Establishment and application of gill cover bone tissue osteoblast line of humpback perch
By establishing the CAOBOB osteoblast line of the operculum of the humpback perch, the technical gap in the study of operculum deformity of the humpback perch has been filled, providing a model for the study of the molecular mechanism of deformity and support for the breeding of superior varieties, thus promoting healthy aquaculture.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- XIAMEN UNIV
- Filing Date
- 2025-12-31
- Publication Date
- 2026-04-10
AI Technical Summary
In the existing technology, the gill operculum deformity of the humpback perch seriously affects its survival, growth and commercial value. The lack of cell lines derived from bone tissue restricts the in-depth analysis of the deformity mechanism and the breeding of superior varieties.
A morphologically stable cell line with osteogenic characteristics and high transfection efficiency was obtained by isolating, dry-attaching, passage, cryopreserving and thawing the operculum tissue of humpback perch through a process of bone marrow isolation, dry-attaching culture, passage culture, cryopreservation and thawing culture. This cell line was named CAOBOB.
It provides an ideal model for studying the molecular mechanisms of operculum malformation, supports the breeding of superior varieties and healthy aquaculture, reduces economic losses, and fills the gap in the bone tissue cell line of humpback perch.
Smart Images

Figure CN121825864A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to the establishment and application of an osteoblast cell line from the operculum of a humpback perch. Background Technology
[0002] The humpback perch (Cromileptes altivelis), commonly known as the mouse perch, belongs to the order Perciformes, family Epinephelidae, and genus Cromileptes. It is a highly prized marine fish, prized for its tender, nutritious flesh and considered a delicacy. Its unique "pointed snout and humpback" shape, with its laterally compressed body, large, rounded pectoral fins, and graceful form, makes it a favorite in the aquarium market. In nature, the humpback perch is widely distributed in the triangular region of the Pacific and Indian Oceans, commonly found in the South China Sea. It typically inhabits coral reefs and lagoons, feeding on small fish and crustaceans. In recent years, overfishing and human destruction of its coral reef habitat have severely damaged its wild populations. Coupled with its relatively slow growth rate, it is listed as Vulnerable by the IUCN. To meet market demand, my country made breakthroughs in the seedling cultivation technology of humpback perch in the 1990s, achieving artificial aquaculture. However, with the development of high-density intensive aquaculture, deformities such as incomplete gill cover closure, curled edges, and abnormal gill bone development have emerged during the aquaculture process. These deformities seriously affect the survival, growth, and commercial value of humpback perch, causing severe economic losses to the humpback perch aquaculture industry (Sugama, K, Genetics and Breeding of marine finfish culture in Asia, Fisheries Science, 2002, Volume 68, Issue sup1, Pages 718-721).
[0003] Cell lines, as important in vitro research models, play a crucial role in fish developmental biology, physiology, genetics, and immunology. However, for the humpback perch, an important economic fish, only cell lines derived from brain and gill tissue have been established (Liu Yixuan. Establishment of humpback perch brain and gill cell lines [D]. Hainan University, 2021. DOI:10.27073 / d.cnki.ghadu.2021.001331), while cell lines derived from bone tissue remain a blank, which seriously restricts in-depth analysis of the mechanism of operculum malformation. As is well known, osteoblasts play a core role in bone development, mineralization, and damage repair; abnormal differentiation and function can lead to skeletal malformations. Therefore, establishing osteoblast cell lines derived from the gill operculum of the humpback perch can not only provide an ideal research model for elucidating the molecular mechanism of gill operculum malformation, but also lay the foundation for subsequent breeding and healthy aquaculture strategies. Summary of the Invention
[0004] The purpose of this invention is to address the problem of gill operculum deformity in humpback perch during aquaculture by providing an osteoblast cell line from the gill operculum tissue of humpback perch. This provides an important tool for studying the molecular mechanism of the deformity, and also provides technical support for the breeding of superior varieties, thus promoting the healthy development of the aquaculture industry.
