Ischemic stroke-related shRNA, lentiviral expression vector and its application

Abstract

The present invention discloses a shRNA and a lentiviral expression vector related to ischemic stroke and applications thereof. The present invention is used to interfere with ADH5 gene expression, inhibit GSNOR protein activity, increase the overall protein nitrosylation level, and enhance the resistance of cells to oxidative stress, especially to alleviate the nerve damage caused by ischemic stroke.

Description

Technical Field

[0001] The present invention relates to the field of medical technology, and in particular to a shRNA related to ischemic stroke, a lentiviral expression vector and an application thereof. Background Art

[0002] Ischemic stroke (IS) is a type of cerebrovascular disease caused by focal neurological deficits due to stenosis or occlusion of the cerebral arteries and transient lack of blood supply. It is one of the main causes of disability and death. Among them, ischemic stroke accounts for 70%-80% of the incidence of stroke. The incidence of ischemic stroke increases with age, especially in the elderly over 65 years old, and is gradually shifting to young people. Although with the development of medical level and technology, there are many means of treating ischemic stroke, such as thrombolytic therapy, antiplatelet aggregation therapy, anticoagulant therapy, intravascular intervention therapy, neuroprotective therapy, etc., but due to the complex pathological mechanism of ischemic stroke, the therapeutic effects of these methods do not seem to be particularly effective and ideal at present. Therefore, in-depth analysis of the pathological mechanism and finding effective therapeutic drugs and means are one of the key issues that need to be solved urgently. The neurovascular unit (NVU) is a dynamic microenvironment structure of the brain composed of neurons, vascular endothelial cells, astrocytes, basement membrane and extracellular matrix. The NVU maintains the normal physiological function of neurons and the repair of damaged neurons. It plays an important role in blood-brain barrier (BBB) ​​regulation, inflammatory immune response, cell preservation, and repair during ischemic stroke. When an ischemic stroke occurs, the BBB is dysfunctional and the NVU is severely damaged. Under ischemic conditions, multiple cell signaling pathways and nutritional factors in the cerebral vascular endothelium regulate barrier tissues and participate in regulating cerebral blood flow and vascular injury repair. Therefore, improving neurological function protection is one of the problems that need to be solved clinically.

[0003] Homeostasis of the internal environment of the nervous system is a necessary condition for maintaining normal neuronal function. S-nitrosoglutathione reductase (GSNOR) is essentially a type of glutathione (GSH)-dependent formaldehyde dehydrogenase (FDH) and type III alcohol dehydrogenase (ADH), and ADH5 is the gene encoding GSNOR. GSNOR regulates the availability of NO in cells by metabolizing S-nitrosoglutathione (GSNO) and regulates S-nitrosylated thiols (RSNO) through GSNO-mediated S-nitrosylation, which has important physiological significance for the respiratory system, cardiovascular and cerebrovascular diseases, neurodegenerative diseases, etc. Summary of the invention

[0004] The purpose of the present invention is to provide a shRNA, a lentiviral expression vector and an application related to ischemic stroke, which are used to interfere with ADH5 gene expression, inhibit GSNOR protein activity, increase the overall nitrosylation level of the protein, and enhance the resistance of cells to oxidative stress, especially to alleviate the neural damage caused by ischemic stroke.

[0005] The technical solution adopted by the present invention to solve the technical problem is:

[0006] The invention discloses a shRNA related to ischemic stroke, wherein the upstream sequence of the shRNA is 5'-GATCC GACGAATTTGTGACCGGCAATCTCGAGATTGCCGGTCACAAATTCGTCTTTTTTG-3', and the downstream sequence is 5'-AATTCAAAAAAGACGAATTTGTGACCGGCAATCTCGAGATTGCCGGTCACAAATTCGTCG-3'.

[0007] A shRNA lentiviral expression vector associated with ischemic stroke. The shRNA lentiviral expression vector is pHBLV-U6-MCS-PGK-PURO-shRNA. The upstream sequence of the shRNA is 5'-GATCC GACGAATTTGTGACCGGCAATCTCGAGATTGCCGGTCACAAATTCGTCTTTTTTG-3', and the downstream sequence is 5'-AATTCAAAAAAGACGAATTTGTGACCGGCAATCTCGAGATTGCCGGTCACAAATTCGTCG-3'.

[0008] In the upstream sequence, the loop is 6 nt CTCGAG, and the termination sequence is 6 nt TTTTTT.

[0009] The shRNA lentiviral expression vector is obtained by cloning the synthesized shRNA into the interference vector pHBLV-U6-MCS-PGK-PURO.

