resulting in a double-stranded assembly formed by the complementarity of continuous single-stranded RNA and fragmented single-stranded nucleic acid strands. The fragmented single-stranded nucleic acid strands can be composed of at least one of DNA fragments and RNA fragments. This preparation method also omits an amplification step and avoids connecting the linkers of the fragmented single-stranded nucleic acid strands (i.e., single-stranded RNA) in the double-stranded assembly. The aforementioned double-stranded assembly can achieve the recovery of the target long-chain RNA through simple denaturation treatment. The preparation method does not include steps such as digestion or cleavage of non-target single-stranded nucleic acid strands, effectively improving the preparation efficiency of single-stranded long-chain RNA and making it suitable for large-scale industrial applications.
[0110] <Sequence segmentation of long RNAs>
[0111] Before preparing long RNA, the sequence of the long RNA must first be divided, and attached... Figure 1A long double-stranded RNA structure is shown, wherein the first strand is the target long RNA, and the second strand is a single-stranded nucleic acid strand complementary to the first strand. The nucleotide sequences of the first and second strands are divided into several short nucleic acid fragment sequences. Specifically, the nucleic acid fragment group forming the first strand consists of RNA fragments, and the nucleic acid fragment group forming the second strand consists of at least one of RNA fragments and DNA fragments.
[0112] Furthermore, the first strand of nucleic acid fragments is selected from RNA fragment group a and optional RNA fragment group b, and the second strand of nucleic acid fragments is selected from nucleic acid fragment group c and optional nucleic acid fragment group d.
[0113] For the first-strand nucleic acid fragment group, it can be RNA fragment group a, or a combination of RNA fragment group a and RNA fragment group b; for the second-strand nucleic acid fragment group, it can be nucleic acid fragment group c, or a combination of nucleic acid fragment group c and nucleic acid fragment group d.
[0114] In some embodiments, nucleic acid fragment group c consists of RNA fragments, and nucleic acid fragment group d consists of RNA fragments. In some embodiments, nucleic acid fragment group c consists of DNA fragments, and nucleic acid fragment group d consists of DNA fragments. In some embodiments, nucleic acid fragment group c consists of both RNA and DNA fragments, and nucleic acid fragment group d consists of both RNA and DNA fragments. In some embodiments, nucleic acid fragment group c consists of both RNA and DNA fragments, and nucleic acid fragment group d consists of RNA fragments. In some embodiments, nucleic acid fragment group c consists of RNA fragments, and nucleic acid fragment group d consists of both RNA and DNA fragments. In some embodiments, nucleic acid fragment group c consists of both RNA and DNA fragments, and nucleic acid fragment group d consists of DNA fragments. In some embodiments, nucleic acid fragment group c consists of DNA fragments, and nucleic acid fragment group d consists of both RNA and DNA fragments.
[0115] Among them, RNA fragment group a includes RNA fragment n i and RNA fragment n i+1 Nucleic acid fragment group c includes nucleic acid fragment m i Nucleic acid fragment m i The 5' end sequence and RNA fragment n i+1 The 5' end sequence is complementary, and the nucleic acid fragment m i The 3' end sequence and RNA fragment n i The 3' end sequence is a complementary sequence.
[0116] As attached Figure 2 and attached Figure 3 As shown, RNA fragment group b includes RNA fragment x. iiand RNA fragment x ii+1 Nucleic acid fragment group d includes nucleic acid fragment y ii Nucleic acid fragments y ii+1 Or it may also include nucleic acid fragments. ii and nucleic acid fragments y ii+1 Among them, RNA fragment x ii and RNA fragment x ii+1 Partial base complementarity forms a hairpin structure with a 5' extension arm and a 3' extension arm, wherein the 5' extension arm sequence is related to the nucleic acid fragment y. ii The 5' end sequence is complementary to the 3' extension arm sequence and the nucleic acid fragment y ii+1 The 3' end sequence is a complementary sequence.
[0117] In some implementations, i and ii are independent integers selected from 1 and above.
[0118] In some implementations, the first strand of RNA fragments is designated as RNA fragment group a, and the second strand of RNA fragments is designated as RNA fragment group c; that is, the first strand of RNA sequence is divided into RNA fragment n. i sequence and RNA fragment n i+1 The sequence of the second strand, complementary to the first strand, is divided into nucleic acid fragments m. i Sequence formation is achieved through nucleic acid fragment m i The 5' end sequence and nucleic acid fragment n i+1 Complementary pairing of the 5' end sequence, nucleic acid fragment m i The 3' end sequence and nucleic acid fragment n i Complementary pairing of the 3' end sequence enables sequence segmentation of double-stranded RNA containing the target long RNA (first strand). Nucleic acid fragment m i It can be either a DNA fragment or an RNA fragment, both of which can achieve the synthesis of the target long RNA sequence.
[0119] Furthermore, RNA fragment group a may also contain other nucleic acid fragments. In some embodiments, RNA fragment group a includes RNA fragment n. i RNA fragment n i+1 RNA fragment n i+2 In some implementations, RNA fragment group a includes RNA fragment n. i RNA fragment n i+1 RNA fragment n i+2 RNA fragment n i+3 In some implementations, RNA fragment group a includes RNA fragment n. i RNA fragment n i+1 RNA fragment n i+2 RNA fragment ni+3 RNA fragment n i+4 Similarly, RNA fragment group a may also include other numbers of RNA fragments, which are not exhaustively listed in this disclosure.
[0120] Furthermore, nucleic acid fragment group c may also contain other nucleic acid fragments. In some embodiments, nucleic acid fragment group c includes nucleic acid fragment m. i Nucleic acid fragment m i+1 Among them, nucleic acid fragment m i The 3' end sequence and RNA fragment n i The 3' end sequence is complementary, and the nucleic acid fragment m i The 5' end sequence and RNA fragment n i+1 The 5' end sequence is complementary; nucleic acid fragment m i+1 The 3' end sequence and RNA fragment n i+1 The 3' end sequence is complementary, and the nucleic acid fragment m i+1 The 5' end sequence is related to RNA fragment n i+2 The 5' end sequence is either complementary or unpaired. Among them, nucleic acid fragment m... i Nucleic acid fragment m i+1 They are either DNA fragments or RNA fragments, independent of each other.
[0121] In some implementations, nucleic acid fragment group c includes nucleic acid fragment m. i Nucleic acid fragment m i+1 Nucleic acid fragment m i+2 Among them, nucleic acid fragment m i The 3' end sequence and RNA fragment n i The 3' end sequence is complementary, and the nucleic acid fragment m i The 5' end sequence and RNA fragment n i+1 The 5' end sequence is complementary; nucleic acid fragment m i+1 The 3' end sequence and RNA fragment n i+1 The 3' end sequence is complementary, and the nucleic acid fragment m i+1 The 5' end sequence is related to RNA fragment n i+2 The 5' end sequence is complementary; nucleic acid fragment m i+2 The 3' end sequence and RNA fragment n i+2 The 3' end sequence is complementary, and the nucleic acid fragment m i+2 The 5' end sequence is related to RNA fragment n i+3 The 5' end sequence is either complementary or unpaired. Among them, nucleic acid fragment m... i Nucleic acid fragment m i+1 Nucleic acid fragment m i+2 They are either DNA fragments or RNA fragments, independent of each other.
[0122] In some implementations, nucleic acid fragment group c includes nucleic acid fragment m. i Nucleic acid fragment m i+1 Nucleic acid fragment m i+3 Among them, nucleic acid fragment m i The 3' end sequence and RNA fragment n i The 3' end sequence is complementary, and the nucleic acid fragment m i The 5' end sequence and RNA fragment n i+1 The 5' end sequence is complementary; nucleic acid fragment m i+1 The 3' end sequence and RNA fragment n i+1 The 3' end sequence is complementary, and the nucleic acid fragment m i+1 The 5' end sequence is related to RNA fragment n i+2 The 5' end sequence is complementary; nucleic acid fragment m i+2 The 3' end sequence and RNA fragment n i+2 The 3' end sequence is complementary, and the nucleic acid fragment m i+2 The 5' end sequence is related to RNA fragment n i+3 The 5' end sequence is complementary; nucleic acid fragment m i+3 The 3' end sequence and RNA fragment n i+3 The 3' end sequence is complementary, and the nucleic acid fragment m i+3 The 5' end sequence is related to RNA fragment n i+4 The 5' end sequence is either complementary or unpaired. Among them, nucleic acid fragment m... i Nucleic acid fragment m i+1 Nucleic acid fragment m i+2 Nucleic acid fragment m i+3 Each fragment is either a DNA fragment or an RNA fragment. Similarly, nucleic acid fragment group c may also include other numbers of nucleic acid fragments, which are not exhaustively listed in this disclosure.
[0123] In some implementations, the first-strand RNA fragment group is RNA fragment group a and RNA fragment group b, and the second-strand nucleic acid fragment group is nucleic acid fragment group c and nucleic acid fragment group d. That is, the first-strand RNA sequence (i.e., the sequence of the target long RNA) is divided into RNA fragment n. i sequence, RNA fragment n i+1 sequence, RNA fragment x ii sequence and RNA fragment x ii+1 The sequence, RNA fragment x ii and RNA fragment x ii+1 Partial base complementarity forms a hairpin structure with 5' and 3' extension arms; the second-strand nucleic acid sequence is divided into nucleic acid fragments m. isequence, nucleic acid fragment y ii sequence and nucleic acid fragment y ii+1 The sequence, through nucleic acid fragment m i The 5' end sequence and RNA fragment n i+1 Complementary pairing of the 5' end sequence, nucleic acid fragment m i The 3' end sequence and RNA fragment n i Complementary pairing of the 3' end sequence, nucleic acid fragment y ii The complementary pairing of the 5' end sequence and the 5' extension arm sequence, nucleic acid fragment y ii+1 The complementary pairing of the 3' end sequence and the 3' extension arm sequence enables the sequence segmentation of double-stranded RNA containing a target long RNA with a hairpin structure. Among them, nucleic acid fragment y ii Nucleic acid fragments y ii+1 Both can be independently selected from DNA or RNA fragments, enabling the synthesis of the target long RNA sequence.
[0124] Furthermore, from RNA fragment x ii and RNA fragment x ii+1 The hairpin structure formed by partial base complementarity also includes a stem region forming a double-stranded structure and a stem-loop region not forming a double-stranded structure. The 5' end and 3' end of the stem region are connected to the 5' extension arm and the 3' extension arm, respectively. Whether the first strand needs to include RNA fragment x... ii and RNA fragment x ii+1 Nucleic acid fragment group b can be selected based on the spatial structure of the target long RNA. For example, before sequence segmentation of nucleic acid fragments, the spatial structure of the target long RNA is predicted. If the target long RNA contains one or more hairpin structures, the sequence corresponding to the hairpin structure in the target long RNA is segmented into RNA fragment x. ii and RNA fragment x ii+1 The sequence of the linear structure in the target long RNA is divided into RNA fragments n. i and RNA fragment n i+1 .
[0125] Furthermore, the second strand, complementary to the first strand, is sequenced, corresponding to RNA fragment n of the first strand. i and RNA fragment n i+1 Divide nucleic acid fragments m i The hairpin structure corresponding to the first strand divides the nucleic acid fragment y. ii Nucleic acid fragments y ii+1 or nucleic acid fragment y ii With nucleic acid fragment y ii+1 The combination of .