[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0006] This invention provides osteoblasts of the operculum of the humpback perch (Cromileptes altivelis), named the humpback perch operculum osteoblast line CAOBOB, which was deposited at the China Center for Type Culture Collection on May 17, 2025, with accession number CCTCC NO:C2025130.
[0007] This invention uses operculum tissue from juvenile humpback perch (Cromileptes altivelis) as starting material. A humpback perch operculum osteoblast cell line (Cromileptes altivelis) was established through isolation of the operculum tissue, dry-attach culture, initiation of primary culture, initiation of passage culture, cryopreservation, and thawing culture. This line was named the humpback perch operculum osteoblast cell line CAOBOB. The humpback perch operculum osteoblast cell line (Cromileptes altivelis) CAOBOB was deposited on May 17, 2025, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Wuhan, China, with accession number CCTCC NO: C2025130.
[0008] This cell line has the following biological characteristics:
[0009] 1) Morphological characteristics: During passage 1-40, the cells are mainly long spindle-shaped and morphologically stable;
[0010] 2) Growth characteristics: It grows well in L-15 complete culture medium containing specific additives at 27℃, can be passaged every 2-3 days, and has stable proliferation capacity.
[0011] 3) Karyotype characteristics: Chromosome karyotype analysis showed that 74% of the mitotic cells had a chromosome number of 2n=48, indicating a stable karyotype;
[0012] 4) Osteogenic characteristics: Positive for alkaline phosphatase staining, exhibiting strong alkaline phosphatase activity, consistent with osteoblast core characteristics;
[0013] 5) Transfection characteristics: It can efficiently receive foreign genes. The transfection efficiency after electrotransfection of pEGFP-N1 plasmid is about 70%, which is suitable for experiments related to foreign gene expression.
[0014] 6) Cryopreservation and thawing characteristics: After cryopreservation with programmed gradient cooling, the cell adhesion rate reaches 60%-80% after thawing for 24 hours. The cell morphology and proliferation capacity after thawing are not significantly different from those before cryopreservation, and the cells can be passaged normally.
[0015] The present invention also provides a method for establishing the CAOBOB osteoblast line from the operculum of the humpback perch, comprising the following steps:
[0016] 1) Obtaining operculum tissue from humpback perch
[0017] Place the long-backed bass fry on ice until they no longer respond to stress. Wipe the mucus off the surface of the fish with sterile gauze, then wipe the surface of the fish with gauze soaked in alcohol. Remove the operculum tissue of the long-backed bass and place it in PBS solution containing penicillin, streptomycin and amphotericin B (100 mL of PBS solution is added to 1 mL of commercially available 100× concentrated solution of triple antibiotics).
[0018] 2) Primary culture of operculum tissue from humpback perch
[0019] The above-mentioned humpback perch operculum tissue was minced into small tissue pieces of approximately 2.0 mm and rinsed three times with PBS solution. After rinsing, the tissue pieces were transferred to 15 mL centrifuge tubes, and the attached blood cells were lysed using erythrocyte lysis buffer. The tissue pieces were then washed three times with PBS solution, and the tissue pieces were evenly placed into cell culture flasks. The bottom of the culture flasks was resuspended and moistened with 1 mL of complete culture medium, and primary culture was initiated at 27°C and 5% CO2. On the second day, 1 mL of culture medium was added; on the third day, another 1 mL of culture medium was added; on the fourth day, the complete culture medium was replaced once, and 5 mL of complete culture medium was added to continue primary culture.
[0020] 3) Passage culture of operculum tissue cells from humpback perch
[0021] When primary cultured cells reach 80-90% adherent cell coverage, remove the old culture medium, add 3 mL of PBS for washing to remove residual serum and divalent metal ions, and discard the waste liquid (using a 1 mL pipette tip). Then, passage the cells using 0.25% trypsin digestion, ensuring all cells at the bottom of the flask are submerged. Seal the flask, shake for 2-3 minutes, and observe the cells under an inverted microscope. As time progresses, the originally adherent cells gradually become more rounded. Before they float to the surface, discard the trypsin and add 10 mL of culture medium to stop digestion. Digestion can also be observed visually; stop digestion when the bottom of the flask turns white and fine pinholes appear. Digestion at room temperature typically takes 1-3 minutes. Use a pipette to resuspend the adherent cells and transfer them to two or three other flasks. Briefly heat the flask opening and cap over an alcohol lamp flame, then seal the flasks and continue culturing at 27°C. Observe the adherent growth the next day. The cells were passaged at a ratio of 1:2; thereafter, they were passaged every 2-3 days until 210 days, 40 generations, at which point the osteoblast cell line of the humpback perch operculum was successfully established.
