Sorghum U6 gene promoter and application

By providing the sorghum U6 gene promoter and its vector, an efficient CRISPR/Cas9 gene editing system was constructed, solving the problem of unstable promoter efficiency in sorghum gene editing, achieving a significant improvement in sorghum gene editing efficiency, and supporting gene function research and breeding of sorghum.

CN121825971APending Publication Date: 2026-04-10JIANGSU ACAD OF AGRI SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202512046639.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-31
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

The lack of an efficient and stable CRISPR/Cas9 genome editing system in sorghum gene editing, coupled with the unstable activation efficiency of the heterologous U6 gene promoter in sorghum cells, leads to low sgRNA expression levels and low editing efficiency.

Method used

Four sorghum U6 gene promoters, SbU6-2-2, SbU6-2-3, SbU6-2-4, and SbU6-10, along with their corresponding promoter activity verification vectors and gene editing vectors, were provided. Promoter activity was verified and gene editing was performed by constructing and transforming sorghum callus tissue using the efficient CRISPR/Cas9 gene editing system.

Benefits of technology

It significantly improves the editing efficiency of sorghum gene editing, with stable promoter activity and editing efficiency higher than the existing rice OsU6 promoter, enabling precise improvement of sorghum gene function research and molecular breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses a sorghum U6 gene promoter and application thereof. The nucleotide sequences of the four sorghum U6 gene promoters disclosed by the invention are as shown in SEQ ID NO. 1 / SEQ ID NO. 2 / SEQ ID NO. 3 / SEQ ID NO. 4. GUS staining of sorghum calluses for respectively performing fusion expression on GUS by the four sorghum U6 gene promoters shows that the four sorghum U6 gene promoters all have promoter activity; the four sorghum U6 gene promoters are fused with sorghum calluses expressing target site sequences (gRNA) and sgRNA respectively, and target site PCR amplification and sequencing show that the four sorghum U6 gene promoters can start expression of targeted gRNA and play an important role in a sorghum CRISPR / Cas9 gene system. The four sorghum U6 gene promoters can be used for genetic engineering improvement of sorghum gene editing.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of plant genetic engineering, and particularly relates to a sorghum U6 promoter and application thereof. BACKGROUND

[0002] Sorghum is the fifth largest cereal in the world and an important bioenergy crop. Genetic improvement of sorghum is of great significance to food security and sustainable agricultural development. In recent years, the rapid development of CRISPR / Cas9 gene editing system has greatly promoted the transformation of crop breeding from traditional "experience breeding" mode to "precision design breeding" mode. At present, gene editing breeding has made breakthrough progress in many species, among which the CRISPR / Cas9-edited crops such as high-yield wheat with white powdery mildew resistance, short-stalk corn, and high-oleic soybean have obtained the agricultural gene editing biosafety certificate issued by the Ministry of Agriculture and Rural Affairs of the People's Republic of China, which marks an important step in the application of gene editing technology in the field of agriculture in China.

[0003] However, the research on gene function and molecular breeding of sorghum has long been faced with a key technical bottleneck: the lack of an efficient and stable CRISPR / Cas9 genome editing system. At present, the application of this technology in sorghum is severely limited by the promoter tool driving the expression of sgRNA. The heterologous U6 gene promoter from rice is usually used in sorghum gene editing vectors, and the heterologous U6 gene promoter has unstable starting efficiency in sorghum cells, which leads to low sgRNA expression level and low editing efficiency.

[0004] Therefore, it is of great significance to study new sorghum U6 gene promoters and their functions, and to apply them in the sorghum CRISPR / Cas9 gene editing system to improve the editing efficiency of the sorghum gene editing system, which has important significance for the research on gene function and precision molecular breeding of sorghum, and also has great application potential and value. SUMMARY

[0005] The purpose of the present application is to provide four sorghum U6 gene promoters and their application in the sorghum CRISPR / Cas9 gene editing system to improve the editing efficiency of the sorghum gene editing system for plant variety improvement.

[0006] One of the purposes of the present application is to provide four sorghum U6 gene promoters, which are located on chromosome 2 and chromosome 10 of sorghum, and are named SbU6-2-2, SbU6-2-3, SbU6-2-4 and SbU6-10 according to their positions on the genome.

[0007] The second purpose of the present application is to provide a promoter activity verification vector containing a sorghum U6 gene promoter and a sorghum gene editing vector.

[0008] The third objective of this invention is to provide the application of four sorghum U6 gene promoters.

[0009] The specific details of this invention are as follows:

[0010] This invention provides four sorghum U6 gene promoters, the nucleotide sequences of which are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, or gene sequences that have 90% homology with the nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4 and can be applied to the sorghum CRISPR / Cas9 gene editing system.