[0126] In some implementations, RNA fragment group b includes RNA fragment x. ii and RNA fragment x ii+1 , from RNA fragment x ii and RNA fragment x ii+1 The first hairpin structure of the first strand is formed. In some embodiments, RNA fragment group b includes RNA fragment x. ii RNA fragment x ii+1 RNA fragment x ii+2 RNA fragment x ii+3 Among them, RNA fragment x ii RNA fragment x ii+1 The first hairpin structure forming the first strand, RNA fragment x ii+2 RNA fragment x ii+3 A second hairpin structure is formed in the first strand. In some embodiments, RNA fragment group b includes RNA fragment x. ii RNA fragment x ii+1 RNA fragment x ii+2 RNA fragment x ii+3 RNA fragment x ii+4 RNA fragment x ii+5 Among them, RNA fragment x ii RNA fragment x ii+1 The first hairpin structure forming the first strand, RNA fragment x ii+2 RNA fragment x ii+3 The second hairpin structure forming the first strand, RNA fragment x ii+4 RNA fragment x ii+5 The third hairpin structure forms the first strand. Similarly, RNA fragment group b may also include other numbers of nucleic acid fragments, the specific number depending on the number of hairpin structures in the target long RNA, which is not exhaustively listed here.
[0127] In some implementations, nucleic acid fragment group d includes nucleic acid fragment y. ii Nucleic acid fragment y ii The 5' end sequence is complementary to the 5' extension arm sequence of the first hairpin structure, and the nucleic acid fragment y ii The 3' end sequence of fragment y is either complementary to or unpaired with the nucleic acid fragment in fragment group a. ii These are DNA or RNA fragments. In some embodiments, the nucleic acid fragment group d includes nucleic acid fragment y. ii+1 Nucleic acid fragment y ii+1 The 3' end sequence is complementary to the 3' extension arm sequence of the first hairpin structure, and the nucleic acid fragment y ii+1 The 5' end sequence of fragment y is either complementary to or unpaired with the nucleic acid fragment in fragment group a.ii+1 It can be a DNA fragment or an RNA fragment.
[0128] In some implementations, nucleic acid fragment group d includes nucleic acid fragment y. ii and nucleic acid fragments y ii+1 Nucleic acid fragment y ii The 5' end sequence is complementary to the 5' extension arm sequence of the first hairpin structure, and the nucleic acid fragment y ii The 3' end sequence of fragment y is either complementary to or unpaired with the nucleic acid fragment in fragment group a; ii+1 The 3' end sequence is complementary to the 3' extension arm sequence of the first hairpin structure, and the nucleic acid fragment y ii+1 The 5' end sequence of y forms a complementary sequence to or is unpaired with the nucleic acid fragment in fragment group a. Among them, nucleic acid fragment y... ii Nucleic acid fragments y ii+1 They are selected independently from DNA or RNA fragments.
[0129] In some implementations, nucleic acid fragment group d includes nucleic acid fragment y. ii Nucleic acid fragments y ii+1 and nucleic acid fragments y ii+2 Nucleic acid fragment y ii The 5' end sequence is complementary to the 5' extension arm sequence of the first hairpin structure, and the nucleic acid fragment y ii The 3' end sequence of fragment y is either complementary to or unpaired with the nucleic acid fragment in fragment group a; ii+1 The 3' end sequence is complementary to the 3' extension arm sequence of the first hairpin structure, and the nucleic acid fragment y ii+1 The 5' end sequence is either complementary to or unpaired with the nucleic acid fragment in nucleic acid fragment group a; nucleic acid fragment y ii+2 The 5' end sequence is complementary to the 5' extension arm sequence of the second hairpin structure, and the nucleic acid fragment y ii+2 The 3' end sequence of y forms a complementary sequence to or is unpaired with the nucleic acid fragment in fragment group a. Among them, nucleic acid fragment y... ii Nucleic acid fragments y ii+1 Nucleic acid fragments y ii+2 They are selected independently from DNA or RNA fragments.
[0130] In some implementations, nucleic acid fragment group d includes nucleic acid fragment y. ii Nucleic acid fragments y ii+1 and nucleic acid fragments y ii+3 Nucleic acid fragment y ii The 5' end sequence is complementary to the 5' extension arm sequence of the first hairpin structure, and the nucleic acid fragment y iiThe 3' end sequence of fragment y is either complementary to or unpaired with the nucleic acid fragment in fragment group a; ii+1 The 3' end sequence is complementary to the 3' extension arm sequence of the first hairpin structure, and the nucleic acid fragment y ii+1 The 5' end sequence is either complementary to or unpaired with the nucleic acid fragment in nucleic acid fragment group a; nucleic acid fragment y ii+3 The 3' end sequence is complementary to the 3' extension arm sequence of the second hairpin structure, and the nucleic acid fragment y ii+3 The 5' end sequence of y forms a complementary sequence to or is unpaired with the nucleic acid fragment in fragment group a. Among them, nucleic acid fragment y... ii Nucleic acid fragments y ii+1 Nucleic acid fragments y ii+3 They are selected independently from DNA or RNA fragments.
[0131] In some implementations, nucleic acid fragment group d includes nucleic acid fragment y. ii Nucleic acid fragments y ii+1 Nucleic acid fragments y ii+2 and nucleic acid fragments y ii+3 Nucleic acid fragment y ii The 5' end sequence is complementary to the 5' extension arm sequence of the first hairpin structure, and the nucleic acid fragment y ii The 3' end sequence of fragment y is either complementary to or unpaired with the nucleic acid fragment in fragment group a; ii+1 The 3' end sequence is complementary to the 3' extension arm sequence of the first hairpin structure, and the nucleic acid fragment y ii+1 The 5' end sequence is either complementary to or unpaired with the nucleic acid fragment in nucleic acid fragment group a; nucleic acid fragment y ii+2 The 5' end sequence is complementary to the 5' extension arm sequence of the second hairpin structure, and the nucleic acid fragment y ii+2 The 3' end sequence of fragment y is either complementary to or unpaired with the nucleic acid fragment in fragment group a; ii+3 The 3' end sequence is complementary to the 3' extension arm sequence of the second hairpin structure, and the nucleic acid fragment y ii+3 The 5' end sequence of the fragment is either complementary to or unpaired with the nucleic acid fragment in fragment group a. Similarly, fragment group b may also include other numbers of nucleic acid fragments, which are not exhaustively listed in this disclosure. Among them, nucleic acid fragment y... ii Nucleic acid fragments y ii+1 Nucleic acid fragments y ii+2 Nucleic acid fragments y ii+3 They are selected independently from DNA or RNA fragments.
[0132] Specifically, whether it is necessary to divide the first-strand RNA fragment group b and the corresponding second-strand nucleic acid fragment group d is determined by the spatial structure of the target long RNA; the actual number of RNA fragment group b and nucleic acid fragment group d is determined by the number of hairpin structures in the target long RNA. The number of RNA fragment group a in the first strand and the number of nucleic acid fragment group c in the second strand are determined by the sequence of the target long RNA to be synthesized. By increasing or decreasing the number of nucleic acid fragments in RNA fragment group a and nucleic acid fragment group c, RNA strands of different lengths can be divided, thereby achieving the synthesis of long RNA of the desired length and quantity.
[0133] In some specific implementations, nucleic acid fragment group a is RNA fragment group a, and nucleic acid fragment group c is RNA fragment group c. RNA fragment group a includes RNA fragment n. i and RNA fragment n i+1 RNA fragment group c includes RNA fragment m i RNA fragment m i The 5' end sequence and RNA fragment n i+1 The 5' end sequence is complementary to the RNA fragment m. i The 3' end sequence and RNA fragment n i The 3' end sequence is a complementary sequence.
[0134] RNA fragment group b includes RNA fragment x ii and RNA fragment x ii+1 RNA fragment group d includes RNA fragment y ii RNA fragments y ii+1 Or it may include RNA fragments at the same time. ii and RNA fragment y ii+1 Among them, RNA fragment x ii and RNA fragment x ii+1 Partial base complementarity forms a hairpin structure with a 5' extension arm and a 3' extension arm, the 5' extension arm sequence being associated with the RNA fragment y. ii The 5' end sequence is complementary to the 3' extension arm sequence of RNA fragment y. ii+1 The 3' end sequence is a complementary sequence.
[0135] In some specific implementations, the first-strand nucleic acid fragment group is RNA fragment group a, and the second-strand nucleic acid fragment group is RNA fragment group c; that is, the first-strand nucleic acid sequence is divided into RNA fragment n. i sequence and RNA fragment n i+1 The sequence of the first strand, the second strand of nucleic acid sequence is divided into RNA fragments m i Sequence formation, through RNA fragment m i The 5' end sequence and RNA fragment ni+1 Complementary pairing of the 5' end sequence, RNA fragment m i The 3' end sequence and RNA fragment n i The complementary pairing of the 3' end sequence enables the sequence division of double-stranded RNA containing the target long RNA.
[0136] Furthermore, RNA fragment group a may also contain other RNA fragments. In some embodiments, RNA fragment group a includes RNA fragment n. i RNA fragment n i+1 RNA fragment n i+2 In some implementations, RNA fragment group a includes RNA fragment n. i RNA fragment n i+1 RNA fragment n i+2 RNA fragment n i+3 In some implementations, RNA fragment group a includes RNA fragment n. i RNA fragment n i+1 RNA fragment n i+2 RNA fragment n i+3 RNA fragment n i+4 Similarly, RNA fragment group a may also include other numbers of RNA fragments, which are not exhaustively listed in this disclosure.
[0137] Furthermore, RNA fragment group c may also contain other RNA fragments. In some embodiments, RNA fragment group c includes RNA fragment m. i RNA fragment m i+1 RNA fragment m i The 3' end sequence and RNA fragment n i The 3' end sequence is complementary to the RNA fragment m. i The 5' end sequence is related to RNA fragment n i+1 The 5' end sequence is either complementary or unpaired; RNA fragment m i+1 The 3' end sequence and RNA fragment n i+1 The 3' end sequence is complementary to the RNA fragment m. i+1 The 5' end sequence is related to RNA fragment n i+2 The 5' end sequence is either a complementary sequence or an unpaired sequence.
[0138] In some specific implementations, RNA fragment group c includes RNA fragment m. i RNA fragment m i+1 RNA fragment m i+2 Among them, RNA fragment m i The 3' end sequence and RNA fragment n iThe 3' end sequence is complementary to the RNA fragment m. i The 5' end sequence is related to RNA fragment n i+1 The 5' end sequence is either complementary or unpaired; RNA fragment m i+1 The 3' end sequence and RNA fragment n i+1 The 3' end sequence is complementary to the RNA fragment m. i+1 The 5' end sequence is related to RNA fragment n i+2 The 5' end sequence is complementary; RNA fragment m i+2 The 3' end sequence and RNA fragment n i+2 The 3' end sequence is complementary to the RNA fragment m. i+2 The 5' end sequence is related to RNA fragment n i+3 The 5' end sequence is either a complementary sequence or an unpaired sequence.