[0022] 4) Cryopreservation of gill operculum tissue cells from humpback perch
[0023] This invention also provides a method for cryopreserving the CAOBOB osteoblast cell line from the operculum of the humpback perch: Take a bottle of vigorously growing CAOBOB osteoblast cells that cover the bottom of the culture bottle, digest them with trypsin, centrifuge and collect the cell pellet, slowly add serum-free cell cryopreservation solution, and gently pipette the cells to disperse them evenly in the cell cryopreservation solution. Use a pipette to transfer the liquid into cryovials; place the cryovials at 4°C for 1 hour, then place them in a programmed gradient cooling cryopreservation box with a temperature decrease rate of 1°C / min. Place the cryopreservation box at -80°C for 1 day, and finally remove the cryovials and immerse them in liquid nitrogen for long-term cryopreservation.
[0024] 5) Recovery of gill operculum cells from humpback perch
[0025] The present invention also provides a method for thawing the CAOBOB osteoblast cell line from the operculum of the humpback perch. The cryovial is removed from liquid nitrogen and quickly placed in a water bath at 40°C. During the thawing process, the cryovial should be shaken continuously to ensure rapid and uniform thawing until completely thawed. The thawed cell suspension is then transferred to a centrifuge tube in a culture flask, and complete culture medium is added to the culture flask. The flask is then cultured at 27°C with 5% CO2. After 24 hours, the complete culture medium is replaced, and the culture continues.
[0026] 6) Application of gill operculum tissue cells in gene function of humpback perch
[0027] The osteoblasts of the operculum of the humpback perch of this invention were analyzed by alkaline phosphatase activity identification, transfection efficiency analysis, and dual-luciferase assay. The functional verification analysis of related genes was preliminarily obtained, which lays the foundation for the functional study of genes related to the development and formation of the humpback perch skeleton. It also provides an ideal model for elucidating the mechanism of skeletal development and the causes of operculum deformity, and has important value for the breeding of superior varieties and healthy aquaculture.
[0028] The above complete culture medium: based on L-15 culture medium, the addition amounts of fetal bovine serum, β-mercaptoethanol, human basic fibroblast growth factor (Human FGF-basic), human epithelial growth factor (Human EGF), human hepatocyte growth factor (Human HGF), human leukemia inhibitory factor (Human LIF), penicillin, streptomycin, and grouper serum were 15vol%~20vol%, 0.5vol‰, 10 μg / L, 5 μg / L, 1 μg / L, 1 μg / L, 100 IU / mL, 100 μg / mL, and 1vol, respectively.
[0029] The above-mentioned fish serum was prepared as follows: A 10 mL syringe was moistened with 15% (w / v) EDTA, and blood was collected from the tail vein of grouper into a 15 mL centrifuge tube placed on ice. The solution was centrifuged at 3,500 g for 15 min, and the supernatant was transferred to a 50 mL centrifuge tube and incubated overnight at 4°C. The solution was then centrifuged again at 3,500 g for 30 min. The supernatant was filtered through a 0.2 μm filter for sterilization. The supernatant was aliquoted into 10 mL tubes and stored at -20°C.
[0030] The method for constructing the operculum cell line of the humpback perch of the present invention has high reproducibility and the cultured operculum cell line has good stability.
[0031] This invention uses electrotransfection to perform transfection experiments on the gill operculum tissue cell line of humpback perch, achieving high transfection efficiency.
[0032] The cellular characteristics of the operculum tissue of the humpback perch of the present invention are excellent; the chromosome karyotype analysis is stable.