[0011] This invention also provides four pairs of primers for amplifying the four sorghum U6 gene promoters described in this invention:

[0012] SbU6-2-2-F: TGGGAGGATATGATGGTGTGTGA (SEQ ID NO.5)

[0013] SbU6-2-2-R: CATTTCTCGATTTGTGCGTGTCA (SEQ ID NO.6)

[0014] SbU6-2-3-F: TGTATTCCTGCTTACTCCATCTCA (SEQ ID NO.7)

[0015] SbU6-2-3-R: GCCATGCTAATCTTCTCTGTATCG (SEQ ID NO.8)

[0016] SbU6-2-4-F: GGTTGTTCCTGGCGATCTTCTC (SEQ ID NO.9)

[0017] SbU6-2-4-R: CGATTTGTGCGTGTCACTCTTG (SEQ ID NO.10)

[0018] SbU6-10-F:ATGCTCATGGCTGTACCTGTTG (SEQ ID NO.11)

[0019] SbU6-10-R: CGATTTGTGGCGTGTCATCCTTG (SEQ ID NO.12)

[0020] The present invention also provides a promoter activity verification vector or a sorghum gene editing vector containing the sorghum U6 gene promoter.

[0021] The promoter activity verification vector can be a commonly used expression plasmid in plant genetic transformation containing a reporter gene. The promoter before the reporter gene is replaced with the sorghum U6 gene promoter described in this invention to form a recombinant expression vector. For example, the complete sorghum U6 gene promoter is inserted into the expression vector pTF101.1 to construct the plant promoter activity verification vector. In one embodiment, they are named pTF101-SbU6-2-2-GUS, pTF101-SbU6-2-3-GUS, pTF101-SbU6-2-4-GUS, and pTF101-SbU6-10-GUS.

[0022] The sorghum gene editing vector can be formed by inserting a monocotyledonous CRISPR / Cas9 gene editing vector plasmid commonly used in plant genetic transformation into the sorghum U6 gene promoter described in this invention. For example, a sorghum gene editing vector can be formed by inserting a complete gRNA expression cassette into the gene editing vector pCas9. In one embodiment, these vectors are named pCas9-SbU6-2-2, pCas9-SbU6-2-3, pCas9-SbU6-2-4, and pCas9-SbU6-10.

[0023] By introducing the four sorghum U6 gene promoters of this invention into sorghum callus using a plant promoter activity verification vector, transgenic cells and transgenic sorghum plants that can be stained by GUS can be obtained.

[0024] By using a plant gene editing vector to introduce the four sorghum U6 gene promoters of this invention into sorghum callus tissue, transgenic cells with targeted gene knockout and transgenic sorghum plants can be obtained.

[0025] When constructing plant gene editing vectors using the four sorghum U6 gene promoters, any 20nt gRNA with a first base of G can be added between the U6 promoter and the sgRNA. To facilitate the identification and screening of transgenic plant cells or plants, the plant gene editing vectors can be modified, for example, by adding selective marker genes expressed in the plant (HYG gene, bar gene, etc.) or antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.). Considering the safety of transgenic plants, no selective marker genes may be added, and transformed plants can be screened directly by genotype.

[0026] The plant gene editing vector carrying the present invention can be used to transform sorghum cells or tissues using conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electrocoagulation, and Agrobacterium-mediated transformation, and the transformed sorghum tissues can be cultured into sorghum plants.

[0027] This invention also provides two transformants, obtained by introducing the aforementioned promoter activity verification vector and sorghum gene editing vector into host cells, preferably *E. coli* cells or *Agrobacterium* cells. For example, the host bacteria containing the plant promoter activity verification vectors pTF101-SbU6-2-2-GUS, pTF101-SbU6-2-3-GUS, pTF101-SbU6-2-4-GUS, and pTF101-SbU6-10-GUS, and the sorghum gene editing vectors pCas9-SbU6-2-2, pCas9-SbU6-2-3, pCas9-SbU6-2-4, and pCas9-SbU6-10, are obtained by transforming the four sorghum U6 gene promoters into the *Agrobacterium tumefaciens* strain EHA101.

[0028] The present invention also provides the application of the four sorghum U6 gene promoters or their amplification primers or sorghum gene editing vectors or transformants in sorghum gene editing.

[0029] The beneficial effects of this invention are:

[0030] This invention

[0031] Four sorghum U6 gene promoters were used. The promoter activity verification vectors of the four sorghum U6 gene promoters were constructed and transformed into sorghum callus tissue and stained with GUS. The results showed that the sorghum callus tissue transformed with the four sorghum U6 gene promoter promoter activity verification vectors could all be stained blue with GUS dye, indicating that the four sorghum U6 gene promoters described in this invention have promoter activity.