[0139] In some specific implementations, RNA fragment group c includes RNA fragment m. i RNA fragment m i+1 RNA fragment m i+3 Among them, RNA fragment m i The 3' end sequence and RNA fragment n i The 3' end sequence is complementary to the RNA fragment m. i The 5' end sequence is related to RNA fragment n i+1 The 5' end sequence is either complementary or unpaired; RNA fragment m i+1 The 3' end sequence and RNA fragment n i+1 The 3' end sequence is complementary to the RNA fragment m. i+1 The 5' end sequence is related to RNA fragment n i+2 The 5' end sequence is complementary; RNA fragment m i+2 The 3' end sequence and RNA fragment n i+2 The 3' end sequence is complementary to the RNA fragment m. i+2 The 5' end sequence is related to RNA fragment n i+3 The 5' end sequence is complementary; RNA fragment m i+3 The 3' end sequence and RNA fragment n i+3 The 3' end sequence is complementary to the RNA fragment m. i+3 The 5' end sequence is related to RNA fragment n i+4 The 5' end sequence is either complementary or unpaired. Similarly, RNA fragment group c may also include other numbers of RNA fragments, which are not exhaustively listed in this disclosure.
[0140] In some specific implementations, the first strand of nucleic acid fragments consists of RNA fragment group a and RNA fragment group b, and the second strand of nucleic acid fragments consists of RNA fragment group c and RNA fragment group d. That is, the nucleic acid sequence of the first strand is divided into RNA fragment n. i sequence, RNA fragment n i+1 sequence, RNA fragment x ii sequence and RNA fragment x ii+1 The sequence, RNA fragment x ii and RNA fragment x ii+1 Partial base complementarity forms a hairpin structure with 5' and 3' extension arms; the second-strand nucleic acid sequence is divided into RNA fragments m i sequence, RNA fragment y ii sequence and RNA fragment y ii+1 The sequence, through RNA fragment m i The 5' end sequence and RNA fragment n i+1 Complementary pairing of the 5' end sequence, RNA fragment m i The 3' end sequence and RNA fragment n i Complementary pairing of the 3' end sequence, RNA fragment y ii The complementary pairing of the 5' end sequence and the 5' extension arm sequence, RNA fragment y ii+1 The complementary pairing of the 3' end sequence and the 3' extension arm sequence enables the sequence division of double-stranded RNA containing the target long RNA with hairpin structure.
[0141] Furthermore, from RNA fragment x ii and RNA fragment x ii+1 The hairpin structure formed by partial base complementarity also includes a stem region forming a double-stranded structure and a stem-loop region not forming a double-stranded structure. The 5' end and 3' end of the stem region are connected to the 5' extension arm and the 3' extension arm, respectively. Whether the first strand needs to include RNA fragment x... ii and RNA fragment x ii+1 RNA fragment group b can be selected based on the spatial structure of the target long RNA. For example, before sequence segmentation of the RNA fragments, the spatial structure of the target long RNA is predicted. If the target long RNA contains one or more hairpin structures, the sequence of the target long RNA is then designed as the first strand, and the sequence corresponding to the hairpin structure in the target long RNA is segmented into RNA fragment x. ii and RNA fragment x ii+1 The sequence of the linear structure in the target long RNA is divided into RNA fragments n. i and RNA fragment n i+1 .
[0142] Furthermore, the second strand, complementary to the first strand, is sequenced, corresponding to RNA fragment n of the first strand. i and n i+1 Divide m i The RNA fragment y corresponds to the hairpin structure of the first strand. ii RNA fragments y ii+1 or RNA fragment y ii With RNA fragment y ii+1 The combination of .
[0143] In some specific implementations, RNA fragment group b includes RNA fragment x. ii and RNA fragment x ii+1 , from RNA fragment x ii and RNA fragment x ii+1 The first hairpin structure of the first strand is formed. In some embodiments, RNA fragment group b includes RNA fragment x. ii RNA fragment x ii+1 RNA fragment x ii+2 RNA fragment x ii+3 Among them, RNA fragment x ii RNA fragment x ii+1 The first hairpin structure forming the first strand, RNA fragment x ii+2 RNA fragment x ii+3 A second hairpin structure is formed in the first strand. In some embodiments, RNA fragment group b includes RNA fragment x. ii RNA fragment x ii+1 RNA fragment x ii+2 RNA fragment x ii+3 RNA fragment x ii+4 RNA fragment x ii+5 Among them, RNA fragment x ii RNA fragment x ii+1 The first hairpin structure forming the first strand, RNA fragment x ii+2 RNA fragment x ii+3 The second hairpin structure forming the first strand, RNA fragment x ii+4 RNA fragment x ii+5 The third hairpin structure forms the first strand. Similarly, RNA fragment group b may also include other numbers of RNA fragments, the specific number depending on the number of hairpin structures in the target long RNA, which is not exhaustive in this disclosure.
[0144] In some specific implementations, RNA fragment group d includes RNA fragment y. ii RNA fragment y ii The 5' end sequence is complementary to the 5' extension arm sequence of the first hairpin structure, RNA fragment yii The 3' end sequence is either complementary to or unpaired with the RNA fragment in RNA fragment group a. In some embodiments, RNA fragment group d includes RNA fragment y. ii+1 RNA fragment y ii+1 The 3' end sequence is complementary to the 3' extension arm sequence of the first hairpin structure, RNA fragment y ii+1 The 5' end sequence is either complementary to or unpaired with the RNA fragment in RNA fragment group a.
[0145] In some specific implementations, RNA fragment group d includes RNA fragment y. ii and RNA fragment y ii+1 RNA fragment y ii The 5' end sequence is complementary to the 5' extension arm sequence of the first hairpin structure, RNA fragment y ii The 3' end sequence is either complementary to or unpaired with the RNA fragment in RNA fragment group a; RNA fragment y ii+1 The 3' end sequence is complementary to the 3' extension arm sequence of the first hairpin structure, RNA fragment y ii+1 The 5' end sequence is either complementary to or unpaired with the RNA fragment in RNA fragment group a.
[0146] In some specific implementations, RNA fragment group d includes RNA fragment y. ii RNA fragments y ii+1 and RNA fragment y ii+2 RNA fragment y ii The 5' end sequence is complementary to the 5' extension arm sequence of the first hairpin structure, RNA fragment y ii The 3' end sequence is either complementary to or unpaired with the RNA fragment in RNA fragment group a; RNA fragment y ii+1 The 3' end sequence is complementary to the 3' extension arm sequence of the first hairpin structure, RNA fragment y ii+1 The 5' end sequence is either complementary to or unpaired with the RNA fragment in RNA fragment group a; RNA fragment y ii+2 The 5' end sequence is complementary to the 5' extension arm sequence of the second hairpin structure, RNA fragment y ii+2 The 3' end sequence is either complementary to or unpaired with the RNA fragment in RNA fragment group a.
[0147] In some specific implementations, RNA fragment group d includes RNA fragment y. ii RNA fragments y ii+1 and RNA fragment y ii+3 RNA fragment y iiThe 5' end sequence is complementary to the 5' extension arm sequence of the first hairpin structure, RNA fragment y ii The 3' end sequence is either complementary to or unpaired with the RNA fragment in RNA fragment group a; RNA fragment y ii+1 The 3' end sequence is complementary to the 3' extension arm sequence of the first hairpin structure, RNA fragment y ii+1 The 5' end sequence is either complementary to or unpaired with the RNA fragment in RNA fragment group a; RNA fragment y ii+3 The 3' end sequence is complementary to the 3' extension arm sequence of the second hairpin structure, RNA fragment y ii+3 The 5' end sequence is either complementary to or unpaired with the RNA fragment in RNA fragment group a.
[0148] In some specific implementations, group d includes y ii y ii+1 y ii+2 and y ii+3 RNA fragment y ii The 5' end sequence is complementary to the 5' extension arm sequence of the first hairpin structure, RNA fragment y ii The 3' end sequence is either complementary to or unpaired with the RNA fragment in RNA fragment group a; RNA fragment y ii+1 The 3' end sequence is complementary to the 3' extension arm sequence of the first hairpin structure, RNA fragment y ii+1 The 5' end sequence is either complementary to or unpaired with the RNA fragment in RNA fragment group a; RNA fragment y ii+2 The 5' end sequence is complementary to the 5' extension arm sequence of the second hairpin structure, RNA fragment y ii+2 The 3' end sequence is either complementary to or unpaired with the RNA fragment in RNA fragment group a; RNA fragment y ii+3 The 3' end sequence is complementary to the 3' extension arm sequence of the second hairpin structure, RNA fragment y ii+3 The 5' end sequence is either complementary to or unpaired with the RNA fragment in RNA fragment group a. Similarly, RNA fragment group b may include other numbers of RNA fragments, which are not exhaustively listed in this disclosure.
[0149] In this disclosure, the 5' end sequence and the 3' end sequence refer to the division of a nucleotide fragment along the 5' to 3' direction, dividing the nucleotide fragment into two regions. Specifically, the sequence of the region closer to the 5' end is called the 5' end sequence, and the sequence of the other region closer to the 3' end is called the 3' end sequence.
[0150] In this disclosure, the 5' end is a nucleotide located at the 5' end of the nucleotide chain along the 5' to 3' direction, and it generally has a 5' phosphate group. The 3' end is a nucleotide located at the 3' end of the nucleotide chain along the 5' to 3' direction, and it generally has a 3' hydroxyl group.
[0151] Furthermore, after the nucleotide sequences of the first and second strands are separated, there will be a connection point between two adjacent nucleic acid fragments. For example, in the first strand, RNA fragment n i and RNA fragment n i+1 There is a junction between them, and RNA fragment x in the first strand ii and RNA fragment x ii+1 There is a connection point between them, and the nucleic acid fragment m in the second strand i and nucleic acid fragment m i+1 There is a connection point between them, and the nucleic acid fragment y ii and nucleic acid fragments y ii+1 There are connection ports between them.
[0152] To ensure relatively good stability of the double-stranded assembly precursor obtained after annealing, the sequence division of the double-stranded nucleic acid strand containing the target long RNA is performed such that the joints between adjacent nucleic acid fragments in the first strand's nucleic acid fragment group are staggered from the joints between adjacent nucleic acid fragments in the second strand's nucleic acid fragment group. In some preferred embodiments, RNA fragment x ii and RNA fragment x ii+1 The connection point between them is located in the stem region of the hairpin structure. In this case, the target RNA sequence with secondary structure is divided into RNA fragments x. ii and RNA fragment x ii+1 By utilizing the self-complementarity of the target RNA sequence to form a hairpin structure, the higher-order structure of the single-stranded long RNA (especially RNA sequences with special physiological functions) formed after ligation can be preserved to the greatest extent, thereby ensuring that its physiological function is not affected.
[0153] Furthermore, when performing sequence partitioning of the first and second strands, the melting temperatures (T0) of the nucleic acid fragments in the first and second strands should be such that... m The nucleic acid fragments should be as close as possible to each other and avoid the presence of complex higher-order structures within the chain to reduce the difficulty of annealing nucleic acid fragments to form double-stranded assembly precursors.
[0154] In some specific embodiments, the 5' end sequence of any nucleic acid fragment in the first-strand nucleic acid fragment group and the second-strand nucleic acid fragment group is 4 nt or more in length, preferably 4-50 nt, more preferably 6-30 nt, and most preferably 10-20 nt. For example, the 5' end sequence of any nucleic acid fragment is 4 nt, 6 nt, 8 nt, 10 nt, 12 nt, 14 nt, 16 nt, 18 nt, etc.
