Gene editing system and its application in constructing pig nuclear transplant donor cells with double gene mutations in nevoid basal cell carcinoma syndrome

Abstract

The present invention discloses a gene editing system and its application in constructing a double gene joint mutation nevus-like basal cell carcinoma syndrome model pig nuclear transplant donor cells. The present invention provides the application of PTCH1-E6g2 shown in SEQ ID NO: 28, PTCH1-E7g1 shown in SEQ ID NO: 29, TP53-E4g1 shown in SEQ ID NO: 30, TP53-E4g4 shown in SEQ ID NO: 31 and NCN protein in preparing a kit. The present invention also provides a method for preparing recombinant cells, wherein PTCH1-E6g2, PTCH1-E7g1, TP53-E4g1, TP53-E4g4 and NCN protein are co-transfected into pig cells to obtain recombinant cells in which PTCH1 gene and TP53 gene are mutated. The purpose of the kit is to prepare recombinant cells; prepare a nevus-like basal cell carcinoma syndrome model pig; prepare a nevus-like basal cell carcinoma syndrome cell model or tissue model or organ model. The present invention has great application value for the research and development of nevus-like basal cell carcinoma syndrome drugs and revealing the pathogenesis of the disease.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, specifically to the field of gene editing technology, and more specifically to a gene editing system and its application in constructing a double gene combined mutation nevus basal cell carcinoma syndrome model pig nuclear transplantation donor cells. Background Art

[0002] Nevoid basal cell carcinoma syndrome (NBCCS), also known as basal cell nevus syndrome (BCNS) or Gorlin syndrome, is an autosomal dominant neurocutaneous disease characterized by the development of basal cell carcinoma (BCC) from a young age, accompanied by other significant clinical features, including odontogenic keratocystic tumors and dyskeratotic palmar and plantar pitting, and a series of skeletal, neural and other systemic developmental abnormalities are also often present. BCC is a common skin cancer that originates from the basal layer of the epidermis and its appendages. It is currently the most common skin cancer in humans. It grows slowly and is locally destructive, but has a low degree of malignancy and rarely metastasizes. Basal cell carcinoma is particularly common in whites; it is very rare in blacks and other dark-skinned people, indicating that ethnicity and genetic background contribute to these differences.

[0003] NBCCS syndrome is mainly caused by mutations in the Patched 1 (PTCH1) gene. Human PTCH1 is a gene of the same family as Drosophila Patched 1, and its mutations include frameshift, missense or nonsense mutations. PTCH1 is a key molecule in the hedgehog (Hh) signaling pathway, which is a highly conserved pathway in vertebrates and consists of Hh, PTCH1, Smoothened (Smo) and GLI proteins. PTCH1 encodes a transmembrane receptor protein of the Hh protein family. The Hh signaling pathway is activated by the binding of Hh protein to the membrane receptor PTCH1. In the absence of Hh, PTCH1 can inactivate the Hh signaling pathway by inhibiting the downstream G protein-coupled receptor Smo. The binding of Hh to PTCH1 relieves the inhibition of Smo, thereby turning on the Hh signaling pathway. Mutations in the PTCH1 gene lead to constitutive and sustained activation of the Hh signaling pathway. Given that the Hh signaling pathway regulates cell growth and development, disordered and sustained activation of this pathway can lead not only to developmental abnormalities but also to the occurrence of a variety of tumors, the most notable of which are tumors in NBCCS.

[0004] In addition to the Hh pathway, TP53 is also often involved in the pathogenesis of NBCCS. The TP53 gene is a tumor suppressor gene that changes the expression of downstream target genes through phosphorylation, regulates cell cycle arrest and activates programmed cell death, maintains the integrity of the genome, and plays an important role in inhibiting tumor formation. TP53 gene inactivation mutations are early changes in tumor formation and have been detected in 50% of human tumors. In a reported basal cell carcinoma mutation gene screening, about 61% detected TP53 mutations.

[0005] At present, the treatment of NBCCS still needs further exploration, and its pathogenic mechanism is still unclear, and it needs to be explored and verified in animal models. The commonly used animal model is the mouse model. However, mice are very different from humans in terms of body shape, organ size, physiology, pathology, etc., and cannot truly simulate the normal physiological and pathological state of humans. As a large animal, pigs are similar in size and physiological functions to humans, easy to breed and raise on a large scale, and have lower requirements in ethics and animal protection, making them ideal human disease model animals.

[0006] Gene editing is a biotechnology that has made significant progress in recent years. It includes gene editing based on homologous recombination to nuclease-based ZFN, TALEN, CRISPR / Cas and other editing technologies. Among them, CRISPR / Cas technology is the most advanced gene editing technology. At present, gene editing technology is increasingly being used in the preparation of animal models. Summary of the invention

[0007] The purpose of the present invention is to provide a gene editing system and its application in constructing a double gene combined mutation nevoid basal cell carcinoma syndrome model pig nuclear transplantation donor cells.

[0008] The present invention provides the use of PTCH1-E6g2, PTCH1-E7g1, TP53-E4g1, TP53-E4g4 and NCN proteins in preparing a kit.

[0009] The present invention also provides the use of PTCH1-E6g2, PTCH1-E7g1, TP53-E4g1, TP53-E4g4 and PRONCN proteins in preparing a kit.

[0010] The present invention also provides the use of PTCH1-E6g2, PTCH1-E7g1, TP53-E4g1, TP53-E4g4 and specific plasmid in preparing a kit.

[0011] The invention provides a kit, comprising PTCH1-E6g2, PTCH1-E7g1, TP53-E4g1, TP53-E4g4 and NCN protein.

[0012] The invention provides a kit, comprising PTCH1-E6g2, PTCH1-E7g1, TP53-E4g1, TP53-E4g4 and PRONCN protein.

[0013] The invention provides a kit, comprising PTCH1-E6g2, PTCH1-E7g1, TP53-E4g1, TP53-E4g4 and a specific plasmid.

[0014] Any of the above kits further comprises pig cells.

[0015] The use of any of the above kits is as follows (a) or (b) or (c): (a) preparing recombinant cells; (b) preparing a pig model of nevus basal cell carcinoma syndrome; (c) preparing a nevus basal cell carcinoma syndrome cell model or a nevus basal cell carcinoma syndrome tissue model or a nevus basal cell carcinoma syndrome organ model.

[0016] The present invention also provides a method for preparing recombinant cells, comprising the following steps: co-transfecting PTCH1-E6g2, PTCH1-E7g1, TP53-E4g1, TP53-E4g4 and NCN proteins into pig cells to obtain recombinant cells.

[0017] The co-transfection specifically adopts the method of electroporation transfection.

[0018] The specific parameters for electroporation transfection can be set as: 1450V, 10ms, 3pulse.

[0019] The co-transfection can be specifically carried out using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a NeonTM transfection system electroporator.

[0020] The ratios of PTCH1-E6g2, PTCH1-E7g1, TP53-E4g1, TP53-E4g4 and NCN proteins are: 0.4-0.6μg PTCH1-E6g2: 0.4-0.6μg PTCH1-E7g1: 0.4-0.6μg TP53-E4g1: 0.4-0.6μg TP53-E4g4: 3-5μg NCN protein.

[0021] The ratios of PTCH1-E6g2, PTCH1-E7g1, TP53-E4g1, TP53-E4g4 and NCN proteins are: 0.5μg PTCH1-E6g2: 0.5μg PTCH1-E7g1: 0.5μg TP53-E4g1: 0.5μg TP53-E4g4: 4μg NCN protein.

[0022] The ratios of pig cells, PTCH1-E6g2, PTCH1-E7g1, TP53-E4g1, TP53-E4g4 and NCN protein are as follows: 100,000 pig cells: 0.4-0.6μg PTCH1-E6g2: 0.4-0.6μg PTCH1-E7g1: 0.4-0.6μg TP53-E4g1: 0.4-0.6μg TP53-E4g4: 3-5μg NCN protein.

[0023] The ratios of pig cells, PTCH1-E6g2, PTCH1-E7g1, TP53-E4g1, TP53-E4g4 and NCN protein are as follows: 100,000 pig cells: 0.5μg PTCH1-E6g2: 0.5μg PTCH1-E7g1: 0.5μg TP53-E4g1: 0.5μg TP53-E4g4: 4μg NCN protein.

[0024] Any of the above PTCH1-E6g2 is an sgRNA, and its target sequence binding region is shown in nucleotides 3 to 22 in SEQ ID NO: 28.

[0025] Specifically, the PTCH1-E6g2 is shown in SEQ ID NO:28.

[0026] Specifically, the PTCH1-E6g2 is shown in SEQ ID NO:11.

[0027] Any of the above PTCH1-E7g1 is an sgRNA, and its target sequence binding region is shown in nucleotides 3 to 22 in SEQ ID NO: 29.

[0028] Specifically, the PTCH1-E7g1 is shown in SEQ ID NO:29.

[0029] Specifically, the PTCH1-E7g1 is shown in SEQ ID NO:14.

[0030] Any of the above TP53-E4g1 is an sgRNA, and its target sequence binding region is shown in nucleotides 3 to 22 in SEQ ID NO: 30.

[0031] Specifically, the TP53-E4g1 is shown in SEQ ID NO: 30.

[0032] Specifically, the TP53-E4g1 is shown in SEQ ID NO: 20.

[0033] Any of the above TP53-E4g4 is an sgRNA, and its target sequence binding region is shown in nucleotides 3-22 in SEQ ID NO: 31.

[0034] Specifically, the TP53-E4g4 is shown in SEQ ID NO: 31.

[0035] Specifically, the TP53-E4g4 is shown in SEQ ID NO: 23.

[0036] Any of the above-mentioned NCN proteins is a Cas9 protein or a fusion protein with a Cas9 protein.

[0037] Specifically, the NCN protein is shown in SEQ ID NO:3.

[0038] Any of the above pig cells is a pig fibroblast.

[0039] Any of the above pig cells is a primary pig fibroblast.

[0040] Any of the above pig cells is a primary pig fibroblast obtained from a newborn pig.

[0041] The preparation method of the NCN protein comprises the following steps:

[0042] (1) Introducing plasmid pKG-GE4 into Escherichia coli BL21 (DE3) to obtain recombinant bacteria;

[0043] (2) culturing the recombinant bacteria in a liquid medium at 30° C., then adding IPTG and inducing the culture at 25° C., and then collecting the bacteria;

[0044] (3) crushing the collected bacterial cells and collecting the crude protein solution;

[0045] (4) purifying the fusion protein with the His6 tag from the crude protein solution using affinity chromatography;

[0046] (5) using enterokinase with a His6 tag to digest the fusion protein with a His6 tag, and then using Ni-NTA resin to remove the protein with the His6 tag to obtain a purified NCN protein;

[0047] Plasmid pKG-GE4 contains the fusion gene shown by nucleotides 5209 to 9852 in SEQ ID NO:1.

[0048] The preparation method of the NCN protein specifically comprises the following steps:

[0049] (1) The plasmid pKG-GE4 was introduced into Escherichia coli BL21 (DE3) to obtain recombinant bacteria.

[0050] (2) inoculating the recombinant bacteria obtained in step (1) into a liquid LB medium containing ampicillin and culturing with shaking;

[0051] (3) The bacterial solution obtained in step (2) was inoculated into liquid LB medium and cultured at 30°C and 230 rpm until OD 600nm value = 1.0, then add IPTG to make its concentration in the system 0.5 mM, then shake culture at 25°C and 230 rpm for 12 hours, and then collect the bacteria by centrifugation;

[0052] (4) Take the bacterial cells obtained in step (3) and wash them with PBS buffer;

[0053] (5) taking the bacterial cells obtained in step (4), adding a crude extraction buffer to suspend the bacterial cells, and then crushing the bacterial cells, and then collecting the supernatant by centrifugation, filtering with a 0.22 μm pore size filter membrane, and collecting the filtrate;

[0054] (6) Purifying the fusion protein with the His6 tag (the fusion protein shown in SEQ ID NO: 2) from the filtrate obtained in step (5) by affinity chromatography;

[0055] (7) taking the column solution collected in step (6), concentrating it using an ultrafiltration tube, and then diluting it with 25 mM Tris-HCl (pH 8.0);

[0056] (8) adding recombinant bovine enterokinase with a His6 tag to the solution obtained in step (7) and performing enzyme digestion;

[0057] (9) mixing the solution obtained in step (8) with Ni-NTA resin, incubating, and then centrifuging to collect the supernatant;

[0058] (10) The supernatant obtained in step (9) is concentrated using an ultrafiltration tube and then added to the enzyme storage solution to obtain the NCN protein solution.

[0059] The specific method of purifying the fusion protein with the His6 tag from the filtrate obtained in step (5) by affinity chromatography is as follows:

[0060] First, use 5 column volumes of equilibration solution to equilibrate the Ni-NTA agarose column (flow rate is 1 ml / min); then load 50 ml of the filtrate obtained in step (5) (flow rate is 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration solution (flow rate is 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate is 1 ml / min) to remove impurities; then elute with 10 column volumes of eluent at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).

[0061] Any of the above PRONCN proteins includes the following elements from upstream to downstream: a signal peptide, a molecular chaperone protein, a protein tag, a protease cleavage site, a nuclear localization signal, a Cas9 protein, and a nuclear localization signal.

[0062] The function of the signal peptide is to promote protein secretion expression. The signal peptide can be selected from the Escherichia coli alkaline phosphatase (phoA) signal peptide, the Staphylococcus aureus protein A signal peptide, the Escherichia coli outer membrane protein (ompa) signal peptide or any other prokaryotic gene signal peptide, preferably an alkaline phosphatase signal peptide (phoA signal peptide). The alkaline phosphatase signal peptide is used to guide the secretion expression of the target protein into the bacterial periplasmic cavity, thereby separating it from the bacterial intracellular protein, and the target protein secreted into the bacterial periplasmic cavity is soluble and can be cleaved by the signal peptidase in the bacterial periplasmic cavity.

[0063] The function of the molecular chaperone protein is to increase the solubility of the protein. The molecular chaperone can be any protein that helps to form disulfide bonds, preferably thioredoxin (TrxA protein). Thioredoxin can act as a molecular chaperone to help the co-expressed target protein (such as Cas9 protein) form disulfide bonds, improve the stability of the protein, the correctness of folding, and increase the solubility and activity of the target protein.

[0064] The function of the protein tag is to purify the protein. The tag may be a His tag (His-Tag, His6 protein tag), a GST tag, a Flag tag, an HA tag, a c-Myc tag or any other protein tag, more preferably a His tag. The His tag can bind to a Ni column, and the target protein can be purified by one-step Ni column affinity chromatography, which can greatly simplify the purification process of the target protein.

[0065] The function of the protease cleavage site is to be used to cut off the non-functional segment after purification to release the natural form of Cas9 protein. The protease can be selected from enterokinase, factor Xa, thrombin, TEV protease, HRV 3C protease, WELQut protease or any other endoprotease, and enterokinase is further preferred. EK is an enterokinase cleavage site, which is convenient for using enterokinase to remove the fused TrxA-His segment to obtain a natural form of Cas9 protein. After the commercial enterokinase with a His tag is used to cut the fusion protein, the TrxA-His segment and the enterokinase with a His tag can be removed by one affinity chromatography to obtain a natural form of Cas9 protein, avoiding damage and loss to the target protein by multiple purification dialysis.