[0010] Application of shRNA as a drug for preparing drugs for inhibiting ADH5 gene expression.

[0011] Application of shRNA lentiviral expression vector as a drug for preparing drugs for inhibiting ADH5 gene expression.

[0012] Application of shRNA in the preparation of drugs for the treatment of ischemic stroke.

[0013] Application of shRNA lentiviral expression vector in the preparation of drugs for treating ischemic stroke.

[0014] The beneficial effects of the present invention are: BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is the interference vector pHBLV-U6-MCS-PGK-PURO vector map selected by the present invention;

[0016] Figure 2 is the sequencing result of shRNA lentiviral expression vector;

[0017] Figure 3 The sh-GSNOR group was used as a control without puromycin selection;

[0018] Figure 4 This is the sh-GSNOR group selected with puromycin, and the calculated titer is 10 3 ×20%×100×10×10 3 =2×10 8 TU / mL.

[0019] Figure 5 The sh-nc group was used as a control without puromycin selection;

[0020] Figure 6 This is the sh-nc group screened with puromycin, and the calculated titer is 10 3 ×30%×100×10×10 3 =3×10 8 TU / mL.

[0021] Figure 7 This is a light microscopic image of cells, with a magnification of 100 times;

[0022] Figure 8 is the expression of GSNOR mRNA;

[0023] Fig. 9 The figure shows the changes in cell survival rate over time in cells with GSNOR expression inhibited and the control group after oxygen-glucose deprivation injury. DETAILED DESCRIPTION

[0024] The technical solution of the present invention is further described in detail below through specific embodiments.

[0025] In the present invention, unless otherwise specified, the raw materials and equipment used can be purchased from the market or are commonly used in the art. The methods in the following embodiments, unless otherwise specified, are all conventional methods in the art.

[0026] Example:

[0027] 1. Materials and methods

[0028] 1.1 Cells, plasmids, main reagents and instruments

[0029] Neuroblastoma Neuro-2a was purchased from Shanghai Institute of Cell Biology, Chinese Academy of Sciences. Figure 1 ) and ADH5 gene interference lentivirus were provided by Hanheng Biotechnology (Shanghai). PBS (Zhejiang Senrui), trypsin-EDTA, high-glucose DMEM (Hyclone), dimethyl sulfoxide DMSO (Sigma), MEM culture medium, Glutamax, Sodium Pyruvate (Gibco), fetal bovine serum (Hangzhou Sijiqing Biotechnology), puromycin (Hanheng Biotechnology), SYBR GreenqPCR Mix, RNA rapid extraction kit (Yishan), mycoplasma prevention and removal reagent (Biyuntian), pure water purifier (Millipore), biological safety cabinet, carbon dioxide cell culture incubator, high-speed low-temperature centrifuge (Thermo Fisher), inverted microscope (Nikon), T25cm 2 Culture flasks (Corning), 1250, 200, 10μL pipette tips, white eight-well tube strips, 1.5ml / 15mL / 50mL centrifuge tubes, 12-well plates (Labselect), sealing film (Parafilm), manual pipettes (eppendorf), microplate reader (Bio Tek synergy LX, Agilent), RT-qPCR instrument (Roche).

[0030] 1.2 Cell culture

[0031] Neuro-2a cells were cultured in high-glucose DMEM complete medium at 37°C with 5% CO 2 Incubate overnight in an incubator.

[0032] 1.3 Primer design and synthesis

[0033] Target gene siRNA sequence and shRNA sequence:

[0034] siRNA sequence (5'-3'): GACGAATTTGTGACCGGCAAT (SEQ ID No. 3);

[0035] Upstream sequence: 5'-GATCC GACGAATTTGTGACCGGCAATCTCGAGATTGCCGGTCACAAATTCGTCTTTTTTG-3' (SEQ ID No. 1),

[0036] Downstream sequence: 5′-AATTCAAAAAAGACGAATTTGTGACCGGCAATCTCGAGATTGCCGGTCACAAATTCGTCG-3′ (SEQ ID No. 2).

[0037] The primers were designed by Hanheng Biotechnology (Shanghai) Co., Ltd. and synthesized by Shanghai Bioengineering, with a primer concentration of 100uM.

