Transcription regulating nucleotide sequences and methods of use thereof
By linking a constitutive promoter-active nucleic acid sequence to a target polynucleotide in a plant, a recombinant gene is constructed and an insecticidal protein is expressed. This solves the problem of insufficient gene expression regulation in existing technologies and achieves a stable insecticidal effect without affecting plant health.
Patent Information
- Application Number
- CN202180020894.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2020-11-20
- Filing Date
- 2021-03-11
- Publication Date
- 2026-02-13
- Estimated Expiration
- 2041-03-11
AI Technical Summary
Existing technologies are insufficient to effectively regulate gene expression in plants to achieve specific phenotypic improvements, and the lack of suitable promoters leads to poor genetic modification effects.
By using a nucleic acid sequence with constitutive promoter activity (such as SEQ ID NO:1 or SEQ ID NO:2), a recombinant gene is operatively linked to the target polynucleotide and introduced into plant cells to achieve stable expression of functional proteins such as insecticidal proteins at moderate expression levels.
This technology enables the stable expression of functional proteins such as insecticidal proteins in plants, avoiding toxic effects on plants and achieving insecticidal effects without affecting plant growth.
Smart Images

Figure CN115279909B_ABST
Abstract
Description
Field of the invention
[0001] Described herein are nucleic acids having constitutive promoter activity, and the use of such nucleic acids having constitutive promoter activity to express a polynucleotide of interest in a plant.
[0002] BACKGROUND
[0003] Modifying plants to alter and / or improve phenotypic characteristics, such as productivity or quality, requires overexpression or downregulation of endogenous genes or expression of heterologous genes in plant tissues. Such genetic modification relies on the availability of means to drive and control gene expression as desired. In practice, genetic modification relies on the availability and use of suitable promoters that are effective in plants and regulate gene expression to produce the desired effect in plants.
[0004] SUMMARY
[0005] In one aspect, described herein is a recombinant gene for regulating expression of a polynucleotide of interest, the recombinant gene comprising a nucleic acid having constitutive promoter activity that is at least 80% identical to the nucleic acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2, or a functional fragment thereof. In some embodiments, the nucleic acid having constitutive promoter activity is at least 80% (or at least 90%, 95%, 98%, or at least 99%) or more identical to the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the nucleic acid having constitutive promoter activity comprises the nucleic acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
[0006] In some embodiments, the recombinant gene further comprises at least one polynucleotide of interest operably linked to the nucleic acid having constitutive promoter activity. In some embodiments, the polynucleotide of interest is a herbicide tolerance-encoding sequence, an insecticidal-encoding sequence, a nematicidal-encoding sequence, an antimicrobial-encoding sequence, an antifungal-encoding sequence, an antiviral-encoding sequence, an abiotic and biotic stress tolerance-encoding sequence, or a sequence that modifies plant traits such as yield, grain quality, nutrient content, starch quality and quantity, nitrogen fixation and / or utilization, and oil content and / or composition. In some embodiments, the polynucleotide of interest is heterologous with respect to the nucleic acid having constitutive promoter activity.
[0007] In another aspect, the disclosure provides a vector comprising the recombinant gene described herein. In some embodiments, the vector is an expression vector.
[0008] In another aspect, the disclosure provides a host cell comprising the recombinant gene or vector described herein. In some embodiments, the host cell is a plant cell.
[0009] In another aspect, the present disclosure provides a plant or plant part or seed comprising a recombinant gene or vector described herein or a heterologous nucleic acid having constitutive promoter activity described herein. In some embodiments, the plant or plant part or seed is a monocot plant or plant part. In some embodiments, the plant or plant part or seed is a dicot plant or plant part or seed. In some embodiments, the plant or plant part is hemizygous for the recombinant gene. In some embodiments, the plant or plant part is homozygous for the recombinant gene.
[0010] In another aspect, the present disclosure provides a method of expressing a polynucleotide of interest in a host cell comprising (a) introducing or providing into the host cell a nucleic acid having constitutive promoter activity, a recombinant gene or vector described herein. In some embodiments, the host cell is a plant cell. In some embodiments, the detectable amount of accumulated protein encoded by the polynucleotide of interest is about 0.01-1.15% (or about 0.05-1.15%, or about 0.1-1.15%, or about 0.5-1.15%, or about 1-1.15%) of total soluble protein extracted. The term "total soluble protein (TSP)" as used herein refers to all proteins that are capable of being solubilized in a buffer suitable for protein quantification that is typically facilitated by mechanical disruption.
[0011] In another aspect, the present disclosure provides a method of producing a plant or plant part or seed comprising (a) introducing into a plant cell a nucleic acid having constitutive promoter activity, a recombinant gene or vector described herein; and (b) regenerating a plant or plant part from the plant cell. In some embodiments, two or more copies of the recombinant gene are introduced into the plant cell.
[0012] In another aspect, the present disclosure provides a method of providing pesticidal activity in a plant comprising introducing or providing into a host cell of the plant a recombinant gene comprising a polynucleotide sequence encoding a pesticidal protein. In some embodiments, the pesticidal protein is an insecticidal protein. In some embodiments, two or more copies of the recombinant gene are introduced into the plant cell. BRIEF DESCRIPTION OF DRAWINGS
[0014] Figure 1 The components of plasmid pBay 02059 are described, including the nucleic acid having constitutive promoter activity shown in SEQ ID NO: 1 (P-bdc 16-1.2) and the insect resistance gene. Figure 1 One aspect of the subject matter in accordance with an embodiment is shown.
[0015] Figure 2Provided are schematic diagrams of various deletion variants of SEQ ID NO: 1 (P-bdc16-1.2) as set forth in Example 2, respectively, SEQ ID NO: 2 (P-bdc16-1.3), SEQ ID NO: 3 (P-bdc16-1.4), and SEQ ID NO: 4 (P-bdc16-1.5).
[0016] Figure 3 Provided are graphs showing the level of expression of the insect resistance gene when operably linked to the nucleotide sequences set forth in SEQ ID NOs 1, 2, 3, and 4.
[0017] Figure 4 is a graph showing expression data (RNA-seq) of the native soybean glyma13g33190 from which the promoter P-bdc 16-1.2 (SEQ ID NO: 1) was derived.
[0018] Figure 5 is a bar graph showing the percentage of insect resistance gene expressed per total soluble protein (TSP) in primary transformants (T0) of two soybean cultivars (maturity group 3 (MG3) and maturity group 8 (MG8)).
[0019] Figure 6 is a scatter plot showing the percentage of insect resistance gene expressed per total soluble protein (TSP) expressed in primary transformants (T0) of two soybean cultivars (MG3 and MG8).
[0020] Figure 7 is a bar graph showing the percentage of insect resistance gene expressed per total soluble protein (TSP) as one or two copies of T1 segregating events from pBay02059 vector in two soybean cultivars (MG3 and MG8).
[0021] Figure 8 is a scatter plot showing the percentage of insect resistance gene expressed per total soluble protein (TSP) as one or two copies of T1 segregating events from pBay02059 vector in MG3 soybean cultivar.
[0022] Figure 9 is a scatter plot showing the percentage of insect resistance gene expressed per total soluble protein (TSP) as one or two copies of T1 segregating events from pBay02059 vector in MG8 cultivar. DETAILED DESCRIPTION
[0024] The present disclosure provides an isolated nucleic acid having constitutive promoter activity and a recombinant gene comprising the nucleic acid having constitutive promoter activity that directs constitutive transcription / expression of an operably linked polynucleotide of interest in a plant cell, plant, or plant part or seed. The present invention is based on the discovery that a nucleic acid having constitutive promoter activity comprising the nucleic acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2, and functional fragments thereof, has constitutive promoter activity in plants and provides a moderate level of expression of a polynucleotide of interest (e.g., a polynucleotide encoding an insecticidal protein). This moderate expression allows the protein (e.g., an insect resistance protein / insecticidal toxin) to be expressed at a level such that the protein effectively functions as an insecticide without adverse effects (e.g., toxicity) to the plant.
[0025] In one aspect, described herein are recombinant genes for modulating expression of a polynucleotide of interest, the recombinant genes comprising a nucleic acid having constitutive promoter activity that is at least 80% (or at least 90%, 95%, 98%, or at least 99%) identical to the nucleic acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2, or a functional fragment thereof. In some embodiments, the nucleic acid having constitutive promoter activity comprises the nucleic acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
[0026] As used herein, "a nucleic acid having promoter activity" refers to the nucleotide sequence of a promoter.
[0027] As used herein, the term "functional fragment thereof" refers to a nucleic acid sequence that is shorter in length than the nucleic acid having constitutive promoter activity set forth in SEQ ID NO: 1 or SEQ ID NO: 2, but still retains the activity of the nucleic acid having constitutive promoter activity set forth in SEQ ID NO: 1 or SEQ ID NO: 2. For example, in some embodiments, a functional fragment of the nucleic acid having constitutive promoter activity comprises a nucleotide sequence that is at least 850 bp, at least 900 bp, or at least 1000 bp in length, and retains the activity of the nucleic acid having constitutive promoter activity.
[0028] Expression vectors
[0029] Another object of the present invention relates to a vector comprising the recombinant gene of the present invention.
[0030] The term "vector" includes phage, plasmid, viral or retroviral vectors and artificial chromosomes, such as bacterial or yeast artificial chromosomes. In addition, the term also relates to targeting constructs which allow the random or site-directed integration of the targeting construct into the genomic DNA. Such targeting constructs comprise DNA of sufficient length for homologous or heterologous recombination, as described in detail below. The vector comprising the polynucleotide of the application can comprise a selectable marker for propagation and / or selection in a host. The vector can be incorporated into a host cell by various techniques well known in the art. If introduced into a host cell, the vector can reside in the cytoplasm or can be incorporated into the genome. In the latter case, it will be appreciated that the vector can further comprise nucleic acid sequences which allow for homologous recombination or heterologous insertion. The vector can be introduced into prokaryotic or eukaryotic cells by conventional transformation or transfection techniques. The terms "transformation" and "transfection", conjugation and transduction as used in the context of the present application are intended to encompass a variety of procedures known in the art for introducing exogenous nucleic acid (e.g. DNA) into a host cell, including calcium phosphate, rubidium chloride or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, natural competence, carbon-based clustering, chemical-mediated transfer, electroporation or particle bombardment (e.g. "gene gun"). Suitable methods for transformation or transfection of host cells, including plant cells, can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nded., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) and other laboratory manuals, such as Methods in Molecular Biology, 1995, Vol. 44, Agrobacterium protocols, Eds.: Gartland and Davey, Humana Press, Totowa, New Jersey. Alternatively, the plasmid vector can be introduced by heat shock or electroporation techniques. If the vector is a virus, it can be packaged in vitro using a suitable packaging cell line prior to administration to the host cell. The retroviral vector can be replication-competent or replication-defective. In the latter case, viral propagation will generally only occur in a complementing host / cell.