[0066] The nuclear localization signal can be any nuclear localization signal, preferably an SV40 nuclear localization signal and / or a nucleoplasmin nuclear localization signal. NLS is a nuclear localization signal, and an NLS site is designed at the N-terminus and the C-terminus of Cas9, respectively, so that Cas9 can more effectively enter the cell nucleus for gene editing.

[0067] The Cas9 protein may be saCas9 or spCas9, preferably spCas9 protein.

[0068] The PRONCN protein is specifically shown in SEQ ID NO:2.

[0069] Any of the above-mentioned specific plasmids includes the following elements from upstream to downstream: a promoter, an operator, a ribosome binding site, a gene encoding PRONCN protein, and a terminator.

[0070] The promoter may specifically be a T7 promoter, which is a strong promoter for prokaryotic expression and can efficiently drive the expression of exogenous genes.

[0071] The operon may specifically be the Lac operon. The Lac operon is a regulatory element for lactose-induced expression. After the bacteria have grown to a certain number, IPTG can be used to induce the expression of the target protein at low temperature, which can avoid the effect of premature expression of the target protein on the growth of the host bacteria. Inducing expression at low temperature also significantly improves the solubility of the expressed target protein.

[0072] The ribosome binding site is a ribosome binding site during protein translation and is necessary for protein translation.

[0073] The terminator may specifically be a T7 terminator. The T7 terminator can effectively terminate gene transcription at the end of the target gene to prevent other downstream sequences other than the target gene from being transcribed and translated.

[0074] For the codons of the spCas9 protein, the present application optimizes the codons to make them fully adapt to the codon preference of the Escherichia coli high-efficiency expression strain E. coli BL21 (DE3) selected in the present application, thereby improving the expression level of the Cas9 protein.

[0075] The T7 promoter is shown in nucleotides 5121-5139 of SEQ ID NO:1.

[0076] The lac operon is shown in nucleotides 5140-5164 of SEQ ID NO:1.

[0077] The ribosome binding site is shown in nucleotides 5178-5201 of SEQ ID NO:1.

[0078] The coding sequence of the alkaline phosphatase signal peptide is shown in nucleotides 5209-5271 of SEQ ID NO:1.

[0079] The coding sequence of TrxA protein is shown in nucleotides 5272-5598 in SEQ ID NO:1.

[0080] The coding sequence of His-Tag is shown in nucleotides 5620-5637 in SEQ ID NO:1.

[0081] The coding sequence of the enterokinase cleavage site is shown in nucleotides 5638-5652 in SEQ ID NO:1.

[0082] The coding sequence of the nuclear localization signal is shown in nucleotides 5656-5670 in SEQ ID NO:1.

[0083] The coding sequence of the spCas9 protein is shown in nucleotides 5701-9801 in SEQ ID NO:1.

[0084] The coding sequence of the nuclear localization signal is shown in nucleotides 9802-9849 of SEQ ID NO:1.

[0085] The T7 terminator is shown as nucleotides 9902-9949 in SEQ ID NO:1.

[0086] Specifically, the specific plasmid is plasmid pKG-GE4.

[0087] Plasmid pKG-GE4 contains the DNA molecule represented by nucleotides 5121 to 9949 in SEQ ID NO:1.

[0088] Specifically, any of the above plasmids pKG-GE4 is shown as SEQ ID NO:1.

[0089] The present invention also protects the recombinant cells prepared by any of the above methods.

[0090] The recombinant cell is a recombinant cell in which the PTCH1 gene and the TP53 gene are mutated.

[0091] The recombinant cell may specifically be a cell that satisfies the following conditions: heterozygous knockout of PTCH1 gene (i.e., the genotype based on PTCH1 gene is heterozygous) and homozygous knockout of TP53 gene (i.e., the genotype based on TP53 gene is biallelic different mutation type or biallelic identical mutation type).

[0092] The recombinant cell may specifically be a single cell clone numbered 10, 17, 19, 22, 28, 35, 41, 45 or 46 in Table 1.

[0093] The present invention also protects the use of the recombinant cell in preparing a nevus-like basal cell carcinoma syndrome model pig.

[0094] The recombinant cells are used as nuclear transplant donor cells for somatic cell cloning to obtain cloned pigs, which are nevus-like basal cell carcinoma syndrome model pigs.

[0095] The present invention also protects the pig tissue of the model pig prepared by using the recombinant cells, namely the nevoid basal cell carcinoma syndrome tissue model.

[0096] The present invention also protects the pig organ of the model pig prepared by using the recombinant cell, namely the nevoid basal cell carcinoma syndrome organ model.

[0097] The present invention also protects pig cells of a model pig prepared by using the recombinant cells, namely a nevus-like basal cell carcinoma syndrome cell model.

[0098] The present invention also protects the use of the recombinant cell, the nevus basal cell carcinoma syndrome tissue model, the nevus basal cell carcinoma syndrome organ model, the nevus basal cell carcinoma syndrome cell model or the nevus basal cell carcinoma syndrome model pig, which is as follows (d1) or (d2) or (d3) or (d4):

[0099] (d1) Screening for drugs to treat nevoid basal cell carcinoma syndrome;

[0100] (d2) To evaluate the efficacy of drugs for nevoid basal cell carcinoma syndrome;

[0101] (d3) Evaluate the efficacy of gene therapy and / or cell therapy for nevoid basal cell carcinoma syndrome;

[0102] (d4) To study the pathogenesis of nevoid basal cell carcinoma syndrome.

[0103] Any of the above-mentioned pigs can specifically be Congjiang Xiang pigs.

[0104] Any of the above nevoid basal cell carcinoma syndromes is caused by PTCH1 gene mutation and TP53 gene mutation.

[0105] Pig PTCH1 gene information: Encodes a receptor protein (Patched 1) that constitutes the Hedgehog signaling pathway; located on chromosome 10; Gene ID is 100627504, Sus scrofa.

[0106] The amino acid sequence encoded by the porcine PTCH1 gene is shown in SEQ ID NO:8.

[0107] The porcine PTCH1 gene has a DNA segment shown in SEQ ID NO:9.

[0108] Pig TP53 gene information: encoding P53 protein; located on chromosome 12; GeneID is 397276, Sus scrofa.

[0109] The amino acid sequence encoded by the porcine TP53 gene is shown in SEQ ID NO: 18.

[0110] The porcine TP53 gene has the DNA segment shown in SEQ ID NO:19.

[0111] Any of the above mutations is a deletion and / or insertion and / or substitution of one or more nucleotides.

[0112] Any of the above mutations is a deletion of one or more nucleotides.

[0113] Any of the above mutations is an insertion of one or more nucleotides.

[0114] Any of the above mutations is a deletion or insertion of one or more nucleotides.

[0115] Compared with the prior art, the present invention has at least the following beneficial effects:

[0116] (1) The research object of the present invention (pig) has better applicability than other animals (rat, mouse, and primate).

[0117] Rodents such as mice and rats are very different from humans in terms of body shape, organ size, physiology, and pathology, and cannot truly simulate the normal physiological and pathological conditions of humans. Studies have shown that more than 95% of drugs that have been proven effective in mice and rats are ineffective in human clinical trials. As far as large animals are concerned, primates are the animals that are most closely related to humans, but they are small in size, mature late (mating begins at 6-7 years old), and are single-birth animals. The population expansion rate is extremely slow, and the cost of raising them is very high. In addition, primate cloning is inefficient, difficult, and costly.

[0118] As a model animal, pigs do not have the above disadvantages. They are the animals that are most closely related to humans except primates. Their body shape, weight, organ size, etc. are similar to humans. They are very similar to humans in anatomy, physiology, immunology, nutritional metabolism, and disease pathogenesis. At the same time, pigs mature early (4-6 months), have high fertility, and can have many offspring per litter. A large group can be formed within 2-3 years. In addition, pig cloning technology is very mature, and the cost of cloning and raising is much lower than that of primates. Therefore, pigs are very suitable animals as models of human diseases.

[0119] (2) The vector constructed by the present invention uses a strong promoter T7-lac capable of efficiently expressing the target protein to express the target protein, and uses the signal peptide of bacterial periplasmic protein alkaline phosphatase (phoA) to guide the secretion and expression of the target protein into the bacterial periplasmic cavity, thereby separating it from the bacterial intracellular protein, and the target protein secreted into the bacterial periplasmic cavity is soluble. At the same time, the thioredoxin TrxA and Cas9 protein fusion expression are also used. TrxA can help the co-expressed target protein to form a disulfide bond, improve the stability of the protein, the correctness of folding, and increase the solubility and activity of the target protein. In order to facilitate the purification of the target protein, a His tag is designed, and the target protein can be purified by one-step Ni column affinity chromatography, which greatly simplifies the purification process of the target protein. At the same time, an enterokinase cleavage site is designed after the His tag to facilitate the excision of the fused TrxA-His polypeptide fragment to obtain a natural form of the Cas9 protein. After the fusion protein is cleaved by enterokinase with a His tag, the TrxA-His polypeptide fragment and the enterokinase with a His tag can be removed by an affinity chromatography to obtain a natural form of Cas9 protein, avoiding the damage and loss of the target protein by multiple purification dialysis. At the same time, the present invention also designs an NLS site at the N-terminus and C-terminus of Cas9, so that Cas9 can more effectively enter the nucleus for gene editing. In addition, the present invention selects E.coli BL21 (DE3) strain as the target protein expression strain, which can efficiently express exogenous genes cloned in an expression vector (such as pET-32a) containing a bacteriophage T7 promoter. At the same time, for the codons of the Cas9 protein, the present invention performs codon optimization to fully adapt to the codon preference of the expression strain, thereby improving the expression level of the target protein. In addition, after the bacteria grow to a certain number, the present invention uses IPTG to induce the expression of the target protein at low temperature, which can avoid the influence of premature expression of the target protein on the growth of the host bacteria, and the induced expression at low temperature also significantly improves the solubility of the expressed target protein. After the above-mentioned optimization designs and experimental implementation, the activity of the obtained Cas9 protein was significantly improved compared with the commercial Cas9 protein.

[0120] (3) The Cas9 high-efficiency protein constructed and expressed by the present invention was combined with in vitro transcribed gRNA for gene editing, and the optimal dosage ratio of Cas9 and gRNA was optimized. Finally, the rate of simultaneous dual-gene editing of single-cell clones was as high as 77.1%, which is much higher than the conventional gene editing efficiency (10-30%).

[0121] (4) Using the target gene knockout single cell clone obtained by the present invention to carry out somatic cell nuclear transplantation animal cloning can directly obtain cloned pigs with target gene knockout, and the gene mutation can be stably inherited.

[0122] The method of embryo transplantation after microinjection of gene editing materials into fertilized eggs used in mouse model making is not suitable for large animal (such as pig) model making with a long gestation period because of its low probability of directly obtaining offspring with gene mutations, and requires hybrid breeding of offspring. Therefore, the present invention adopts a method of in vitro editing of primary cells with high technical difficulty and challenge, and cutting and screening of positive edited single cell clones with Cas9 protein and double gRNA, and then directly obtains the corresponding disease model pigs through somatic cell nuclear transplantation animal cloning technology in the later stage, which can greatly shorten the model pig production cycle and save manpower, material resources and financial resources.

[0123] The present invention uses CRISPR / Cas9 technology in combination with dual gRNA editing to knock out the PTCH1 gene and TP53 gene, simulates the natural genetic characteristics of nevus basal cell carcinoma syndrome, and obtains a single-cell clone of double gene knockout, which lays the foundation for the later cultivation of nevus basal cell carcinoma syndrome model pigs through somatic cell nuclear transplantation animal cloning technology. The present invention will help to study and reveal the pathogenesis of nevus basal cell carcinoma syndrome, and can also be used for drug screening, drug efficacy evaluation, gene therapy and cell therapy research, which can provide effective experimental data for further clinical applications, and then provide a powerful experimental means for the successful treatment of human nevus basal cell carcinoma syndrome. The present invention has great application value for the research and development of nevus basal cell carcinoma syndrome drugs and revealing the pathogenesis of the disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0124] Figure 1 Schematic diagram of the structure of plasmid pET-32a.

[0125] Figure 2 Schematic diagram of the structure of plasmid pKG-GE4.

[0126] Figure 3 This is the electrophoresis diagram of the optimized dosage ratio of gRNA and NCN protein in Example 1.

[0127] Figure 4 This is an electrophoresis diagram comparing the gene editing efficiency of NCN protein and commercial Cas9 protein in Example 1.

[0128] Figure 5 This is the electrophoresis diagram of PCR amplification using different primer pairs for the PTCH1 gene using the genome extracted from the ear tissue of the pig named 1 as a template in Example 2.

[0129] Figure 6 This is the electrophoresis diagram of PCR amplification performed using the genomic DNA of 18 pigs as templates and the primer pair consisting of PTCH1-i5-JDF60 and PTCH1-i7-JDR953 in Example 2.

[0130] Figure 7 This is an electrophoresis diagram comparing the editing efficiency of different target sites of the PTCH1 gene in Example 2.

[0131] Figure 8 This is the electrophoresis diagram of PCR amplification using different primer pairs for the TP53 gene using the genome extracted from the ear tissue of the pig named 1 as a template in Example 3.

[0132] Fig. 9 This is the electrophoresis diagram of PCR amplification performed using the genomic DNA of 18 pigs as templates and the primer pair consisting of TP53-GT-nF167 and TP53-GT-nR570 in Example 3.

[0133] Fig.10 This is an electrophoresis diagram comparing the editing efficiency of different target sites of the TP53 gene in Example 3.

[0134] Fig.11 This is the comparison result of the forward sequencing of the PTCH1 gene of the single cell clone numbered 17 and the wild-type sequence.

[0135] Fig.12 This is the comparison result of reverse sequencing of TP53 gene of single cell clone No. 17 and the wild-type sequence. DETAILED DESCRIPTION

[0136] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0137] The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out in accordance with the techniques or conditions described in the literature in the art or in accordance with the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources. The recombinant plasmids constructed in the examples have all been sequenced and verified. The commercial Cas9-A protein is a commercially available Cas9 protein with good effects. The commercial Cas9-B protein is a commercially available Cas9 protein with good effects. Complete culture medium (% is volume ratio): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicillin-Streptomycin (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: 37°C, 5% CO2, 5% O2 constant temperature incubator.

[0138] The porcine primary fibroblasts used in the examples were all prepared from the ear tissue of the newly born Congjiang Xiang pig. Method for preparing porcine primary fibroblasts: ① Take 0.5g of pig ear tissue, remove hair and bone tissue, then soak it in 75% alcohol for 30-40s, then wash it 5 times with PBS buffer containing 5% (volume ratio) Penicillin-Streptomycin (Gibco), and then wash it once with PBS buffer; ② Cut the tissue into pieces with scissors, use 5mL 0.1% collagenase solution (Sigma), digest it at 37℃ for 1h, then centrifuge it at 500g for 5min, and discard the supernatant; ③ Resuspend the precipitate with 1mL complete culture medium, and then spread it into a cell culture dish with a diameter of 10cm containing 10mL complete culture medium and sealed with 0.2% gelatin (VWR), and culture it until the cells cover the bottom of the dish by about 60%; ④ After completing step ③, use trypsin to digest and collect the cells, and then resuspend them in complete culture medium. Used for subsequent electroporation experiments.