[0038] Primer sequences:

[0039] Forward: 5'- AGT TCG GAT TAA GAT CCT TGC CA-3' (SEQ ID No. 4)

[0040] Reverse: 5'-CCT TCA TGT CCC AAG ATC ACT G-3' (SEQ ID No. 5)

[0041] 1.4 Preparation of shRNA lentiviral expression vector

[0042] shRNA synthesis: 10 × oligo Buffer (commercially available): 2 μL, forward primer: 1 μL, reverse primer: 1 μL, H 2 O: 16 μL, total 20 μL.

[0043] Annealing program: 95 ℃ 10 min, 75 ℃ 10 min, 55 ℃ 10 min, 35 ℃ 10 min, 15 ℃ 10 min; after primer annealing, double-stranded fragments (shRNA) with sticky ends are formed.

[0044] Vector digestion

[0045] The vector was digested with restriction endonucleases (BamHI and MIUⅠ), and the target fragment was recovered by agarose gel electrophoresis.

[0046] The annealed product was connected with the pHBLV-U6-MCS-PGK-PURO vector after enzyme digestion at 22°C for 1-2 hours according to homologous recombination or T4 connection method, and the connection product was transformed into competent DH5a cells, and the bacterial solution was plated and cultured for 12-16 hours. Then single clones were selected for colony PCR verification, and the correct positive clones were sent to Hanheng Bio (Shanghai) for sequencing. The sequencing results were consistent with the target sequence, and the clone samples with correct sequencing were subjected to plasmid extraction to obtain the shRNA lentiviral expression vector (pHBLV-U6-MCS-PGK-PURO-shRNA).

[0047] 1.5 Lentivirus packaging and quality testing

[0048] A three-plasmid lentiviral system was used for virus packaging: the shRNA lentiviral expression vector (a vector plasmid carrying the target gene shRNA), the psPAX2 vector (a virus packaging auxiliary plasmid, Hanbio Biotech (Shanghai) Co., Ltd.) and the pMD2G vector (a virus packaging auxiliary plasmid, Hanbio Biotech (Shanghai) Co., Ltd.) were lysed with Lipofiter TM The transfection reagent was co-transfected into 293T cells. Fresh complete medium containing 10% fetal bovine serum (FBS) was replaced 16 hours after transfection. The virus supernatant was collected after 48 hours and 72 hours, and the virus was ultracentrifuged to obtain the final lentivirus storage solution, which was stored in a -80°C refrigerator. Puromycin was used to determine the lentivirus titer. Titer (TU / mL) = number of cells × percentage of positive clones × MOI (1) × virus dilution factor × 10 3 TU / mL.

[0049] 1.6 Transfection of Neuro-2a cells with shRNA-GSNOR (lentivirus)

[0050] 1.6.1 Preliminary experiment of lentivirus infection of cells

[0051] MOI (Multiplicity of Infection) refers to the number of viruses infected per cell. The higher the MOI, the higher the number of viruses integrated into the chromosome and the expression of the target protein. The steps to find the MOI using a 96-well plate are as follows:

[0052] 1) Cell preparation: Digest and count Neuro-2a cells that are growing well and dilute to 1×10 5 / mL, 96-well plate, 100 μl / well (1×10 4 cells) at 37°C and 5% CO 2 Culture in an incubator overnight. The cell confluence should be 30-50% the next day.

[0053] 2) Virus infection: Use the 1 / 2 small volume method for infection, the steps are as follows:

[0054] Before infection, take the virus out of the refrigerator and slowly thaw it on ice, remove the original culture medium of the cells, and add 50 μl of fresh culture medium;

[0055] Take MOI = 3, 10, 30, 100, add 0.15 μL, 0.5 μL, 1.5 μL, 5 μL of virus stock solution into the corresponding cells respectively, and mix gently.

[0056] Medium change: On the second day after infection (about 24 hours), remove the culture medium containing the virus and replace it with 100 μL of fresh culture medium, and continue to culture at 37 ℃;

[0057] Observe fluorescence: 72 hours after infection, it was found that the cells at MOI = 100 were in good growth state and the infection efficiency was about 80%, so MOI = 100 is the optimal value required for our subsequent experiments.

[0058] 1.6.2 Lentivirus infection of adherent cells

[0059] Cell preparation: Neuro-2a cells with good growth status were seeded into 12-well plates to a cell concentration of 3×10 5 / ml, 500 μL / well, the number of cells in each well is about 1×10 5 Place in 37°C, 5% CO 2 Culture in an incubator overnight. The cell confluence should be 30-50% the next day.

[0060] Virus infection (1 / 2 small volume infection method): Before infection, take out the virus from the refrigerator and slowly melt it on ice, remove the original cell culture medium, add 0.5 mL of fresh culture medium, add 50 μL of virus for infection; set up a control group and add 33.3 μL of virus for infection. Make up to 1 mL 4 hours after lentivirus infection.