[0032] Furthermore, gene editing vectors for four sorghum U6 gene promoters were constructed and transformed into sorghum callus tissue for verification by PCR amplification. The results showed that sorghum callus tissue transformed with the four sorghum U6 gene promoter gene editing vectors exhibited double-peak sequencing of the target site after sequencing, indicating that the genome sequence was edited. Moreover, the editing efficiency was significantly higher than that of the currently used rice OsU6 gene promoter. This demonstrates that the four sorghum U6 gene promoters described in this invention can all be used in the sorghum CRISPR / Cas9 system, and can be used for sorghum gene editing and sorghum genetic engineering improvement with high and stable initiation efficiency. Attached Figure Description

[0033] Figure 1 Sorghum U6 gene alignment;

[0034] Figure 2 Verification of promoter activity of the sorghum U6 gene promoter;

[0035] Figure 3 Schematic diagram of a promoter validation vector containing the sorghum U6 gene promoter;

[0036] Figure 4 A schematic diagram of a gene editing vector containing the sorghum U6 gene promoter;

[0037] Figure 5 Sequencing peak diagram of target site sequences in sorghum callus. Detailed Implementation

[0038] The present invention will be further described below with reference to embodiments. It should be understood that the specific embodiments described herein are only for explaining the present invention and are not intended to limit the present invention. Any simple improvements to the preparation method of the present invention under the premise of the concept of the present invention are within the protection scope of the present invention. Experimental methods in the following embodiments that do not specify specific conditions are generally carried out in accordance with well-known means in the art.

[0039] Unless otherwise specified, the sorghum material used below is BTx623, which is a known variety.

[0040] Example 1

[0041] 1) Bioinformatics analysis and cloning of four sorghum U6 gene promoters

[0042] Based on the sorghum genome database, homologous sequences of Arabidopsis thaliana AtU6 were compared in the sorghum genome (https: / / phytozome-next.jgi.doe.gov / blast-search) using the online BLAST tool. The results showed that seven sorghum SbU6 genes were highly homologous to AtU6: SbU6-2-1, SbU6-2-2, SbU6-2-3, SbU6-2-4, SbU6-3, SbU6-5, and SbU6-10. Analysis of the seven sorghum SbU6 genes revealed the presence of a transcription start site (USE) and a promoter cis-acting element (TATA box) upstream of the U6 gene. Figure 1 Primers were designed for seven SbU6 promoters, and four SbU6 promoters were cloned from sorghum leaf tissue using RT-PCR (three of which could not be successfully cloned). Primer sequences are shown in Table 1.

[0043] Table 1 Primer Sequences

[0044]

[0045] Sorghum leaf tissue was collected, ground in a mortar and pestle, and added to a 1.5 ml EP tube containing lysis buffer. After thorough shaking, total DNA was extracted using the SDS method and PCR amplification was performed. The PCR program was as follows: 98℃ pre-denaturation for 10 minutes, 95℃ denaturation for 30 seconds, annealing for 30 seconds (temperature depends on primers), 72℃ extension for 30 seconds, for a total of 33 cycles, followed by incubation at 72℃ for 10 minutes, and finally isothermal treatment at 16℃. The PCR products were then purified by gel extraction and ligated into pEASY PCR products. ® After using the Blunt Simple Cloning Kit (TransGen, China) to transform the vector into E. coli competent cells DH5α, positive single clones were picked and sequenced. The SbU6-2-2 sequence is shown in SEQ ID NO.1, the SbU6-2-3 sequence in SEQ ID NO.2, the SbU6-2-4 sequence in SEQ ID NO.3, and the SbU6-10 sequence in SEQ ID NO.4.

[0046] Example 2: Validation of promoter activity of four sorghum U6 gene promoters

[0047] Primers containing restriction enzyme sites were designed based on the promoter sequences of four sorghum U6 genes. The DNA sequences were used for vector construction via double digestion, with Hind III and BamHI as the restriction sites. The complete sorghum U6 gene promoter was inserted into the expression vector pTF101.1 to construct the plant overexpression vectors SbU6-2-2-GUS, SbU6-2-3-GUS, SbU6-2-4-GUS, and SbU6-10-GUS. Figure 3 The promoter activity verification vector was transformed into Agrobacterium tumefaciens strain EHA101 via electroporation, and then sorghum mature embryos were transformed using Agrobacterium-mediated transformation to induce embryogenic callus. The resulting transgenic callus was then stained with the GUS marker gene on the vector and photographed. The staining results showed that callus transformed with SbU6-2-2-GUS, SbU6-2-3-GUS, SbU6-2-4-GUS, and SbU6-10-GUS could all be stained. Figure 2 The results indicate that all four sorghum U6 gene promoters possess initiation activity. Therefore, we believe that SbU6-2-2, SbU6-2-3, SbU6-2-4, and SbU6-10 can all be used as promoters to initiate gRNA expression in the sorghum CRISPR / Cas9 gene editing system.