[0139] Plasmid pKG-GE3 is a circular plasmid, as shown in SEQ ID NO: 2 in patent application 202010084343.6. In NO: 2, nucleotides 395-680 constitute the CMV enhancer, nucleotides 682-890 constitute the EF1a promoter, nucleotides 986-1006 encode a nuclear localization signal (NLS), nucleotides 1016-1036 encode a nuclear localization signal (NLS), nucleotides 1037-5161 encode the Cas9 protein, nucleotides 5162-5209 encode a nuclear localization signal (NLS), nucleotides 5219-5266 encode a nuclear localization signal (NLS), and nucleotides 5276-5332 encode a self-cleaving polypeptide P2A (the amino acid sequence of the self-cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP", and the cleavage position where self-cleavage occurs is The nucleotides at positions 5333-6046 encode the EGFP protein, the nucleotides at positions 6056-6109 encode the self-cleaving polypeptide T2A (the amino acid sequence of the self-cleaving polypeptide T2A is "EGRGSLLTCGDVEENPGP", and the self-cleavage cleavage position is between the first amino acid residue and the second amino acid residue starting from the C-terminus), the nucleotides at positions 6110-6703 encode the Puromycin protein (abbreviated as Puro protein), the nucleotides at positions 6722-7310 constitute the WPRE sequence element, the nucleotides at positions 7382-7615 constitute the 3'LTR sequence element, and the nucleotides at positions 7647-7871 constitute the bGH poly (A) signal sequence element. In SEQ ID NO: 2 in patent application 202010084343.6, the nucleotides at positions 911-6706 form a fusion gene to express a fusion protein. Due to the presence of the self-cleaving polypeptide P2A and the self-cleaving polypeptide T2A, the fusion protein spontaneously forms the following three proteins: a protein with Cas9 protein, a protein with EGFP protein, and a protein with Puro protein.

[0140] The pKG-U6gRNA vector, i.e., the plasmid pKG-U6gRNA, is a circular plasmid, as shown in SEQ ID NO: 3 in patent application 202010084343.6. In SEQ ID NO: 3 in patent application 202010084343.6, nucleotides 2280-2539 constitute the hU6 promoter, and nucleotides 2558-2637 are used to transcribe to form the gRNA backbone. When used, a DNA molecule of about 20 bp (used to transcribe the target sequence binding region of the gRNA) is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in the cell to obtain the gRNA.

[0141] Example 1. Preparation, purification and properties of NCN protein

[0142] 1. Construction of prokaryotic Cas9 efficient expression vector

[0143] The schematic diagram of the structure of plasmid pET-32a is shown in Figure 1 .

[0144] Plasmid pKG-GE4 was obtained by transforming plasmid pET-32a. Plasmid pET32a-T7lac-phoA:SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (referred to as plasmid pKG-GE4), as shown in SEQ ID NO: 1, is a circular plasmid, and the structural schematic diagram is shown in Figure 2 .

[0145] In SEQ ID NO: 1, nucleotides 5121-5139 constitute a T7 promoter, nucleotides 5140-5164 encode a Lac operator, nucleotides 5178-5201 constitute a ribosome binding site (RBS), nucleotides 5209-5271 encode an alkaline phosphatase signal peptide (phoA signal peptide), nucleotides 5272-5598 encode a TrxA protein, nucleotides 5620-5637 encode a His-Tag (also known as a His6 tag), nucleotides 5638-5652 encode an enterokinase cleavage site (EK cleavage site), nucleotides 5656-5670 encode a nuclear localization signal, nucleotides 5701-9801 encode a spCas9 protein, nucleotides 9802-9849 encode a nuclear localization signal, and nucleotides 9902-9949 constitute a T7 terminator. The nucleotide encoding the spCas9 protein has been codon-optimized for the Escherichia coli BL21(DE3) strain.

[0146] The main modifications of plasmid pKG-GE4 are as follows: ① The coding region of TrxA protein is retained. TrxA protein can help the expressed target protein to form disulfide bonds and increase the solubility and activity of the target protein; the coding sequence of alkaline phosphatase signal peptide is added before the coding region of TrxA protein. The alkaline phosphatase signal peptide can guide the expressed target protein to be secreted into the membrane periplasmic cavity of bacteria and can be cleaved by prokaryotic periplasmic signal peptidase; ② The coding sequence of His-Tag is added after the coding sequence of TrxA protein. His-Tag can be used for Enrichment of the expressed target protein; ③ Add the coding sequence of the enterokinase cleavage site DDDDK (Asp-Asp-Asp-Asp-Lys) downstream of the His-Tag coding sequence. The purified protein will remove the His-Tag and the TrxA protein fused upstream under the action of enterokinase; ④ Insert the codon-optimized Cas9 gene suitable for expression in the Escherichia coli BL21 (DE3) strain, and add the nuclear localization signal coding sequence upstream and downstream of the gene to increase the nuclear localization ability of the Cas9 protein purified later.

[0147] The fusion gene in the plasmid pKG-GE4 is shown in nucleotides 5209-9852 in SEQ ID NO: 1, encoding the fusion protein shown in SEQ ID NO: 2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, referred to as PRONCN protein). Due to the presence of the alkaline phosphatase signal peptide and the enterokinase cleavage site, the fusion protein is cleaved by enterokinase to form the protein shown in SEQ ID NO: 3, and the protein shown in SEQ ID NO: 3 is named NCN protein.

[0148] 2. Inducible Expression

[0149] 1. Introduce plasmid pKG-GE4 into Escherichia coli BL21 (DE3) to obtain recombinant bacteria.

[0150] 2. The recombinant bacteria obtained in step 1 were inoculated into liquid LB medium containing 100 μg / ml ampicillin and cultured overnight at 37°C and 200 rpm with shaking.

[0151] 3. Inoculate the bacterial solution obtained in step 2 into liquid LB medium and culture at 30°C and 230 rpm until OD 600nm Value = 1.0, then isopropylthiogalactoside (IPTG) was added to make its concentration in the system 0.5 mM, and then shake-cultured at 25°C and 230 rpm for 12 hours, and then centrifuged at 4°C and 10000g for 15 minutes to collect the bacteria.

[0152] 4. Take the bacteria obtained in step 3 and wash them with PBS buffer.

[0153] 3. Purification of fusion protein TrxA-His-EK-NLS-spCas9-NLS

[0154] 1. Take the cells obtained in step 2, add crude extraction buffer and suspend the cells, then use a homogenizer to break the cells (1000par cycle three times), then centrifuge at 4°C and 15000g for 30min, collect the supernatant, filter the supernatant with a 0.22μm pore size filter membrane, and collect the filtrate. In this step, 10ml crude extraction buffer is added for every gram of wet weight of the cells.

[0155] Crude extraction buffer: contains 20mM Tris-HCl (pH8.0), 0.5M NaCl, 5mM Imidazole, 1mM PMSF, and the balance is ddH2O.

[0156] 2. Purify the fusion protein using affinity chromatography.

[0157] First, use 5 column volumes of equilibration solution to equilibrate the Ni-NTA agarose column (flow rate is 1 ml / min); then load 50 ml of the filtrate obtained in step 1 (flow rate is 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration solution (flow rate is 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate is 1 ml / min) to remove impurities; then elute with 10 column volumes of eluent at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).

[0158] Ni-NTA agarose column: GenScript, L00250 / L00250-C, filler volume 10 ml.

[0159] Balance solution: contains 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, and the balance is ddH2O.

[0160] Buffer: contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 50 mM Imidazole, and the balance is ddH2O.

[0161] Elution buffer: contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole, and the balance is ddH2O.

[0162] IV. Enzyme cleavage of fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of NCN protein

[0163] 1. Take 15 ml of the post-column solution collected in step 3, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml), and then dilute it to 1 ml with 25 mM Tris-HCl (pH 8.0). Use 6 ultrafiltration tubes to obtain a total of 6 ml.

[0164] 2. Add commercially available recombinant bovine enterokinase with a His6 tag (Sangon Biotech, C620031, Recombinant Bovine Enterokinase Light Chain, with a His6 tag) to the solution obtained in step 1 (about 6 ml) and digest at 25°C for 16 hours. Add 2 units of enterokinase for every 50 μg of protein.

[0165] 3. Take the solution from step 2 (about 6 ml), mix it with 480 μl Ni-NTA resin (GenScript, L00250 / L00250-C), rotate and mix at room temperature for 15 min, then centrifuge at 7000 g for 3 min and collect the supernatant (4-5.5 ml).

[0166] 4. Take the supernatant obtained in step 3, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml), then add it to the enzyme storage solution and adjust the protein concentration to 5 mg / ml to obtain the NCN protein solution.

[0167] After sequencing, the protein in the NCN protein solution has 15 amino acid residues at the N-terminus as shown in SEQ ID NO: 3, positions 1 to 15, namely, the NCN protein.

[0168] The NCN proteins used in the subsequent steps and examples are provided by NCN protein solution.

[0169] Enzyme storage solution (pH 7.4): contains 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% (volume ratio) glycerol, and the balance is ddH2O.

[0170] 5. Performance of NCN protein

[0171] The two gRNA targets targeting the TTN gene were selected as follows:

[0172] TTN-gRNA1: AGAGCACAGTCAGCCTGGCG;

[0173] TTN-gRNA2: CTTCCAGAATTGGATCTCCG.

[0174] The primers used to identify the target fragment containing the gRNA in the TTN gene are as follows:

[0175] TTN-F55: TACGGAATTGGGGAGCCAGCGGA;

[0176] TTN-R560: CAAAGTTAACTCTCTGTGTCT.

[0177] 1. Prepare gRNA

[0178] Prepare TTN-T7-gRNA1 transcription template and TTN-T7-gRNA2 transcription template. TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 4. TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 5.

[0179] TTN-T7-gRNA1 transcription template was used for in vitro transcription using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) was used for recovery and purification to obtain TTN-gRNA1. TTN-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 6.

[0180] TTN-T7-gRNA2 transcription template was used for in vitro transcription using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) was used for recovery and purification to obtain TTN-gRNA2. TTN-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: 7.

[0181] 2. Optimization of the dosage ratio of gRNA and NCN protein

[0182] (1) Co-transfection of primary porcine fibroblasts

[0183] Group 1: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 0.5μg TTN-gRNA1: 0.5μg TTN-gRNA2: 4μg NCN protein.

[0184] Group 2: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 0.75μg TTN-gRNA1: 0.75μg TTN-gRNA2: 4μg NCN protein.

[0185] Group 3: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 1μg TTN-gRNA1: 1μg TTN-gRNA2: 4μg NCN protein.

[0186] Group 4: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 1.25μg TTN-gRNA1: 1.25μg TTN-gRNA2: 4μg NCN protein.

[0187] Group 5: TTN-gRNA1 and TTN-gRNA2 were co-transfected into primary porcine fibroblasts. Ratio: about 100,000 primary porcine fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.

[0188] Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon TM transfection system electroporator (parameter settings: 1450 V, 10 ms, 3 pulses).

[0189] (2) After completing step (1), the cells were cultured in complete culture medium for 12-18 hours, and then replaced with new complete culture medium for culture. The total culture time after electroporation was 48 hours.

[0190] (3) After completing step (2), the cells were digested and collected using trypsin, genomic DNA was extracted, PCR amplification was performed using a primer pair consisting of TTN-F55 and TTN-R560, and then 1% agarose gel electrophoresis was performed.

[0191] Electrophoresis diagram Figure 3 The 505bp band is the wild-type band (WT), and the 254bp band (the wild-type band is 505bp and theoretically lacks 251bp) is the deletion mutation band (MT).

[0192] Gene deletion mutation efficiency = (MT grayscale / MT band bp number) / (WT grayscale / WT band bp number + MT grayscale / MT band bp number) × 100%. The gene deletion mutation efficiency of the first group was 19.9%, the second group was 39.9%, the third group was 79.9%, and the fourth group was 44.3%. No mutation occurred in the fifth group.

[0193] The results showed that the gene editing efficiency was highest when the mass ratio of the two gRNAs to the NCN protein was 1:1:4 and the actual dosage was 1μg:1μg:4μg. Therefore, the optimal dosage of the two gRNAs to the NCN protein was determined to be 1μg:1μg:4μg.

[0194] 3. Comparison of gene editing efficiency between NCN protein and commercial Cas9 protein

[0195] (1) Co-transfection of primary porcine fibroblasts

[0196] Cas9-A group: TTN-gRNA1, TTN-gRNA2 and commercial Cas9-A protein were co-transfected into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 1μg TTN-gRNA1: 1μg TTN-gRNA2: 4μg Cas9-A protein.

[0197] pKG-GE4 group: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 1μg TTN-gRNA1: 1μg TTN-gRNA2: 4μg NCN protein.

[0198] Cas9-B group: TTN-gRNA1, TTN-gRNA2 and commercial Cas9-B protein were co-transfected into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 1μg TTN-gRNA1: 1μg TTN-gRNA2: 4μg Cas9-B protein.

[0199] Control group: TTN-gRNA1 and TTN-gRNA2 were co-transfected into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 1μg TTN-gRNA1: 1μg TTN-gRNA2.

[0200] Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon TM transfection system electroporator (parameter settings: 1450 V, 10 ms, 3 pulses).

[0201] (2) After completing step (1), the cells were cultured in complete culture medium for 12-18 hours, and then replaced with new complete culture medium for culture. The total culture time after electroporation was 48 hours.

[0202] (3) After completing step (2), the cells were digested and collected using trypsin, genomic DNA was extracted, PCR amplification was performed using a primer pair consisting of TTN-F55 and TTN-R560, and then 1% agarose gel electrophoresis was performed.

[0203] Electrophoresis diagram Figure 4 The gene deletion mutation efficiency using the commercial Cas9-A protein was 28.5%, the gene deletion mutation efficiency using the NCN protein was 85.6%, and the gene deletion mutation efficiency using the commercial Cas9-B protein was 16.6%.

[0204] The results show that compared with commercial Cas9 protein, the NCN protein prepared by the present invention significantly improves the gene editing efficiency.

[0205] Example 2: Screening of efficient gRNA targets for the PTCH1 gene

[0206] Pig PTCH1 gene information: Encodes a receptor protein (Patched 1) that constitutes the Hedgehog signaling pathway; located on chromosome 10; Gene ID is 100627504, Sus scrofa. The amino acid sequence of the protein encoded by the pig PTCH1 gene is shown in SEQ ID NO: 8. In the pig genomic DNA, the PTCH1 gene has 27 exons, and its partial sequence (including exons 6 and 7 and 400 bp upstream and downstream) is shown in SEQ ID NO: 9.

[0207] 1. Conservative analysis of the pre-deleted region of the PTCH1 gene and adjacent genomic sequences

[0208] 18 newborn Congjiang Xiang pigs, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) and 8 males (named A, B, C, D, E, F, G, H).

[0209] PTCH1-i5-JDF60:TGCCAGGGTCCCAGCATTAAT;

[0210] PTCH1-i7-JDR953:ATTCTAGGACACCCAGATAGCTA;

[0211] PTCH1-i5-JDF100: TCAGACATTCCAGAGGCAATAGA;

[0212] PTCH1-i7-JDR994:GGCGCTTTGTGAGCTGCTTTGGT.

[0213] The genome was extracted from the ear tissue of the pig named 1 as a template, and PCR amplification was performed using different primer pairs, followed by 1% agarose gel electrophoresis. The electrophoresis diagram is shown in Figure 5 . Figure 5 Middle: Group 1: using a primer pair consisting of PTCH1-i5-JDF60 and PTCH1-i7-JDR953; Group 2: using a primer pair consisting of PTCH1-i5-JDF60 and PTCH1-i7-JDR994; Group 3: using a primer pair consisting of PTCH1-i5-JDF100 and PTCH1-i7-JDR953; Group 4: using a primer pair consisting of PTCH1-i5-JDF100 and PTCH1-i7-JDR994. The results show that the primer pair consisting of PTCH1-i5-JDF60 and PTCH1-i7-JDR953 is preferably used for amplifying the target fragment.