[0155] In some more specific embodiments, the first-strand nucleic acid fragment group is an RNA fragment group, wherein the 5' end sequence of any RNA fragment in the RNA fragment group is 4 nt or more in length, preferably 4-50 nt, more preferably 6-30 nt, and most preferably 10-20 nt. For example, the 5' end sequence of any RNA fragment is 4 nt, 6 nt, 8 nt, 10 nt, 12 nt, 14 nt, 16 nt, 18 nt, etc.
[0156] In some more specific embodiments, the second-strand nucleic acid fragment group is an RNA fragment group, a DNA fragment group, or a combination of RNA and DNA fragments, wherein the 5' end sequence of any RNA fragment or any DNA fragment is 4 nt or longer, preferably 4-50 nt, more preferably 6-30 nt, and most preferably 10-20 nt. For example, the 5' end sequence of any RNA fragment is 4 nt, 6 nt, 8 nt, 10 nt, 12 nt, 14 nt, 16 nt, 18 nt, etc.
[0157] In some specific embodiments, the 3' end sequence of any nucleic acid fragment in the first-strand nucleic acid fragment group and the second-strand nucleic acid fragment group is 4 nt or more in length, preferably 4-50 nt, more preferably 6-30 nt, and most preferably 10-20 nt. For example, the 3' end sequence of any nucleic acid fragment is 4 nt, 6 nt, 8 nt, 10 nt, 12 nt, 14 nt, 16 nt, 18 nt, etc.
[0158] In some more specific embodiments, the first-strand nucleic acid fragment group is an RNA fragment group, wherein the length of the 3' end sequence of any RNA fragment in the RNA fragment group is 4 nt or more, preferably 4-50 nt, more preferably 6-30 nt, and most preferably 10-20 nt. For example, the length of the 3' end sequence of any RNA fragment is 4 nt, 6 nt, 8 nt, 10 nt, 12 nt, 14 nt, 16 nt, 18 nt, etc.
[0159] In some more specific embodiments, the second-strand nucleic acid fragment group is an RNA fragment group, a DNA fragment group, or a combination of RNA and DNA fragments, wherein the 3' end sequence of any RNA fragment or any DNA fragment is 4 nt or longer, preferably 4-50 nt, more preferably 6-30 nt, and most preferably 10-20 nt. For example, the 3' end sequence of any RNA fragment is 4 nt, 6 nt, 8 nt, 10 nt, 12 nt, 14 nt, 16 nt, 18 nt, etc.
[0160] In some specific embodiments, the length of the continuous single-stranded RNA is 60-1000 nt, preferably 80-600 nt, more preferably 100-400 nt, and most preferably 120-360 nt. For example, the length of any single-stranded nucleic acid strand is 60 nt, 70 nt, 80 nt, 90 nt, 100 nt, 120 nt, 140 nt, 160 nt, 180 nt, 200 nt, 220 nt, 240 nt, 250 nt, 260 nt, 267 nt, 270 nt, 300 nt, 320 nt, 340 nt, 360 nt, 400 nt, 500 nt, 600 nt, 700 nt, 800 nt, 900 nt, 1000 nt, etc.
[0161] In some specific embodiments, the first strand is a single-stranded RNA assembled from RNA fragments. After connecting the linkers in the first strand, a continuous single-stranded RNA is obtained. The length of the continuous single-stranded RNA is 60-1000 nt, preferably 80-600 nt, more preferably 100-400 nt, and most preferably 120-360 nt. For example, the length of the single-stranded RNA is 60 nt, 70 nt, 80 nt, 90 nt, 100 nt, 120 nt, 140 nt, 160 nt, 180 nt, 200 nt, 220 nt, 240 nt, 250 nt, 260 nt, 267 nt, 270 nt, 300 nt, 320 nt, 340 nt, 360 nt, 400 nt, 500 nt, 600 nt, 700 nt, 800 nt, 900 nt, 1000 nt, etc.
[0162] In some specific embodiments, the second strand is single-stranded RNA, single-stranded DNA, or a mixed single-stranded DNA and RNA. The second strand is present in the double-stranded assembly and is a fragmented single-stranded nucleic acid strand. The length of the second strand in the double-stranded assembly is 60-1000 nt, preferably 80-600 nt, more preferably 100-400 nt, and most preferably 120-360 nt. For example, the length of the single-stranded RNA is 60 nt, 70 nt, 80 nt, 90 nt, 100 nt, 120 nt, 140 nt, 160 nt, 180 nt, 200 nt, 220 nt, 240 nt, 250 nt, 260 nt, 267 nt, 270 nt, 300 nt, 320 nt, 340 nt, 360 nt, 400 nt, 500 nt, 600 nt, 700 nt, 800 nt, 900 nt, 1000 nt, etc.
[0163] In one specific embodiment, this disclosure describes a method for preparing single-stranded long RNA, comprising the following steps:
[0164] Synthesis steps: Synthesize a first-strand nucleic acid fragment group and a second-strand nucleic acid fragment group, wherein the first-strand nucleic acid fragment group consists of RNA fragments and the second-strand nucleic acid fragment group consists of at least one of RNA fragments and DNA fragments;
[0165] The first strand's nucleic acid fragment group includes RNA fragment group a and optional RNA fragment group b; the second strand's nucleic acid fragment group includes nucleic acid fragment group c and optional nucleic acid fragment group d; the RNA fragment group a includes RNA fragment n. i and RNA fragment n i+1 The nucleic acid fragment group b includes RNA fragment x ii and RNA fragment x ii+1 The nucleic acid fragment group c includes nucleic acid fragment m. i The nucleic acid fragment group d includes nucleic acid fragment y ii and nucleic acid fragments y ii+1 At least one of them, i and ii are independent integers selected from 1 or above;
[0166] Among them, nucleic acid fragment m i The 5' end sequence and RNA fragment n i+1 The 5' end sequence is complementary, and the nucleic acid fragment m i The 3' end sequence and RNA fragment n i The 3' end sequence is complementary; RNA fragment x ii and RNA fragment x ii+1 Partial base complementarity forms a hairpin structure with a 5' extension arm and a 3' extension arm, wherein the 5' extension arm sequence is related to the nucleic acid fragment y. iiThe 5' end sequence is complementary to the 3' extension arm sequence and the nucleic acid fragment y ii+1 The 3' end sequence is a complementary sequence;
[0167] Annealing step: The nucleic acid fragment group of the first strand and the nucleic acid fragment group of the second strand are mixed in the same reaction system and annealed to form a double-stranded assembly precursor; wherein, there is a connection between two adjacent nucleic acid fragments in the first strand and there is a connection between two adjacent nucleic acid fragments in the second strand; the connection between adjacent nucleic acid fragments in the first strand and the connection between adjacent nucleic acid fragments in the second strand are staggered.
[0168] Ligation step: Connect the linker of the first strand to obtain a double-stranded assembly formed by the complementarity of continuous single-stranded RNA and fragmented single-stranded nucleic acid strands.
[0169] Denaturation step: The double-stranded assembly is denatured to obtain continuous single-stranded RNA.
[0170] <Synthetic Nucleic Acid Fragments>
[0171] After the target long RNA is sequenced, the required sequence and the specified number of nucleic acid fragments are synthesized. The nucleic acid fragments can be synthesized using commonly used RNA and DNA synthesis methods in the art, such as solid-phase synthesis. Solid-phase synthesis allows for the large-scale preparation of short nucleic acid fragments while ensuring the accuracy of the nucleic acid fragment sequences.
[0172] It should be noted that current RNA synthesis methods, particularly solid-phase synthesis which enables site-specific modifications, are generally only used for short RNAs under 60 nt, with a maximum length of 120 nt. Furthermore, site-specific modifications are difficult to introduce when preparing short RNAs in the 60-120 nt length range using solid-phase synthesis. In vitro transcription and RCT methods, suitable for long RNA synthesis, also struggle to achieve site-specific modifications. Therefore, for the synthesis of long RNAs exceeding 60 nt, precise modification of bases, ribose, or phosphodiester bonds at specific positions within the long RNA is typically difficult during synthesis. This indicates that current technologies face technical obstacles in precisely modifying any site in long RNAs exceeding 60 nt, especially 120 nt, significantly limiting the application of long RNAs in the biomedical field.
[0173] In some specific embodiments, the length of any nucleic acid fragment in the first-strand nucleic acid fragment group and the second-strand nucleic acid fragment group is 8-120 nt, preferably 10-80 nt, more preferably 15-40 nt, and most preferably 20-30 nt. For example, the length of the nucleic acid fragment is 22 nt, 24 nt, 26 nt, 28 nt, 30 nt, 40 nt, 50 nt, 60 nt, 70 nt, 80 nt, 90 nt, 100 nt, etc. The length of the nucleic acid fragment determines its synthesis difficulty and cost. Controlling the length of the nucleic acid fragment to 20-30 nt can effectively reduce the synthesis difficulty and control the synthesis cost.
[0174] In some more specific embodiments, the first-strand nucleic acid fragment group is an RNA fragment group, wherein the length of any RNA fragment in the RNA fragment group is 8-120 nt, preferably 10-80 nt, more preferably 15-40 nt, and most preferably 20-30 nt. For example, the length of the RNA fragment is 22 nt, 24 nt, 26 nt, 28 nt, 30 nt, 40 nt, 50 nt, 60 nt, 70 nt, 80 nt, 90 nt, 100 nt, etc.
[0175] In some more specific embodiments, the second-strand nucleic acid fragment set is an RNA fragment set, a DNA fragment set, or a combination of RNA and DNA fragments, wherein the length of any RNA fragment or any DNA fragment is 8-120 nt, preferably 10-80 nt, more preferably 15-40 nt, and most preferably 20-30 nt. For example, the length of the RNA fragment is 22 nt, 24 nt, 26 nt, 28 nt, 30 nt, 40 nt, 50 nt, 60 nt, 70 nt, 80 nt, 90 nt, 100 nt, etc.
[0176] In some specific embodiments, modified bases are contained at one or more positions of any nucleic acid fragment in the first-strand nucleic acid fragment group and the second-strand nucleic acid fragment group. For example, modified bases are contained at one, two, three, four, etc., positions of the nucleic acid fragment. The base modification method can employ methods commonly used in the art, such as introducing modified bases during the chemical synthesis of short-chain nucleic acid fragments. Introducing modified bases during the synthesis of nucleic acid fragments allows for base modification at arbitrary sites, and after the nucleic acid fragments are assembled into long-chain RNA, long-chain RNA with precise base modification at arbitrary sites can be obtained.
[0177] Specifically, the modification method for any base at any position in a nucleic acid fragment can be selected from m 6 A、Ψ、m 1 A、m 5 A, ms 2 i 6 A、i6 A、m 3 C, m 5 C、ac 4 C, m 7 G、m2、2G、m 2 G, m 1 G, Q, m 5 U、mcm 5 U、ncm 5 U、ncm 5 Um, D, mcm 5 s 2 U, Inosine(I), hm 5 C, s 4 U、s 2 U, azobenzene, Cm, Um, Gm, t 6 A, yW, ms 2 t 6 A or its derivatives [19,20] .