[0033] The osteoblasts of the operculum of the humpback perch of this invention were analyzed by alkaline phosphatase activity identification, transfection efficiency analysis and dual-luciferase experiment, and functional verification analysis of related genes were obtained. This provides an ideal model for elucidating the mechanism of skeletal development and the causes of operculum malformation, and has important value for breeding and healthy aquaculture.
[0034] The CAOBOB osteoblast cell line from the operculum of the humpback perch can be used to establish cell models related to skeletal development and operculum deformities in humpback perch.
[0035] The CAOBOB osteoblast cell line from the operculum of the humpback perch can be used in cell models to study the differentiation mechanism of osteoblasts in humpback perch, abnormal cell morphology and function, and the regulatory mechanism of operculum development.
[0036] The CAOBOB osteoblast cell line from the operculum of the humpback perch can be used to study the skeletal development and causes of operculum malformation in humpback perch, and to screen for reagents related to improving skeletal developmental malformations.
[0037] The CAOBOB osteoblast cell line from the operculum tissue of the humpback perch can be linked to osteogenic genes in humpback perch (such as...). En1b Applications in cell models for gene function verification, promoter activity analysis, and gene interaction research.
[0038] The CAOBOB osteoblast cell line from the operculum of the humpback perch can be used in the species origin verification of humpback perch-derived cell lines and as a cell model for cytogenetic studies.
[0039] The CAOBOB osteoblast cell line from the operculum of the humpback perch can be used in the large-scale preparation, long-term preservation, and resuscitation of the operculum osteoblast cell line from the humpback perch.
[0040] The complete culture medium used in the construction method of this invention consists of L-15 medium as the basal medium, fetal bovine serum, β-mercaptoethanol, human basic fibroblast growth factor (FGF-basic), human epithelial growth factor (EGF), human hepatocyte growth factor (HGF), human leukemia inhibitory factor (LIF), penicillin, streptomycin, and grouper serum. L-15 medium and FBS provide sufficient nutrients for cell growth; the addition of β-mercaptoethanol, human FGF-basic, human EGF, and human HGF stimulates cell activity and accelerates cell division and proliferation, while providing a good buffer environment for in vitro cell culture, enabling cells to maintain a stable pH during long-term culture; fish serum helps improve the mitotic activity of fish cells in culture and may be one of the key additives in current culture media; the addition of LIF effectively inhibits the differentiation of osteoblasts in the operculum and promotes cell proliferation.
[0041] This invention establishes, for the first time, a cell line derived from the bone tissue of the humpback perch, filling a gap in humpback perch bone tissue cell lines and providing a dedicated model for studying the mechanism of operculum deformity. The construction method of this invention exhibits good reproducibility; the cell line maintains stable morphology, karyotype, and growth characteristics even after 40 passages, and its activity remains stable after cryopreservation and thawing. This invention possesses excellent transfection characteristics and osteoblast specificity, meeting various experimental needs such as gene function verification and osteogenic mechanism analysis. This invention provides a key technical tool for the prevention and control of humpback perch operculum deformity and the breeding of superior varieties, contributing to the healthy development of the aquaculture industry and reducing economic losses. Attached Figure Description
[0042] Figure 1 Image of primary cultured operculum tissue cells of humpback perch after 5 days;
[0043] Figure 2 Image of primary cultured operculum tissue cells of humpback perch after 7 days;
[0044] Figure 3 Image of first-generation passaged cells from the operculum of the humpback perch;
[0045] Figure 4 Image of second-generation passaged cells from the operculum of the humpback perch;
[0046] Figure 5 Figure 5 shows the passaged cells of the operculum of the humpback perch.
[0047] Figure 6 Figure 10 shows the passaged culture of opercular bone tissue cells of humpback perch.
[0048] Figure 7 Figure 15 shows the passaged culture of opercular bone tissue cells of humpback perch.
[0049] Figure 8 Figure 20 passages of opercular bone tissue cells from humpback perch.
[0050] Figure 9 Image of 25 passages of operculum tissue cells from humpback perch.