[0031] The vectors mentioned herein can be suitable as cloning vectors, i.e. can be replicated in microbial systems. Such vectors ensure efficient cloning in bacteria, yeast or fungi and make possible the stable transformation of plants. Those which must be mentioned are in particular the various binary and co-integrated vector systems which are suitable for T DNA-mediated transformation. In general, such vector systems are characterized in that they contain at least the vir genes required for Agrobacterium-mediated transformation and sequences which delimit the T-DNA (T-DNA borders). These vector systems can also comprise further cis-regulatory regions, such as promoters and terminators and / or selection markers with which suitable transformed host cells or organisms can be identified. While the co-integrated vector systems have the vir genes and the T DNA sequences arranged on the same vector, the binary systems are based on at least two vectors, one of which carries the vir genes, but does not contain the T-DNA, while the second vector carries the T-DNA, but not the vir genes. The last-mentioned vectors are therefore relatively small, easy to manipulate and can be replicated in E. coli and Agrobacterium. An overview of binary vectors and their use can be found in Hellens et al., Trends in Plant Science (2000) 5, 448-451. Furthermore, by using suitable cloning vectors, the recombinant genes of the present application can be introduced into host cells or organisms (such as plants or animals) and thus used for the transformation of plants, as disclosed and cited in those documents: Plant Molecular Biology and Biotechnology (CRC Press, Boca Raton, Florida), Chapter 6 / 7, pages 71-119 (1993); F. F. White, Vectors for Gene Transfer in Higher Plants; in: Transgenic Plants, vol. 1, Engineering and Utilization, eds.: Kung and R. Wu, Academic Press, 1993, 15-38; B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, vol. 1, Engineering and Utilization, eds.: Kung and R. Wu, Academic Press (1993), 128-143; Potrykus, Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991), 205-225.
[0032] The vectors of the application can be expression vectors. In such expression vectors, the recombinant gene comprises a nucleic acid having constitutive promoter activity as described above, which allows expression in eukaryotic cells or isolated fractions thereof. In addition to the recombinant gene of the application, the expression vector can comprise additional regulatory elements, including transcriptional and translational enhancers. The expression vector can also be a gene transfer or targeting vector. Expression vectors derived from viruses such as retroviruses, vaccinia virus, adeno-associated virus, herpes simplex virus, or bovine papilloma virus can be used to deliver the recombinant gene or vector of the application into the targeted cell population. Methods well known to those skilled in the art can be used to construct recombinant viral vectors; see, for example, the techniques described in Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989) N.Y. and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y. (1994).
[0033] Suitable expression vector backbones can be derived from expression vectors known in the art, such as the Okayama-Berg cDNA expression vector pcDVl (Pharmacia), pCDM8, pRc / CMV, pcDNAI, pcDNA3 (Invitrogene), or pSPORTI (GIBCO BRL). Other examples of typical fusion expression vectors are pGEX (Pharmacia Biotech Inc; Smith, D. B., and Johnson, K. S (1988) Gene 67: 31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ) in which glutathione S-transferase (GST), maltose E-binding protein, and protein A respectively are fused to the N-terminus of the polypeptide of interest to be expressed. Target gene expression from the pTrc vector is based on transcription from a hybrid trp-lac fusion promoter under the control of IPTG inducible lac repressor. Target gene expression from the pET 11d vector is based on transcription from a T7-gn10-lac fusion promoter, which is mediated by a co-expressed viral RNA polymerase (T7 gn1). This viral polymerase is provided in the host strain BL21 (DE3) or HMS 174 (DE3) from a resident L- phage containing the T7 gn1 gene under the transcriptional control of the lacUV 5 promoter. Examples of vectors for expression in Saccharomyces cerevisiae include pYepSec1 (Baldari et al. (1987) EMBO J. 6: 229-234), pMFa (Kurjan and Herskowitz (1982) Cell 30: 933-943), pJRY88 (Schultz et al. (1987) Gene 54: 113-123), and pYES2 (Invitrogen Corporation, San Diego, CA).Vectors and methods for constructing vectors suitable for other fungi (e.g., filamentous fungi) include those described in detail in van den Hondel, C.A.M.J.J., & Punt, P.J. (1991) "Gene transfer systems and vector development for filamentous fungi, in: Applied Molecular Genetics of fungi, J.F. Peberdy et al. eds., pp. 1-28, Cambridge University Press: Cambridge, or in: More Gene Manipulations in Fungi (J.W. Bennett & L.L. Lasure, eds., pp. 396-428: Academic Press: San Diego). Other suitable yeast vectors are, for example, pAG-1, YEp6, YEp13, or pEMBLYe23.
[0034] In some embodiments, one vector (or multiple vectors) comprising a recombinant gene described herein is propagated and amplified in a suitable organism (i.e., an expression host). In some embodiments, one copy of the vector is propagated and amplified in the suitable organism. In some embodiments, two or more (e.g., 3, 4, 5, 6, 7, 8, or more) copies of the vector are propagated and amplified in the suitable organism.
[0035] The term "recombinant gene" as used herein refers to a linear or circular nucleic acid molecule. It includes DNA as well as RNA sequences which are capable of directing the expression of a specific nucleotide sequence in an appropriate host cell. Typically, it comprises a promoter operably linked to a polynucleotide of interest, which is optionally operably linked to a termination signal and / or other regulatory elements. A recombinant gene of the present application is characterized in that it shall comprise a nucleic acid having constitutive promoter activity as defined herein. The recombinant gene can further comprise sequences which can be required for the correct translation of the nucleotide sequence. The coding region typically encodes a protein of interest, but can also encode a functional RNA of interest, e.g. an antisense RNA or a non-translated RNA, in the sense or antisense orientation. The recombinant gene comprising the polynucleotide sequence of interest can be chimeric, meaning that at least one of its components is heterologous with respect to at least one of the other components. The recombinant gene can also be a gene which is naturally occurring but obtained in a recombinant form which is useful for heterologous expression. The recombinant gene can be assembled entirely extracellularly (e.g. by recombinant cloning techniques). However, it is also possible to assemble the recombinant gene using partial endogenous components. For example, a recombinant gene can be obtained by placing (or inserting) a promoter sequence upstream of (or into) an endogenous sequence, thereby functionally linking and bringing it under control of said promoter sequence. Likewise, a nucleic acid sequence to be expressed can be placed (or inserted) downstream of (or into) an endogenous promoter sequence, thereby forming a recombinant gene. In another embodiment, such a recombinant gene will comprise a transcriptional initiation region linked to a nucleotide sequence of interest. Such a recombinant gene can have multiple restriction sites for insertion of a gene of interest under the transcriptional control of the regulatory region. The recombinant gene can additionally contain a selectable marker gene. The cassette will include in the 5'-3' direction of transcription and translation initiation regions operable with the plant, the DNA sequence of interest, and transcriptional and translational termination regions. The termination region can be native with the transcriptional initiation region, with the DNA sequence of interest, or can be derived from another source. Convenient termination regions are available from the Ti plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions, and others described below (see also Guerineau 1991 ; Proudfoot 1991 ; Sanfacon 1991 ; Mogen 1990; Munroe 1990; Balias 1989; Joshi 1987). The recombinant gene can also comprise a multiple cloning site. In this case, the multiple cloning site can be arranged in a manner that allows the polynucleotide to be introduced into the multiple cloning site to be operably linked to the transcriptional regulatory sequence. In addition to the components described above, the recombinant gene of the present application can comprise components required for homologous recombination, i.e. flanking genomic sequences from the target locus. However, a recombinant gene consisting essentially of a nucleic acid having constitutive promoter activity is also contemplated, as defined below.
[0036] The term "operably linked" or "functionally linked" refers to the association of nucleic acid sequences on a single nucleic acid fragment such that the function of one is affected by the other. For example, a regulatory DNA sequence is said to be "operably linked" or "associated" with a DNA sequence encoding a RNA or polypeptide if the two sequences are in a position relative to each other such that the regulatory DNA sequence affects the expression of the coding DNA sequence (i.e., the coding sequence or functional RNA is under the transcriptional control of the promoter). A coding sequence can be operably linked to a regulatory sequence in sense or antisense orientation.
[0037] The term "promoter" as used herein refers to a nucleotide sequence, usually upstream (5') to its coding sequence, which controls the transcription of the coding sequence by providing a recognition for RNA polymerase and other factors needed for proper transcription. A "promoter" includes the basal promoter, a short DNA sequence, which in some cases includes a TATA box and other sequences whose role is to specify precisely the transcription initiation site, on which regulatory elements can be added for enhancing expression. A "promoter" also refers to a nucleotide sequence, including the basal promoter and regulatory elements, which is capable of controlling the expression of a coding sequence or a functional RNA. This type of promoter sequence includes proximal and more remote upstream elements, the latter often referred to as enhancers. Thus, an "enhancer" is a DNA sequence stimulating the promoter activity, and can be an intrinsic element of the promoter or an inserted heterologous element, to enhance the level or tissue specificity of the promoter. It can function in both orientation (normal or inverted), and can function when moved either upstream or downstream from a promoter. Enhancers and other upstream promoter elements bind sequence-specific DNA-binding proteins that mediate their effects.
[0038] A promoter can also contain DNA sequences involved in the binding of protein factors that control the efficiency of transcription initiation in response to physiological or developmental conditions. The "start site" is the position around the first nucleotide, which is part of the transcribed sequence, also defined as position +1. All other sequences of the gene and their control regions are numbered with respect to this site. Downstream sequences (i.e., other protein coding sequences in the 3' direction) are designated positive, while upstream sequences (most of the control regions in the 5' direction) are designated negative. Promoter elements that are inactivated or whose activity is greatly reduced under conditions of upstream activation, such as the TATA element, are referred to as "basal" or "core" promoters. The basal promoter functions to allow transcription in the presence of appropriate transcription factors. Thus, a "basal" or "core" promoter consists only of all the essential elements needed for transcription initiation, such as the TATA box and / or the initiator.
[0039] The term "constitutive promoter" as used herein refers to a promoter (ORF) that is capable of expressing an open reading frame in all or nearly all plant tissues during all or nearly all stages of plant development. Each transcriptional activation element does not exhibit absolute tissue specificity, but mediates transcriptional activation in most plant tissues at least at a level of 1% of the highest transcriptional activity in the plant tissue in which the highest transcriptional activity is achieved. "Constitutive expression" refers to expression using a constitutive promoter.
[0040] As used herein, the term "cis-regulatory element" or "promoter motif" refers to a cis-acting transcriptional regulatory element that contributes to one aspect of the overall control of gene expression. Cis-elements can function to bind transcriptional factors, which are trans-acting protein factors that regulate transcription. Some cis-elements bind more than one transcriptional factor, and transcriptional factors can interact with more than one cis-element with different affinities. The promoters of the present application desirably contain cis-elements that contribute to or regulate gene expression. Cis-elements can be identified by a variety of techniques, including deletion analysis, i.e., deletion of one or more nucleotides from the 5' end or middle of a promoter; DNA binding protein analysis using DNase I footprinting; methylation interference, electrophoretic mobility shift assays; in vivo genomic footprinting by ligation-mediated PCR, and other conventional assays; or by DNA sequence similarity analysis with known cis-elements by conventional DNA sequence comparison methods. The fine structure of a cis-element can be further investigated by mutagenesis (or substitution) of one or more nucleotides, or by other conventional methods. Cis-elements can be obtained by chemical synthesis, or by isolation from promoters containing such elements, and can be synthesized to contain additional flanking nucleotides containing useful restriction enzyme sites to facilitate manipulation of the sequence.