[0061] Medium change: On the second day after infection (about 24 hours), aspirate the culture medium containing the virus, replace it with fresh complete culture medium, and continue culturing at 37 ℃.

[0062] Observe fluorescence: 48 hours after infection, when the cells are stable, replace the medium with fresh complete medium containing appropriate concentration of puromycin to screen stable cell lines.

[0063] 1.6.3 Screening of shRNA-GSNOR Neuro-2a cell line with puromycin

[0064] Construction of stable lentiviral strains

[0065] Determine the optimal concentration of puromycin: Spread the cells on a 12-well plate so that the fusion rate is about 50-60% on the second day. After 24 hours, replace the complete medium with different concentrations of puromycin. Set the puromycin gradient to 0.5, 1.0, 2.0, 4.0, 6.0, 8.0 gL / mL for 48 hours. It was found that when the puromycin concentration was 4.0 μg / mL, more than 90% of the non-transfected cells could be killed.

[0066] To perform a puromycin screen:

[0067] Empty cells not infected with the virus were set as the control group, and 4.0 μg / mL of puromycin was added;

[0068] 48-72 hours after lentiviral infection, the infection efficiency was about 80%, and the cells were stable. When the confluence was 60-70%, 4.0 μg / mL of puromycin was added for treatment.

[0069] About 48 hours after drug addition, the death of empty cells in the control group was observed. If the cell death rate of the empty cell group was above 90%, puromycin was removed and fresh culture medium was used for culture.

[0070] Amplification and culture of screened cells: After the puromycin screening is completed, the cells can be subcultured at an appropriate ratio when they are fully grown. After the cells are expanded to a certain number, mixed clones and stable strains can be screened.

[0071] 1.6.4 Detection of GSNOR mRNA levels by real-time fluorescence quantification PCR (qRT-PCR)

[0072] There are 4 cell sample groups from A to D, each with 2 primers: A1: control cell NC / internal reference primer; A2: control cell NC / GSNOR primer; B1: stable cell kd2 / internal reference primer B2: stable cell kd2 / GSNOR primer C1: stable cell kd / internal reference primer C2: stable cell kd4 / GSNOR primer D1: stable cell kd6 / internal reference primer D2: stable cell kd6 / GSNOR primer. Each group has 3 replicate wells.

[0073] Design primers, extract RNA using a kit, measure concentration, and reverse transcribe to obtain cDNA.

[0074] Add 40 μL of DEPC water (i.e., concentration of 10 ng / μL) to cDNA, take 2 μL and add it to the white eight-tube strip, then add 0.5 μL of each downstream primer, 5 μL of SYBR Green, and 2 μL of DEPC water.

[0075] The program was set to denature at 94°C for 10 minutes, followed by 40 cycles of denaturation at 94°C for 10 seconds, annealing at 60°C for 15 seconds, and extension at 72°C for 20 seconds, and finally extension at 72°C for 90 seconds. The C(t) value was obtained based on the melting curve of the product.

[0076] 2. Results

[0077] 2.1 Identification of shRNA lentiviral expression vector plasmid

[0078] The plasmid was sent to Hanheng Biotech for sequencing, and the sequencing results were found to be consistent with the target sequence, indicating that the target plasmid had been successfully constructed ( Figure 2). After the extracted plasmid was verified by QC, it was found that the concentration was greater than 200ng / uL, and 260-280 was between 1.8-2.0, indicating that the plasmid was qualified and could be used for subsequent cell transfection.

[0079] 2.2 Lentiviral packaging and titer detection

[0080] Using Lipofiter TM The transfection reagent co-transfected 293T cells with three plasmids, shRNA lentiviral expression vector (m-Adh5 shRNA), psPAX2 vector, and pMD2G vector. The titer of 293T cells was tested with puromycin. The titer of HBLV-m-Adh5 shRNA1-PURO was 2*10^8 TU / mL, and the titer of HBLV-PURO NC was 3*10^8 TU / mL. The Puro titer test proved that the titer of the lentivirus met the transfection requirements, and the synthesized fragment was effective. The puromycin resistance gene fragment it carried could make the transfected cells resistant to puromycin. The titer of the virus produced was tested with puromycin, and the results are as follows: Figure 3-6 shown.

[0081] 2.3 Effects of lentivirus on cell morphology

[0082] After the lentivirus infected Neuro-2a cells, the cell morphology was not affected and no damage was seen, indicating that the lentivirus had no effect on the survival of the cells ( Figure 7 ).

