PCR specific primers, detection method and PCR kit for detecting Populus alba genome

Abstract

The present invention discloses PCR-specific primers, a detection method, and a detection kit for detecting the genome of Populus alba. Based on the genomes of Populus alba, Xinjiang Populus, Populus davidianus, and Populus tremula, the present invention finds fragments with large differences in the genome through whole-genome sequence comparison analysis, and designs specific primers for each poplar accordingly, from which specific primers that can accurately distinguish the genome of Populus alba from the genomes of other poplars are screened. The present invention further provides a PCR detection method for quickly distinguishing Populus alba from other poplar species using the specific primers. The present invention can quickly distinguish Populus alba from other poplar species. The PCR detection method used is easy to operate, has a simple banding pattern, and can distinguish Populus alba-specific genomic fragments directly by amplifying fragments without sequencing. It has application prospects in the classification and utilization of poplar planting resources and the identification of hybrids.

Description

Technical Field

[0001] The present invention relates to primers and a detection method for detecting poplar species, in particular to PCR-specific primers, a detection method and a PCR kit for detecting the genome of Populus alba L., belonging to the field of PCR detection of Populus alba genome. Background Art

[0002] Currently, primers used for identification of different tree species are mainly SSR-based, but SSR primers exist in all species and are not specific enough at the genomic level and need to be improved.

[0003] To date, there is still a lack of identification primers that are specific only to the genome of Populus alba. The use of such specific identification primers can quickly identify whether a certain tree species has the genomic components of Populus alba, thereby inferring whether Populus alba is involved in the formation of this tree species. Summary of the Invention

[0004] One of the objectives of the present invention is to provide a specific PCR primer pair for accurately identifying the genome of Populus alba;

[0005] The second object of the present invention is to provide a PCR detection method for quickly distinguishing Populus alba from other Populus species;

[0006] The third object of the present invention is to provide a PCR detection kit for detecting the genome of Populus alba.

[0007] The above-mentioned object of the present invention is achieved through the following technical solutions:

[0008] One aspect of the present invention is to provide a specific PCR primer pair for distinguishing the genomes of Populus alba from those of other Populus species, selected from either primer pair 1 or primer pair 2; the nucleotide sequence of the upstream primer of primer pair 1 is: AGTGGTTAATGTAGCCAACTGAG, and the nucleotide sequence of the downstream primer of primer pair 1 is: CCATAATACTACCAAACATCGGAAA;

[0009] The nucleotide sequence of the upstream primer of the primer pair 2 is: AGTGATTTCCCCACGCCTTT, and the nucleotide sequence of the downstream primer of the primer pair 2 is: TACCCCAACAACCACTGAGC.

[0010] The second aspect of the present invention is to provide a PCR detection method for rapidly distinguishing Populus alba from other Populus species, comprising:

[0011] (1) extracting DNA from the poplar sample to be tested;

[0012] (2) using the extracted poplar sample DNA as a template and the upstream primer and downstream primer shown in primer pair 1 or primer pair 2 as PCR amplification primers to establish a PCR reaction system for PCR amplification;

[0013] (3) If a specific amplification band appears, it indicates that the poplar sample to be tested contains the Populus alba genome component; wherein, the upstream primer and downstream primer of primer pair 1 are used as PCR amplification primers to establish a PCR reaction system for PCR amplification. If a specific amplification band of 835 bp appears, it indicates that the poplar sample to be tested contains the Populus alba genome component; wherein, the upstream primer and downstream primer of primer pair 2 are used as PCR amplification primers to establish a PCR reaction system for PCR amplification. If a specific amplification band of 598 bp appears, it indicates that the poplar sample to be tested contains the Populus alba genome component.

[0014] As a preferred embodiment of the present invention, the PCR reaction system established in step (2) includes: 2 μL of sample DNA to be detected, 10 μL of PCR Mix, 0.5 μL of upstream primer, 0.5 μL of downstream primer, and 7 μL of double-distilled water.

[0015] As a preferred embodiment of the present invention, the PCR amplification procedure in step (2) includes: 95°C for 5 min, 95°C for 30 s, annealing for 30 s, 72°C for 30 s, 35 cycles, 72°C for 5 min, 12°C, ∞.

[0016] The third aspect of the present invention is to provide a PCR detection kit for detecting the genome of Populus alba, comprising: Taq enzyme, dNTP, Mg 2+ , ddH2O and PCR amplification primers; wherein the PCR amplification primers are composed of upstream and downstream primers whose nucleotide sequences are shown in primer pair 1 or primer pair 2 respectively.

[0017] The specific PCR primer pair for identifying the genome of Populus alba provided by the present invention can quickly distinguish Populus alba from other Populus species. The PCR detection method amplification and agarose gel electrophoresis are convenient to operate, the banding pattern is simple, and the specific genome fragments of Populus alba can be distinguished directly through the amplified fragments without sequencing, which effectively saves manpower and material resources. It has a good application prospect in the classification and utilization of poplar planting resources and the identification of hybrids. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Electrophoresis results of specific bands amplified by PCR using specific primers for the selected Populus alba genome; 1-5 are Populus alba, Populus xinjiangensis, Populus siliquae, Populus tremula, and water (negative control), respectively.

[0019] Figure 2Results of PCR amplification using some nonspecific primers during the screening of genome-specific primers for Populus alba; 1-5 are Populus alba, Populus xinjiangensis, Populus scolopendra, Populus tremula, and water (negative control), respectively. DETAILED DESCRIPTION

[0020] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not limit the scope of the present invention in any way. It should be understood by those skilled in the art that the details and forms of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, and such modifications and replacements fall within the scope of protection of the present invention.