[0041] The term "heterologous" with respect to a nucleic acid molecule or DNA means a nucleic acid molecule that is operably linked to, or manipulated to become operably linked to, a second nucleic acid molecule that is not operably linked to it in nature or is operably linked to it in a different location in nature. For example, a promoter of the application is functionally linked to its native coding sequence in its natural environment, whereas in the application it can be linked to another coding sequence, possibly from the same organism, a different organism or a synthetic coding sequence. It will also be understood that a coding sequence under the control of a promoter of the application is heterologous to said promoter because its sequence has been manipulated by, for example, mutation (such as insertion, deletion, etc.) such that the native sequence of said coding sequence is modified and thus becomes heterologous to the promoter of the application. Furthermore, a nucleic acid having constitutive promoter activity is heterologous to a plant, plant part or seed comprising it if it is synthetic, derived from another organism to which it cannot be hybridized (transgenic), another organism to which it can be hybridized (cisgenic), or the same organism as compared to a control plant (cisgenic) (e.g. wild type plant) that is given its natural genomic location. It will be understood that given the genomic location means that the nucleic acid having constitutive promoter activity is located on another chromosome or on the same chromosome but 10 kb or more, such as 10 kb, preferably 5 kb or more, such as 5 kb, more preferably 1000 bp or more, such as 1000 bp, even more preferably 500 bp or more, such as 500 bp, particularly preferably 100 bp or more, such as 100 bp, most preferably 10 bp or more, such as 10 bp, away from its natural genomic location in a wild type plant.
[0042] Expression in a host cell
[0043] In another aspect, described herein is a method of expressing a polynucleotide of interest in a host cell, comprising introducing a recombinant gene or vector described herein into the host cell and expressing the polynucleotide of interest in the host cell.
[0044] The term "expression" as used herein refers to the transcription and / or translation of an endogenous gene, ORF or part thereof, transgene or cisgene in a plant. For example, in the case of an antisense construct, expression can refer only to the transcription of the antisense DNA. Furthermore, expression refers to the transcription and stable accumulation of sense (mRNA) or functional RNA. Expression can also refer to the production of a protein.
[0045] The "expression pattern" of a promoter (with or without an enhancer) is the pattern of expression levels showing where and at which developmental stage transcription is initiated by the promoter in a plant. A set of promoters is considered to have complementary expression patterns when the expression pattern of one promoter shows little overlap with the expression pattern of the other promoter. Expression levels of a promoter can be determined by measuring the "steady state" concentration of a standard transcribed reporter mRNA. This measurement is indirect, since the concentration of the reporter mRNA depends not only on its rate of synthesis, but also on the rate of mRNA degradation. Thus, the steady state level is the product of the rate of synthesis and the rate of degradation. However, when the transcribed sequence is identical, the rate of degradation can be considered to proceed at a fixed rate, and thus this value can be used as a measure of the rate of synthesis. When comparing promoters in this way, the techniques available to the skilled artisan are hybrid S1-RNase analysis, northern blotting and competitive RT-PCR. This list of techniques is in no way representative of all available techniques, but rather describes commonly used procedures for analyzing transcriptional activity and mRNA expression levels. In practice, analysis of the transcription start site of all promoters reveals that the beginning of transcription is usually not a single base, but rather a more or less clustered set of start sites, each responsible for several start sites of mRNA. Since this distribution differs between promoter and promoter, the sequence of the reporter mRNA of each group also differs from each other. Since each mRNA more or less tends to be degraded, different reporter mRNAs are not expected to have a single rate of degradation. It has been shown that for a number of eukaryotic promoter sequences, the sequence surrounding the start site ("initiator") plays an important role in determining the expression level of the RNA directed by that particular promoter. This also includes parts of the transcribed sequence. Thus, direct fusion of a promoter to a reporter sequence leads to suboptimal transcription levels. A commonly used procedure for analyzing expression patterns and levels is by determining the "steady state" levels of protein accumulation in a cell. Commonly used candidates for reporter genes known to the skilled artisan are β-glucuronidase (GUS), chloramphenicol acetyl transferase (CAT) and proteins with fluorescent properties, such as the green fluorescent protein (GFP) of Aequora victoria. However, in principle, more proteins are suitable for this purpose, as long as the protein does not interfere with essential plant functions. A number of tools are available for quantification and determination of distribution. Detection systems can be readily created, or are available based on, for example, immunochemistry, enzymatic, fluorescent detection and quantification. Using in situ analysis of protein expression, protein levels in plant tissue extracts or intact tissues can be determined. In general, a single transformed line with a chimeric promoter-reporter construct can vary in its expression level of the reporter gene. It is also frequently observed that such transformants do not express any detectable product (RNA or protein). The variation in expression is often attributed to "position effects", although the molecular mechanism of this inactivation is often not clear.
[0046] Expression of a polynucleotide of interest can be determined by various well-known techniques, for example by Northern blotting or in situ hybridization techniques as described in WO 02 / 102970.
[0047] Nucleic acid
[0048] The term "nucleic acid" as used herein refers to a polymer of deoxyribonucleotides or ribonucleotides in either single- or double-stranded form, including a monomer (nucleotide) containing a sugar, a phosphate, and a base, the base being either a purine or a pyrimidine. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides, which have similar binding properties to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and
[0049] "Isolated nucleic acid", used interchangeably herein with "isolated DNA", refers to a nucleic acid that is not in its natural genomic environment, regardless of its length and sequence. Isolated DNA can for example refer to a DNA that is physically separated from the genomic environment, such as a fragment of genomic DNA. Isolated DNA can also be artificially produced DNA, such as chemically synthesized DNA, or DNA produced by amplification reactions, such as the polymerase chain reaction (PCR) as well known in the art. Isolated DNA can further refer to DNA that is present in a context in which it is not naturally found. For example, isolated DNA can refer to a DNA fragment present in a plasmid. Furthermore, isolated DNA can refer to a DNA fragment present in another chromosomal context than the one in which it is naturally found, such as for example in another location in the genome than the natural location, in the genome of another species than the one in which it is naturally found, or in an artificial chromosome.
[0050] Also contemplated are nucleic acid variants of nucleic acids having constitutive promoter activity that retain the activity of the wild-type nucleic acid having constitutive promoter activity. The term "variant" as used herein with respect to a sequence (e.g., a polypeptide or nucleic acid sequence, such as, for example, a nucleic acid of the application having constitutive promoter activity) is intended to denote a substantially similar sequence. Naturally occurring allelic variants such as these can be identified by using known molecular biologic techniques, such as, for example, the polymerase chain reaction (PCR) and hybridization techniques.
[0051] Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated by the use of site-directed mutagenesis. Generally, nucleotide sequence variants of the application will have at least 70%, for example, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% to 79%, typically at least 80%, for example, 81%-84%, at least 85%, for example, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, to 98% and 99% nucleotide sequence identity with the natural (wild-type or endogenous) nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 or a functional fragment thereof.
[0052] As used herein, "sequence identity" or "identity" in the context of two nucleic acid or polypeptide sequences refers to the residues in the two sequences that are the same when aligned for the maximum length of comparison window. When percent sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues having similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity can be adjusted to correct for the conservative nature of the substitution. Sequences which differ by such conservative substitutions are said to have "sequence similarity" or "similarity". Means for making this adjustment are well known in the art. Typically, this involves scoring a conservative substitution as a partial rather than complete mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is scored as a 1, a non-conservative substitution is scored as 0, and a conservative substitution is scored as between 0 and 1, such as a function of the difference between the two amino acids involved in the substitution. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC / GENE (Intelligenetics, Mountain View, Calif.).
[0053] The term "substantial identity" of polynucleotide sequences refers to a polynucleotide comprising at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%, at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, at least 90%, 91%, 92%, 93%, or 94%, and at least 95%, 96%, 97%, 98%, or 99% sequence identity to a reference sequence using one of the algorithm programs described using standard parameters. Those skilled in the art will recognize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences, taking into account codon degeneracy, amino acid similarity, reading frame positioning, etc.
[0054] Another indication that nucleotide sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions (see below). Typically, stringent conditions will be selected to be about 5°C lower than the thermal melting point (Tm) for a specific sequence at a defined ionic strength and pH. However, stringent conditions can encompass temperatures ranging from about 1°C to about 20°C lower than Tm, depending upon the desired degree of stringency, as is understood in the art. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides they encode are substantially identical. This can occur, e.g., when a copy of a nucleic acid is created using the best
[0055] "Stringent hybridization conditions" and "stringent hybridization wash conditions" in the context of nucleic acid hybridization experiments (e.g., Southern and Northern hybridizations) are sequence-dependent, and vary depending on a variety of parameters including the length and G-C content of the sequence. Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Specificity is typically a function of the post-hybridization wash conditions, with key factors being the ionic strength and temperature of the wash solutions. For DNA-DNA hybrids, Tm can be approximated by the equation of Meinkoth and Wahl, 1984:
[0056] Tm = 81.5°C + 16.6(log 10 M) + 0.41(%GC) - 0.61(% form) - 500 / L
[0057] Where M is the molar concentration of the monovalent cation, %GC is the percentage of guanosine and cytidine nucleotides in the DNA, %form is the percentage of formamide in the hybridization solution, and L is the length of the heterozygote by base pairs. Each 1% mismatch reduces Tm by approximately 1°C; therefore, Tm, hybridization, and / or washing conditions can be adjusted to hybridize sequences with ideal identity. For example, if a sequence with >90% identity is sought, Tm can be reduced by 10°C. Generally, the chosen stringent conditions are approximately 5°C lower than the heat melting point I of the specific sequence and its complement at the defined ionic strength and pH. However, stringent stringent conditions can be used for hybridization and / or washing at approximately 1, 2, 3, or 4°C lower than the heat melting point I; moderately stringent conditions can be used for hybridization and / or washing at approximately 6, 7, 8, 9, or 10°C lower than the heat melting point I; and low stringent conditions can be used for hybridization and / or washing at approximately 11, 12, 13, 14, 15, or 20°C lower than the heat melting point I. Using this equation, the hybridization and washing compositions, and the ideal temperature (T), those skilled in the art will understand that variations in the stringent conditions of the hybridization and / or washing solutions are inherently described. If the ideal degree of mismatch results in a T below 45°C (including aqueous solutions) or 32°C (formamide solutions), it is preferable to increase the SSC concentration so that higher temperatures can be used. Extensive guidance on nucleic acid hybridization can be found in Tijssen, 1993. Generally, highly stringent hybridization and washing conditions are chosen to be approximately 5°C lower than the thermal melting point (Tm) of the specific sequence at defined ionic strengths and pH.
[0058] An example of a high stringency wash condition is about 15 minutes at 72°C in 0.15 M NaCl. An example of a moderately stringent wash condition is a 15 minute wash in 0.2x SSC at 65°C (see, Sambrook, supra, for a description of SSC buffer). Typically, a low stringency wash is preceded by a high stringency wash to remove background probe signal. An exemplary moderately stringent wash for duplexes of, e.g., greater than 100 nucleotides, is 1x SSC at 45°C for 15 minutes. An exemplary low stringency wash for duplexes of, e.g., greater than 100 nucleotides, is 4 to 6x SSC at 40°C for 15 minutes. For short probes (e.g., about 10 to 50 nucleotides), stringency conditions typically involve salt concentrations of less than about 1.5 M, more preferably about 0.01 to 1.0 M Na ion (or other salt) at pH 7.0 to 8.3, and temperatures of at least about 30°C, for long probes (e.g., >50 nucleotides) of at least about 60°C. Stringent conditions can also be achieved with the addition of destabilizing agents, such as formamide. Generally, a signal to noise ratio of 2X (or greater) observed for a particular hybridization assay indicates that a specific hybridization is detected, if the encoded proteins are substantially identical, nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical. This occurs, e.g., when nucleic acid copies are generated using the maximum codon degeneracy allowed for by the genetic code.
[0059] Very high stringency wash conditions are equal to the Tmof the particular probe. An example of high stringency hybridization conditions for complementary nucleic acids that have more than 100 complementary residues is 50% formamide, e.g., hybridization at 37°C in 50% formamide, 1 M NaCl, 1% SDS, and a wash in 0.1x SSC at 60 to 65°C. Exemplary low stringency conditions include hybridization in 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulfate) at 37°C, and a wash in 1x to 2x SSC at 50 to 55°C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.5x to 1x SSC at 55 to 60°C.