[0051] Figure 10 Figure 30 passages of operculum tissue cells from humpback perch.
[0052] Figure 11 Figure 35 passages of operculum tissue cells from humpback perch.
[0053] Figure 12 Image of the cell line of the operculum of the humpback perch 24 h after cryopreservation and thawing.
[0054] Figure 13 Image showing the species origin identification results of the operculum tissue cell line of the humpback perch;
[0055] Figure 14 Image showing the karyotype analysis results of chromosomes from the operculum tissue of the humpback perch;
[0056] Figure 15 Image showing alkaline phosphatase staining of cells from the operculum of the humpback perch;
[0057] Figure 16 Image showing the results of transfecting EGFP into the operculum tissue cell line of humpback perch;
[0058] Figure 17 The image shows the results of a dual-luciferase assay on the operculum cell line of the humpback perch. Detailed Implementation
[0059] To make the objectives, technical solutions, and advantages of this invention clearer, the following embodiments will be used in conjunction with the accompanying drawings to further illustrate the invention. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
[0060] Unless otherwise specified, the experimental methods and reagents described in the following examples are all conventional methods.
[0061] Example 1: Establishment of a cell line from the operculum of the humpback perch
[0062] (1) Place the juvenile humpback bass on ice until the fish show no stress response to stimulation. Wipe off the mucus on the fish's body with sterile gauze. Wipe the fish's body twice with gauze soaked in 75% alcohol. Transfer the fish to a clean bench, remove the operculum tissue with dissecting instruments, and rinse 3-4 times in PBS solution containing 1X commercial triple antibiotics (penicillin, streptomycin, and amphotericin B) (i.e., 100mL of PBS solution with 1mL of 100X concentrated commercial triple antibiotics).
[0063] (2) The operculum tissue block was cross-cut into small pieces approximately 2 mm in size using two No. 11 scalpels. The cut tissue pieces were rinsed three times with PBS solution containing triple antibodies. After rinsing, the tissue pieces were transferred to 15 mL centrifuge tubes. Commercially available erythrocyte lysis buffer was used to lyse the attached blood cells. The tissue pieces were then washed three times with PBS solution. The tissue pieces were evenly placed into a cell culture flask, and the bottom of the flask was resuspended and moistened with 1 mL of complete culture medium. Primary culture was initiated at 27°C. 1 mL of culture medium was added on the second day, and another 1 mL was added on the third day. On the fourth day, the complete culture medium was replaced once, and 5 mL of complete culture medium was added to continue primary culture. Figures 1 to 2 As shown, adherent cells migrated from the surrounding tissue block on day 5 after the initiation of primary culture of the operculum tissue of the humpback perch. Figure 1 By day 9, the cell count had increased to 70-80%. Figure 2 ).
[0064] (3) When the primary culture of the cubital operculum bone cell line reaches 80-90% or higher of the adherent cell coverage, the primary cells may show obvious contact inhibition. At this time, the passage culture should be started by trypsin digestion. The classic cell digestion procedure is as follows: Remove the old culture medium from the original culture flask; add 5 mL of PBS solution and wash once to remove serum and divalent metal ions from the original culture medium (these substances will greatly affect the digestion of trypsin); pour out the PBS solution, add 0.5 mL of 0.25% commercially available EDTA-containing trypsin digestion solution, shake the flask to ensure the trypsin solution fully contacts the bottom cells, and pour out the trypsin digestion solution (this step should be done quickly, otherwise over-digestion may occur; when removing the trypsin digestion solution, leave enough solution to keep the bottom of the flask moist, otherwise some areas of the bottom of the flask may dry out and affect digestion); remove the culture flask and observe it under an inverted microscope. Once most cells have rounded up and detached from the wall, immediately transfer it to a clean bench and add 5 mL of serum-containing complete culture medium to stop digestion; pipette and examine the effect of pipetting. If there are too many residual cells, digestion can be repeated once; seed the cell suspension into a new culture flask at a ratio of 1:2-10, and add culture medium to a final volume of 5 mL. After adding mL, place the culture flask at a constant temperature of 27℃ for incubation, and then subculture every 2-3 days. Figures 3 to 11 As shown, the operculum cell line of the humpback perch exhibits a relatively stable predominantly long spindle shape from generation 1 to generation 40.