[0178] In some more specific embodiments, the first-strand nucleic acid fragment group is an RNA fragment group, in which one or more positions of any RNA fragment contain modified ribose. For example, modified bases are contained at positions 1, 2, 3, 4, etc., of the RNA fragment.
[0179] In some specific embodiments, modified ribose is contained at one or more positions of any nucleic acid fragment in the first-strand nucleic acid fragment group and the second-strand nucleic acid fragment group. For example, modified ribose is contained at one, two, three, four, etc., positions of the nucleic acid fragment. The ribose modification method can employ methods commonly used in the art, such as introducing modified ribose during the chemical synthesis of short-chain nucleic acid fragments. Introducing modified ribose during the synthesis of nucleic acid fragments allows for ribose modification at arbitrary sites, and after the nucleic acid fragments are assembled into long-chain RNA, long-chain RNA with precise modification of ribose at any site can be obtained.
[0180] Specifically, the modification of ribose at any position in a nucleic acid fragment can be selected from LNA, 2'-OMe, 3'-OMeU, vmoe, 2'-F, or 2'-OBn (2'-O-benzyl group) or their derivatives.
[21] .
[0181] In some more specific embodiments, the first-strand nucleic acid fragment group is an RNA fragment group, wherein modified ribose is contained at one or more positions of any RNA fragment in the RNA fragment group. For example, modified ribose is contained at positions 1, 2, 3, 4, etc. of the RNA fragment.
[0182] In some specific embodiments, modified phosphodiester bonds are contained at one or more positions of any nucleic acid fragment in the first-chain nucleic acid fragment group and the second-chain nucleic acid fragment group. These phosphodiester bonds are formed between two adjacent nucleotides of the short-chain nucleic acid fragment. For example, modified phosphodiester bonds are contained at one, two, three, four, etc., positions of the nucleic acid fragment. The phosphodiester bond modification can be performed using methods commonly used in the art, such as introducing modified phosphodiester bonds during the chemical synthesis of the short-chain nucleic acid fragment. Introducing modified phosphodiester bonds during nucleic acid fragment synthesis allows for phosphodiester bond modification at any site. After the nucleic acid fragments are assembled into long-chain RNA, long-chain RNA with precise modification of phosphodiester bonds at any site can be obtained.
[0183] Specifically, the modification of the phosphodiester bond at any position in a nucleic acid fragment can be selected from phosphorothioate (PS), nucleotide triphosphate (NTPαS), or their derivatives. [22,23] .
[0184] In some preferred embodiments, modifications to bases, ribose, and phosphodiester bonds should be avoided at locations immediately adjacent to the linker site to prevent modifications at the first or second strand linker site from potentially affecting linker ligation in the subsequent double-stranded RNA assembly precursor.
[0185] In some more specific embodiments, the first-strand nucleic acid fragment group is an RNA fragment group, wherein one or more positions of any RNA fragment in the RNA fragment group contain modified phosphodiester bonds, which are formed between two adjacent ribonucleotides of the short-strand nucleic acid fragment. For example, modified phosphodiester bonds are contained at positions 1, 2, 3, 4, etc., of the nucleic acid fragment.
[0186] By modifying at least one of the bases, ribose, and phosphodiester bonds at any one or more sites in a nucleic acid fragment, the modified nucleic acid fragment can be applied to the synthesis of long RNA in this disclosure. This enables precise modification of any site in the long RNA, effectively solving the problem of synthesizing long RNA with precise modifications at specific sites in the current field. The modified long RNA not only has improved structural stability but also further enhances its immunogenicity and other biological properties, thus enabling the synthesized long RNA to have wide applications in the biomedical field.
[0187] In some specific implementations, the first-strand nucleic acid fragment group is an RNA fragment group, where each RNA fragment contains a 5' phosphate group and a 3' hydroxyl group. For example, RNA fragment n iThe 5' end contains a phosphate group, and the 3' end contains a hydroxyl group; RNA fragment n i+1 The 5' end contains a phosphate group, and the 3' end contains a hydroxyl group. RNA fragment n i+2 The 5' end contains a phosphate group, and the 3' end contains a hydroxyl group; RNA fragment n i+3 The 5' end contains a phosphate group, and the 3' end contains a hydroxyl group; RNA fragment x ii The 5' end contains a phosphate group, and the 3' end contains a hydroxyl group. When the nucleic acid fragments of the first and second strands are assembled to form a double-stranded assembly precursor with a hairpin structure, the 5' phosphate group and 3' hydroxyl group on both sides of the linker can be linked into a phosphodiester bond to connect the linker in the first strand, thereby obtaining a double-stranded assembly formed by the complementarity of the continuous single-stranded RNA (first strand) and the fragmented single-stranded nucleic acid strand (second strand).
[0188] In some specific implementations, the first-strand nucleic acid fragment group is an RNA fragment group, where each RNA fragment contains a 5' phosphate group and a 3' hydroxyl group. For example, RNA fragment n i The 5' end contains a phosphate group, and the 3' end contains a hydroxyl group; RNA fragment n i+1 The 5' end contains a phosphate group, and the 3' end contains a hydroxyl group. RNA fragment n i+2 The 5' end contains a phosphate group, and the 3' end contains a hydroxyl group; RNA fragment n i+3 The 5' end of the RNA contains a phosphate group, and the 3' end contains a hydroxyl group. When the first and second strands of nucleic acid fragments assemble to form a precursor of a double-stranded RNA assembly with a hairpin structure, the linker in the first strand can be connected by linking the 5' phosphate group and the 3' hydroxyl group on both sides of the linker port into a phosphodiester bond. This results in a double-stranded assembly formed by the complementarity of a continuous single-stranded RNA (first strand) and a fragmented single-stranded nucleic acid strand (second strand).
[0189] For example, the introduction of a phosphate group at the 5' end of an RNA fragment can be achieved using modification methods commonly used in the art. For instance, a phosphate group can be introduced directly at the 5' end of the RNA fragment during the synthesis of the RNA fragment; or a kinase can be applied to an RNA fragment without a phosphate group to modify the 5' end of the RNA fragment with a phosphate group.
[0190] Using the above design method, 5' phosphate groups and 3' hydroxyl groups are added to the RNA fragments of the target single-stranded RNA in the first and second strands. This allows only the target single-stranded RNA to be ligated in the ligation step, resulting in continuous single-stranded RNA. The nucleic acid strand complementary to the target single-stranded RNA remains a fragmented nucleic acid strand, effectively avoiding the need for digestion, cleavage, or other processing of the complementary strand during subsequent recovery of the target single-stranded RNA. Specifically, the fragmented nucleic acid strand can be a nucleic acid strand composed of RNA fragments, a nucleic acid strand composed of DNA fragments, or a nucleic acid strand composed of both RNA and DNA fragments.
[0191] <Double-chain assembly precursor>
[0192] The nucleic acid fragment groups of the first strand and the nucleic acid fragment groups of the second strand are mixed in the same reaction system and annealed to obtain a double-stranded assembly precursor formed by at least partial complementarity of the first strand and the second strand; wherein, there is a connection between two adjacent nucleic acid fragments in the first strand and there is a connection between two adjacent nucleic acid fragments in the second strand; the connection between adjacent nucleic acid fragments in the nucleic acid fragment group of the first strand and the connection between adjacent nucleic acid fragments in the nucleic acid fragment group of the second strand are staggered.
[0193] DNA molecules contain four types of deoxyribonucleotides: adenine (A), guanine (G), cytosine (C), and thymine (T), depending on the base type. Similar to DNA, RNA molecules contain four different ribonucleotides: adenine (A), guanine (G), cytosine (C), and uracil (U), depending on the base type. Bases are interconnected by hydrogen bonds; A and T, A and U, and C and G can form hydrogen bonds, respectively. This precise complementary pairing ability between base pairs allows two inverse single-stranded nucleic acids with complementary sequences to form a precise double-stranded structure through hydrogen bonding. In the preparation of double-stranded assembly precursors, the first and second strands of nucleic acid in the reaction system, after annealing, can reassemble into the initial target long double-stranded structure under the guidance of the complementary base pairing principle.
[0194] Specifically, the first-strand nucleic acid fragment group and the second-strand nucleic acid fragment group are dissolved in the same solvent and thoroughly mixed to obtain a reaction system for preparing a precursor of a double-stranded assembly. This disclosure does not specifically limit the specific solvent; it can be a commonly used polar solvent in the art, such as water. Regarding the molar ratio of the nucleic acid fragments in the reaction system, the molar ratio of any two nucleic acid fragments in the first-strand and second-strand nucleic acid fragment groups is 1:(0.1-10), preferably 1:(0.5-2), and most preferably 1:1. Exemplary examples include molar ratios of 1:0.2, 1:0.4, 1:0.6, 1:0.8, 1:1, 1:2, 1:4, 1:6, 1:8, etc. By setting the molar ratio of the nucleic acid fragments, the assembly efficiency of short-strand nucleic acid fragments can be improved.
[0195] In some specific embodiments, the first-strand RNA fragment group and the second-strand RNA fragment group are dissolved in the same solvent and thoroughly mixed to obtain a reaction system for preparing the assembly precursor of double-stranded RNA. This disclosure does not particularly limit the specific solvent; it can be a polar solvent commonly used in the art, such as water. Regarding the molar ratio of RNA fragments in the reaction system, the molar ratio of any two RNA fragments in the first-strand RNA fragment group and the second-strand RNA fragment group is 1:(0.1-10), preferably 1:(0.5-2), and most preferably 1:1. Exemplary examples include molar ratios of 1:0.2, 1:0.4, 1:0.6, 1:0.8, 1:1, 1:2, 1:4, 1:6, 1:8, etc. By setting the molar ratio of RNA fragments, the assembly efficiency of short-stranded RNA fragments can be improved.
[0196] To further improve the assembly efficiency of the double-stranded assembly precursor and increase the yield of double-stranded RNA assemblies, the pH of the reaction system is set to 3-11, preferably pH 4-10, more preferably pH 5-9, and most preferably pH 6-8. For example, the pH of the reaction system may be 6, 7, 8, 9, etc.
[0197] Furthermore, after incubating the nucleic acid fragment group of the first strand and the nucleic acid fragment group of the second strand, the mixture is cooled to form a double-stranded assembly precursor;
[0198] Optionally, the incubation temperature is any temperature between 0 and 100°C, preferably any temperature between 10 and 85°C, more preferably any temperature within the range of 20 and 65°C, and the incubation time is any desired time.
[0199] The cooling rate can be arbitrary, and the temperature can be lowered to any temperature at which the nucleic acid fragments in the reaction system hybridize to form a precursor for a double-stranded assembly.
[0200] <Double-chain assembly>
[0201] Only the connectors existing in the first chain are connected to form a double-chain assembly.
[0202] Specifically, the 5' phosphate group and 3' hydroxyl group on both sides of the linker are connected to form a phosphodiester bond. The ligation method can be enzymatic ligation using T4 RNA ligase or chemical ligation. After ligation, a complete double-stranded assembly is obtained, with the first and second strands complementing each other. In this assembly, the first strand is a continuous single-stranded RNA, and the second strand is a fragmented single-stranded nucleic acid chain composed of RNA fragments, DNA fragments, or a combination of both, thus achieving the preparation of long-chain RNA.