[0060] The following are examples of hybridization / washing condition sets that can be used to clone nucleotide sequences that are substantially identical to the reference nucleotide sequences of the present application: the reference nucleotide sequence preferably is hybridized to the reference nucleotide sequence in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM EDTA at 50°C, washed in 2xSSC, 0.1% SDS at 50°C (very low stringency conditions), more preferably hybridized to the reference nucleotide sequence in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM EDTA at 50°C, washed in lxSSC, 0.1% SDS at 50°C (low stringency conditions), more preferably still hybridized to the reference nucleotide sequence in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM EDTA at 50°C, washed in 0.5xSSC, 0.1% SDS at 50°C (moderate stringency conditions), preferably hybridized to the reference nucleotide sequence in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM EDTA at 50°C, washed in 0.1xSSC, 0.1% SDS at 50°C (high stringency conditions), more preferably hybridized to the reference nucleotide sequence in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM EDTA at 50°C, washed in 0.1xSSC, 0.1% SDS at 65°C (very high stringency conditions).
[0061] In some embodiments, the nucleic acid molecules described herein can be "optimized" to enhance expression in plants of interest (see, e.g., WO 91 / 16432; Periak 1991; Murray 1969). In this manner, the open reading frames in the genes or gene fragments can be synthesized using plant-preferred codons (for a discussion of host-preferred codon usage, see, e.g., Campbell & Gowri. 1990). Thus, nucleotide sequences can be optimized for expression in any plant. It is recognized that all or any portion of a gene sequence can be optimized or synthesized. That is, synthetic or partially optimized sequences can also be used. Variant nucleotide sequences and proteins also encompass sequences and proteins derived from mutagenic and recombinogenic procedures, such as DNA shuffling. Using such procedures, one or more different coding sequences can be manipulated to create a new polypeptide having desired properties. In this way, libraries of recombinant polynucleotides are generated from a population of related polynucleotide sequences, which contain regions of substantial sequence identity and can be homologously recombined in vitro or in vivo. Strategies for such DNA shuffling are known in the art (see, e.g., Stemmer 1994; Stemmer 1994; Crameri 1997; Moore 1997; Zhang 1997; Crameri 1998; and US 5,605,794, 6,8,10 and 12,837,458).
[0062] polynucleotide of interest
[0063] The term "polynucleotide of interest" as used herein refers to a nucleic acid that is expressed under the control of a nucleic acid having constitutive promoter activity as described herein. The polynucleotide of interest can encode a polypeptide whose presence in a plant cell, plant or plant part as mentioned herein is desired. Such a polypeptide can be an enzyme required for the synthesis of a seed storage compound, or can be a seed storage protein. It will be appreciated that if the polynucleotide of interest encodes a polypeptide, it can be necessary to transcribe the nucleic acid into RNA and to translate the transcribed RNA into a polypeptide. The polynucleotide of interest can also include a biologically active RNA molecule and an antisense RNA, a ribozyme, a microRNA or an siRNA. For example, due to the seed-specific expression of an antisense RNA, a ribozyme, a microRNA or an siRNA, an undesired enzyme activity in the seed can be reduced. The underlying biological principles of the potential biological effects of the above-mentioned biologically active RNA molecules are well known in the art. Furthermore, it is well known to the person skilled in the art how to obtain a nucleic acid encoding such a biologically active RNA molecule. It will be appreciated that a biologically active RNA molecule can be obtained directly by transcription of a nucleic acid of interest, i.e. without translation into a polypeptide. Preferably, the at least one polynucleotide of interest expressed under the control of a nucleic acid having constitutive promoter activity according to the present application is heterologous with respect to said nucleic acid having constitutive promoter activity, i.e. it is not naturally under its control, but said control is generated in a non-natural way (e.g. by genetic engineering methods).
[0064] The operable linkage in connection with any of the recombinant genes described herein can be achieved by various methods known in the art, including in vitro and in vivo procedures. Thus, the recombinant genes of the present application or a vector comprising such a recombinant gene can be achieved by using standard recombination and cloning techniques well known in the art (see e.g. Maniatis 1989; Silhavy 1984; Ausubel 1987).
[0065] An operable linkage can, for example, comprise a nucleic acid having constitutive promoter activity as described herein (e.g., a nucleotide sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 2, or a functional fragment thereof) in sequential arrangement with a nucleic acid sequence to be expressed, and, optionally, other regulatory elements, such as, for example, polyadenylation or transcription termination elements, enhancers, introns, etc., in an arrangement such that the nucleic acid having constitutive promoter activity can fulfill its function in the process of expressing the nucleic acid sequence of interest under appropriate conditions. The term "appropriate conditions" can mean the presence of the recombinant gene in a plant cell. A preferred arrangement is one in which the nucleic acid sequence of interest to be expressed is placed downstream (i.e., in the 3' direction) of the nucleic acid of the application having constitutive promoter activity in a covalent linkage of the two sequences. Optionally, additional sequences can be inserted between the two sequences. Such sequences can be, for example, linkers or multiple cloning sites. In addition, sequences encoding portions of a fusion protein can be inserted (in the case where a fusion protein of the protein encoded by the nucleic acid of interest is intended to be expressed). Preferably, the distance between the nucleic acid of interest to be expressed and the nucleic acid of the application having constitutive promoter activity is no more than 200 base pairs, preferably no more than 100 base pairs, more preferably no more than 50 base pairs.
[0066] In some embodiments, the recombinant gene is assembled by inserting a nucleic acid having constitutive promoter activity as described herein (e.g., a nucleotide sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 2, or a functional fragment thereof) into the plant genome. This insertion will result in an operable linkage with a nucleic acid sequence of interest that is already present in the genome itself. By virtue of the transcriptional regulatory properties of the nucleic acid having constitutive promoter activity, the nucleic acid of interest is expressed in a constitutive manner by virtue of the insertion. The insertion can be directed or fortuitous. When the insertion is directed, it can be achieved, for example, by gene editing. By this procedure, the native promoter can be exchanged for the nucleic acid of the application having constitutive promoter activity, thereby modifying the expression profile of the endogenous gene. The nucleic acid having constitutive promoter activity can also be inserted in such a way as to express an antisense mRNA of the endogenous gene, thereby inducing gene silencing.
[0067] Similarly, a nucleic acid of interest to be expressed can be inserted into a plant genome that comprises a nucleic acid having constitutive promoter activity in its native genomic environment (i.e., linked to its native gene), in such a way that the inserted sequence is operably linked to the nucleic acid having constitutive promoter activity, thereby forming a recombinant gene of the application.
[0068] The recombinant gene can be used for a variety of expression purposes, such as, for example, the expression of a protein, or the expression of an antisense RNA, sense or double-stranded RNA. The expression of the nucleic acid sequence can confer on the plant an agronomically valuable trait.
[0069] In some embodiments, the polynucleotide of interest is obtained from an insect resistance gene; a disease resistance gene, such as, for example, a bacterial disease resistance gene, a fungal disease resistance gene, a viral disease resistance gene, or a nematode disease resistance gene; a herbicide resistance gene; a gene affecting grain composition or quality; a nutrient utilization gene; a mycotoxin reduction gene; a male sterility gene; a selection marker gene; a screening marker gene; a negative selection marker; a positive selection marker; a gene affecting a plant agronomic characteristic (i.e., yield, standability, etc.); or an environmental or stress resistance gene, i.e., one or more genes conferring herbicide resistance or tolerance, insect resistance or tolerance, disease resistance or tolerance (viral, bacterial, fungal, oomycete, or nematode), stress tolerance or resistance (e.g., resistance or tolerance to drought, heat, cold, freezing, excess moisture, salt stress, or oxidative stress), increased yield, food content and composition, physical appearance, male sterility, dry down, standability, fecundity, starch properties or quantity, oil quantity and quality, amino acid or protein composition, etc.
[0070] “Resistant” refers to a plant that exhibits essentially no phenotypic change as a result of active agent application, infection by a pathogen, or exposure to stress. “Tolerant” refers to a plant that, although it can exhibit some phenotypic change as a result of infection, has essentially no reduction in reproductive capacity or essentially no change in metabolism.
[0071] In some embodiments, the polynucleotide of interest is a selection marker gene. As used herein, the term “selection marker gene” refers to a gene that confers a growth advantage to a plant or plant cell transformed with the selection marker as compared to a plant or plant cell that has not been transformed with the plant recombinant gene and thus does not comprise the selection marker gene in the presence of the corresponding selection compound (e.g., herbicide) in the growth medium. The selection marker gene and / or the plant recombinant gene of the marker gene can be heterologous to the plant to be transformed, and thus not naturally occurring in the plant to be transformed.
[0072] In some embodiments, the selection marker gene is a negative selection marker gene. A negative selection marker gene confers resistance and / or increased tolerance to a selected compound (e.g., a herbicide). Exemplary selection marker genes include, but are not limited to, HPPD inhibitors as described in WO / 2011 / 095460, which is incorporated herein by reference in its entirety; glyphosate acetyltransferase (PAT; also known as diammonium phosphate resistance; bar; De Block et al. (1987) Plant Physiol 91:694-701; EP 0 333033; U.S. Patent No. 4,975,374), 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS; U.S. Patent No. 5,633,435), or the glyphosate oxidoreductase gene (U.S. Patent No. 5,463,175), which confer resistance to glyphosate. TM Resistance to (N-(phosphonomethyl)glycine) (Shah et al. (1986) Science 233:478). Glyphosate TM Degrading enzymes (glyphosate) TM Oxidoreductases; gox), sulfonylurea-inactivated acetyllactate synthase and imidazolinone-inactivated acetyllactate synthase (e.g., mutant ALS variants bromobenzonitrile with, for example, S4 and / or Hra mutations). TM A nitrile hydrolase (bxn) kanamycin- or G418-resistance gene (NPTII; NPTI) encodes, for example, neomycin phosphotransferase (Fraley et al., (1983), Proc Natl Acad Sci USA 80:4803), the expression of which confers resistance to the antibiotic kanamycin and related antibiotics neomycin, paromomycin, gentamicin and G418, and a dicamba degrading enzyme (O-demethylase, oxygenase, ferroredoxin) marker gene (Behrens et al. 2007 Science 316: 1185-1188; US Patent No. 7,022,896), which confers resistance to the toxic effects of D-amino acids (e.g. D-alanine and D-serine) (WO03 / 060133). The marker genes in this competition could be the daol gene (EC: 1.4.3.3; GenBank accession number: U60066) from the yeast Rhodotorula gracilis (Rhodosporidium toruloides) and the Escherichia coli gene dsdA (D-serine dehydratase [EC: 4.3.1.18; GenBank accession number: J01603]).
[0073] In some embodiments, the selectable marker gene is a positive selection marker that confers a growth advantage to the transformed plant compared to the untransformed plant. Exemplary positive selection markers include, but are not limited to, mannose-6-phosphate isomerase (in combination with mannose), UDP-galactose-4-epimerase (in combination with, e.g., galactose), or mannose-6-phosphate isomerase in combination with mannose.