[0214] The genomic DNA of 18 pigs was used as template, and the primer pair consisting of PTCH1-i5-JDF60 and PTCH1-i7-JDR953 was used for PCR amplification, and then 1% agarose gel electrophoresis was performed. Figure 6 The PCR amplification products were recovered and sequenced, and the sequencing results were compared with the PTCH1 gene sequence in the public database. The conserved regions common to the 18 pigs were selected for gRNA target design.

[0215] 2. Target Screening

[0216] By screening NGG (avoiding possible mutation sites), several targets were initially screened, and 8 targets were further screened after preliminary experiments.

[0217] The 8 targets are as follows:

[0218] PTCH1-E6-gRNA1:TCAAAGTTTGTCCACTGCAA;

[0219] PTCH1-E6-gRNA2:CTATCAAGTGGACAGCTGGG;

[0220] PTCH1-E6-gRNA3:GGAAATGCTGAATAAGGCTG;

[0221] PTCH1-E6-gRNA4: GGATCAGCCGGATTGAGGCA;

[0222] PTCH1-E7-gRNA1:AAAGTATATGCACTGGCAGG;

[0223] PTCH1-E7-gRNA2: TGGCAGGAGGAACTCATCGT;

[0224] PTCH1-E7-gRNA3: CAGGAGGAACTCATCGTGGG;

[0225] PTCH1-E7-gRNA4: GGCACAGTCAAGAACAGTAC.

[0226] 3. Preparation of gRNA

[0227] The plasmid pKG-U6gRNA was taken and digested with restriction endonuclease BbsI to recover the vector backbone (a large linear fragment of about 3 kb).

[0228] PTCH1-E6-gRNA1-S and PTCH1-E6-gRNA1-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends was connected to the vector backbone to obtain a plasmid pKG-U6gRNA (PTCH1-E6-gRNA1). Plasmid pKG-U6gRNA (PTCH1-E6-gRNA1) expresses the sgRNA shown in SEQ ID NO: 10 PTCH1-E6-gRNA1 .

[0229] sgRNA PTCH1-E6-gRNA1 (SEQ ID NO: 10):

[0230] UCAAAGUUUGUCCACUGCAAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0231] PTCH1-E6-gRNA2-S and PTCH1-E6-gRNA2-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends was connected to the vector backbone to obtain a plasmid pKG-U6gRNA (PTCH1-E6-gRNA2). Plasmid pKG-U6gRNA (PTCH1-E6-gRNA2) expresses the sgRNA shown in SEQ ID NO: 11 PTCH1-E6-gRNA2 .

[0232] sgRNA PTCH1-E6-gRNA2 (SEQ ID NO: 11):

[0233] CUAUCAAGUGGACAGCUGGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaagu

[0234] ggcaccgagucggugcuuuu

[0235] PTCH1-E6-gRNA3-S and PTCH1-E6-gRNA3-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends was connected to the vector backbone to obtain a plasmid pKG-U6gRNA (PTCH1-E6-gRNA3). Plasmid pKG-U6gRNA (PTCH1-E6-gRNA3) expresses the sgRNA shown in SEQ ID NO: 12 PTCH1-E6-gRNA3 .

[0236] sgRNA PTCH1-E6-gRNA3 (SEQ ID NO: 12):

[0237] GGAAAUGCUGAAUAAGGCUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0238] PTCH1-E6-gRNA4-S and PTCH1-E6-gRNA4-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends was connected to the vector backbone to obtain a plasmid pKG-U6gRNA (PTCH1-E6-gRNA4). Plasmid pKG-U6gRNA (PTCH1-E6-gRNA4) expresses the sgRNA shown in SEQ ID NO: 13 PTCH1-E6-gRNA4 .

[0239] sgRNA PTCH1-E6-gRNA4 (SEQ ID NO: 13):

[0240] GGAUCAGCCGGAUUGAGGCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0241] PTCH1-E7-gRNA1-S and PTCH1-E7-gRNA1-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends was connected to the vector backbone to obtain a plasmid pKG-U6gRNA (PTCH1-E7-gRNA1). Plasmid pKG-U6gRNA (PTCH1-E7-gRNA1) expresses the sgRNA shown in SEQ ID NO: 14 PTCH1-E7-gRNA1 .

[0242] sgRNA PTCH1-E7-gRNA1 (SEQ ID NO: 14):

[0243] AAAGUAUAUGCACUGGCAGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0244] PTCH1-E7-gRNA2-S and PTCH1-E7-gRNA2-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends was connected to the vector backbone to obtain a plasmid pKG-U6gRNA (PTCH1-E7-gRNA2). Plasmid pKG-U6gRNA (PTCH1-E7-gRNA2) expresses the sgRNA shown in SEQ ID NO: 15 PTCH1-E7-gRNA2 .

[0245] sgRNA PTCH1-E7-gRNA2 (SEQ ID NO: 15):

[0246] UGGCAGGAGGAACUCAUCGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0247] PTCH1-E7-gRNA3-S and PTCH1-E7-gRNA3-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends was connected to the vector backbone to obtain a plasmid pKG-U6gRNA (PTCH1-E7-gRNA3). Plasmid pKG-U6gRNA (PTCH1-E7-gRNA3) expresses the sgRNA shown in SEQ ID NO: 16 PTCH1-E7-gRNA3 .

[0248] sgRNA PTCH1-E7-gRNA3 (SEQ ID NO: 16):

[0249] CAGGAGGAACUCAUCGUGGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0250] PTCH1-E7-gRNA4-S and PTCH1-E7-gRNA4-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends was connected to the vector backbone to obtain a plasmid pKG-U6gRNA (PTCH1-E7-gRNA4). Plasmid pKG-U6gRNA (PTCH1-E7-gRNA4) expresses the sgRNA shown in SEQ ID NO: 17 PTCH1-E7-gRNA4 .

[0251] sgRNA PTCH1-E7-gRNA4 (SEQ ID NO: 17):

[0252] GGCACAGUCAAGAACAGUACguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0253] PTCH1-E6-gRNA1-S: caccgTCAAAGTTTGTCCACTGCAA;

[0254] PTCH1-E6-gRNA1-A:aaacTTGCAGTGGACAAACTTTGAc;

[0255] PTCH1-E6-gRNA2-S:caccgCTATCAAGTGGACAGCTGGG;

[0256] PTCH1-E6-gRNA2-A:aaacCCCAGCTGTCCACTTGATAGc;

[0257] PTCH1-E6-gRNA3-S: caccGGAAATGCTGAATAAGGCTG;

[0258] PTCH1-E6-gRNA3-A:aaacCAGCCTTATTCAGCATTTCC;

[0259] PTCH1-E6-gRNA4-S: caccGGATCAGCCGGATTGAGGCA;

[0260] PTCH1-E6-gRNA4-A: aaacTGCCTCAATCCGGCTGATCC.

[0261] PTCH1-E7-gRNA1-S: caccgAAAGTATATGCACTGGCAGG;

[0262] PTCH1-E7-gRNA1-A: aaacCCTGCCAGTGCATATACTTTc;

[0263] PTCH1-E7-gRNA2-S: caccgTGGCAGGAGGAACTCATCGT;

[0264] PTCH1-E7-gRNA2-A: aaacACGATGAGTTCCTCCTGCCAc;

[0265] PTCH1-E7-gRNA3-S: caccgCAGGAGGAACTCATCGTGGG;

[0266] PTCH1-E7-gRNA3-A: aaacCCCACGATGAGTTCCTCCTGc;

[0267] PTCH1-E7-gRNA4-S: caccGGCACAGTCAAGAACAGTAC;

[0268] PTCH1-E7-gRNA4-A: aaacGTACTGTTCTTGACTGTGCC.

[0269] PTCH1-E6-gRNA1-S, PTCH1-E6-gRNA1-A, PTCH1-E6-gRNA2-S, PTCH1-E6-gRNA2-A, PTCH1-E6-gRNA3-S, PTCH1-E6-gRNA3-A, PTCH1-E6-gRNA4-S, PTCH1-E6-gRNA4-A, PTCH1-E7-gRNA1-S, PTCH1-E7-gRNA1-A, PTCH1-E7-gRNA2-S, PTCH1-E7-gRNA2-A, PTCH1-E7-gRNA3-S, PTCH1-E7-gRNA3-A, PTCH1-E7-gRNA4-S, PTCH1-E7-gRNA4-A are all single-stranded DNA molecules.

[0270] 4. Comparison of editing efficiency of different target combinations

[0271] 1. Co-transfection

[0272] Group 1: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA (PTCH1-E6-gRNA1) and plasmid pKG-GE3. Ratio: about 200,000 porcine primary fibroblasts: 0.92μg plasmid pKG-U6gRNA (PTCH1-E6-gRNA1): 1.08μg plasmid pKG-GE3.

[0273] Group 2: Plasmid pKG-U6gRNA (PTCH1-E6-gRNA2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92μg plasmid pKG-U6gRNA (PTCH1-E6-gRNA2): 1.08μg plasmid pKG-GE3.

[0274] Group 3: Plasmid pKG-U6gRNA (PTCH1-E6-gRNA3) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92μg plasmid pKG-U6gRNA (PTCH1-E6-gRNA3): 1.08μg plasmid pKG-GE3.

[0275] Group 4: Plasmid pKG-U6gRNA (PTCH1-E6-gRNA4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92μg plasmid pKG-U6gRNA (PTCH1-E6-gRNA4): 1.08μg plasmid pKG-GE3.

[0276] Group 5: Plasmid pKG-U6gRNA (PTCH1-E7-gRNA1) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92μg plasmid pKG-U6gRNA (PTCH1-E7-gRNA1): 1.08μg plasmid pKG-GE3.

[0277] Group 6: Plasmid pKG-U6gRNA (PTCH1-E7-gRNA2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92μg plasmid pKG-U6gRNA (PTCH1-E7-gRNA2): 1.08μg plasmid pKG-GE3.

[0278] Group 7: Plasmid pKG-U6gRNA (PTCH1-E7-gRNA3) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92μg plasmid pKG-U6gRNA (PTCH1-E7-gRNA3): 1.08μg plasmid pKG-GE3.

[0279] Group 8: Plasmid pKG-U6gRNA (PTCH1-E7-gRNA4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92μg plasmid pKG-U6gRNA (PTCH1-E7-gRNA4): 1.08μg plasmid pKG-GE3.

[0280] Group 9: Primary porcine fibroblasts, electroporated with the same electroporation parameters but without plasmid.

[0281] Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon TM transfection system electroporator (parameter settings: 1450 V, 10 ms, 3 pulses).

[0282] 2. After completing step 1, culture in complete culture medium for 12-18 hours, then replace with new complete culture medium for culture. The total culture time after electroporation is 48 hours.

[0283] 3. After completing step 2, digest and collect cells with trypsin, lyse cells, extract genomic DNA, perform PCR amplification using primers consisting of PTCH1-i5-JDF60 and PTCH1-i7-JDR953, and then perform 1% agarose gel electrophoresis to detect cell target gene mutations. See the electrophoresis diagram for details. Figure 7 .

[0284] After the target product was excised and recovered, it was sent to a sequencing company for sequencing. Then the sequencing results were analyzed using the web version of the Synthego ICE tool to analyze the sequencing peak graph to obtain the gene editing efficiency of different targets. The gene editing efficiency of the first to eighth groups was 15%, 50%, 18%, 30%, 35%, 19%, 31%, and 15%, respectively, and no gene editing occurred in the ninth group. The results showed that PTCH1-E6-gRNA2 and PTCH1-E7-gRNA1 had higher editing efficiency.

[0285] Example 3: Screening of efficient gRNA targets for the TP53 gene

[0286] Pig TP53 gene information: Encodes P53 protein; located on chromosome 12; GeneID is 397276, Sus scrofa. The protein encoded by the pig TP53 gene is shown in SEQ ID NO: 18. In the pig genomic DNA, the TP53 gene has 11 exons, and its partial sequence (including the 4th exon and 400 bp upstream and downstream) is shown in SEQ ID NO: 19.

[0287] 1. Conservative analysis of the TP53 gene pre-deleted region and adjacent genomic sequences

[0288] 18 newborn Congjiang Xiang pigs, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) and 8 males (named A, B, C, D, E, F, G, H).

[0289] TP53-GT-nF67: ACTGACTCTCTGCCCTTGTCTTC;

[0290] TP53-GT-nR570:AAAGCCTGACACAAAGCCAAAGG;

[0291] TP53-GT-nF167: CTCCTGACTCCTGTTGTTCCCAT;

[0292] TP53-GT-nR610:ACCAGGGTCCAAGGTCATAGAC.

[0293] The genome was extracted from the ear tissue of the pig named 1 as a template, and PCR amplification was performed using different primer pairs, followed by 1% agarose gel electrophoresis. The electrophoresis diagram is shown in Figure 8 . Figure 8 Middle: Group 1: using a primer pair consisting of TP53-GT-nF67 and TP53-GT-nR570; Group 2: using a primer pair consisting of TP53-GT-nF67 and TP53-GT-nR610; Group 3: using a primer pair consisting of TP53-GT-nF167 and TP53-GT-nR570; Group 4: using a primer pair consisting of TP53-GT-nF167 and TP53-GT-nR610. The results showed that the primer pair consisting of TP53-GT-nF167 and TP53-GT-nR570 was preferably used for amplification of the target fragment.

[0294] The genomic DNA of 18 pigs was used as template, and the primer pair consisting of TP53-GT-nF167 and TP53-GT-nR570 was used for PCR amplification, followed by 1% agarose gel electrophoresis. Fig. 9The PCR amplification products were recovered and sequenced, and the sequencing results were compared with the TP53 gene sequences in the public database. The conserved regions common to the 18 pigs were selected for gRNA target design.

[0295] 2. Target Screening

[0296] By screening NGG (avoiding possible mutation sites), several targets were initially screened, and 4 targets were further screened after preliminary experiments.

[0297] The four targets are as follows:

[0298] TP53-E4-gRNA1:GCAGTCCTCTGAGCTTCCCC;

[0299] TP53-E4-gRNA2: GCAGATCGTTCACTGCTGCC;

[0300] TP53-E4-gRNA3:GCTGTTGCTGCAGGAGGCGC;

[0301] TP53-E4-gRNA4:GCGGGCGCTGTTGCTGCAGG.

[0302] 3. Preparation of gRNA

[0303] The plasmid pKG-U6gRNA was taken and digested with restriction endonuclease BbsI to recover the vector backbone (a large linear fragment of about 3 kb).

[0304] TP53-E4-gRNA1-S and TP53-E4-gRNA1-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends was connected to the vector backbone to obtain the plasmid pKG-U6gRNA (TP53-E4-gRNA1). Plasmid pKG-U6gRNA (TP53-E4-gRNA1) expresses the sgRNA shown in SEQ ID NO: 20 TP53-E4-gRNA1 .

[0305] sgRNA TP53-E4-gRNA1 (SEQ ID NO: 20):

[0306] GCAGUCCUCUGAGCUCUCCCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0307] TP53-E4-gRNA2-S and TP53-E4-gRNA2-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends was connected to the vector backbone to obtain the plasmid pKG-U6gRNA (TP53-E4-gRNA2). Plasmid pKG-U6gRNA (TP53-E4-gRNA2) expresses the sgRNA shown in SEQ ID NO: 21 TP53-E4-gRNA2 .