[0065] The above experiments demonstrate that the cell line culture method established in this invention is stable and reliable, and can be applied in the large-scale preparation of osteoblast cells from the operculum of the humpback perch.
[0066] Example 2: Cryopreservation and thawing of osteoblast cells from the operculum of the humpback perch
[0067] (1) Cryopreservation: Take one 75 cm bottle 2 The vigorous growth of osteoblast cells from the operculum of the humpback perch, which covered the bottom of the culture flask, was analyzed. After trypsin digestion and centrifugation, the cell pellet was collected, and 3 mL of prepared cell cryopreservation solution was slowly added. The cells were gently pipetted to ensure even dispersion. The liquid was then transferred to cryovials using a pipette. The cryovials were incubated at 4°C for 1 hour, then placed in a programmed gradient freezing box (temperature decrease rate of 1°C / min). The box was then incubated at -80°C for 1 day. Finally, the cryovials were removed and immersed in liquid nitrogen for long-term cryopreservation.
[0068] (2) Remove the cryovials from liquid nitrogen and quickly place them in a preheated water bath (40°C). During the thawing process, continuously shake the cryovials to ensure rapid and even thawing until completely thawed. Transfer the thawed cell suspension to centrifuge tubes in a 25 cm² culture flask, add 5 mL of complete culture medium, and incubate at 27°C with 5% CO₂. Replace with fresh complete culture medium after 24 h and continue culturing. Figure 12 As shown, the adhesion rate of the operculum osteoblasts of the humpback perch reached 60%-80% after cryopreservation and thawing for 24 hours, with no significant difference in cell morphology compared to before cryopreservation. The thawed operculum osteoblasts of the humpback perch can be passaged normally.
[0069] The above experiments demonstrate that the cell cryopreservation and thawing method of the present invention has excellent effects and can be applied to the long-term preservation and subsequent thawing of osteoblast cells from the operculum of the humpback perch.
[0070] Example 3: Species identification and verification of the operculum cell line of the humpback perch
[0071] The opercular bone cell line of the humpback perch was identified using RT-PCR technology. En1b Gene (upstream primer sequence (5'-3'): ATGGAAGAGCAAAAGGAG, downstream primer sequence (5'-3'): CTATTCACTGTCCTCCTTGTCC); such as Figure 13 As shown, En1b The gene was highly expressed in both opercular bone tissue and opercular bone cells. After gel extraction and purification, the sequencing sequence was similar to that of the humpback perch. En1b The gene sequence alignment results are over 99%.
[0072] The above experiments demonstrate that the identification method established in this invention is accurate and effective, and can be applied in the species tracing and verification of cell lines derived from humpback perch.
[0073] Example 4 Chromosome analysis of the operculum cell line of humpback perch
[0074] Harvesting operculum cells (30 generations, cells in good condition and basically covered the bottom of the flask at 48h) were collected from humpback perch and seeded into 75 cm2 cell culture flasks. When the cells were in the logarithmic growth phase, colchicine was added to a final concentration of 20 μg / mL. After culturing for another 6-8 h, the cells were collected to obtain a cell suspension. Transfer the cell suspension to a 15 mL centrifuge tube, centrifuge at 1,000 g for 10 min, gently aspirate the supernatant, add 4 mL of 0.075 M KCl for hypotonic treatment for 30 min; add 0.5 mL of freshly prepared, pre-chilled Carnoy's fixative for pre-fixation for 10 min, centrifuge at 2,000 g for 10 min; take the cell pellet, add 0.5 mL of Carnoy's fixative, and resuspend the pellet with a pipette; add another 1 mL of fixative; drop the pellet onto a glass slide (pretreated at -20 ℃) from a height of 30 cm, place it horizontally to allow it to spread completely, and dry at 65 ℃; then immerse it in a staining jar containing Giemsa stain working solution for staining for 10 min, rinse with double-distilled water to remove surface debris, dry, mount with neutral resin, and observe and count at 1000 × oil immersion. Figure 14 As shown, chromosome analysis of the operculum cell line of the humpback perch showed that 74% of the cells in the mitotic phase had a chromosome number of 2n=48.