[0074] In some embodiments, the selectable marker gene is an acetohydroxy acid synthase (AHAS) gene, or a mutated AHAS gene. Acetohydroxy acid synthase (also known as acetolactate synthase or ALS) is a protein found in plants and microorganisms that catalyzes the first step in the synthesis of branched chain amino acids (valine, leucine, and isoleucine). Preferably, it has the enzymatic activity described in Enzyme Commission Code EC 2.2.1.6. A mutated AHAS protein preferably confers resistance to at least one imidazolinone herbicide. Imidazolinone herbicides are well known in the art, and preferably include imazapyr, imazaquin, imazethapyr, imazamethapyr, imazamox, and imazapic. Preferably, the imidazolinone herbicide is imazaquin. More preferably, the imidazolinone herbicide is imazethapyr. Most preferably, the imidazolinone herbicide is imazapyr.
[0075] Exemplary mutated AHAS genes are disclosed in WO 2004 / 005516 or WO 2008 / 124495, the entire disclosures of which are incorporated herein by reference. Further mutated AHAS genes are disclosed in WO 2006 / 015376 or WO 2007 / 054555 or US 20100287641. Mutated AHAS enzymes confer resistance to imidazolinone herbicides.
[0076] Further selectable marker genes are marker genes that confer resistance or increased tolerance to the toxic effects of D-amino acid application. Such marker genes can encode proteins capable of metabolizing D-amino acids. The D-amino acids can be D-alanine and D-serine. The marker genes can encode D-serine deaminase, D-amino acid oxidase, and D-alanine transaminase. Preferred examples of such marker genes that encode proteins capable of metabolizing D-amino acids are those disclosed in International Patent Publication Nos. WO 03 / 060133, WO 05 / 090584, WO 07 / 107,516, and WO 08 / 077,570, which are incorporated herein by reference in their entireties.
[0077] In some embodiments, the polynucleotide of interest is a herbicide resistance gene encoding a herbicide resistance protein. Exemplary herbicide resistance genes include, but are not limited to, genes encoding phosphinothricin acetyl transferase (bar and pat), glyphosate-tolerant EPSP synthase genes, glyphosate-degrading enzyme genes gox encoding glyphosate oxidoreductase, deh (encoding a dehalogenase enzyme that inactivates dalapon), herbicide resistance (e.g., sulfonylurea and imidazolinone) acetolactate synthase and bxn genes (encoding nitrilase enzymes that degrade bromoxynil). The bar and pat genes encode the enzyme phosphinothricin acetyl transferase (PAT), which inactivates the herbicide phosphinothricin and prevents this compound from inhibiting glutamine synthetase. The enzyme 5-enolpyruvylshikimate 3-phosphate synthase (EPSP synthase) is normally inhibited by the herbicide N-(phosphonomethyl)glycine (glyphosate). However, genes encoding glyphosate-resistant EPSP synthase are known. The deh gene encodes a dalapon dehalogenase enzyme and confers resistance to the herbicide dalapon. The bxn gene encodes a specific nitrilase enzyme that converts bromoxynil to a non-herbicidal degradation product.
[0078] In some embodiments, the polynucleotide of interest is an insect resistance gene or a variant thereof that encodes an insect resistance protein. Such variants can include synthetically derived sequences, including but not limited to sequences that are fusions of two or more polynucleotides of interest (e.g., two or more insect resistance genes). Exemplary insect resistance genes include, but are not limited to, genes encoding insecticidal proteins such as Cry and Cyt proteins, as well as genes encoding insecticidal proteins such as vegetative insecticidal proteins known as "VIP" proteins, all of which are well known to those skilled in the art. Examples of such genes include Cryl, such as members of the CrylA, CrylB, CrylC, CrylD, CrylE, CrylF, and CrylL families; Cry2, such as members of the Cry2A family; Cry9, such as members of the Cry9A, Cry9B, Cry9C, Cry9D, Cry9E, and Cry9F families; and members of the Vip3 family, among others. Those skilled in the art will appreciate that a plant can comprise any gene that confers a desirable agronomic trait. Exemplary insect resistance genes include, but are not limited to, Bacillus thuringiensis crystal toxin genes or Bt genes (Ward md 1985). Bt genes can provide resistance to Lepidoptera or Coleoptera pests such as European corn borer (ECB) and corn rootworm (CRW). Bt toxin genes useful in such embodiments can include CrylA(b) and CrylA(c) genes. In this regard, endotoxin genes from other Bacillus thuringiensis species that affect insect growth or development can also be used. Protease inhibitors can also provide insect resistance (Johnson 1989) and thus would be of utility in plant transformation. The use of the protease inhibitor II gene pinll from tomato or potato is envisioned to be particularly useful. Other genes encoding inhibitors of the insect digestive system or genes encoding enzymes or cofactors that facilitate the production of inhibitors can also be useful. Cysteine protease inhibitors and amylase inhibitors, such as those from wheat and barley, can illustrate this group.
[0079] In addition, genes encoding lectins can confer additional or alternative insecticidal properties. Lectins (originally known as phytohemagglutinins) are multivalent carbohydrate-binding proteins that have the ability to agglutinate red blood cells from a range of species. Lectins have recently been identified as insecticidal agents with activity against corn rootworm, ECB, and rootworm (Murdock 1990; Czapla & Lang, 1990). Lectin genes expected to be useful include, for example, barley and wheat germ agglutinin (WGA) and rice agglutinin (Gatehouse 1984), with WGA being preferred.
[0080] Genes that control the production of large or small polypeptides active against insects, such as, for example, lytic peptides, peptide hormones, and toxins and venoms, are introduced into insect pests form another aspect of the application. For example, expression of juvenile hormone esterase against a particular insect pest is also expected to result in insecticidal activity, or can result in metamorphosis arrest (Hammock 1990).
[0081] Plants and Host Cells
[0082] Host cells or non-human organisms comprising the recombinant genes described herein are also contemplated. They can be prokaryotic or eukaryotic organisms. Microorganisms and higher organisms are included. Examples of microorganisms are bacteria, yeasts, algae, and fungi. Preferred bacteria are Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Pseudomonas, Bacillus, or Cyanobacterium (such as, for example, Synechocystis) and other bacteria described in Brock Biology of Microorganisms, 8thEdition (pages A-8, A-9, A10, and A11). In some embodiments, the cell or non-human organism comprising the recombinant genes described herein is a plant cell or a plant (as defined herein). In some embodiments, the plant is hemizygous for the recombinant gene. In some embodiments, the plant is homozygous for the recombinant gene.
[0083] Other examples of microorganisms are those capable of infecting plants and transferring DNA into their genome, especially bacteria of the genus Agrobacterium, preferably Agrobacterium tumefaciens and Agrobacterium rhizogenes. Preferred yeasts are Candida, Saccharomyces, Hansenula, and Pichia. Preferred fungi are Aspergillus, Trichoderma, Ashbya, Neurospora, Fusarium, and Beauveria.
[0084] In some embodiments, the host cell is a plant cell, a plant, a plant seed or other plant part, a non-human animal, or a multicellular microorganism. The term "plant" as used herein refers to a eukaryotic multicellular organism that performs photosynthesis. Plants include green algae (Chlorophyta), red algae (Rhodophyta), glaucophytes (Glaucophyta), mosses and liverworts (bryophytes), seedless vascular plants (horsetails, clubmosses, ferns), and seed plants (gymnosperms and angiosperms). The term "plant" encompasses whole plants, ancestors and progeny of the plants, and plant parts, including seeds, shoots, stems, leaves, roots, flowers, and tissues and organs, each of which comprises a gene / nucleic acid of interest. The term "plant" also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen, microspores, and propagules, likewise each of which comprises a gene / nucleic acid of interest.
[0085] The term "plant part" as used herein includes all components of a plant, including seeds, shoots, stems, leaves, roots, flowers, plant tissues and plant organs, plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen, microspores, and propagules. A "propagule" is any kind of organ, tissue or cell of a plant that is capable of developing into a whole plant. Propagules can be based on vegetative reproduction (also known as vegetative reproduction, asexual reproduction or vegetative cloning) or sexual reproduction. A propagule can thus be a seed or a part of a non-reproductive organ, such as a stem or a leaf. In particular, for Poaceae, a suitable propagule can also be a part of a stem, i.e. a stem cutting.
[0086] Particularly contemplated are plants, plant parts or seeds comprising a recombinant gene or vector as described herein. The recombinant gene or vector can be present in the cytoplasm of the organism or can be incorporated into the genome by heterologous or homologous recombination. Host cells, in particular those obtained from plants or animals, can be introduced into developing embryos to obtain mosaic or chimeric organisms, i.e. organisms, i.e. plants, comprising a host cell as described herein. Suitable organisms are, for example, all organisms suitable for expressing a recombinant gene.
[0087] Plants expressing genes encoding enzymes that affect the integrity of the insect cuticle form another aspect of the present application. Such genes include those encoding, for example, chitinases, proteases, lipases, and genes for the production of nikkomycin, a compound that inhibits chitin synthesis, introduction of any of these genes is contemplated to produce insect-resistant maize plants. Genes encoding activities that affect insect molting, such as those affecting the production of ecdysteroid UDP-glucosyltransferase, also fall within the range of useful transgenes of the present application.
[0088] Genes encoding enzymes that facilitate the production of compounds that decrease the nutritional quality of a host plant to an insect pest are also included in the present application. For example, plants can be rendered insecticidally active by altering the sterol composition of the plant. Sterols are obtained by insects from their diet and are used for hormone synthesis and membrane stability. Thus, altering the sterol composition of a plant by expressing a new gene, such as those that directly facilitate the production of undesirable sterols or those that convert desirable sterols to an undesirable form, can have a negative impact on insect growth and / or development and thus render the plant insecticidally active. Lipoxygenases are naturally occurring plant enzymes that have been shown to exhibit an antinutritive effect on insects and decrease the nutritional quality of their diet. Thus, other embodiments of the present application relate to plants having enhanced lipoxygenase activity that can be resistant to insect feeding.
[0089] The properties of the plants, plant parts, and seeds are not limited; for example, the plants, plant parts, or seeds can be monocotyledonous or dicotyledonous plants. In some embodiments, the plants, plant parts, or seeds are from a monocotyledonous plant. In some embodiments, the plants or plant parts are from a dicotyledonous plant. Examples of plant cells for use according to the present disclosure include, but are not limited to, cells (or whole plants or plant parts) derived from the following genera; Ananas, Musa, Vitis, Fragaria, Lotus, Medicago, Onobrychis, Trifolium, Trigonella, Vigna, Citrus, Carica, Persea, Prunus, Syragrus, Theobroma, Coffea, Linum, Pelargonium, Manihot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa, Capsicum, Datura, Hyoscyamus, Lycopersicon, Nicotiana, Solanum, Petunia, Digitalis, Majorana, Mangifera, Cichorium, Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum, Heterocallis, Nemesia, Pelargonium, Panicum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucurbita, Cucumis, Browaalia, Lolium, Malus, Apium, Gossypium, Vicia, Lathyrus, Lupinus, Pachyrhizus, Wisteria, Stizolobium, Agrostis, Phleum, Dactylis, Sorghum, Setaria, Zea, Oryza, Triticum, Secale, Avena, Hordeum, Saccharum, Poa,Festuca, Stenotaphrum, Cynodon, Coix, Olyreae, Phareae, Glycine, Pisum, Psidium, Passiflora, Cicer, Phaseolus, Lens, and Arachis.