[0021] Experimental Example 1 Screening of specific PCR primers for identifying the genome of Populus alba

[0022] 1. Test materials

[0023] Genomic DNA from Populus alba L., Populus alba var. pyramidalis Bge., Populus adenopoda Maxim., and Populus davidiana Dode, as well as water (negative control), was used. Based on the genomes of these four poplar species previously obtained by our laboratory, whole-genome sequence alignment analysis revealed highly divergent segments within the genomes. Specific primers were designed for each species accordingly, with 100 pairs of primers designed for each chromosome (Table 1 lists only the nucleotide sequences of the designed primers). Primers were then screened by PCR amplification to select primers that specifically amplify the Populus alba genome.

[0024] Table 1 lists some amplification primers designed using the same design principles and methods to distinguish the genome of Populus alba.

[0025] Table 1 PCR primers used for amplification and screening of specific fragments of the Populus alba genome

[0026]

[0027] 2. Test methods

[0028] The above four genomes were amplified by PCR using the primer sets screened above.

[0029] PCR reaction system (20 μL): DNA 2 μL (10-30 ng / μL), PCR Mix 10 μL (Sangon Biotech, Shanghai), upstream primer 0.5 μL (10 μM), downstream primer 0.5 μL (10 μM), pure water 7 μL.

[0030] The PCR reaction procedure was as follows: 95°C for 5 min, 95°C for 30 s, annealing for 30 s, 72°C for 30 s, 35 cycles, 72°C for 5 min, 12°C, ∞. The products were electrophoresed on a 1.5% agarose gel, and primers that expressed specific bands in the P. alba genome were selected based on the banding results.

[0031] 3. Test results

[0032] The amplification results of the specific primers designed in Table 1 are shown in Figure 1 and Figure 2 The distinction standard is the presence or absence of bands. If a band appears in lane 1, the genome component of Populus alba is detected.

[0033] Depend on Figure 1 From the amplification results, it can be seen that only two pairs of primers (Chr03a-1 and Chr05a-10) among the 18 pairs of primers in Table 1 can amplify a single specific band, among which Chr03a-1 has better amplification effect, higher sensitivity, and the results are easier to distinguish.

[0034] according to Figure 2 It can be seen that the 16 primer pairs in Table 1 are not specific for the Populus alba genome and can simultaneously amplify corresponding fragments of other poplars. They cannot be used as specific primers to identify whether poplar samples contain the Populus alba genome.

Claims

1. A specific PCR primer pair for distinguishing the genome of Populus alba L from that of other Populus species, characterized in that: Selected from any one pair of primer pair 1 or primer pair 2; the nucleotide sequence of the upstream primer of the primer pair 1 is: AGTGGTTAATGTAGCCAACTGAG, and the nucleotide sequence of the downstream primer of the primer pair 1 is: CCATAATACTACCAAACATCGGAAA; The nucleotide sequence of the upstream primer of the primer pair 2 is: AGTGATTCCCCACGCCTTT, and the nucleotide sequence of the downstream primer of the primer pair 2 is: TACCCCAACAACCACTGAGC.

2. The specific PCR primer pair according to claim 1, characterized in that The other Populus species include Populus alba var. pyramidalis Bge., Populus adenopoda Maxim., and Populus davidiana Dode.

3. Use of the specific PCR primer pair according to claim 1 in detecting the genome of Populus alba.

4. A PCR detection method for distinguishing Populus alba L from other Populus species, characterized in that: include: (1) extracting DNA from the poplar sample to be tested; (2) using the extracted poplar sample DNA as a template and the upstream primer and downstream primer of the primer pair 1 or primer pair 2 described in claim 1 as PCR amplification primers to establish a PCR reaction system for PCR amplification; (3) If a specific amplified band appears, it indicates that the poplar sample to be tested contains the genome components of Populus alba.

5. The PCR detection method according to claim 4, characterized in that A PCR reaction system is established using the upstream primer and the downstream primer of the primer pair 1 of claim 1 as PCR amplification primers for PCR amplification. If a specific amplification band of 835 bp appears, it indicates that the poplar sample to be tested contains the alba poplar genomic component; a PCR reaction system is established using the upstream primer and the downstream primer of the primer pair 2 of claim 1 as PCR amplification primers for PCR amplification. If a specific amplification band of 598 bp appears, it indicates that the poplar sample to be tested contains the alba poplar genomic component.

6. The PCR detection method according to claim 4, characterized in that The PCR reaction system established in step (2) includes: 2 μL of sample DNA to be detected, 10 μL of PCR Mix, 0.5 μL of upstream primer, 0.5 μL of downstream primer, and 7 μL of double-distilled water.

7. The PCR detection method according to claim 4, characterized in that The PCR amplification procedure described in step (2) includes: 95°C for 5 min, 95°C for 30 s, annealing for 30 s, 72°C for 30 s, 35 cycles, 72°C for 5 min, 12°C, ∞.

8. The PCR detection method according to claim 4, characterized in that The other Populus species include Populus alba var. pyramidalis Bge., Populus adenopoda Maxim., and Populus davidiana Dode.

9. A PCR detection kit for detecting the genome of Populus alba, comprising: Taq enzyme, dNTP, Mg 2+ , ddH2O and a PCR amplification primer pair; characterized in that the PCR amplification primer pair is selected from any one of primer pair 1 or primer 2; the nucleotide sequence of the upstream primer of primer pair 1 is: AGTGGTTAATGTAGCCAACTGAG, and the nucleotide sequence of the downstream primer of primer pair 1 is: CCATAATACTACCAAACATCGGAAA; The nucleotide sequence of the upstream primer of the primer pair 2 is: AGTGATTCCCCACGCCTTT, and the nucleotide sequence of the downstream primer of the primer pair 2 is: TACCCCAACAACCACTGAGC.

10. Use of the PCR detection kit according to claim 9 in detecting the genome of Populus alba.

Images