[0308] sgRNA TP53-E4-gRNA2 (SEQ ID NO: 21):

[0309] GCAGAUCGUUCACUGCUGCCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0310] TP53-E4-gRNA3-S and TP53-E4-gRNA3-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends was connected to the vector backbone to obtain the plasmid pKG-U6gRNA (TP53-E4-gRNA3). Plasmid pKG-U6gRNA (TP53-E4-gRNA3) expresses the sgRNA shown in SEQ ID NO: 22 TP53-E4-gRNA3 .

[0311] sgRNA TP53-E4-gRNA3 (SEQ ID NO: 22):

[0312] GCUGUUGCUGCAGGAGGCGCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0313] TP53-E4-gRNA4-S and TP53-E4-gRNA4-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends was connected to the vector backbone to obtain the plasmid pKG-U6gRNA (TP53-E4-gRNA4). Plasmid pKG-U6gRNA (TP53-E4-gRNA4) expresses the sgRNA shown in SEQ ID NO: 23 TP53-E4-gRNA4 .

[0314] sgRNA TP53-E4-gRNA4(SEQ ID NO: 23):

[0315] GCGGGCGCUGUUGCUGCAGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0316] TP53-E4-gRNA1-S: caccGCAGTCCTCTGAGCTCTCCC;

[0317] TP53-E4-gRNA1-A: aaacGGGAGAGCTCAGAGGACTGC;

[0318] TP53-E4-gRNA2-S: caccGCAGATCGTTCACTGCTGCC;

[0319] TP53-E4-gRNA2-A: aaacGGCAGCAGTGAACGATCTGC;

[0320] TP53-E4-gRNA3-S: caccGCTGTTGCTGCAGGAGGCGC;

[0321] TP53-E4-gRNA3-A: aaacGCGCCTCCTGCAGCAACAGC;

[0322] TP53-E4-gRNA4-S: caccGCGGGCGCTGTTGCTGCAGG;

[0323] TP53-E4-gRNA4-A: aaacCCTGCAGCAACAGCGCCCGC.

[0324] TP53-E4-gRNA1-S, TP53-E4-gRNA1-A, TP53-E4-gRNA2-S, TP53-E4-gRNA2-A, TP53-E4-gRNA3-S, TP53-E4-gRNA3-A, TP53-E4-gRNA4-S, and TP53-E4-gRNA4-A are all single-stranded DNA molecules.

[0325] IV. Comparison of Editing Efficiencies of Different Target Combinations

[0326] 1. Co-transfection

[0327] Group 1: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA (TP53-E4-gRNA1) and plasmid pKG-GE3. Ratio: about 200,000 porcine primary fibroblasts: 0.92μg plasmid pKG-U6gRNA (TP53-E4-gRNA1): 1.08μg plasmid pKG-GE3.

[0328] Group 2: Plasmid pKG-U6gRNA (TP53-E4-gRNA2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92μg plasmid pKG-U6gRNA (TP53-E4-gRNA2): 1.08μg plasmid pKG-GE3.

[0329] Group 3: Plasmid pKG-U6gRNA (TP53-E4-gRNA3) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92μg plasmid pKG-U6gRNA (TP53-E4-gRNA3): 1.08μg plasmid pKG-GE3.

[0330] Group 4: Plasmid pKG-U6gRNA (TP53-E4-gRNA4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92μg plasmid pKG-U6gRNA (TP53-E4-gRNA4): 1.08μg plasmid pKG-GE3.

[0331] Group 5: Porcine primary fibroblasts, electroporated with the same electroporation parameters but without adding plasmids.

[0332] Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon TM transfection system electroporator (parameter settings: 1450 V, 10 ms, 3 pulses).

[0333] 2. After completing step 1, culture in complete culture medium for 12-18 hours, then replace with new complete culture medium for culture. The total culture time after electroporation is 48 hours.

[0334] 3. After completing step 2, use trypsin to digest and collect cells, lyse cells, extract genomic DNA, use primer pairs consisting of TP53-GT-nF167 and TP53-GT-nR570 for PCR amplification, and then perform 1% agarose gel electrophoresis to detect cell target gene mutations. See the electrophoresis diagram Fig.10 .

[0335] After the target product was excised and recovered, it was sent to a sequencing company for sequencing. The sequencing results were then analyzed using the web version of the Synthego ICE tool to analyze the sequencing peak graph to obtain the gene editing efficiency of different targets. The gene editing efficiencies of the first to fourth groups were 65%, 22%, 36%, and 54%, respectively, and no gene editing occurred in the fifth group. The results showed that TP53-E4-gRNA1 and TP53-E4-gRNA4 had higher editing efficiencies.

[0336] Example 4: Preparation of single cell clones of Congjiang Xiang pigs with combined knockout of PTCH1 and TP53 genes

[0337] The two efficient gRNA targets screened in Example 2 (PTCH1-E6-gRNA2 and PTCH1-E7-gRNA1) and the two efficient gRNA targets screened in Example 3 (TP53-E4-gRNA1 and TP53-E4-gRNA4) were selected.

[0338] 1. Preparation of gRNA

[0339] 1. Prepare transcription template

[0340] The PTCH1-T7-E6g2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO:24.

[0341] The PTCH1-T7-E7g1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO:25.

[0342] The TP53-T7-E4g1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO:26.

[0343] The TP53-T7-E4g4 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO:27.

[0344] 2. Obtain gRNA by in vitro transcription

[0345] Take the transcription template, use Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) for in vitro transcription, and then use MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) was used to recover and purify gRNA, which was a single-stranded RNA.

[0346] The PTCH1-T7-E6g2 transcription template was subjected to the above steps to obtain the gRNA PTCH1-E6g2, as shown in SEQ ID NO: 28.

[0347] The PTCH1-T7-E7g1 transcription template was subjected to the above steps to obtain the gRNA PTCH1-E7g1, as shown in SEQ ID NO: 29.

[0348] The TP53-T7-E4g1 transcription template was subjected to the above steps, and the resulting gRNA was TP53-E4g1, as shown in SEQ ID NO: 30.

[0349] The TP53-T7-E4g4 transcription template was subjected to the above steps, and the resulting gRNA was TP53-E4g4, as shown in SEQ ID NO: 31.

[0350] PTCH1-E6g2 (SEQ ID NO: 28):

[0351] GGCUAUCAAGUGGACAGCUGGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGGCUUUU

[0352] PTCH1-E7g1 (SEQ ID NO: 29):

[0353] GGAAAGUAUAUGCACUGGCAGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU

[0354] TP53-E4g1 (SEQ ID NO: 30):

[0355] GGGCAGUCCUCUGAGCUCUCCCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU

[0356] TP53-E4g4 (SEQ ID NO: 31):

[0357] GGGCGGGCGCUGUUGCUGCAGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU

[0358] 2. Transfection of primary porcine fibroblasts

[0359] 1. Co-transfect PTCH1-E6g2, PTCH1-E7g1, TP53-E4g1, TP53-E4g4 and NCN proteins into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 0.5μg PTCH1-E6g2: 0.5μg PTCH1-E7g1: 0.5μg TP53-E4g1: 0.5μg TP53-E4g4: 4μg NCN protein. Co-transfection was performed by electroporation, using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon TM transfection system electroporator (parameter settings: 1450V, 10ms, 3pulse).

[0360] 2. After completing step 1, culture the cells in complete culture medium for 16-18 hours, then replace with new complete culture medium for culture. The total culture time after electroporation is 48 hours.

[0361] 3. After completing step 2, digest and collect the cells with trypsin, then wash with complete culture medium, resuspend with complete culture medium, and then pick each monoclonal clone and transfer it to a 96-well plate (1 cell per well, 100 μl complete culture medium in each well), and culture for 2 weeks (replace new complete culture medium every 2-3 days).

[0362] 4. After completing step 3, use trypsin to digest and collect the cells (about 2 / 3 of the cells obtained in each well are inoculated into a 6-well plate filled with complete culture medium, and the remaining 1 / 3 are collected in a 1.5 mL centrifuge tube).

[0363] 5. Take the 6-well plate from step 4 and culture the cells until they grow to 80% confluence, digest and collect the cells using trypsin, and freeze the cells using cell freezing solution (90% complete culture medium + 10% DMSO, volume ratio).

[0364] 6. Take the centrifuge tube from step 4, take the cells, lyse the cells and extract genomic DNA, use two primer pairs (primer pair composed of PTCH1-i5-JDF60 and PTCH1-i7-JDR953, primer pair composed of TP53-GT-nF167 and TP53-GT-nR570) for PCR amplification, and then perform electrophoresis. Use porcine primary fibroblasts as wild-type control (WT).

[0365] 7. After completing step 6, recover the PCR amplification product and sequence it.

[0366] For the genotype based on each gene: there is only one sequencing result of porcine primary fibroblasts, and its genotype is wild type (also called homozygous wild type); if there are two sequencing results of a single cell clone, one is consistent with the sequencing result of porcine primary fibroblasts, and the other is mutated compared with the sequencing result of porcine primary fibroblasts (mutation includes deletion, insertion or substitution of one or more nucleotides), the genotype of the single cell clone is heterozygous; if there are two sequencing results of a single cell clone, both of which are mutated compared with the sequencing result of porcine primary fibroblasts (mutation includes deletion, insertion or substitution of one or more nucleotides), the genotype of the single cell clone is biallelic different mutation type; if there is one sequencing result of a single cell clone, and it is mutated compared with the sequencing result of porcine primary fibroblasts (mutation includes deletion, insertion or substitution of one or more nucleotides), the genotype of the single cell clone is biallelic identical mutation type; if there is one sequencing result of a single cell clone, and it is consistent with the sequencing result of porcine primary fibroblasts, the genotype of the single cell clone is wild type (also called homozygous wild type).

[0367] Studies have shown that homozygous knockout of the PTCH1 gene can have a significant impact on mice and easily cause the death of cloned mice, while homozygous knockout of the TP53 gene has no significant effect on cloned mice. Therefore, the target recombinant cells of the present invention are: single cell clones with heterozygous knockout of PTCH1 (i.e., the genotype of the PTCH1 gene is heterozygous) and homozygous knockout of TP53 (i.e., the genotype of the TP53 gene is biallelic different mutations or biallelic identical mutations).

[0368] A total of 48 single-cell clones were obtained. The results are shown in Table 1. According to the genotypes identified by sequencing results, 9 single-cell clones numbered 10, 17, 19, 22, 28, 35, 41, 45, and 46 were selected as target single-cell clones, accounting for 18.75%. The rate of obtaining dual-gene simultaneous editing single-cell clones was as high as 77.1%.

[0369] For example, the sequencing results of the PTCH1 gene of the single cell clone numbered 17 were compared with those of the wild-type (WT) cell. Fig.11 The sequencing results of the TP53 gene of the single cell clone numbered 17 were compared with those of the wild-type (WT) cells. Fig.12 .

[0370] Table 1 Genotyping results of single cell clones co-edited with PTCH1 and TP53 genes

[0371]

[0372]

[0373] The target recombinant cells in Table 1 [single cell clones with heterozygous knockout of PTCH1 (i.e., the genotype of the PTCH1 gene is heterozygous) and homozygous knockout of TP53 (i.e., the genotype of the TP53 gene is biallelic different mutation type or biallelic identical mutation type)], i.e., 9 single cell clones numbered 10, 17, 19, 22, 28, 35, 41, 45, and 46, are used as nuclear transplant donor cells for somatic cell cloning to obtain cloned pigs, i.e., nevus-like basal cell carcinoma syndrome model pigs.