[0075] The above experiments demonstrate that the cell line karyotype established in this invention is stable and can be applied in cytogenetic studies of humpback perch and in the analysis of karyotype mechanisms related to skeletal development.
[0076] Example 5: Alkaline phosphatase staining analysis of the operculum cell line of the humpback perch
[0077] Harvesting, actively dividing operculum cells (passage 30, cells in good condition and largely adhering to the bottom of the flask at 48 hours) were collected and cultured in cell culture plates to a suitable density (to allow for 80% cell proliferation before subsequent experiments). The culture medium was aspirated, and the cells were gently washed twice with pre-chilled PBS. 4% PFA was added, and the cells were fixed at room temperature for 15-20 min. The cells were washed three times with PBS, 5 min each time. 0.1% Triton X-100 (prepared with PBS) was added, and the cells were incubated at room temperature for 10 min. The cells were washed twice with PBS, 5 min each time. BCIP / NBT staining solution was prepared according to the manufacturer's instructions (operated in the dark). The staining solution was evenly applied to the cells, and the cells were placed in a light-proof container and incubated at 37°C or room temperature for 30-60 min (observing the staining under a microscope). After staining was complete (a blue-purple precipitate appeared), the reaction was stopped with PBS or deionized water, and the cells were washed three times. Figure 15 As shown, the operculum cells of the humpback perch were stained blue-purple, indicating that the cell line has strong alkaline phosphatase (ALP) activity and osteoblast characteristics.
[0078] The above experiments demonstrate that the cell line established in this invention possesses osteoblast core characteristics and can be applied in the study of osteogenic mechanisms in humpback perch and in the analysis model of osteogenic function related to operculum development.
[0079] Example 6: Analysis of EGF transfection efficiency of humpback perch operculum cell line
[0080] Vigorously dividing opercular bone cells of humpback perch (passage 30, cells in good condition and largely adhering to the bottom of the flask at 48h) were used for transfection experiments using a BEX™ CUY21 EDIT II electroporator. The pEGFP-N1 plasmid was electroporated into the humpback perch opercular bone cell line. The culture medium was changed after 24h, and cell status was observed after 48h. Cells were gently washed twice with pre-cooled PBS, and fixed for 10min at room temperature with 4% PFA. They were then washed three times with PBS for 3min each time. 0.1% Triton X-100 (prepared with PBS) was added, and the cells were incubated for 10min at room temperature. They were then washed twice with PBS for 2min each time. DAPI staining solution was prepared according to the manufacturer's instructions (protected from light), and the staining solution was evenly applied to the cells. The cells were incubated in a light-protected container at room temperature for 15min for nuclear staining. Cells were washed three times with PBS for 1min each time. The expression of green fluorescence in the cells was observed and photographed under an inverted fluorescence microscope. Figure 16 As shown, 48 h after transfection, the cell nuclei stained blue, and the pEGFP-N1 plasmid expressed green fluorescence in the cell line. The transfection efficiency was about 70%, indicating that the established humpback perch operculum cell line can adapt to the transfection experiment of exogenous genes.
[0081] The above experiments demonstrate that the cell line established in this invention has high transfection efficiency and can be applied in the model for verifying the function of exogenous genes in humpback perch and studying gene regulation mechanisms.
[0082] Example 7: Dual-luciferase assay of ovarian operculum cell line of humpback perch
[0083] The plasmids used for transfection in this experiment were the target plasmid (PGL3-en1b-basic, pCDNA3.1-en1b-8s), the internal control plasmid (TK), the negative control (PGL3-basic), and the positive control (PGL3-en1b-basic).