[0090] In some embodiments, the plant cell comprises a cell (or whole plant or plant part) from the poaceae family, such as the genera Hordeum, Secale, Avena, Sorghum, Eleusine, Festuca, Panicum, Oryza, Zea, Triticum, and the like, such as Hordeum vulgare, Hordeum jubatum, Hordeum murinum, Hordeum secalinum, Hordeum distichon, Hordeum aegiceras, Hordeum hexastichon, Hordeum hexastichum, Hordeum irregular, Hordeum sativum, Hordeum secalinum, Secale cereale, Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. strigosa, Avena fatua var. sativa, Avena fatua var. strigosa, Avena fatua var. sativa, Avena fatua var. strigosa, Avena fatua var. sativa, Avena fatua var. strigosa, Avena fatua var. sativa, Avena fatua var. strigosa, Avena fatua var. sativa, Avena fatua var. strigosa, Avena fatua var. sativa, Avena fatua var. strigosa, Avena fatua var. sativa, Avena fatua var. strigosa, Avena fatua var. sativa, Avena fatua var. strigosa, Avena fatua var. sativa, Avena fatua var. strigosa, Avena fatua var. sativa, Avena fatua var. strigosa, Avena fatua var. sativa, Avena fatua var. strigosa, Avena fatua var. sativa, Avena fatua var. strigosa, Avena fatua var. sativa, Avena fatua var. strigosa, Avena fatua var. sativa, Avena fatua var. strigosa, Avena fatua var. sativa, AvenAvena sativa, Avena hybrida, Sorghum bicolor, Sorghum halepense, Sorghum saccharatum, Sorghum vulgare, Andropogon drummondii, Holcus bicolor, Holcus sorghum, Sorghum aethiopicum, Sorghum arundinaceum, Sorghum caffrorum, Sorghum cernuum, Sorghum dochna, Sorghum drummondii, Sorghum durra, Sorghum guineense, Sorghum lanceolatum, Sorghum nervosum, Sorghum saccharatum, Sorghum subglabrescens, Sorghum verticilliflorum, Sorghum vulgare, Holcus halepensis, Sorghum miliaceum, Panicum militaceum, Oryza sativa, Oryza latifolia, Zea mays, Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum, or Triticum vulgare.
[0091] In some embodiments, the plant to be used is an oil crop comprising a large amount of lipid compounds, such as peanut, rapeseed, canola, sunflower, safflower, poppy, mustard, hemp, castor oil plant, olive, sesame, calendula, pomegranate, evening primrose, mullein, thistle, wild rose, hazel, apricot, macadamia, avocado, laurel, pumpkin / squash, flax, soybean, pistachio, borage, woody (oil palm, coconut, walnut) or a crop such as corn, wheat, rye, oat, triticale, rice, barley, cotton, cassava, pepper, marigold, a Solanaceae plant such as potato, tobacco, eggplant and tomato, Vicia species, pea, alfalfa or shrubs (coffee, cocoa, tea), Salix species and perennial grasses and forage crops. The plant according to the application can be an oil crop such as peanut, rapeseed, canola, sunflower, safflower, poppy, mustard, hemp, castor oil plant, olive, calendula, pomegranate, pumpkin / squash, flax, soybean, borage, woody (oil palm, coconut).
[0092] Also contemplated is a method of producing a plant or plant part (including plant tissue, plant organ, plant or seed) comprising introducing a recombinant gene of a vector described herein into a plant cell and regenerating the plant cell to form a plant tissue, plant organ, plant or seed.
[0093] Also contemplated is a method of providing a plant with pesticidal activity comprising introducing a recombinant gene of a vector described herein comprising a nucleotide sequence encoding a pesticidal protein into a plant cell and regenerating the plant cell to form a plant or plant part, including plant tissue, plant organ, plant or seed, thereby providing the plant with pesticidal activity. In some embodiments, the pesticidal activity is insecticidal activity.
[0094] A recombinant gene can be introduced into a plant cell using any of a number of art- recognized methods. A plant species can be transformed with a DNA construct or recombinant gene described herein by DNA-mediated transformation of plant cell protoplasts, followed by regeneration of plants from the transformed protoplasts according to procedures well known in the art.
[0095] Any plant tissue capable of subsequent clonal propagation, whether by organogenesis or embryogenesis, can be transformed with the vectors described herein. As used herein, the term "organogenesis" refers to the process by which shoots and roots develop sequentially from the center of a meristem; the term "embryogenesis" as used herein refers to the process by which shoots and roots develop together in a coordinated manner (not sequentially), whether from somatic or gametic tissue, the particular tissue chosen will vary depending on the clonal propagation system available and best suited for the particular species to be transformed, exemplary tissue targets include leaf disks, pollen, embryos, cotyledons, hypocotyls, megagametophytes, callus tissue, existing meristematic tissue (e.g., apical meristem, axillary buds, and root meristems), and induced meristem tissue (e.g., cotyledon meristem and leaf meristem).
[0096] Plants can take a variety of forms. For example, plants can be chimeras of transformed and untransformed cells; plants can be clonal transformants (e.g., all cells transformed to contain the recombinant gene); plants can comprise grafts of transformed and untransformed tissues (e.g., transformed rootstock grafted to untransformed scion in Citrus species). Transformed plants can be propagated in a variety of ways, such as by clonal propagation or classical breeding techniques. For example, a first generation (or Tl) transformed plant can be selfed to generate homozygous second generation (or T2) transformed plants, and the T2 plants further propagated by classical breeding techniques. A dominant selectable marker (e.g., npt II) can be associated with the recombinant gene to aid in breeding.
[0097] Transformation of plants can be performed with a single DNA molecule or multiple DNA molecules (i.e., co-transformation), and both techniques are suitable for the recombinant genes described herein. A number of transformation vectors are available for plant transformation, and the recombinant genes of the present application can be used in conjunction with any such vector. The choice of vector will depend on the transformation technique chosen and the target species for transformation.
[0098] A variety of techniques are available for introducing constructs into plant cell hosts and are known to those of skill in the art. Exemplary techniques include transformation with DNA using A. tumefaciens or A. rhizogenes as a transformation agent, liposomes, PEG precipitation, electroporation, DNA injection, direct DNA uptake, microprojectile bombardment, particle acceleration, and the like (see, e.g., EP 295959 and EP 138341) (see below). However, cells other than plant cells can be transformed with the recombinant genes described herein. General descriptions of plant expression vectors and reporter genes, as well as Agrobacterium and Agrobacterium-mediated gene transfer, can be found in Gruber et al. (1993).
[0099] Expression vectors containing the genomic or synthetic fragments can be introduced into protoplasts or whole tissues or isolated cells. Expression vectors can be introduced into whole tissues. General methods for culturing plant tissues are provided, for example, by Maki et al. (1993); and Phillips et al. (1988). Expression vectors can be introduced into corn or other plant tissues using direct gene transfer methods such as microprojectile-mediated delivery, DNA injection, electroporation, and the like. Expression vectors can also be introduced into plant tissues using biolistic devices using microprojectile media. See, for example, Tomes et al. (1995). The vectors of the present application can be used not only for expression of structural genes, but also for exon trapping cloning or promoter trapping procedures to detect differential gene expression in various tissues (Lindsey 1993; Auch & Reth 1990).
[0100] In some embodiments, binary vectors of the Tl and Ri plasmids of Agrobacterium can be used to transform a variety of higher plants, including monocots and dicots, such as soybean, cotton, canola, tobacco, and rice (Pacciotti 1985: Byrne 1987; Sukhapinda 1987; Lorz 1985; Potrykus, 1985; Park 1985: Hiei 1994). The use of T-DNA to transform plant cells has been extensively studied and is well described (EP 120516; Hoekema, 1985; Knauf, 1983; and An 1985).
[0101] Other transformation methods can be utilized by those skilled in the art, such as direct uptake of foreign DNA constructs (see EP 295959), electroporation techniques (Fromm 1986) or high velocity ballistic bombardment with metal particles coated with nucleic acid constructs (Kline 1987 and US 4,945,050). Once transformed, cells can be regenerated by those skilled in the art. Of particular interest are the methods currently described for transforming foreign genes into important economic crops, such as canola (De Block 1989), sunflower (Everett 1987), soybean (McCabe 1988; Hinchee 1988; Chee 1989; Christou 1989; EP 301749), rice (Hiei 1994) and corn (Gordon-Kamm 1990; Fromm 1990).
[0102] Those skilled in the art will appreciate that the choice of method depends on the type of plant being transformed, i.e., monocot or dicot. Suitable methods for transforming plant cells include, but are not limited to, microinjection (Crossway 1986), electroporation (Riggs 1986), Agrobacterium-mediated transformation (Hinchee 1988), direct gene transfer (Paszkowski 1984), and the use of ballistic particle acceleration using equipment available from Agracetus, Inc., Madison, Wis. and BioRad, Hercules, Calif (see, e.g., US 4,945,050 and McCabe 1988). See also, Weissinger 1988; Sanford 1987 (onion); Christou 1988 (soybean); McCabe 1988 (soybean); Datta 1990 (rice); Klein 1988 (maize); Klein 1988 (maize); Klein 1988 (maize); Fromm 1990 (maize); and Gordon-Kamm 1990 (maize); Svab 1990 (tobacco chloroplast); Koziel 1993 (maize); Shimamoto 1989 (rice); Christou 1991 (rice); European Patent Application EP 0 332 581 (fescue and other graminaceous); Vasil 1993 (wheat); Weeks 1993 (wheat).
[0103] Methods using direct gene transfer or Agrobacterium-mediated transfer are typically, but not necessarily, performed with a selectable marker that provides resistance to an antibiotic (e.g., kanamycin, hygromycin, or methotrexate) or a herbicide (e.g., phosphinothricin). For certain plant species, different antibiotic or herbicide selection markers are preferred. Selection markers routinely used in transformation include the nptll gene that confers resistance to kanamycin and related antibiotics (Messing & Vierra, 1982; Bevan 1983), the bar gene that confers resistance to the herbicide phosphinothricin (White 1990, Spencer 1990), the hph gene that confers resistance to the antibiotic hygromycin (Blochlinger & Diggelmann), and the dhfr gene that confers resistance to methotrexate (Bourouis 1983).
[0104] Methods for producing and further characterizing stably transformed plants are generally known to those of skill in the art. As an example, transformed plant cells are placed in an appropriate selection medium for selection of transformed cells, and then grown into callus. Shoots are grown from the callus. Plantlets are generated from the shoots by growth in rooting medium. Various constructs are generally linked to markers for selection of plant cells. Conventionally, the marker can be resistance to a biocide, particularly an antibiotic, such as kanamycin, G418, bleomycin, hygromycin, chloramphenicol, a herbicide, and the like. The particular marker allows for comparison of cells lacking the introduced DNA to select for transformed cells. Components of DNA constructs comprising the transcription cassettes of the application can be prepared from sequences that are native (endogenous) or foreign (exogenous) to the host. "Foreign" means that the sequence is not found in the wild-type host into which the construct is introduced. A heterologous construct can contain at least one region that is not native to the gene from which the transcription initiation region is derived.
[0105] To verify the presence of the transferred polynucleotide of interest in the transformed cells and plants, a variety of assays can be performed. Such assays include, for example, "molecular biology" assays generally known to those of skill in the art, such as Southern and Northern blots, in situ hybridizations, and nucleic acid-based amplification methods, such as PCR or RT-PCR or Taqman; "biochemical" assays, such as detection of protein products by immunological means (ELISA and Western blots) or by enzyme function; plant part assays, such as seed assays; and by analyzing the phenotype of the whole regenerated plant, such as disease or pest resistance.
[0106] The presence of a preselected nucleic acid fragment can be determined by isolating DNA from a cell line or any plant part using techniques generally known to those of skill in the art. Note that the entire sequence is not always present, possibly due to rearrangement or deletion of sequences within the cell.