[0374] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims. Sequence Listing <110> Nanjing Qizhen Gene Engineering Co., Ltd. <120> Gene editing system and its application in constructing pig nuclear transplant donor cells with double gene mutations in nevoid basal cell carcinoma syndrome <130> GNCYX213213 <160> 31 <170> SIPOSequenceListing 1.0 <210> 1 <211> 9974 <212> DNA <213> Artificial Sequence <400> 1 tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60 cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120 ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180 gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240 acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300 ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360 ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420 acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480 tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540 tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 600 gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 660 ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 720 agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 780 agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg 840 tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 900 tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg 960 cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg 1020 aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga 1080 tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc 1140 tgcagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc 1200 ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc 1260 ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 1320 cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac 1380 gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc 1440 actgattaag cattggtaac tgtcagacca agtttactca fathercttt agttgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac caaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1680 accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1740. aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcgga caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 2220 cgccagcaac gcggccttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 2280 ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 2340 taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 2400 gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc catatatgg 2460 tgcactctca gtacaatctg ctctgatgcc ccatagttaa gccagtatac actccgctat 2520 cgctacgtga ctgggtcatg gctgcgcccc gacacccgcc aacacccgct gacgcgccct 2580 gacgggcttg tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct 2640 gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc gaggcagctg cggtaaagct 2700 catcagcgtg gtcgtgaagc gattcacaga tgtctgcctg ttcatccgcg tccagctcgt 2760 tgagtttctc cagaagcgtt aatgtctggc ttctgataaa gcgggccatg ttaagggcgg 2820 ttttttcctg tttggtcact gatgcctccg tgtaaggggg atttctgttc atgggggtaa 2880 tgataccgat gaacgagag aggatgctca cgatacggggt tactgat gaacatgccc 2940 ggttactgga acgttgtgag ggtaacaac tggcggtag gatgcggcgg gaccagagaa 3000 aaatcactca gggtcaatgc cagcgcttcg ttatacaga tgtaggtgtt ccacagggta 3060 gccagcagca tcctgcgatg cagatccgga acataatggt gcagggcgct gacttccgcg 3120 tttccagact ttacgaaca cggaaccga agaccattca tgttgttgct caggtcgcag 3180 acgttttgca gcagcagtcg cttcacgttc gctcgcgtat cggtgattca ttctgctaac 3240 cagtaggca accccgccag cctagccggg tcctcaacga caggagcacg atcatgcgca 3300 cccgtggggc cgccatgccg gcgataatgg cctgctctc gccgaaacgt ttggtggcgg 3360 gaccagtgac gaaggcttga gcgaggggcgt gcaagattcc gataccgca agcgacaggc 3420 cgatcatcgt cgcgctccag cgaagcggt cctcgccgaa atgacccag agcgctgccg 3480 gcacctgtcc tacgagttgc atgataaga agacagtcat aagtgcggcg acgatagtca 3540 tgccccgcgc ccaccggaag gagctgactg ggttgaggc tctcaagggc atcggtcgag 3600 atcccggtgc ctaatgagtg agctaactta cattaattgc gttgcgctca ctgcccgctt 3660 tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 3720 gcggtttgcg tattgggcgc cagggtggtt tttcttttca ccagtgagac gggcaacagc 3780 tgattgccct tcaccgcctg gccctgagag agttgcagca agcggtccac gctggtttgc 3840 cccagcaggc gaaaatcctg tttgatggtg gttaacggcg ggatataaca tgagctgtct 3900 tcggtatcgt cgtatcccac taccgagatg tccgcaccaa cgcgcagccc ggactcggta 3960 atggcgcgca ttgcgcccag cgccatctga tcgttggcaa ccagcatcgc agtgggaacg 4020 atgccctcat tcagcatttg catggtttgt tgaaaaccgg acatggcact ccagtcgcct 4080 tcccgttccg ctatcggctg aatttgattg cgagtgagat atttatgcca gccagccaga 4140 cgcagacgcg ccgagacaga acttaatggg cccgctaaca gcgcgatttg ctggtgaccc 4200 aatgcgacca gatgctccac gcccagtcgc gtaccgtctt catgggagaa aataatactg 4260 ttgatgggtg tctggtcaga gacatcaaga aataacgccg gaacattagt gcaggcagct 4320 tccacagcaa tggcatcctg gtcatccagc ggatagttaa tgatcagccc actgacgcgt tgcgcgagaa gattgtgcac cgccgcttta caggcttcga cgccgcttcg ttctaccatc 4440 gacaccacca cgctggcacc cagttgatcg gcgcgagatt taatcgccgc gacaatttgc gacggcgcgt gcagggccag actggaggtg gcaacgccaa tcagcaacga ctgtttgccc 4560. gccagttgtt gtgccacgcg gttgggaatg taattcagct ccgccatcgc cgcttccact 4620 ttttcccgcg ttttcgcaga aacgtggctg gcctggttca ccaccgggga aacggtctga 4680. taagagacac cggcatactc tgcgacatcg fathercgtta ctggtttcac attcaccacc ctgaattgac tctcttccgg gcgctatcat gccataccgc gaaaggtttt gcgccattcg 4800. atggtgtccg ggatctcgac gctctccctt atgcgactcc tgcattagga agcagcccag 4860 tagtagttg aggccgttga gcaccgccgc cgcaaggaat ggtgcatgca aggagatggc 4920 gcccaacagt cccccggcca cggggcctgc caccataccc acgccgaaac aagcgctcat 4980. gagcccgaag tggcgagccc gatcttcccc atcggtgatg tcggcgatat aggcgccagc 5040. aaccgcacct gtggcgccgg tgatgccggc cacgatgcgt ccggcgtaga ggatcgagat 5100 5160 ttcccctcta gaataattt tgtttaactt taagaaggag atatacatat gaacaaagc 5220 actattgcac tggcactctt accgttactg tttacccctg tgacaaaagc catgagcgat 5280 aaaattattc acctgactga cgacagtttt gacacggatg tactcaaagc ggacggggcg 5340 atcctcgtcg atttctgggc agagtggtgc ggtccgtgca aaatgatcgc cccgattctg 5400 5460 aaccctggca ctgcgccgaa atatggcatc cgtggtatcc cgactctgct gctgttcaaa 5520 aacggtgaag tggcggcaac caaagtgggt gcactgtcta aaggtcagtt gaaagagttc 5580 ctcgacgcta acctggccgg ttctggttct ggccatatgc accatcatca tcatcatgac 5640 gatgacgata agatgcccaa aaagaaacga aaggtgggta tccacggagt cccagcagcc 5700 gacaaaaaat atagcatcgg cctggacatc ggtaccaaca gcgttggctg ggcagtgatc 5760 actgatgaat acaaagttcc atccaaaaaa tttaaagtac tgggcaacac cgaccgtcac 5820 tctatcaaaa aaaacctgat tggtgctctg ctgtttgaca gcggcgaaac tgctgaggct 5880 acccgtctga aacgtacggc tcgccgtcgc tacactcgtc gtaaaaaccg catctgttat 5940 ctgcaggaaa ttttctctaa cgaaatggca aaagttgatg atagcttctt tcatcgtctg 6000 gaagagagct tcctggtgga agaagataaa aaacacgaac gtcacccgat tttcggtaac 6060 attgtggatg aggttgccta ccacgagaaa tatccgacca tctaccatct gcgtaaaaaa 6120 ctggttgata gcactgacaa agcggatctg cgtctgatct acctggctct ggcacacatg 6180 atcaaattcc gtggtcactt cctgatcgaa ggtgatctga accctgataa ctccgacgtg 6240 gacaaactgt tcattcagct ggttcagacc tataaccagc tgttcgaaga aaacccgatc 6300 aacgcgtccg gtgtagacgc taaggcaatt ctgtctgcgc gtctgtctaa gtctcgtcgt 6360 ctggaaaacc tgattgcgca actgccaggt gaaaagaaaa acggcctgtt cggcaatctg 6420 atcgccctgt ccctgggtct gactccgaac tttaaatcca actttgacct ggcggaagat 6480 gccaagctgc agctgagcaa agatacctat gacgatgacc tggataacct gctggcacag 6540 atcggtgatc agtatgccga tctgttcctg gccgcgaaaa acctgtctga tgcgattctg 6600 ctgtctgata tcctgcgcgt taacactgaa attactaaag cgccgctgag cgcatccatg 6660 attaaacgtt acgatgaaca ccaccaggat ctgaccctgc tgaaagcgct ggtgcgtcag 6720 cagctgccgg aaaaatacaa ggagatcttc ttcgaccaga gcaaaaacgg ttacgcgggc 6780 tacattgatg gtggtgcatc tcaggaggaa ttctacaaat tcattaaacc gatcctggaa 6840 aaaatggatg gtactgaaga gctgctggtt aaactgaatc gtgaagatct gctgcgcaaa 6900 cagcgtacct tcgataacgg ttccatcccg catcagattc atctgggcga actgcacgct 6960 atcctgcgcc gtcaggaaga cttttatccg ttcctgaaag acaaccgtga gaaaattgaa 7020 aaaatcctga ccttccgtat tccgtactat gtaggtccgc tggcgcgtgg taactcccgt 7080 ttcgcttgga tgacccgcaa aagcgaagaa accatcaccc cgtggaattt cgaagaagtc 7140 gttgacaaag gcgcgtccgc gcagtctttc atcgaacgca tgacgaactt cgacaaaaac 7200 ctgccgaacg agaaagtgct gccgaaacac tctctgctgt acgagtactt cactgtgtac 7260 aacgaactga ccaaagtgaa atacgtcacc gaaggtatgc gtaaaccggc attcctgtcc 7320 ggtgagcaaa aaaaagcaat cgtggatctg ctgttcaaaa ccaaccgtaa agtaaccgtg 7380 aaacagctga aggaagacta tttcaagaaa atcgaatgtt ttgattctgt tgaaatctcc 7440 ggcgtggaag atcgcttcaa tgcgtccctg ggtacgtatc acgacctgct gaaaattatc 7500 aaagacaaag attttctgga caacgaggaa aacgaagaca tcctggagga tattgtactg 7560 accctgaccc tgttcgaaga ccgtgagatg atcgaagaac gcctgaaaac ctacgcccac 7620 ctgttcgatg acaaggtaat gaagcagctg aaacgtcgtc gttataccgg ctggggtcgt 7680 ctgtcccgta aactgatcaa tggcatccgt gataaacagt ctggcaaaac catcctggac 7740 ttcctgaaat ccgacggttt cgcgaatcgt aacttcatgc aactgattca tgacgattct 7800 ctgactttca aagaagacat ccagaaagca caggtttccg gccagggtga ctctctgcac 7860 gagcacattg ccaatctggc tggttctccg gctattaaaa agggtattct gcagactgtg 7920 aaagtagttg atgagctggt caaagtaatg ggccgtcaca agccggaaaa cattgtgatc 7980 gaaatggcac gtgaaaacca gacgacccag aaaggtcaga aaaactctcg tgaacgcatg 8040 aaacgtatcg aagaaggcat caaagaactg ggctctcaga tcctgaagga acaccctgta 8100 gaaaataccc agctgcagaa cgaaaagctg tatctgtatt acctgcagaa cggccgcgat 8160 atgtatgtgg accaggaact ggatatcaac cgcctgtccg attacgatgt agatcacatc 8220 gtgccgcaaa gcttcctgaa agacgacagc attgacaaca aagtactgac ccgttctgat 8280 aagaaccgtg gcaaatccga taacgtcccg tctgaagaag ttgttaaaaa aatgaaaaac 8340 tattggcgtc agctgctgaa cgcgaaactg atcacccagc gtaagttcga caatctgact 8400 aaagctgagc gcggtggtct gtccgaactg gataaagcgg gttttatcaa acgccagctg 8460 gttgaaaccc gtcagatcac gaagcacgtt gcgcagattc tggactctcg tatgaacacc 8520 aaatacgacg aaaacgacaa actgatccgc gaggttaagg ttatcaccct gaaaagcaaa 8580 ctggtatccg attttcgtaa agactttcag ttctacaaag tgcgcgaaat taacaactat 8640 caccacgctc acgatgcata tctgaatgca gttgttggca cggcgctgat caaaaagtat 8700 ccgaaactgg aatctgaatt cgtatacggc gattacaaag tgtatgacgt tcgtaagatg 8760 atcgcaaaat ccgagcagga aattggtaag gcgacggcga aatacttctt ttattccaat 8820 attatgaact ttttcaaaac cgaaatcacc ctggcgaatg gtgaaattcg taaacgcccg 8880 ctgatcgaaa ccaacggtga aactggtgaa atcgtttggg acaaaggccg cgacttgcg 8940 accgtgcgta aagttctgtc tatgccgcaa gtgaacatcg tcaagaagac cgaagtacaa 9000 accggcggtt ttagcaaaga gagcattctg ccaaaacgta actccgacaa actgatcgcg 9060 cgcaagaaag actgggatcc gaaaaaatac ggtggtttcg attctccaac cgttgcttat 9120 tccgttctgg tggtagccaa agttgagaaa ggtaaaagca aaaaactgaa atccgtaaag 9180 gaactgctgg gtattactat catggagcgt agctccttcg aaaaaaaccc gatcgatttt 9240 ctggaagcga aaggctataa agaagtcaaa aaggacctga tcatcaaact gccaaaatac 9300 agcctgttcg agctggaaaa cggccgtaaa cgtatgctgg catctgcggg cgaactgcag 9360 aaaggcaacg agctggctct gccgtccaaa tacgtgaact ttctgtacct ggcctctcac 9420 tacgaaaaac tgaaaggttc cccggaagac aacgaacaga aacagctgtt cgtagagcag 9480 cacaaacact acctggacga gatcatcgaa cagatttctg aattttctaa acgtgtgatt 9540 ctggctgatg cgaatctgga taaagttctg tctgcctata acaagcatcg tgacaaaccg 9600 atccgcgaac aggctgagaa catcatccac ctgttcactc tgactaacct gggcgcgcca 9660 gcggctttca agtactttga taccaccatt gaccgcaagc gttacacctc cactaaagaa 9720 gtgctggacg cgactctgat ccaccagtcc atcaccggtc tgtacgagac ccgtatcgat 9780 ctgagccagc tgggcggtga caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa 9840 aagaaaaagt gacaaagccc gaaaggaagc tgagttggct gctgccaccg ctgagcaata 9900 actagcataa ccccttgggg cctctaaacg ggtcttgagg ggttttttgc tgaaaggagg 9960 aactatatcc ggat 9974 <210> 2 <211> 1547 <212> PRT <213> Artificial Sequence <400> 2 Met Lys Gln Ser Thr Ile Ala Leu Ala Leu Leu Pro Leu Leu Phe Thr 1 5 10 15 Pro Val Thr Lys Ala Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp 20 25 30 Ser Phe Asp Thr Asp Val Leu Lys Ala Asp Gly Ala Ile Leu Val Asp 35 40 45 Phe Trp Ala Glu Trp Cys Gly Pro Cys Lys Met Ile Ala Pro Ile Leu 50 55 60 Asp Glu Ile Ala Asp Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu 65 70 75 80 Asn Ile Asp Gln Asn Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly 85 90 95 Ile Pro Thr Leu Leu Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys 100 105 110 Val Gly Ala Leu Ser Lys Gly Gln Leu Lys Glu Phe Leu Asp Ala Asn 115 120 125 Leu Ala Gly Ser Gly Ser Gly His Met His His His His His His Asp 130 135 140 Asp Asp Asp Lys Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly 145 150 155 160 Val Pro Ala Ala Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr 165 170 175 Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser 180 185 190 Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys 195 200 205 Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala 210 215 220 Thr Arg Leu Lys Arg Thr Ala Arg Arg Tyr Thr Arg Lys Asn 225 230 235 240 Arg With Cys Tyr Leu Gln Glu Phe Serves As An Glu Met Ala Lys Val 245 250 255 Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu 260 265 270 Asp Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu 275 280 285 Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys 290,295,300 Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala 305 310 315 320 Leu Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp 325 330 335 Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val 340 345 350 Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly 355 360 365 Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg 370 375 380 Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu 385 390 395 400 Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys 405 410 415 Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp 420 425 430 Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln 435 440 445 Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu 450 455 460 Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu 465 470 475 480 Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr 485 490 495 Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu 500 505 510 Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly 515 520 525 Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu 530 535 540 Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp 545 550 555 560 Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln 565 570 575 Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe 580 585 590 Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr 595 600 605 Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg 610 615 620 Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn 625 630 635 640 Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu 645 650 655 Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro 660 665 670 Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr 675 680 685 Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser 690 695 700 Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg 705 710 715 720 Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu 725 730 735 Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala 740 745 750 Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp 755 760 765 Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu 770 775 780 Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys 785 790 795 800 Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg 805 810 815 Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly 820 825 830 Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser 835 840 845 Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser 850 855 860 Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly 865 870 875 880 Asp Ser Leu His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile 885 890 895 Lys Lys Gly Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys 900 905 910 Val Met Gly Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg 915 920 925 Glu Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met 930 935 940 Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys 945 950 955 960 Glu His Pro Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu 965 970 975 Tyr Tyr Leu Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp 980 985 990 Ile Asn Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser 995 1000 1005 Phe Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp 1010 1015 1020 Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys 1025 1030 1035 1040 Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr 1045 1050 1055 Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser 1060 1065 1070 Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg 1075 1080 1085 Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr 1090 1095 1100 Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr 1105 1110 1115 1120 Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr 1125 1130 1135 Lys Val Arg Glu Ile Asn Asn Tyr His Ala His Asp Ala Tyr Leu 1140 1145 1150 Asn Ala Val Val Gly Thr Ala Leu Ile Lys Tyr Pro Lys Leu Glu 1155 1160 1165 Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met 1170 1175 1180 Ile Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe 1185 1190 1195 1200 Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala 1205 1210 1215 Asn Gly Glu With Arg Lys Arg Pro Leu Glu Thr Asn Gly Glu Thr 1220 1225 1230 Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys 1235 1240 1245 Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln 1250 1255 1260 Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp 1265 1270 1275 1280 Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly 1285 1290 1295 Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val 1300 1305 1310 Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly 1315 1320 1325 Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe 1330 1335 1340 Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys 1345 1350 1355 1360 Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met 1365 1370 1375 Leu Ala Ser Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro 1380 1385 1390 Ser Lys Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu 1395 1400 1405 Lys Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln 1410 1415 1420 His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser 1425 1430 1435 1440 Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala 1445 1450 1455 Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile 1460 1465 1470 Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys 1475 1480 1485 Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu 1490 1495 1500 Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu 1505 1510 1515 1520 Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala 1525 1530 1535 Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys 1540 1545 <210> 3 <211> 1399 <212> PRT <213> Artificial Sequence <400> 3 Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala Ala 1 5 10 15 Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val Gly 20 25 30 Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe Lys 35 40 45 Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile Gly 50 55 60 Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys 65 70 75 80 Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys Tyr 85 90 95 Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser Phe 100 105 110 Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His 115 120 125 Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His 130 135 140 Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp Ser 145 150 155 160 Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met 165 170 175 Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp 180 185 190 Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr Asn 195 200 205 Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys 210 215 220 Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn Leu 225 230 235 240 Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu 245 250 255 Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp 260 265 270 Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp 275 280 285 Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu 290 295 300 Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile 305 310 315 320 Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met 325 330 335 Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala 340 345 350 Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp 355 360 365 Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln 370 375 380 Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly 385 390 395 400 Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys 405 410 415 Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly 420 425 430 Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu 435 440 445 Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro 450 455 460 Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met 465 470 475 480 Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val 485 490 495 Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn 500 505 510 Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu 515 520 525 Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr 530 535 540 Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys 545 550 555 560 Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val 565 570 575 Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser 580 585 590 Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr 595 600 605 Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn 610 615 620 Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu 625 630 635 640 Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His 645 650 655 Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr Thr 660 665 670 Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp Lys 675 680 685 Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ala 690 695 700 Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys 705 710 715 720 Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His 725 730 735 Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile 740 745 750 Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg 755 760 765 His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr 770 775 780 Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu 785 790 795 800 Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val 805 810 815 Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln 820 825 830 Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu 835 840 845 Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys Asp 850 855 860 Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly 865 870 875 880 Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn 885 890 895 Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe 900 905 910 Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp Lys 915 920 925 Only Gly Phe With Lys Arg Gln Leu Val Glu Thr Arg Gln With Thr Lys 930,935,940 His Gln Ile Leu Asp Ser Arg With Asn Thr Lys Tyr Asp Glu 945 950 955 960 Asn Asp Lys With Arg Glu Val Val Lys With Thr Lys Ser Ser Lys 965,970,975 Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu 980,985,990 Ile Asn Asn Tyr His Ala His Asp Ala Tyr Leu Asn Ala Val Val 995 1000 1005 Gly Thr Ala Leu Ile Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val 1010 1015 1020 Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser 1025 1030 1035 1040 Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn 1045 1050 1055 Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile 1060 1065 1070 Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val 1075 1080 1085 Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser Met 1090 1095 1100 Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly Phe 1105 1110 1115 1120 Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala 1125 1130 1135 Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro 1140 1145 1150 Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys 1155 1160 1165 Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met 1170 1175 1180 Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys 1185 1190 1195 1200 Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr 1205 1210 1215 Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala 1220 1225 1230 Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val 1235 1240 1245 Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro 1250 1255 1260 Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr 1265 1270 1275 1280 Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile 1285 1290 1295 Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys His 1300 1305 1310 Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile His Leu Phe 1315 1320 1325 Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp Thr 1330 1335 1340 Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu Asp Ala 1345 1350 1355 1360 Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp 1365 1370 1375 Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala 1380 1385 1390 Gly Gln Ala Lys Lys Lys Lys 1395 <210> 4 <211> 225 <212> DNA <213> Artificial Sequence <400> 4 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggagagc acagtcagcc tggcggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 5 <211> 225 <212> DNA <213> Artificial Sequence <400> 5 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggcttcc agaattggat ctccggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 6 <211> 102 <212> RNA <213> Artificial Sequence <400> 6 ggagagcaca gucagccugg cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 7 <211> 102 <212> RNA <213> Artificial Sequence <400> 7 ggcuuccaga auuggaucuc cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 8 <211> 1452 <212> PRT <213> Sus scrofa <400> 8 Met Ala Ser Ala Gly Asn Ala Ala Glu Pro Gln Asp Leu Gly Ser Gly 1 5 10 15 Gly Ser Gly Gly Ser Cys Ser Gly Ala Pro Gly Arg Pro Ala Gly Gly 20 25 30 Gly Arg Arg Arg Arg Thr Gly Gly Leu Arg Arg Asn Ala Ala Pro Asp 35 40 45 Arg Asp Tyr Leu His Arg Pro Ser Tyr Cys Asp Ala Ala Phe Ala Leu 50 55 60 Glu Gln Ile Ser Lys Gly Lys Ala Thr Gly Arg Lys Ala Pro Leu Trp 65 70 75 80 Leu Arg Ala Lys Phe Gln Arg Leu Leu Phe Lys Leu Gly Cys Tyr Ile 85 90 95 Gln Lys Asn Cys Gly Lys Phe Leu Val Val Gly Leu Leu Ile Phe Gly 100 105 110 Ala Phe Ala Val Gly Leu Lys Ala Ala Asn Leu Glu Thr Asn Val Glu 115 120 125 Glu Leu Trp Val Glu Val Gly Gly Arg Val Ser Arg Glu Leu Asn Tyr 130 135 140 Thr Arg Gln Lys Ile Gly Glu Glu Ala Met Phe Asn Pro Gln Leu Met 145 150 155 160 Ile Gln Thr Pro Lys Glu Glu Gly Ala Asn Val Leu Thr Thr Glu Ala 165 170 175 Leu Arg Gln His Leu Asp Ser Ala Leu Gln Ala Ser Arg Val His Val 180 185 190 Tyr Met Tyr Asn Arg Gln Trp Lys Leu Glu His Leu Cys Tyr Lys Ser 195 200 205 Gly Glu Leu Ile Thr Glu Thr Gly Tyr Met Asp Gln Ile Ile Glu Tyr 210 215 220 Leu Tyr Pro Cys Leu Ile Ile Thr Pro Leu Asp Cys Phe Trp Glu Gly 225 230 235 240 Ala Lys Leu Gln Ser Gly Thr Ala Tyr Leu Leu Gly Lys Pro Pro Leu 245 250 255 Gln Trp Thr Asn Phe Asp Pro Leu Glu Phe Leu Glu Glu Leu Lys Lys 260 265 270 Ile Asn Tyr Gln Val Asp Ser Trp Glu Glu Met Leu Asn Lys Ala Glu 275 280 285 Val Gly His Gly Tyr Met Asp Arg Pro Cys Leu Asn Pro Ala Asp Pro 290 295 300 Asp Cys Pro Ala Thr Ala Pro Asn Lys Asn Thr Thr Lys Pro Leu Asp 305 310 315 320 Met Ala Leu Val Leu Asn Gly Gly Cys His Gly Leu Ser Arg Lys Tyr 325 330 335 Met His Trp Gln Glu Glu Leu Ile Val Gly Gly Thr Val Lys Asn Ser 340 345 350 Thr Gly Lys Leu Val Ser Ala His Ala Leu Gln Thr Met Phe Gln Leu 355 360 365 Met Thr Pro Lys Gln Met Tyr Glu His Phe Lys Gly Tyr Glu Tyr Val 370 375 380 Ser His Ile Ser Trp Asn Glu Asp Lys Ala Ala Ala Ile Leu Glu Ala 385 390 395 400 Trp Gln Arg Thr Tyr Val Glu Val Val His Gln Ser Val Ala Gln Asn 405 410 415 Ser Thr Gln Lys Val Leu Ser Phe Thr Thr Thr Thr Leu Asp Asp Ile 420 425 430 Leu Lys Ser Phe Ser Asp Val Ser Val Ile Arg Val Ala Ser Gly Tyr 435 440 445 Leu Leu Met Leu Ala Tyr Ala Cys Leu Thr Met Leu Arg Trp Asp Cys 450 455 460 Ser Lys Ser Gln Gly Ala Val Gly Leu Ala Gly Val Leu Leu Val Ala 465 470 475 480 Leu Ser Val Ala Ala Gly Leu Gly Leu Cys Ser Leu Ile Gly Ile Ser 485 490 495 Phe Asn Ala Ala Thr Thr Gln Val Leu Pro Phe Leu Ala Leu Gly Val 500 505 510 Gly Val Asp Asp Val Phe Leu Leu Ala His Ala Phe Ser Glu Thr Gly 515 520 525 Gln Asn Lys Arg Ile Pro Phe Glu Asp Arg Thr Gly Glu Cys Leu Lys 530 535 540 Arg Thr Gly Ala Ser Val Ala Leu Thr Ser Ile Ser Asn Val Thr Ala 545 550 555 560 Phe Phe Met Ala Ala Leu Ile Pro Ile Pro Ala Leu Arg Ala Phe Ser 565 570 575 Leu Gln Ala Ala Val Val Val Phe Asn Phe Ala Met Val Leu Leu 580 585 590 Ile Phe Pro Ala Ile Leu Ser Met Asp Leu Tyr Arg Arg Glu Asp Arg 595 600 605 Arg Leu Asp Ile Phe Cys Cys Phe Thr Ser Pro Cys Val Ser Arg Val 610 615 620 Ile Gln Val Glu Pro Gln Ala Tyr Thr Glu Thr His Asp Asn Thr Arg 625 630 635 640 Tyr Ser Pro Pro Pro Pro Tyr Ser Ser His Ser Phe Ala His Glu Thr 645 650 655 Gln Ile Thr Met Gln Ser Thr Val Gln Leu Arg Thr Glu Tyr Asp Pro 660 665 670 His Thr His Val Tyr Tyr Thr Thr Ala Glu Pro Arg Ser Glu Ile Ser 675 680 685 Val Gln Pro Val Thr Leu Ala Gln Asp Thr Leu Ser Cys Gln Ser Pro 690 695 700 Glu Ser Thr Ser Ser Thr Arg Asp Leu Leu Ser Gln Phe Ser Asp Ser 705 710 715 720 Ser Leu His Cys Leu Glu Pro Pro Cys Thr Lys Trp Thr Leu Ser Ser 725 730 735 Phe Ala Glu Lys His Tyr Ala Pro Phe Leu Leu Lys Pro Lys Ala Lys 740 745 750 Val Val Val Ile Phe Leu Phe Leu Gly Leu Leu Gly Val Ser Leu Tyr 755 760 765 Gly Thr Thr Arg Val Arg Asp Gly Leu Asp Leu Thr Asp Ile Val Pro 770 775 780 Arg Glu Thr Arg Glu Tyr Asp Phe Ile Ala Ala Gln Phe Lys Tyr Phe 785 790 795 800 Ser Phe Tyr Asn Met Tyr Ile Val Thr Gln Lys Ala Asp Tyr Pro Asn 805 810 815 Ile Gln His Leu Leu Tyr Asp Leu His Lys Ser Phe Ser Asn Val Lys 820 825 830 Tyr Val Met Leu Glu Glu Asn Lys Gln Leu Pro Lys Met Trp Leu His 835 840 845 Tyr Phe Arg Asp Trp Leu Gln Gly Leu Gln Asp Ala Phe Asp Ser Asp 850 855 860 Trp Glu Thr Gly Lys Ile Met Pro Asn Asn Tyr Lys Asn Gly Ser Asp 865 870 875 880 Asp Gly Val Leu Ala Tyr Lys Leu Leu Val Gln Thr Gly Ser Arg Asp 885 890 895 Lys Pro Ile Asp Ile Ser Gln Leu Thr Lys Arg Arg Leu Val Asp Ala 900 905 910 Asp Gly Ile Ile Asn Pro Ser Ala Phe Tyr Ile Tyr Leu Thr Ala Trp 915 920 925 Val Ser Asn Asp Pro Val Ala Tyr Ala Ala Ser Gln Ala Asn Ile Arg 930 935 940 Pro His Arg Pro Glu Trp Val His Asp Lys Ala Asp Tyr Met Pro Glu 945 950 955 960 Thr Arg Leu Arg Ile Pro Ala Ala Glu Pro Ile Glu Tyr Ala Gln Phe 965 970 975 Pro Phe Tyr Leu Asn Gly Leu Arg Asp Thr Ser Asp Phe Val Glu Ala 980 985 990 Ile Glu Lys Val Arg Thr Ile Cys Asn Asn Tyr Thr Ser Leu Gly Leu 995 1000 1005 Ser Ser Tyr Pro Asn Gly Tyr Pro Phe Leu Phe Trp Glu Gln Tyr Ile 1010 1015 1020 Gly Leu Arg His Trp Leu Leu Leu Ser Ile Ser Val Val Leu Ala Cys 1025 1030 1035 1040 Thr Phe Leu Val Cys Ala Val Phe Leu Leu Asn Pro Trp Thr Ala Gly 1045 1050 1055 Ile Ile Val Thr Val Leu Ala Leu Met Thr Val Glu Leu Phe Gly Met 1060 1065 1070 Met Gly Leu Ile Gly Ile Lys Leu Ser Ala Val Pro Val Val Ile Leu 1075 1080 1085 Ile Ala Ser Val Gly Ile Gly Val Glu Phe Thr Val His Val Ala Leu 1090 1095 1100 Ala Phe Leu Thr Ala Ile Gly Asp Lys Asn Arg Arg Ala Val Leu Ala 1105 1110 1115 1120 Leu Glu His Met Phe Ala Pro Val Leu Asp Gly Ala Val Ser Thr Leu 1125 1130 1135 Leu Gly Val Leu Met Leu Ala Gly Ser Glu Phe Asp Phe Ile Val Arg 1140 1145 1150 Tyr Phe Phe Ala Val Leu Ala Ile Leu Thr Ile Leu Gly Val Leu Asn 1155 1160 1165 Gly Leu Val Leu Leu Pro Val Leu Leu Ser Phe Phe Gly Pro Tyr Pro 1170 1175 1180 Glu Val Ser Pro Ala Asn Gly Leu Asn Arg Leu Pro Thr Pro Ser Pro 1185 1190 1195 1200 Glu Pro Pro Pro Ser Val Val Arg Phe Ala Val Pro Pro Ser His Ala 1205 1210 1215 Asn Asn Gly Ser Asp Ser Ser Asp Ser Glu Tyr Ser Ser Gln Thr Thr 1220 1225 1230 Val Ser Gly Ile Ser Glu Glu Leu Arg Ala Tyr Glu Ala Gln Gln Gly 1235 1240 1245 Thr Gly Gly Pro Ala His Gln Val Ile Val Glu Ala Thr Glu Asn Pro 1250 1255 1260 Val Phe Ala Arg Ser Thr Val Val His Pro Glu Pro Arg His His Pro 1265 1270 1275 1280 Pro Pro Asn Pro Arg Gln Gln Pro His Arg Asp Ser Gly Ser Leu Pro 1285 1290 1295 Pro Gly Arg Pro Gly Gln Gln Pro Arg Arg Asp Pro Ser Arg Glu Gly 1300 1305 1310 Ser Arg Pro Pro Pro Tyr Arg Pro Arg Arg Asp Ala Phe Glu Ile Ser 1315 1320 1325 Thr Glu Gly His Ser Gly Pro Ser His Arg Asp Arg Ala Gly Pro Arg 1330 1335 1340 Gly Ala Arg Ser His Asn Pro Arg His Ser Ala Phe Thr Thr Thr Gly 1345 1350 1355 1360 Gly Ser Ala Pro Gly Tyr Cys Gln Pro Ile Thr Thr Val Thr Ala Ser 1365 1370 1375 Ala Ser Val Thr Val Ala Val His Pro Pro Pro Ala Pro Gly Ser Ser 1380 1385 1390 Arg Asn Pro Arg Gly Gly Leu Cys Pro Gly Tyr Glu Gly Tyr Pro Glu 1395 1400 1405 Thr Asp Pro Gly Leu Phe Glu Asp Pro His Val Pro Phe Asn Val Arg 1410 1415 1420 Cys Glu Arg Arg Asp Ser Lys Val Glu Val Ile Glu Leu Gln Asp Val 1425 1430 1435 1440 Glu Cys Glu Glu Arg Pro Arg Gly Ser Gly Ser Asn 1445 1450 <210> 9 <211> 1416 <212> DNA <213> On sow <400> 9 gacacttaca aagcatttgt taggctggca agtgctaatt tgacatcccg attccccccc 60 ccccccccag ttttgggtct ccgtcttctg cttagaagca cccattggct aattttgttt 120 tcagatacta aatacactgt atcagcaaag cgacagttct ttggtacctt tgttaactta 180 tagctgttt gccatcttca ttcataaatt atttcctgt cttaggtttg cctagagata 240 tactggaaag gaacatttgg gttttgtgcc agggtcccag cattataata ggagcaccaa 300 aaagcctcag acattccaga ggcaatagat gcagtcttgt tttttcacta aggcttagaa 360 gcctcttt cattgcctcg cctcctaatt tctttcacag aggtaagcct cctttgcagt 420 ggacaaactt tgaccctttg gaattccttg aagagttaaa gaaaataaac tatcaagtgg 480 acagctggga ggaaatgctg aataaggctg aggttggtca tggttacatg gaccggccct 540 gcctcaatcc ggctgatcca gactgccctg ccacagcccc caacaaaaat acaaccaaag 600 taagtacagc ccctgattct tcttaggagg ggcagagaga aaaacccgat gctccccccc 660 ccttgttagt tctcttattt ttattccct ttttttggt ctctggatct aagttttgttg 720 atagagctaa atttgctgt aagatttgcc atacgcctct cattagcctg gttattaatg 780 ttctccctga aacaaacaag cccttaatgc actggatttt aaaggcat gtgacctgcc 840 tactaattcc tgtaattatg tggctgcctt ttttttcttt ttattttttt aaagcctctt 900 gatatggccc ttgttttgaa cggtggatgt catggattat ccagaaagta tatgcactgg 960 caggaggaac tcatcgtggg tggcacagtc aagaacagta ctggaaagct tgtcaggtaa 1020 tccaacacac acgggaagat ccaagccatc tattattttt cgccctttcc tcagaaacca 1080 cttcctttct gacatctgca ggtgtctttg tattaacact taaccgtcat ccccgctagc 1140 tatctgggtg tcctagaatg ttcagagata tgagtggacc aaagcagctc acaaagcgcc 1200 ttgtggtgta ttcccaaga gcagatatgt acggggttcc tgttgtggct cagcggtaat 1260 gaacctgact cagatccatg aggatacggg ttcgatccct ggccccgctc catgggtaca 1320 agatccagca ctgctgcggc tgtggtgcag gccggcgcct gcggctccag ttcatcccct 1380 agcctgggaa cttccaaatg ccacgggtgc gacttt 1416 <210> 10 <211> 100 <212> RNA <213> Artificial Sequence <400> 10 ucaaaguuug uccacugcaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 11 <211> 100 <212> RNA <213> Artificial Sequence <400> 11 cuaucaagug gacagcuggg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 12 <211> 100 <212> RNA <213> Artificial Sequence <400> 12 ggaaaugcug aauaaggcug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 13 <211> 100 <212> RNA <213> Artificial Sequence <400> 13 ggaucagccg gauugaggca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 14 <211> 100 <212> RNA <213> Artificial Sequence <400> 14 aaaguauaug cacuggcagg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 15 <211> 100 <212> RNA <213> Artificial Sequence <400> 15 uggcaggagg aacucaucgu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 16 <211> 100 <212> RNA <213> Artificial Sequence <400> 16 caggaggaac ucaucguggg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 17 <211> 100 <212> RNA <213> Artificial Sequence <400> 17 ggcacaguca agaacaguac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 18 <211> 386 <212> PRT <213> Sus scrofa <400> 18 Met Glu Glu Ser Gln Ser Glu Leu Gly Val Glu Pro Pro Leu Ser Gln 1 5 10 15 Glu Thr Phe Ser Asp Leu Trp Lys Leu Leu Pro Glu Asn Asn Leu Leu 20 25 30 Ser Ser Glu Leu Ser Leu Ala Ala Val Asn Asp Leu Leu Leu Ser Pro 35 40 45 Val Thr Asn Trp Leu Asp Glu Asn Pro Asp Asp Ala Ser Arg Val Pro 50 55 60 Ala Pro Pro Ala Ala Thr Ala Pro Ala Pro Ala Ala Pro Ala Pro Ala 65 70 75 80 Thr Ser Trp Pro Leu Ser Ser Phe Val Pro Ser Gln Lys Thr Tyr Pro 85 90 95 Gly Ser Tyr Asp Phe Arg Leu Gly Phe Leu His Ser Gly Thr Ala Lys 100 105 110 Ser Val Thr Cys Thr Tyr Ser Pro Ala Leu Asn Lys Leu Phe Cys Gln 115 120 125 Leu Ala Lys Thr Cys Pro Val Gln Leu Trp Val Ser Ser Pro Pro Pro 130 135 140 Pro Gly Thr Arg Val Arg Ala Met Ala Ile Tyr Lys Lys Ser Glu Tyr 145 150 155 160 Met Thr Glu Val Val Arg Arg Cys Pro His His Glu Arg Ser Ser Asp 165 170 175 Tyr Ser Asp Gly Leu Ala Pro Pro Gln His Leu Ile Arg Val Glu Gly 180 185 190 Asn Leu Arg Ala Glu Tyr Leu Asp Asp Arg Asn Thr Phe Arg His Ser 195 200 205 Val Val Val Pro Tyr Glu Pro Pro Glu Val Gly Ser Asp Cys Thr Thr 210 215 220 Ile His Tyr Asn Phe Met Cys Asn Ser Ser Cys Met Gly Gly Met Asn 225 230 235 240 Arg Arg Pro Ile Leu Thr Ile Ile Thr Leu Glu Asp Ala Ser Gly Asn 245 250 255 Leu Leu Gly Arg Asn Ser Phe Glu Val Arg Val Cys Ala Cys Pro Gly 260 265 270 Arg Asp Arg Arg Thr Glu Glu Glu Asn Phe Leu Lys Lys Gly Gln Ser 275 280 285 Cys Pro Glu Pro Pro Pro Gly Ser Thr Lys Arg Ala Leu Pro Thr Ser 290 295 300 Thr Ser Ser Ser Pro Val Gln Lys Lys Lys Pro Leu Asp Gly Glu Tyr 305 310 315 320 Phe Thr Leu Gln Ile Arg Gly Arg Glu Arg Phe Glu Met Phe Arg Glu 325 330 335 Leu Asn Asp Ala Leu Glu Leu Lys Asp Ala Gln Thr Ala Arg Glu Ser 340 345 350 Gly Glu Asn Arg Ala His Ser Ser His Leu Lys Ser Lys Lys Gly Gln 355 360 365 Ser Pro Ser Arg His Lys Lys Pro Met Phe Lys Arg Glu Gly Pro Asp 370 375 380 Ser Asp 385 <210> 19 <211> 1055 <212> DNA <213> On the scrofa <400> 19 cttccctcgg ggcttgggtg tgtctcaggc tggatcctg cctttctccc cacagcggcc 60 acactcccct ccagggagct gcaatggagg agtcgcagtc cgagctgggc gtggagcccc 120 ctctgagtca ggagacattt tcagacttgt ggaaactgtg agtggagtct caagggaggg 180 ctgcccgtct tctaataacc ttgcttcccc ccccaccagc ccccagcccc caaccccagt 240 agaggcctct gggaagcaca gacctatact gactctctgc ccttgtctttc caggcttcct 300 gaaaacaacc tgctggtaag gactggggcg cggcaagggc aggggcctgg ggggctgggg 360 ggctggcctc ctgactcctg ttgttcccat ccatccgcag tcctctgagc tctccctggc 420 agcagtgaac gatctgctgc tgtccccagt cacgaactgg ctggatgaaa atccagatga 480 cgcctccaga gtgccagcgc ctcctgcagc aacagcgccc gcaccagctg ccccgcacc 540 agccacctcc tggcccctgt cgtcctttgt cccttctcag aagacctacc ctggcagcta 600 tgattccgt ctagggttcc tgcattctgg aacagccaag tctgtaacct gcacggtcag 660 tggccttgag ggactggctt cgtagggaca gtgcctggcc cctatccccc cgggtttttc 720 tgtttagaac ttcgtggttc cactgcagcc tttggctttg tgtcaggctt tctatgttta 780 acctatttgg tctatgacct tggaccctgg tcccaaagtt gaatactccc acttgacctt 840 ggcctctcat ccttcccatc acactcttca gcatttgtca tgaggccatg gaactttttt 900 tcttttctct ccactcattc attccttggc ttttgtaagg aagcttctgg gagggagccc 960 ccgaccctgc catctctggc taccctcccc accgagcact tggctgctaa tcagtattta 1020 ggcagcgtct gttcatttga ctgctggctc cctgt 1055 <210> 20 <211> 100 <212> RNA <213> Artificial Sequence <400> 20 gcaguccucu gagcucuccc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 21 <211> 100 <212> RNA <213> Artificial Sequence <400> 21 gcagaucguu cacugcugcc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 22 <211> 100 <212> RNA <213> Artificial Sequence <400> 22 gcuguugcug caggaggcgc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 23 <211> 100 <212> RNA <213> Artificial Sequence <400> 23 gcgggcgcug uugcugcagg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 24 <211> 225 <212> DNA <213> Artificial Sequence <400> 24 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggctatc aagtggacag ctggggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 25 <211> 225 <212> DNA <213> Artificial Sequence <400> 25 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggaaagt atatgcactg gcagggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 26 <211> 225 <212> DNA <213> Artificial Sequence <400> 26 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 atagggcagt cctctgagct ctcccgtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 27 <211> 225 <212> DNA <213> Artificial Sequence <400> 27 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 atagggcggg cgctgttgct gcagggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 28 <211> 102 <212> RNA <213> Artificial Sequence <400> 28 ggcuaucaag uggacagcug ggguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 29 <211> 102 <212> RNA <213> Artificial Sequence <400> 29 ggaaaguaua ugcacuggca ggguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 30 <211> 102 <212> RNA <213> Artificial Sequence <400> 30 gggcaguccu cugagcucuc ccguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 31 <211> 102 <212> RNA <213> Artificial Sequence <400> 31 gggcgggcgc uguugcugca ggguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102