[0203] Furthermore, the preparation method disclosed herein also includes a denaturation step. The denaturation step involves denaturing the double-stranded assembly to obtain continuous single-stranded RNA, which is the target long-chain RNA. The denaturation method can be a method commonly used in the art to unwind double-stranded RNA to form single-stranded RNA. For example, treatment at 70°C for 5 minutes yields single-stranded RNA.
[0204] Furthermore, the preparation method disclosed herein also includes a purification step. The purification step involves purifying the continuous single-stranded RNA from the reaction system. This disclosure does not specifically limit the purification method; any method capable of efficiently recovering RNA from the reaction system can be used. The long-chain RNA obtained after the purification step, free of other substances, can be further applied in various fields such as clinical practice, drug development, and biological research.
[0205] The preparation method disclosed herein retains all the advantages of conventional RNA chemical synthesis methods (including no template strand required and precise site-directed modification), while simultaneously dividing the target long RNA into several shorter RNA fragments. The single-stranded nucleic acid strand complementary to the target single-stranded RNA can be divided into several shorter RNA fragments, DNA fragments, or combinations of RNA and DNA fragments. This sequence design significantly reduces the difficulty of chemical synthesis while preserving the high accuracy, high yield, and site-directed modification capabilities of chemical synthesis methods for preparing short nucleic acid fragments.
[0206] Nucleic acid fragments, easily synthesized via solid-phase synthesis, are reassembled in a specific sequence using nucleic acid self-assembly to form a precursor for a double-stranded assembly of the target structure. The linker ports within the assembly are then reconnected via phosphodiester bonds using techniques such as enzyme ligation or chemical ligation, resulting in a double-stranded assembly formed by complementary single-stranded RNA and fragmented single-stranded nucleic acid strands. Only simple denaturation is required to obtain the target single-stranded long RNA. Because solid-phase synthesis allows for precise modification of any site (except for bases immediately adjacent to the linker ports) of the initial short nucleic acid fragments, the resulting target long RNA can be accurately modified at almost any site.
[0207] Second aspect
[0208] A second aspect of this disclosure provides a long RNA, which is prepared by the method of the first aspect. Optionally, the long RNA is a single-stranded long RNA.
[0209] The long RNA disclosed herein can achieve accurate modification at any site, and the long RNA itself and the modification are not sequence-dependent, which provides a foundation for expanding the application of long RNA (especially long RNA with precise modification) in the biomedical field.
[0210] Unless otherwise specified, the experimental techniques and methods used in this embodiment are conventional techniques and methods. For example, experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in the embodiments can be obtained through legitimate commercial channels.
[0211] References:
[0212]
[19] Harcourt EM, Kietrys AM and Kool ET Chemical and structural effects of base modifications in messenger RNA. Nature 2017, 541(7637), 339-346.
[0213]
[20] Esteve-Puig R., Bueno-Costa A. and Esteller M. Writers, readers and erasers of RNA modifications in cancer. Cancer Lett. 2020, 474, 127-137.
[0214]
[21] Khvorova A.and Watts JKThe chemical evolution of oligonucleotide therapies of clinical utility.Nat.Biotechnol.2017,35(3),238-248.
[0215]
[22] Strzelecka D., Smietanski M., Sikorski PJ, et al. Phosphodiestermodifications in mRNA poly(A)tail prevent deadenylation without compromisingprotein expression. RNA2020, 26(12), 1815-1837.
[0216]
[23] Jiang L., Berraondo P., Jerico D., et al. Systemic messenger RNA asan etiological treatment for acute intermittent porphyria. Nat. Med. 2018, 24(12), 1899-1909.
[0217] Example
[0218] The embodiments of this disclosure will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of this disclosure. Where specific conditions are not specified in the examples, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.
[0219] Materials and methods
[0220] All RNA sequences used in the examples were purchased from Rigol Scientific and were not pretreated. All experimental water was 18.2 MΩcm ultrapure water from Millipore. T4 RNA ligase 2 and 10X ligase buffer were purchased from NEB. All other chemical reagents were of analytical grade.
[0221] Example 1. Construction of a 100 / 80 bp RNA double-stranded assembly
[0222] (1) Using long RNA chains of 80 nt and 100 nt in length for the first and second strands respectively (referred to as RNA80 / 100) as the target long chains, the long chains are cleaved into 9 short RNA chains of 20 nt each. Among them, R-n1, R-n2, R-n3 and R-n4 are RNA fragments for synthesizing the first strand, and R-m1, R-m2, R-m3, R-m4 and R-m5 are RNA fragments for synthesizing the second strand.
[0223] (2) Nine RNA fragments were prepared by chemical synthesis.
[0224] The specific sequences of the nine chains used are shown in the table below:
[0225] Table 1. Sequence information of the nine short RNA strands used to prepare the assembly
[0226] sequence name Sequence information nt SEQ ID NO R-m1 AAAAGGAAAAGCGAUGCUAU 20 SEQ ID NO: 1 R-n1 UACGAAUCCAAUAGCAUCGC 20 SEQ ID NO: 2 R-m2 UGGAUUCGUAGGACUGCCUG 20 SEQ ID NO: 3 R-n2 CAAGUAGUUACAGGCAGUCC 20 SEQ ID NO: 4 R-m3 UAACUACUUGUCACUCUCUU 20 SEQ ID NO: 5 R-n3 UGUCGGUAAGAAGAGAGUGA 20 SEQ ID NO: 6 R-m4 CUUACCGACAAAACCUAAAU 20 SEQ ID NO: 7 R-n4 UGAACAGAUAAUUUAGGUUU 20 SEQ ID NO: 8 R-m5 UAUCUGUUCAAAAAGGAAAA 20 SEQ ID NO: 9
[0227] (3) Mix the above 9 RNA fragments in equimolar ratio in 1×TAE-Mg 2+ Each strand was concentrated at 10 μM in the buffer solution and heated at 70 °C for 5 min, then gradually cooled to room temperature and incubated at 4 °C for 10 min to obtain the target RNA assembly. The obtained assemblies were observed by non-denaturing polyacrylamide gel electrophoresis, and the results are as follows. Figure 4 As shown.
[0228] Depend on Figure 4 It can be seen that the target double-stranded RNA assembly precursor was obtained with high efficiency under the conditions described.
[0229] Example 2. Synthesis and gel electrophoretic characterization of 80nt RNA single strands
[0230] (1) Synthesize the 9 RNA fragments in Example 1.
[0231] (2) The R-n1, R-n2, R-n3, and R-n4 fractions obtained from the first chain (80nt) are modified with 5' terminal phosphate groups, while the R-m1, R-m2, R-m3, R-m4, and R-m5 fractions obtained from the second chain are not modified. The 5' terminal phosphate groups are introduced during the synthesis of R-n1, R-n2, R-n3, and R-n4.
[0232] (3) An aqueous solution of the RNA 80 / 100 assembly was obtained at a concentration of 10 μM according to the method in Example 1. Different amounts of T4 RNA ligase (10, 20, 40 or 80 U) and 2 μL of 10X T4 RNA ligase buffer were added to 10 μL of the assembly aqueous solution, and ultrapure water was added to bring the total volume to 20 μL. The system was reacted at 37 °C for 10 min to allow the T4 RNA ligase to ligate the three linker sites in the first strand, so that the four short strands in the first strand form a complete 80 nt strand.
[0233] (4) An equal volume of formamide was added to the ligated RNA 80 / 100 assembly, mixed well, heated at 70°C for 5 min, and immediately cooled with liquid nitrogen for denaturation to obtain a continuous first strand. The obtained 80 nt first strand was observed by polyacrylamide gel electrophoresis, and the results are as follows: Figure 5 As shown.
[0234] Depend on Figure 5 It can be seen that the target 80nt RNA single strand was obtained with high efficiency under the conditions described.
[0235] Example 3. Preparation of longer RNA double-stranded assemblies
[0236] To synthesize longer RNA sequences, the system was expanded in Example 3 by increasing the number of short RNA chains. The specific steps are as follows:
[0237] (1) Using long RNA chains of 200nt and 180nt in length for the first and second strands respectively (referred to as RNA200 / 180) as the target long chains, the long chains are cut into 19 short RNA chains of 20nt in length. Starting from the 5' end of strand 1, 10, 13 and 19 of the short chains are taken respectively for assembly (referred to as RNA100 / 100, RNA140 / 120 and RNA200 / 180 respectively). The RNA fragments formed by splitting the first strand (200nt) include: R-n5, R-n6, R-n7, R-n8, R-n9, R-n10, R-n11, R-n12, R-n13, and R-n14; the RNA fragments formed by splitting the second strand (180nt) include: R-m6, R-m7, R-m8, R-m9, R-m10, R-m11, R-m12, R-m13, and R-m14.
[0238] (2) The RNA assembly was synthesized using the method shown in Example 1.
[0239] The results are as follows Figure 6As shown, this method can efficiently assemble 140 / 120bp RNA chains in one pot, or obtain 200 / 180bp RNA double-stranded assemblies through stepwise assembly, providing a guarantee for the subsequent synthesis of long sequences.
[0240] The specific sequences of the 19 chains used are shown in the table below:
[0241] Table 2. Sequence information of the 19 short RNA strands used to prepare the assembly
[0242] sequence name Sequence information nt SEQ ID NO R-n5 GUUCUUCUCUAGCUAUCCAU 20 SEQ ID NO: 10 R-m6 CACUACCAGGAUGGAUAGCU 20 SEQ ID NO: 11 R-n6 CCUGGUAGUGCAGCAUAAUC 20 SEQ ID NO: 12 R-m7 GUAUCAGAGAGAUUAUGCUG 20 SEQ ID NO: 13 R-n7 UCUCUGAUACGACAUGUAAG 20 SEQ ID NO: 14 R-m8 AAAACCUCUUCUUACAUGUC 20 SEQ ID NO: 15 R-n8 AAGAGGUUUUACAACUUGGA 20 SEQ ID NO: 16 R-m9 GAAUACCAUGUCCAAGUUGU 20 SEQ ID NO: 17 R-n9 CAUGGUAUUCAUUCGCUAAG 20 SEQ ID NO: 18 R-m10 GUGUUGAAUGCUUAGCGAAU 20 SEQ ID NO: 19 R-n10 CAUUCAACACCCAAUUUAUG 20 SEQ ID NO: 20 R-m11 UAUCGUUGUGCAUAAAUUGG 20 SEQ ID NO: 21 R-n11 CACAACGAUAGCGAUGCUAU 20 SEQ ID NO: 22 R-m12 UACGAAUCCAAUAGCAUCGC 20 SEQ ID NO: 23 R-n12 UGGAUUCGUAGGACUGCCUG 20 SEQ ID NO: 24 R-m13 CAAGUAGUUACAGGCAGUCC 20 SEQ ID NO: 25 R-n13 UAACUACUUGUCACUCUCUU 20 SEQ ID NO: 26 R-m14 UGUCGGUAAGAAGAGAGUGA 20 SEQ ID NO: 27 R-n14 CUUACCGACAAAACCUAAAU 20 SEQ ID NO: 28
[0243] Example 4. Preparation of 200nt RNA single strands
[0244] (1) In the three groups of target RNA long chains involved in Example 3, RNA100 / 100, RNA140 / 120 and RNA200 / 180, the 20nt RNA fragments obtained by splitting the first chain (100nt, 140nt and 200nt) were modified with 5' phosphate groups. The modification method was the same as in Example 2. The RNA fragments obtained by splitting the second chain (100nt, 120nt and 180nt) were not modified.