[0107] In some embodiments, the presence of the nucleic acid element introduced by the methods of the application can be determined by polymerase chain reaction (PCR). Discrete fragments of nucleic acids are amplified using these techniques and detected by gel electrophoresis. This type of analysis allows for the determination of the presence of a preselected nucleic acid fragment in the form of a stable transformant, but does not verify whether the introduced preselected nucleic acid fragment is integrated into the host cell genome. Furthermore, the use of PCR techniques does not allow for the determination of whether the transformant has exogenous genes introduced into different sites in the genome, i.e., whether the transformant is independently derived. It is contemplated that the use of PCR techniques will enable the cloning of fragments of host genomic DNA adjacent to the introduced preselected DNA fragment.
[0108] Known PCR methods include, but are not limited to, methods using paired primers, nested primers, single-specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially mismatched primers, and the like.
[0109] Southern hybridization techniques can be used to provide positive evidence of DNA integration into the host genome and the independent identity of transformants. Using this technique, one can identify the specific DNA sequence introduced into the host genome as well as the flanking host DNA sequences. Thus, the Southern hybridization pattern of a given transformant can serve as a characteristic for identifying that transformant. In addition, the presence of the introduced preselected DNA fragment in the high molecular weight DNA can be verified by Southern hybridization, i.e., that the introduced preselected DNA fragment has integrated into the host cell genome. Southern hybridization techniques provide information obtained using PCR, e.g., the presence of the preselected DNA fragment, but also confirm integration into the genome and characterize individual transformants.
[0110] Using a modified form of the Southern hybridization technique, dot or slot blot hybridization techniques, one can obtain the same information as derived from PCR, e.g., the presence of the preselected DNA fragment.
[0111] Both PCR and Southern hybridization techniques can be used to confirm that the preselected DNA fragment is passed on to the progeny. In most cases, the characteristic Southern hybridization pattern of a given transformant will segregate as one or more Mendelian genes in the progeny (Spencer 1992); Laursen 1994), indicating stable inheritance of the gene. Pedigree transmission, as well as the same Southern blot hybridization pattern and intensity of the transformed DNA in the callus, the R0 plant, and the transformed gene segregating R1 progeny, all suggest the nonchimeric nature of the callus and the parent transformant (R0).
[0112] DNA analysis techniques can be performed using DNA isolated from any part of the plant, whereas RNA can only be expressed in specific cell or tissue types, and thus it is necessary to prepare RNA for analysis from these tissues. PCR techniques can also be used to detect and quantify RNA produced from the introduced preselected DNA fragment. In this PCR application, the RNA must first be reverse transcribed into DNA using enzymes such as reverse transcriptase, and then the DNA amplified by using conventional PCR techniques. In most cases, PCR techniques, while effective, do not confirm the integrity of the RNA product. Additional information about the nature of the RNA product can be obtained by Northern blotting. This technique will confirm the presence of the RNA sample and give information about the integrity of the RNA. Dot or slot blot Northern hybridization can also be used to determine the presence or absence of the RNA sample. These techniques are modified Northern blots and only confirm the presence or absence of the RNA sample.
[0113] While Southern blotting and PCR can be used to detect the preselected DNA fragment in question, they do not provide information about whether the preselected DNA fragment is expressed. Expression can be assessed by specifically identifying the protein product of the introduced preselected DNA fragment, or by assessing phenotypic changes resulting from its expression.
[0114] Assays for the production and identification of specific proteins can utilize the physicochemical, structural, functional, or other properties of the protein. Unique physicochemical or structural properties allow the protein to be separated and identified by electrophoretic methods, such as native or denaturing gel electrophoresis or isoelectric focusing, or by chromatographic techniques such as ion exchange or gel exclusion chromatography. The unique structure of individual proteins provides the opportunity to detect their presence using specific antibodies in an assay such as an ELISA. Combinations of methods with even greater specificity can be used, such as Western blots, where antibodies are used to locate individual gene products that have been separated by electrophoretic techniques. The identity of the desired product can be absolutely verified using other techniques, such as assessment by amino acid sequencing after purification. While the above are the most commonly used, other procedures can additionally be used.
[0115] Assay procedures can also be used to identify the expression of a protein by its functionality, particularly the ability of an enzyme to catalyze a specific chemical reaction involving specific substrates and products. These reactions can then provide and quantify the loss of substrate or production of reaction product by physical or chemical procedures. The examples vary with the enzyme to be analyzed.
[0116] It is very common to determine expression of a gene product by assessing the phenotypic consequences of its expression. These assays can also take many forms, including but not limited to analyzing changes in the chemical composition, morphology, or physiological properties of the plant. Morphological changes can include larger stature or thicker stems. Most commonly, changes in the response of the plant or plant part to an applied treatment are assessed under carefully controlled conditions known as bioassays.
[0117] Provided is the use of a nucleic acid described herein having constitutive promoter activity in modulating expression of an operably linked nucleic acid in a plant or in identifying other nucleic acids having constitutive promoter activity.
[0118] A method of producing a food, feed, or industrial product comprises: a) obtaining a plant, plant part, or seed of the invention, and b) preparing the food, feed, or industrial product from the plant, plant part, or seed. The method can further comprise: wherein a) the food or feed is oil, meal, grain, starch, flour, or protein, or b) the industrial product is a biofuel, fiber, industrial chemical, pharmaceutical, or nutraceutical.
[0119] It is to be understood that this invention is not limited to particular methods, protocols, cell lines, plant species or genera, constructs, and reagents described herein, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. It must be noted that as used herein and in the appended claims, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a vector" is a reference to one or more vectors and includes equivalents thereof known to those skilled in the art, and so forth.
[0120] SEQUENCE LISTING
[0121] As a separate part of this disclosure, the application contains a Sequence Listing in computer readable form (file name: 202017P2_Seqlisting.txt; size: 5,022 bytes; creation: November 20, 2020), which is incorporated by reference in its entirety. EMBODIMENTS
[0122] Unless otherwise stated in the examples, all recombinant DNA techniques are carried out according to standard protocols, as described in Sambrook and Russell (2001) Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, NY, Volumes 1 and 2 of Ausubel et al. (1994) Current Protocols in Molecular Biology, Current Protocols, USA and Volumes I and II of Brown (1998) Molecular Biology, Labfax, Second Edition, Academic Press (UK). Standard materials and methods for plant molecular work are described in Plant Molecular Biology Labfax (1993) by R.D.D. Croy, jointly published by BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications, UK. Standard materials and methods for polymerase chain reaction can be found in Dleffenbach and Dveksier (1995) PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, and McPherson et al. (2000) PCR-Basics: From Background to Bench, First Edition, Springer Verlag, Germany.
[0123] Example 1 - Cloning of the promoter region of the soybean gene glyma13g33190
[0124] To clone the promoter region of the soybean gene glyma13g33190 (Soybase annotation Glyma 1.1) designated P-bdc16-1.2, SEQ ID NO: 1, the plasmid containing the promoter sequence of the glyma13g33190 gene from Thorne was used as template for PCR amplification of SEQ ID NO: 1 using the Q5 High-Fidelity DNA Polymerase Kit from NEB (Ipswich, MA, USA). The PCR was performed on plasmid DNA with an aptamer and sequence-specific primers (forward primer: ctccgaatatctcttagttgaaaaaaaacatttc (SEQ ID NO: 5); reverse primer: TTTCTTTCTTGCTTTCTTATGATTCTCTTCTTCTC (SEQ ID NO: 6)). The aptamer is a short DNA sequence complementary to the vector sequence of interest adjacent to the cloning site. The PCR products were separated by electrophoresis on a 0.8% (w / v) agarose gel. Fragments of approximately 1080 bp in size were excised from the gel, purified and assembled into our proprietary plant gene expression vector pBay01339 using the Gibson Assembly Kit according to the manufacturer's instructions (SGI-DNA, Madison, Wis., USA), which was pre-digested with SbfI and BsgI enzymes. The resulting vector pBay02059 was sequenced and aligned to the P-bdc16-1.2 sequence from Thome and found to be 100% aligned.
[0125] P-bdc16-1.2 was originally cloned by PCR amplification from soybean (Glycine Max cultivar Thome) genomic DNA.
[0126] Example 2 - Promoter deletion variants
[0127] A series of 200 bp deletions from the 5' end of P-bdc16-1.2 was generated by PCR-mediated cloning. Briefly, the promoter region of the soybean gene glyma13g33190 was PCR amplified from plasmid DNA of pBay02059 in sizes of 480 bp (SEQ ID NO: 4), 680 bp (SEQ ID NO: 3) and 880 bp (SEQ ID NO: 2). PCR was performed in the same way as described in Example 1. The PCR primers consisted of an aptamer and a sequence-specific primer for each of these truncated promoters, which shared the same 3' end. The aptamer is a short DNA sequence complementary to the vector sequence of interest adjacent to the cloning site. In this case, the vector of interest was pBay02059. The PCR products were separated by electrophoresis on a 1% (w / v) agarose gel. Fragments of sizes 480 bp (SEQ ID NO: 4), 680 bp (SEQ ID NO: 3) and 880 bp (SEQ ID NO: 2) were excised from the gel, purified and assembled into pBay02059 pre-digested with SbfI and BsgI enzymes using the Gibson Assembly kit according to the manufacturer's instructions (SGI-DNA, Madison, Wis., USA). The resulting plasmids pBay2206, pBay02207, pBay02208 contain P-bdc16-1.3 (880 bp - SEQ ID NO: 2), P-bdc16-1.4 (680 bp - SEQ ID NO: 3), P-bdc16-1.5 (480 bp - SEQ ID NO: 4), respectively. Results are shown in Figure 2
[0128] Example 3 - Tobacco transient assay
[0129] Plasmid DNA of pBay02059, pBay2206, pBay02207 and pBay02208 was transformed into Agrobacterium strain EHA105 (Hood et al., 1986). The resulting Agrobacterium containing these plasmids was used for Agroinfiltration of fully expanded young leaves of Nicotiana Benthamiana (Wydro et al., 2006). Infiltrated leaf samples were collected two days after Agroinfiltration. These samples were analyzed for reporter (insect resistance gene) expression (percentage of total soluble protein, %TSP). Results are shown in Figure 3
[0130] Example 4 - Additional expression analysis
[0131] Expression data (RNA-seq) was performed on the native soybean glyma13g33L90 from which the promoter P-bdc16-1.2 (SEQ ID NO: 1) was derived. RNA-seq data was generated at GENEWIZ (South Plainfield, NJ) using soybean tissue (cultivar Thome). As shown in Figure 4 P-bdc16-1.2 (SEQ ID NO: 1) was constitutively expressed in all plant tissues tested, including stem, leaf, root, and flower seed / pod.
[0132] Example 5 - Stable Transformation in Soybean Cultivars
[0133] Stable transformation events were generated using Agrobacterium tumefaciens transformation methods that utilize starting material from mature half-seeds as described in Agrobacterium Protocols pp. 275-284 (Luth et al., 2015). Plasmid DNA from vector pBay02059 was transformed into Agrobacterium strain EHA105 (Hood et al., 1986) and also used for stable transformation experiments. Starting material was derived from two soybean cultivars adapted for transformation that represent two different maturity groups (MG), MG3 and MG8. Successful gene transfer was confirmed by both herbicide selection and copy number PCR to select T0 events containing a single T-DNA insertion. See Table 1 and Figure 5 .
[0134] Table 1.