[0048] Example 3: Application of a gene editing system based on four sorghum U6 gene promoters

[0049] Based on the promoter sequences of four sorghum U6 genes, the restriction enzyme site, SbU6 promoter, target site C-ALS sequence (gRNA, SEQ ID NO.13), and sgRNA (SEQ ID NO.14) were synthesized into a single DNA fragment using gene synthesis methods. The DNA sequence was used to construct a vector using a single enzyme digestion method, with the restriction enzyme site being Bsa I. The complete gRNA expression cassette was inserted into the gene editing vector pCas9 to construct the plant gene editing vectors pCas9-SbU6-2-2, pCas9-SbU6-2-3, pCas9-SbU6-2-4, and pCas9-SbU6-10. Figure 4 Gene editing vectors were transformed into Agrobacterium tumefaciens strain EHA101 via electroporation. Sorghum mature embryos were then transformed using Agrobacterium-mediated transformation to induce embryogenic callus. Thirty transgenic callus tissues from each vector were selected, and genomic DNA was extracted. PCR and sequencing were performed on the gene editing target sites. The target site sequences and amplification primers are shown in Table 2. The results showed that the target site sequences of callus tissues transformed with pCas9-SbU6-2-2, pCas9-SbU6-2-3, pCas9-SbU6-2-4, and pCas9-SbU6-10 all exhibited bimodal distributions. Figure 5 In this study, all target site sequences in the callus tissue were edited. The rice OsU6 promoter, commonly used in sorghum gene editing, achieved an editing efficiency of only 50.0% in sorghum, while the SbU6-2-2 promoter (90.0%), SbU6-2-3 (86.7%), SbU6-2-4 (83.3%), and SbU6-10 (73.3%) in this invention demonstrated significantly higher activation efficiency of the sorghum SbU6 promoter compared to the rice OsU6 promoter.

[0050] The results above demonstrate that all four sorghum U6 gene promoters can initiate the expression of targeted gRNAs, and their initiation efficiency is significantly higher than that of the currently used rice OsU6 promoter. Therefore, we believe that SbU6-2-2, SbU6-2-3, SbU6-2-4, and SbU6-10 can all serve as promoters for targeted gRNA expression in the sorghum CRISPR / Cas9 gene editing system, playing an important role in sorghum gene editing. New materials with different genotypes obtained using these four sorghum U6 gene promoters (SbU6-2-2, SbU6-2-3, SbU6-2-4, and SbU6-10) can be used for sorghum quality breeding and genetic engineering improvement applications.

[0051] Table 2 Target site sequences and detection primers

[0052] 。

Claims

1. 4 sorghum U6 gene promoters, characterized in that, The nucleotide sequence is as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4, or a gene sequence that has 90% homology with the nucleotide sequence shown in SEQ ID NO.1 / SEQ ID NO.2 / SEQ ID NO.3 / SEQ ID NO.4 and can improve the efficiency of sorghum gene editing.

2. A primer pair for amplifying the promoters of the four sorghum U6 genes described in claim 1.

3. The primer pair according to claim 2, characterized in that, The primer pairs are shown in SEQ ID NO.5 and SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, and SEQ ID NO.11 and SEQ ID NO.12, respectively.

4. A promoter activity verification vector comprising the promoters of the four sorghum U6 genes as described in claim 1.

5. A sorghum gene editing vector comprising the four sorghum U6 gene promoters as described in claim 1.

6. A transformant obtained by introducing the promoter activity verification vector of claim 4 or 5 or the sorghum gene editing vector of claim 4 into a host cell.

7. The transformant according to claim 6, characterized in that, The host cell is either an Escherichia coli cell or an Agrobacterium cell.

8. The application of the four sorghum U6 gene promoters of claim 1, the primers of claim 2 or 3, the promoter activity verification vector of claim 4, the sorghum gene editing vector of claim 5, or the transformant of claim 6 or 7 in the sorghum gene editing system.

9. The application of the four sorghum U6 gene promoters of claim 1, the primers of claim 2 or 3, the promoter activity verification vector of claim 4, the sorghum gene editing vector of claim 5, or the transformant of claim 6 or 7 in sorghum breeding.

10. The application of the four sorghum U6 gene promoters of claim 1, the primers of claim 2 or 3, the promoter activity verification vector of claim 4, the sorghum gene editing vector of claim 5, or the transformants of claim 6 or 7 in obtaining genotypes and varieties of different gene edits after introduction into sorghum.