[0245] (2) An aqueous solution of RNA100 / 80 assembly was obtained according to the method in Example 3. Then, 4, 6 and 9 linker sites in chain 1 were ligated by T4 RNA ligase. The ligation method was the same as in Example 2, so that all RNA fragments in the first chain formed complete 100nt, 140nt and 200nt chains, respectively.
[0246] (3) The RNA fragment from step (2) was denatured using the same method as in Example 2 to obtain a continuous first strand. The first strand was observed by polyacrylamide gel electrophoresis, and the results are as follows: Figure 7 As shown.
[0247] Depend on Figure 7 It can be seen that, using this method, RNA single strands of different lengths can be prepared in one pot, with the shown RNA single strand lengths being 100, 140, and 200 nt, respectively.
[0248] Example 5. Preparation of 267nt RNA single strands
[0249] In order to synthesize a functional RNA sequence, the 267 / 220 bp long RNA double strand was split in Example 5. The details are as follows:
[0250] (1) The first strand, which is 267 nt in length, is divided into 10 RNA fragments with a length of 24-44 nt. The RNA fragments of the first strand include R-n15, R-n16, R-n17, R-n18, R-x1, R-x2, R-n19, R-n20, R-n21, and R-n22 in Table 3. The second strand, which is 220 nt in length, is divided into 8 short strands with a length of 24-30 nt. The RNA fragments of the second strand include R-m15, R-m16, R-y1, R-y2, R-m17, R-m18, R-m19, and R-m20 in Table 3. It should be noted that, since there are some natural hairpin structures in the target chain 1 (first chain), when designing the assembly, some regions (R-x1 and R-x2) are formed using the self-assembled hairpin structure of chain 1, without the need for a corresponding complementary chain (chain 2). Therefore, chain 2 and chain 1 are not completely corresponding and complementary.
[0251] (2) In the target RNA long chain, the RNA fragments divided from the first chain (267nt) are modified with 5' phosphate groups, while the RNA fragments divided from the second chain (220nt) are not modified.
[0252] (3) The 18 RNA short chains were mixed in equimolar ratio and assembled under the same conditions as in Example 1. After obtaining the RNA267 / 220 assembly in aqueous solution, the nine linker sites in chain 1 were ligated using T4 RNA ligase, so that all short chains in chain 1 formed complete 267nt chains. It should be noted that all Rn series short chains used in this experiment were modified with 5' terminal phosphate groups (except for R-n15 and its corresponding base-modified short chains), while Rm and Ry series short chains were unmodified.
[0253] (4) The RNA267 / 220 assembly was denatured to obtain a continuous first strand containing a hairpin structure. The results were observed by polyacrylamide gel electrophoresis. Figure 8 As shown.
[0254] like Figure 8 As shown, this method allows for the preparation of single-stranded RNA up to 267 nt in a single batch. The specific sequences of the short strands used are shown in Table 3.
[0255] To verify the correctness of the synthesized 267nt single strand sequence, the obtained sequence was sequenced in Example 5. The results are shown in Table 4. The effective signal regions were consistent with the expected sequence, with no mismatches or gaps / insertions.
[0256] Table 3. Sequence information of the short RNA strands used to prepare the assemblies
[0257]
[0258] Table 4. Sequencing information of the prepared 267nt ssRNA
[0259] sequencing direction Number of bases measured Comparative base regions Number of mismatches Number of gaps / insertions positive 241 40-264 0 0 Reverse 244 2-231 0 0
[0260] Example 6. 267nt containing precise point-to-point modification Preparation of RNA single strands
[0261] To synthesize RNA sequences containing precisely targeted modifications, in Example 6, the 267 / 220 bp long double-stranded RNA was split, with the short strand splitting method basically the same as described in Example 5. Specifically, one of the three short strands, R-n15, R-n16, or R-n17, was randomly selected to introduce an m... 6 A modification (the three RNA sequences containing the modification are respectively called R-n15-m) 6 A、R-n16-m 6 A and R-n17-m 6 A) or, randomly select one of the four short chains R-n15, R-n17, R-n20, or R-n21 to introduce a BrU modification (the four modified RNA sequences are referred to as R-n15-BrU, R-n17-BrU, R-n20-BrU, and R-n21-BrU, respectively). For simplicity, only the modified sequences used are shown in Table 5; the remaining unmodified sequences are the same as those described in Example 5. It should be noted that the Rn and Rx series short chains used in this experiment all have 5' terminal phosphate group modifications (except for R-n16 and its corresponding base-modified short chains), while the Rm and Ry series short chains are unmodified.
[0262] The 18 short chains described in Example 5 were mixed in equimolar ratio and assembled, wherein the unmodified short chains R-n15, R-n16, or R-n17 were respectively modified by the short chain R-n15-m. 6 A、R-n16-m 6 A and R-n17-m 6 In the A-substitution, the unmodified short chains R-n15, R-n17, R-n20, or R-n21 were replaced by the modified short chains R-n15-BrU, R-n17-BrU, R-n20-BrU, and R-n21-BrU, respectively. Only one sequence was replaced in each group, and a total of 7 groups were assembled. The synthesis conditions of the assemblies were the same as in Example 1. After obtaining 7 groups of RNA267 / 220 assemblies with different site modifications in aqueous solution, the 9 linker sites in chain 1 were ligated using T4 RNA ligase, so that all short chains in chain 1 formed complete 267nt chains with precise site-directed modifications. The resulting ligated chain 1 was observed by polyacrylamide gel electrophoresis, and the results are as follows: Figure 9 As shown.
[0263] like Figure 9 As shown, this method can be used to prepare 267nt RNA single strands with precise site-directed modifications at different positions in a single batch.
[0264] Table 5. Sequence information of the seven RNA short strands to be modified used to prepare 267nt RNA with precise site-directed modification.
[0265] sequence name Sequence information nt SEQ ID NO <![CDATA[R-n15-m 6 A]]> AUUAAAGGUUUAUACCUUCCCA(m6A)GGU 25 SEQ ID NO: 47 <![CDATA[R-n16-m 6 A]]> AACAAA(m6A)CCAACCAACUUUCGAUCU 24 SEQ ID NO: 48 <![CDATA[R-n17-m 6 A]]> CUUGUA(m6A)GAUCUGUUCUCUAAACGA 24 SEQ ID NO: 49 R-n15-BrU AUUAAAGGUUUAUACCUU(BrU)CCCAGGU 25 SEQ ID NO: 50 R-n17-BrU CUU(BrU)GUAGAUCUGUUCUCUAAACGA 24 SEQ ID NO: 51 R-n20-BrU UUACGGUU(BrU)UCGUCCGUGUUGCAGC 24 SEQ ID NO: 52 R-n21-BrU CGAUCAUCAGCACAUCUAGGU(BrU)UUC 24 SEQ ID NO: 53
[0266] The embodiments described above are merely examples for clearly illustrating the present disclosure and are not intended to limit the implementation of the present disclosure. Those skilled in the art can make other variations or modifications based on the above description. It is neither necessary nor possible to exhaustively describe all possible implementations. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of this disclosure should be included within the scope of protection of the claims of this disclosure. sequence list <110> Tsinghua University <120> A method for preparing site-directed modified long RNA <130> 6044-2018220IB <150> CN202110185251.1 <151> 2021-02-10 <160> 53 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 1 aaaaggaaaa gcgaugcuau 20 <210> 2 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 2 uacgaaucca auagcaucgc 20 <210> 3 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 3 uggauucgua ggacugccug 20 <210> 4 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 4 caaguaguua caggcagucc 20 <210> 5 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 5 uaacuacuug ucacucucuu 20 <210> 6 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 6 ugucgguaag aagagaguga 20 <210> 7 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 7 cuuaccgaca aaaccuaaau 20 <210> 8 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 8 ugaacagaua auuuagguuu 20 <210> 9 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 9 uaucuguuca aaaaggaaaa 20 <210> 10 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 10 guucuucucu agcuauccau 20 <210> 11 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 11 cacuaccagg auggauagcu 20 <210> 12 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 12 ccugguagug cagcauaauc 20 <210> 13 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 13 guaucagaga gauuaugcug 20 <210> 14 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 14 ucucugauac gacauguaag 20 <210> 15 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 15 aaaaccucuu cuuacauguc 20 <210> 16 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 16 aagagguuuu acaacuugga 20 <210> 17 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 17 gaauaccaug uccaaguugu 20 <210> 18 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 18 caugguauuc auucgcuaag 20 <210> 19 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 19 guguugaaug cuuagcgaau 20 <210> 20 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 20 cauucaacac ccaauuuaug 20 <210> twenty one <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> twenty one uaucguugug cauaaauugg 20 <210> twenty two <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> twenty two cacaacgaua gcgaugcuau 20 <210> twenty three <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> twenty three uacgaaucca auagcaucgc 20 <210> twenty four <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> twenty four uggauucgua ggacugccug 20 <210> 25 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 25 caaguaguua caggcagucc 20 <210> 26 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 26 uaacuacuug ucacucucuu 20 <210> 27 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 27 ugucgguaag aagagaguga 20 <210> 28 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 28 cuuaccgaca aaaccuaaau 20 <210> 29 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 29 auuaaagguu uauaccuucc caggu 25 <210> 30 <211> twenty four <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 30 aacaaaccaa ccaacuuucg aucu 24 <210> 31 <211> twenty four <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 31 cuuguagauc uguucucuaa acga 24 <210> 32 <211> twenty four <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 32 acuuuaaaau cuguguggcu guca 24 <210> 33 <211> 44 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 33 cucggcugca ugcuuagugc acucacgcag uauaauuaau aacu 44 <210> 34 <211> 28 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 34 aauuacugucguugacaggacacgagua 28 <210> 35 <211> twenty four <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 35 acucgucuau cuucugcagg cugc 24 <210> 36 <211> twenty four <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 36 uuacgguuuc guccguguug cagc 24 <210> 37 <211> twenty four <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 37 cgaucaucag cacaucuagg uuuc 24 <210> 38 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 38 guccgggugu gaccgaaagg uaagau 26 <210> 39 <211> twenty four <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 39 gguugguuug uuaccuggga aggu 24 <210> 40 <211> twenty four <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 40 cagaucuaca agagaucgaa aguu 24 <210> 41 <211> twenty two <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 41 auuuuaaagu ucguuuagag aa 22 <210> 42 <211> 30 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 42 gucaacgaca guaauuaguu auuaauuaua 30 <210> 43 <211> twenty four <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 43 agauagacga guuacucgug uccu 24 <210> 44 <211> twenty four <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 44 acgaaaccgu aagcagccug caga 24 <210> 45 <211> twenty four <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 45 ugcugaugau cggcugcaac acgg 24 <210> 46 <211> twenty four <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <400> 46 ucacacccgg acgaaaccua gaug 24 <210> 47 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <220> <221> modified_base <222> (22)..(23) <223> m6A <400> 47 auuaaagguu uauaccuucc caggu 25 <210> 48 <211> twenty four <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <220> <221> modified_base <222> (6) (7) <223> m6A <400> 48 aacaaaccaa ccaacuuucg aucu 24 <210> 49 <211> twenty four <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <220> <221> modified_base <222> (6) (7) <223> m6A <400> 49 cuuguagauc uguucucuaa acga 24 <210> 50 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <220> <221> modified_base <222> (18)..(19) <223> BrU <400> 50 auuaaagguu uauaccuucc caggu 25 <210> 51 <211> twenty four <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <220> <221> modified_base <222> (3)..(4) <223> BrU <400> 51 cuuguagauc uguucucuaa acga 24 <210> 52 <211> twenty four <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <220> <221> modified_base <222> (8)..(9) <223> BrU <400> 52 uuacgguuuc guccguguug cagc 24 <210> 53 <211> twenty four <212> RNA <213> Artificial Sequence <220> <223> RNA fragment sequence <220> <221> modified_base <222> (21)..(22) <223> BrU <400> 53 cgaucaucag cacaucuagg uuuc 24
Claims
1. A method for preparing long RNA, comprising the following steps: Synthesis steps: Synthesize a first-strand nucleic acid fragment group and a second-strand nucleic acid fragment group, wherein the first-strand nucleic acid fragment group consists of RNA fragments and the second-strand nucleic acid fragment group consists of at least one of RNA fragments and DNA fragments; The first strand's nucleic acid fragment group includes RNA fragment group a and optional RNA fragment group b; the second strand's nucleic acid fragment group includes nucleic acid fragment group c and optional nucleic acid fragment group d; the RNA fragment group a includes RNA fragment n. i and RNA fragment n i+1 The RNA fragment group b includes RNA fragment x ii and RNA fragment x ii+1 The nucleic acid fragment group c includes nucleic acid fragment m. i The nucleic acid fragment group d includes nucleic acid fragment y ii and nucleic acid fragments y ii+1 At least one of them, i and ii are independent integers selected from 1 or above; Among them, nucleic acid fragment m i The 5' end sequence and RNA fragment n i+1 The 5' end sequence is complementary, and the nucleic acid fragment m i The 3' end sequence and RNA fragment n i The 3' end sequence is complementary; RNA fragment x ii and RNA fragment x ii+1 Partial base complementarity forms a hairpin structure with a 5' extension arm and a 3' extension arm, wherein the 5' extension arm sequence is related to the nucleic acid fragment y. ii The 5' end sequence is complementary to the 3' extension arm sequence and the nucleic acid fragment y ii+1 The 3' end sequence is a complementary sequence; Annealing step: The nucleic acid fragment group of the first strand and the nucleic acid fragment group of the second strand are mixed in the same reaction system and annealed to form a double-stranded assembly precursor; wherein, there is a connection between two adjacent nucleic acid fragments in the first strand and there is a connection between two adjacent nucleic acid fragments in the second strand; the connection between adjacent nucleic acid fragments in the first strand and the connection between adjacent nucleic acid fragments in the second strand are staggered. Ligation step: Connect the linker of the first strand to obtain a double-stranded assembly formed by the complementarity of continuous single-stranded RNA and fragmented single-stranded nucleic acid strands; Denaturation step: The double-stranded assembly is denatured to obtain continuous single-stranded RNA.