[0135] horizontal number average upper 95% limit lower 95% limit MG3 soybean MG8 soybean 24 0.031533 0.00335 0.02480 0.03826 Figure 6 27 0.024887 0.00316 0.01854 0.03123
[0136] Following positive event identification, sampling was taken at the v2-v3 growth stage to confirm relative protein expression by ELISA (BioRad) using assays specific for the introduced insect resistance genes. Figure 7
[0137] Example 6 - Expression of Polynucleotides of Interest in Soybean Cultivars
[0138] Events representing the T0 generation quartile range for protein expression of the insect resistance genes were selected (n=9 events for MG3 soybean, n=8 events for MG8 soybean). Isolated T1 seed was sown and plants were grown under typical greenhouse conditions. Shortly after emergence, all plants were sampled for copy number and the insect resistance genes and herbicide selection markers were analyzed. See Table 2 and Figure 9 and 8 .
[0139] Table 2.
[0140]
[0141] ELISA analysis samples were taken at the v3-v4 growth stage from each event - one 0 copy (null) and up to three 1 copy (hemizygous) and 2 copy (homozygous) of the vector. See .
[0142] References:
[0143] Hood, E. E., G. L. Helmer, R. T. Fraley, and M.-D. Chilton. 1986. The hypervirulence of Agrobacterium tumefaciens A281 is encoded in a region of pTiBo542 outside of T-DNA. J. Bacteriol. 168: 1291-1301.
[0144] Wydro M., E. Kozubek and P. Lehmann. 2006. Optimization of transient Agrobacterium-mediated gene expression system in leaves of Nicotiana benthamiana. Acta Biochimica Polonica. Vol. 53, No 2 / 2006, 289-298. SEQUENCE LISTING <110> BASF Agricultural Solutions Seed US LLC <120> Transcriptional regulatory nucleotide sequences and methods of use thereof <130> 202017 <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 1080 <212> DNA <213> Glycine Max <400> 1 ctccgaatat ctcttagttg gaaaaaaaca tttcatcttt taaaaactag atcaaacttg 60 ttgtttccac cacaaattgg tttgctttaa gggataatta tgatttttga tctgtggact 120 tttttggatt tttaatttta gtctttaaac aaaaaattag ctagttgtaa ttgttaaagt 180 tatcatccgt taacattttt ggtcccttcc attaagtgtt gtcattaaca gatgatgtga 240 cgatagctgt gagtgtcatg tggtacttat ttgtggcaat ttattttgtt acgattttgg 300 ctgtcagaaa atgcttactg agttgctttg aaaggtatta aacatttttc tacggtttaa 360 aacctctaga aattgctact catgcataca tcatcaacaa attttgtata aagacgattc 420 tcccacaaag tttcatcttt ttttttaata acacaaattc atatagactt aattcactca 480 atcacctatg agtaaagatt gcgtctgaga agaatttacc acacatttct agctttatca 540 tcatatatat ttttcaaaat ttgaggtgaa cataccatca attcatcatc acactaactt 600 aatggtaaac accatcatct atacttttcc aaattacaac atcaggcttt ccatccaaat 660 ggaaagtcat aatagagtta ttgtttgggc atgaaaaatg gttctcaatc ttgtaaggaa 720 aaacttaagt ttaatcccga catagtacac ttttaaatct ggattgatga ttagtcttat 780 aattagtcaa aaagattcta attaaggtgg tataaaaaaa tgatcaacta atgtgatgaa 840 actgaagaaa caatttgagc taattgatat taaaaaaaaa aaactctgta aagttaaagg 900 aataatttga aaccaaaaat aaaaaacaat tgtattttaa cctaatagta tttaaattaa 960 aaataataat atactccgag aagaagggaa tatataagaa gagcggcgga gctaaagaag 1020 agagtgggca tagtagacga gaaaggagaa gaagagaatc ataagaaagc aagaaagaaa 1080 <210> 2 <211> 880 <212> DNA <213> Soybean <400> 2 ggtcccttcc attaagtgtt gtcattaaca gatgatgtga cgatagctgt gagtgtcatg 60 tggtacttat ttgtggcaat ttattttgtt acgattttgg ctgtcagaaa atgcttactg 120 agttgctttg aaaggtatta aacatttttc tacggtttaa aacctctaga aattgctact 180 catgcataca tcatcaacaa attttgtata aagacgattc tcccacaaag tttcatcttt 240 ttttttaata acacaaattc atatagactt aattcactca atcacctatg agtaaagatt 300 gcgtctgaga agaatttacc acacatttct agctttatca tcatatatat ttttcaaaat 360 ttgaggtgaa cataccatca attcatcatc acactaactt aatggtaaac accatcatct 420 atacttttcc aaattacaac atcaggcttt ccatccaaat ggaaagtcat aatagagtta 480 ttgtttgggc atgaaaaatg gttctcaatc ttgtaaggaa aaacttaagt ttaatcccga 540 catagtacac ttttaaatct ggattgatga ttagtcttat aattagtcaa aaagattcta 600 attaaggtgg tataaaaaaa tgatcaacta atgtgatgaa actgaagaaa caatttgagc 660 taattgatat taaaaaaaaa aaactctgta aagttaaagg aataatttga aaccaaaaat 720 aaaaaacaat tgtattttaa cctaatagta tttaaattaa aaataataat atactccgag 780 aagaagggaa tatataagaa gagcggcgga gctaaagaag agagtgggca tagtagacga 840 gaaaggagaa gaagagaatc ataagaaagc aagaaagaaa 880 <210> 3 <211> 680 <212> DNA <213> Glycine max <400> 3 attttgtata aagacgattc tcccacaaag tttcatcttt ttttttaata acacaaattc 60 atatagactt aattcactca atcacctatg agtaaagatt gcgtctgaga agaatttacc 120 acacatttct agctttatca tcatatatat ttttcaaaat ttgaggtgaa cataccatca 180 attcatcatc acactaactt aatggtaaac accatcatct atacttttcc aaattacaac 240 atcaggcttt ccatccaaat ggaaagtcat aatagagtta ttgtttgggc atgaaaaatg 300 gttctcaatc ttgtaaggaa aaacttaagt ttaatcccga catagtacac ttttaaatct 360 ggattgatga ttagtcttat aattagtcaa aaagattcta attaaggtgg tataaaaaaa 420 tgatcaacta atgtgatgaa actgaagaaa caatttgagc taattgatat taaaaaaaaa 480 aaactctgta aagttaaagg aataatttga aaccaaaaat aaaaaacaat tgtattttaa 540 cctaatagta tttaaattaa aaataataat atactccgag aagaagggaa tatataagaa 600 gagcggcgga gctaaagaag agagtgggca tagtagacga gaaaggagaa gaagagaatc 660 <000039%5>ataagaaagc aagaaagaaa 680 <210> 4 <211> 480 <212> DNA <213> Soybean <400> 4 aatggtaaac accatcatct atacttttcc aaattacaac atcaggcttt ccatccaaat 60 It should be noted that the original text seems to have some possible formatting or encoding issues, especially the "acacatttct" part which might be better presented in a more standard DNA sequence format. Also, the "acacatttct" line might be missing some spaces or proper formatting to be a typical DNA sequence. The translation is done as accurately as possible based on the provided text.ggaaagtcat aatagagtta ttgtttgggc atgaaaaatg gttctcaatc ttgtaaggaa 120 aaacttaagt ttaatcccga catagtacac ttttaaatct ggattgatga ttagtcttat 180 aattagtcaa aaagattcta attaaggtgg tataaaaaaa tgatcaacta atgtgatgaa 240 actgaagaaa caatttgagc taattgatat taaaaaaaaa aaactctgta aagttaaagg 300 aataatttga aaccaaaaat aaaaaacaat tgtattttaa cctaatagta tttaaattaa 360 aaataataat atactccgag aagaagggaa tatataagaa gagcggcgga gctaaagaag 420 agagtgggca tagtagacga gaaaggagaa gaagagaatc ataagaaagc aagaaagaaa 480 <210> 5 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 5 ctccgaatat ctcttagttg aaaaaaaaca tttc 34 <210> 6 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 6 tttctttctt gctttcttat gattctcttc ttctc 35
Claims
1. An isolated nucleic acid having constitutive promoter activity, comprising the nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:
2.
2. A recombinant gene for regulating the expression of a target polynucleotide, said recombinant gene comprising a nucleic acid having constitutive promoter activity according to claim 1.
3. The recombinant gene of claim 2, wherein the recombinant gene further comprises at least one target polynucleotide operatively linked to a nucleic acid having constitutive promoter activity.
4. The recombinant gene of any one of claims 2 to 3, wherein the target polynucleotide encodes an insecticidal protein or a herbicide selection marker.
5. A vector comprising a nucleic acid having constitutive promoter activity according to claim 1 or a recombinant gene according to any one of claims 2 to 4.
6. The carrier of claim 5, wherein the carrier is an expression carrier.
7. A host cell comprising a heterologous nucleic acid having constitutive promoter activity according to claim 1, a recombinant gene according to any one of claims 2 to 4, or a vector according to claim 5 or 6, wherein the host cell is a microbial cell or a non-reproductive plant cell.
8. The host cell of claim 7, wherein the microbial cell is selected from bacterial cells, algal cells, and fungal cells.
9. The host cell of claim 8, wherein the fungal cell is a yeast cell.
10. A method for expressing a target polynucleotide in a host cell, comprising: (a) Introducing a nucleic acid having constitutive promoter activity according to claim 1, a recombinant gene according to any one of claims 2 to 4, or a vector according to claim 5 or 6 into a host cell, and (b) Express at least one target polynucleotide in the host cell.
11. The method of claim 10, wherein the host cell is a plant cell.
12. The method of claim 10 or claim 11, wherein the detectable amount of the accumulated protein encoded by the target polynucleotide is about 0.01% to 1.15% of the total extracted soluble protein.
13. A method for producing a plant or a plant part, comprising: (a) Introducing a nucleic acid having constitutive promoter activity according to claim 1, a recombinant gene according to any one of claims 2 to 4, or a vector according to claim 5 or 6 into plant cells; and (b) Regenerate the plant cells to form a plant or plant part.
14. A method for providing insecticidal activity in plants, comprising: (a) Introducing a nucleic acid having constitutive promoter activity according to claim 1, a recombinant gene according to any one of claims 2 to 4, or a vector according to claim 5 or 6 into a plant host cell; and (b) Expressing a polynucleotide encoding an insecticidal protein in the host cell, thereby providing insecticidal activity in the plant.
15. The method of claim 14, wherein the insecticidal protein is an insecticidal protein.
16. The use of the nucleic acid with constitutive promoter activity according to claim 1 for regulating the expression of operatively linked nucleic acids in plants.
17. The use of the nucleic acid with constitutive promoter activity according to claim 1 for identifying other nucleic acids with constitutive promoter activity.
18. A method for producing food, feed, or industrial products, comprising: a) Obtaining a plant or plant part according to claim 13; and b) Prepare food, feed or industrial products from plants or plant parts.
19. The method of claim 18, wherein a) The food or feed is oil, coarse flour, grain, starch, flour, or protein, or b) Industrial products are biofuels, fibers, industrial chemicals, pharmaceuticals, or nutritional products.
Citation Information
Patent Citations
A process for the incorporation of foreign DNA into the genome of dicotyledonous plants; Agrobacterium tumefaciens bacteria and a process for the production thereof
EP0120516A2
Beer and other beverages and their manufacture
EP0138341A2
Sulphur-rich protein from bertholletia excelsa H.B.K.
EP0295959A2
Particle-mediated transformation of soybean plants and lines
EP0301749A2
Regeneration of fertile graminaceous plants of the subfamily pooideae from protoplasts
EP0332581A2