Claims

1. Use of PTCH1-E6g2, PTCH1-E7g1, TP53-E4g1, TP53-E4g4 and NCN proteins in preparing a kit; The PTCH1-E6g2 is an sgRNA, and its target sequence binding region is shown in nucleotides 3-22 of SEQ ID NO: 28; the PTCH1-E7g1 is an sgRNA, and its target sequence binding region is shown in nucleotides 3-22 of SEQ ID NO: 29; the TP53-E4g1 is an sgRNA, and its target sequence binding region is shown in nucleotides 3-22 of SEQ ID NO: 30; the TP53-E4g4 is an sgRNA, and its target sequence binding region is shown in nucleotides 3-22 of SEQ ID NO: 31; the NCN protein is shown in SEQ ID NO: 3; The kit is used for the following (a) or (b) or (c): (a) preparing recombinant cells; (b) preparing a pig model of nevus basal cell carcinoma syndrome; (c) preparing a cell model of nevus basal cell carcinoma syndrome or a tissue model of nevus basal cell carcinoma syndrome or an organ model of nevus basal cell carcinoma syndrome.

2. The use according to claim 1, characterized in that: The preparation method of the NCN protein comprises the following steps: (1) Introduce plasmid pKG-GE4 into Escherichia coli BL21 (DE3) to obtain recombinant bacteria; (2) culturing the recombinant bacteria in a liquid medium at 30° C., then adding IPTG and inducing the culture at 25° C., and then collecting the bacteria; (3) crushing the collected bacteria and collecting the crude protein solution; (4) purifying the fusion protein with the His6 tag from the crude protein solution using affinity chromatography; (5) using enterokinase with a His6 tag to digest the fusion protein with a His6 tag, and then using Ni-NTA resin to remove the protein with the His6 tag to obtain a purified NCN protein; Plasmid pKG-GE4 contains the fusion gene shown by nucleotides 5209 to 9852 in SEQ ID NO:

1.

3. A kit comprising PTCH1-E6g2, PTCH1-E7g1, TP53-E4g1, TP53-E4g4 and NCN protein; PTCH1-E6g2 is the PTCH1-E6g2 described in claim 1; PTCH1-E7g1 is the PTCH1-E7g1 described in claim 1; TP53-E4g1 is the TP53-E4g1 described in claim 1; TP53-E4g4 is the TP53-E4g4 described in claim 1; NCN protein is the NCN protein described in claim 1; The kit is used for the following (a) or (b) or (c): (a) preparing recombinant cells; (b) preparing a pig model of nevus basal cell carcinoma syndrome; (c) preparing a cell model of nevus basal cell carcinoma syndrome or a tissue model of nevus basal cell carcinoma syndrome or an organ model of nevus basal cell carcinoma syndrome.

4. The kit according to claim 3, characterized in that: The preparation method of the NCN protein comprises the following steps: (1) Introduce plasmid pKG-GE4 into Escherichia coli BL21 (DE3) to obtain recombinant bacteria; (2) culturing the recombinant bacteria in a liquid medium at 30° C., then adding IPTG and inducing the culture at 25° C., and then collecting the bacteria; (3) crushing the collected bacteria and collecting the crude protein solution; (4) purifying the fusion protein with the His6 tag from the crude protein solution using affinity chromatography; (5) using enterokinase with a His6 tag to digest the fusion protein with a His6 tag, and then using Ni-NTA resin to remove the protein with the His6 tag to obtain a purified NCN protein; Plasmid pKG-GE4 contains the fusion gene shown by nucleotides 5209 to 9852 in SEQ ID NO:

1.

5. A method for preparing recombinant cells, comprising the following steps: co-transfecting PTCH1-E6g2, PTCH1-E7g1, TP53-E4g1, TP53-E4g4 and NCN protein into pig cells to obtain recombinant cells; PTCH1-E6g2 is the PTCH1-E6g2 described in claim 1; PTCH1-E7g1 is the PTCH1-E7g1 described in claim 1; TP53-E4g1 is the TP53-E4g1 described in claim 1; TP53-E4g4 is the TP53-E4g4 described in claim 1; and NCN protein is the NCN protein described in claim 1.

6. The method according to claim 5, characterized in that: The preparation method of the NCN protein comprises the following steps: (1) Introduce plasmid pKG-GE4 into Escherichia coli BL21 (DE3) to obtain recombinant bacteria; (2) culturing the recombinant bacteria in a liquid medium at 30° C., then adding IPTG and inducing the culture at 25° C., and then collecting the bacteria; (3) crushing the collected bacteria and collecting the crude protein solution; (4) purifying the fusion protein with the His6 tag from the crude protein solution using affinity chromatography; (5) using enterokinase with a His6 tag to digest the fusion protein with a His6 tag, and then using Ni-NTA resin to remove the protein with the His6 tag to obtain a purified NCN protein; Plasmid pKG-GE4 contains the fusion gene shown by nucleotides 5209 to 9852 in SEQ ID NO:

1.

7. Use of the recombinant cells prepared by the method of claim 5 or 6 in preparing a pig model of nevus-like basal cell carcinoma syndrome.

8. The use of recombinant cells, pig tissues prepared using recombinant cells, pig organs prepared using recombinant cells, pig cells prepared using recombinant cells, or nevus-like basal cell carcinoma syndrome model pigs prepared using recombinant cells is as follows (d1) or (d2) or (d3) or (d4): (d1) Screening for drugs to treat nevoid basal cell carcinoma syndrome; (d2) To evaluate the efficacy of drugs for nevoid basal cell carcinoma syndrome; (d3) Evaluate the efficacy of gene therapy and / or cell therapy for nevoid basal cell carcinoma syndrome; (d4) Study the pathogenesis of nevoid basal cell carcinoma syndrome; The recombinant cell is a recombinant cell prepared by the method of claim 5 or 6.

Images