2. The method for preparing long RNA according to claim 1, wherein, The method further includes a purification step: purifying the continuous single-stranded RNA from the reaction system.
3. The method for preparing long RNA according to claim 1 or 2, wherein, The hairpin structure also includes a stem region forming a double-chain structure and a stem ring region not forming a double-chain structure, wherein the 5' end and the 3' end of the stem region are respectively connected to the 5' extension arm and the 3' extension arm.
4. The method for preparing long RNA according to claim 3, wherein, The RNA fragment x ii and RNA fragment x ii+1 The connection point between them is located in the stem area.
5. The method for preparing long RNA according to claim 1 or 2, wherein, The RNA fragment n i+1 The 3' end sequence is complementary to or unpaired with the 3' end sequences of other nucleic acid fragments in nucleic acid fragment group c; or, The nucleic acid fragment y ii The 3' end sequence is complementary to or unpaired with the 3' end sequences of other nucleic acid fragments in RNA fragment group a; or, The nucleic acid fragment y ii+1 The 5' end sequence is either complementary to or unpaired with the 5' end sequences of other nucleic acid fragments in RNA fragment group a.
6. The method for preparing long RNA according to claim 5, wherein, The RNA fragment n i+1 The 3' end sequence and nucleic acid fragment m i+1 The 3' end sequence is a complementary sequence, and the nucleic acid fragment m i+1 The 5' end sequence is either complementary to or unpaired with other nucleic acid fragments in the RNA fragment group a.
7. The method for preparing long RNA according to claim 1 or 2, wherein, The length of the continuous single-stranded RNA is 60 nt or more.
8. The method for preparing long RNA according to claim 7, wherein, The length of the continuous single-stranded RNA is 60-1000 nt.
9. The method for preparing long RNA according to claim 1 or 2, wherein, The length of any nucleic acid fragment in the first strand and the second strand is 8-120 nt.
10. The method for preparing long RNA according to claim 9, wherein, The length of any nucleic acid fragment in the first strand and the second strand is 10-80 nt.
11. The method for preparing long RNA according to claim 9, wherein, The length of any nucleic acid fragment in the first strand and the second strand is 15-40 nt.
12. The method for preparing long RNA according to claim 9, wherein, The length of any nucleic acid fragment in the first strand and the second strand is 20-30 nt.
13. The method for preparing long RNA according to claim 1 or 2, wherein, The 5' end sequence of any nucleic acid fragment in the first strand's nucleic acid fragment group and the second strand's nucleic acid fragment group is 4 nt or longer; or, The 3' end sequence of any nucleic acid fragment in the first strand and the second strand is 4 nt or longer.
14. The method for preparing long RNA according to claim 13, wherein, The 5' end sequence of any nucleic acid fragment in the first strand and the second strand is 4-50 nt in length; or, The length of the 3' end sequence of any nucleic acid fragment in the first strand nucleic acid fragment group and the second strand nucleic acid fragment group is 4-50 nt.
15. The method for preparing long RNA according to claim 13, wherein, The 5' end sequence of any nucleic acid fragment in the first strand and the second strand is 6-30 nt in length; or, The length of the 3' end sequence of any nucleic acid fragment in the first strand and the second strand is 6-30 nt.
16. The method for preparing long RNA according to claim 13, wherein, The 5' end sequence of any nucleic acid fragment in the first strand and the second strand is 10-20 nt in length; or, The length of the 3' end sequence of any nucleic acid fragment in the first strand nucleic acid fragment group and the second strand nucleic acid fragment group is 10-20 nt.
17. The method for preparing long RNA according to claim 1 or 2, wherein, Any nucleic acid fragment in the first chain of nucleic acid fragments contains a phosphate group at the 5' end and a hydroxyl group at the 3' end; in the ligation step, the phosphate group and hydroxyl group on both sides of the ligation port are connected to form a phosphodiester bond.
18. The method for preparing long RNA according to claim 17, wherein, Adjacent phosphate groups and hydroxyl groups are linked together to form phosphodiester bonds by enzyme linkage or chemical linkage.
19. The method for preparing long RNA according to claim 1 or 2, wherein, One or more positions of any nucleic acid fragment in the first strand and the second strand contain modified bases, and the bases immediately adjacent to the linker are unmodified bases.
20. The method for preparing long RNA according to claim 19, wherein, The modification is selected from m 6 A、Ψ、m 1 A、m 5 A, ms 2 i 6 A、i 6 A、m 3 C, m 5 C、ac 4 C, m 7 G、m2、2G、m 2 G, m 1 G, Q, m 5 U、mcm 5 U、ncm 5 U、ncm 5 Um, D, mcm 5 s 2 U, Inosine (I), hm 5 C, s 4 U、s 2 U, azobenzene, Cm, Um, Gm, t 6 A, yW, ms 2 t 6 A or its derivatives.
21. The method for preparing long RNA according to claim 1 or 2, wherein, The nucleic acid fragments in the first strand and the second strand contain modified ribose at one or more locations, and the ribose immediately adjacent to the junction is unmodified ribose.
22. The method for preparing long RNA according to claim 21, wherein, The modification is selected from LNA, 2'-OMe, 3'-OMeU, vmoe, 2'-F or 2'-OBn (2'-O-benzyl group) or derivatives thereof.
23. The method for preparing long RNA according to claim 1 or 2, wherein, The nucleic acid fragments in the first chain contain modified phosphodiester bonds at one or more positions, and the phosphodiester bonds immediately adjacent to the linker are unmodified phosphodiester bonds. Alternatively, one or more positions of any nucleic acid fragment in the second chain's nucleic acid fragment group contain modified phosphodiester bonds, and the phosphodiester bonds immediately adjacent to the linker are unmodified phosphodiester bonds.
24. The method for preparing long RNA according to claim 23, wherein, The modification is selected from phosphorothioate (PS), nucleotide triphosphate (NTPαS), or derivatives thereof.
25. The method for preparing long RNA according to claim 1 or 2, wherein, In the annealing step, the nucleic acid fragment group of the first strand and the nucleic acid fragment group of the second strand are incubated and then cooled to form a double-stranded assembly precursor.
26. The method for preparing long RNA according to claim 25, wherein, The incubation temperature is any temperature between 0 and 100°C.
27. The method for preparing long RNA according to claim 25, wherein, The incubation temperature is any temperature between 10-85℃.
28. The method for preparing long RNA according to claim 25, wherein, The incubation temperature is any temperature within the range of 20-65℃.
29. The method for preparing long RNA according to claim 1 or 2, wherein, In the annealing step, the nucleic acid fragment group of the first chain and the nucleic acid fragment group of the second chain are dissolved in the same solvent to obtain the reaction system.
30. The method for preparing long RNA according to claim 29, wherein, The pH of the reaction system is 3-11.
31. The method for preparing long RNA according to claim 30, wherein, The pH of the reaction system is 4-10.
32. The method for preparing long RNA according to claim 30, wherein, The pH of the reaction system is 5-9.
33. The method for preparing long RNA according to claim 30, wherein, The pH of the reaction system is 6-8.
34. The method for preparing long RNA according to claim 29, wherein, In the reaction system, the molar ratio of any two nucleic acid fragments in the first chain nucleic acid fragment group and the second chain nucleic acid fragment group is 1:(0.1-10).
35. The method for preparing long RNA according to claim 34, wherein, In the reaction system, the molar ratio of any two nucleic acid fragments in the first chain nucleic acid fragment group and the second chain nucleic acid fragment group is 1:(0.5-2).
36. The method for preparing long RNA according to claim 34, wherein, In the reaction system, the molar ratio of any two nucleic acid fragments in the first chain nucleic acid fragment group and the second chain nucleic acid fragment group is 1:1.
Citation Information
Patent Citations
Method for large-scale synthesis of long-chain nucleic acid molecules
CN102876658A
New production process for large-scale synthesis of long-chain RNA drugs
CN103993002A
Method for large-scale synthesis of long-chain RNA and method for fixed-point modification of long-chain RNA
CN111235198A
Method for producing single-strand RNA
CN111971396A