[0083] 2.4 Real-time fluorescence quantitative PCR detection of GSNOR expression level

[0084] The ADH5 knockdown effect was used to detect the GSNOR mRNA level in the GSNOR shRNA Neuro-2a stable transfectant. The results showed that compared with the control group, the expression level of GSNOR mRNA in the experimental group was significantly reduced, and the ADH5 expression level was about 35% of that in the empty virus group ( Figure 8 ), (p<0.01).

[0085] 2.5CCK-8 assay to detect the protective effect of ADH5 knockdown on neurons in oxygen-glucose deprivation (OGD) model

[0086] The oxygen-glucose deprivation model (OGD) is a classic experimental model used to simulate pathological ischemia and tissue damage. CellCounting Kit-8, referred to as CCK-8 kit, is a rapid, highly sensitive, non-radioactive colorimetric detection method based on WST-8 and widely used in cytotoxicity. In the presence of electron coupling reagents (that is, the cells are alive, breathing, and have energy metabolism), it can be oxidized and reduced by NAD+ to become a water-soluble yellow formazan product. The more living cells there are, the more formazan is produced and the darker the color. After 3-6 hours of OGD injury, the percentage of cell viability was determined by the CCK-8 method, and it was found that the proportion of damaged cells in the group where ADH5 expression was inhibited was significantly lower than that in the untreated group ( Fig. 9 ). The above experimental results show that knocking down ADH5 in nerve cells can reduce the damage caused by hypoxia and glucose deprivation, suggesting that inhibiting the expression of GSNOR may be a potential target for the treatment of ischemic stroke. By knocking down ADH5, the shRNA-Neuro-2a neural cell line was stably constructed. The results showed that the stable GSNOR shRNANeuro-2a cell line was successfully constructed, and the expression level of GSNORmRNA in the stable cell line was significantly reduced.

[0087] The above-described embodiment is only a preferred solution of the present invention and does not limit the present invention in any form. There are other variations and modifications without exceeding the technical solution described in the claims. SEQUENCE LISTING <110> Zhejiang Provincial People's Hospital <120> Ischemic stroke-related shRNA, lentiviral expression vector and its application <130> 2022.06 <160> 5 <170> PatentIn version 3.3 <210> 1 <211> 60 <212> RNA <213> Artificial sequence <400> 1 gatccgacga atttgtgacc ggcaatctcg agattgccgg tcacaaattc gtcttttttg 60 <210> 2 <211> 60 <212> RNA <213> Artificial sequence <400> 2 aattcaaaaa agacgaattt gtgaccggca atctcgagat tgccggtcac aaattcgtcg 60 <210> 3 <211> twenty one <212> RNA <213> Artificial sequence <400> 3 gacgaatttg tgaccggcaa t 21 <210> 4 <211> twenty three <212> DNA <213> Artificial sequence <400> 4 agttcggatt aagatccttg cca 23 <210> 5 <211> twenty two <212> DNA <213> Artificial sequence <400> 5 ccttcatgtc ccaagatcac tg 22

Claims

1. A shRNA associated with ischemic stroke, characterized in that: The upstream sequence of the shRNA is 5'-GATCCGACGAATTTGTGACCGGCAATCTCGAGATTGCCGGTCACAAATTCGTCTTTTTTG-3', and the downstream sequence is 5'-AATTCAAAAAAGACGAATTTGTGACCGGCAATCTCGAGATTGCCG GTCACAAATTCGTCG-3'.

2. A shRNA lentiviral expression vector related to ischemic stroke, characterized in that: The shRNA lentiviral expression vector is pHBLV-U6-MCS-PGK-PURO-shRNA, the upstream sequence of the shRNA is 5'-GATCC GACGAATTTGTGACCGGCAATCTCGAGATTGCCGGTCACAAATTCGTCTTTTTTG-3', and the downstream sequence is 5'-AATTCAAAAAAGACGAATTTGTGACCGGCAATCTCGAGATTGCCG GTCACAAATTCGTCG-3'.

3. The shRNA lentiviral expression vector according to claim 2, characterized in that The shRNA lentiviral expression vector is obtained by cloning the synthesized shRNA into the interference vector pHBLV-U6-MCS-PGK-PURO.

4. Use of the shRNA as claimed in claim 1 in preparing a drug for treating ischemic stroke.

5. Use of the shRNA lentiviral expression vector as claimed in claim 2 in the preparation of a drug for treating ischemic stroke.

Images