[0084] When cells have grown well after passage and reached 70%–80% confluency, transfection can be performed. After digestion, do not discard the mixture; directly add an appropriate amount of fresh cell culture medium, repeatedly pipette, and then seed the cells into 48-well plates. Incubate in a constant temperature incubator. After 24 hours, observe the cells under a microscope. If all cells adhere to the plate and the density reaches 70%–80%, transfection can be performed. Use Lipofectamine 3000 as the transfection reagent, with a ratio of internal control plasmid to target plasmid of 1:20. The specific procedure is as follows:
[0085] Before transfection, the concentration of the transfected plasmid must be determined, and... En1b The promoter plasmid and en1b overexpression plasmid were diluted to approximately 200 ng / μL, and the internal control plasmid was diluted to 50 ng / μL. 1 μg (5 μL) of plasmid was added to 25 μL of Opti-MEM medium, mixed well, and incubated at room temperature for 5 min. Simultaneously, 1 μL of Lipo3000 transfection reagent was added to 25 μL of Opti-MEM medium in a new 1.5 mL EP tube, mixed by pipetting, and incubated at room temperature for 5 min. After 5 min, the plasmid and Opti-MEM medium mixture was added dropwise to the transfection reagent and Opti-MEM medium mixture, mixed by pipetting, and incubated at room temperature for 20 min. During this time, the old cell culture medium was aspirated from the culture plate, and 200 μL of Opti-MEM medium was slowly added. The mixture was carefully suspended and added dropwise to the culture plate, 50 μL per well, and the bottom of the plate was gently tapped to mix the solution thoroughly. After transfection, the 48-well plate was returned to the incubator for 24 hours of incubation. h, then cells can be collected for activity assays. Dual-luciferase activity was measured using the Promega Dual-Luciferase® Reporter Assay System kit and the Berthold LB9508 tube chemiluminescence analyzer. The activities of firefly luciferase and Renilla luciferase were recorded separately; the ratio of their activities represents the relative activity of the plasmid dual-luciferase reporter gene. For example... Figure 17 As shown, it can be seen that after overexpression of pCDNA3.1-en1b-8s, En1b The activation of promoter activity indicates that the established humpback perch operculum cell line can adapt to overexpression experiments and promoter interaction experiments. These experiments demonstrate that the cell line established in this invention can express humpback perch osteogenic-related genes (such as…) En1b It is applied in promoter activity analysis, gene interaction and functional verification models of genes, providing technical support for elucidating the causes of operculum deformity.
[0086] The above embodiments are merely preferred embodiments of the present invention and should not be considered as limiting the scope of the present invention. All equivalent variations and improvements made within the scope of the present invention should still fall within the patent coverage of the present invention.
Claims
1. An osteoblast cell line from the operculum of a humpback perch, characterized in that... It was named the CAOBOB osteoblast line from the operculum of the humpback perch and was deposited at the China Center for Type Culture Collection on May 17, 2025, with accession number CCTCC NO:C2025130.
2. The method for establishing an osteoblast cell line from the operculum of a humpback perch according to claim 1, characterized in that... Includes the following steps: 1) Obtaining the operculum tissue of the humpback bass: Place the humpback bass fry on ice until they no longer respond to the stress; after disinfecting the body surface, remove the operculum tissue of the humpback bass and place it in PBS solution containing penicillin, streptomycin and amphotericin B. 2) Primary culture: The above-mentioned operculum tissue of the humpback perch was chopped into small tissue pieces, washed with PBS solution, treated with red blood cell lysis buffer, dry-attached to culture flasks and added with complete culture medium. Primary culture was started at 27℃ and 5% CO2. The culture medium was added and replaced as needed. 3) Subculture: When the cells grow to 80%-90% coverage, they are washed with PBS, digested with trypsin, and digested with culture medium to stop the digestion. The cells are then prepared into a cell suspension and subcultured at a ratio of 1:
2. The cells are cultured at 27°C and subcultured every 2-3 days. After 40 generations, the osteoblast cell line of the cubital operculum tissue is obtained. 4) Cryopreservation: Take logarithmic phase cells, digest and centrifuge to collect the precipitate, add serum-free cell cryopreservation solution, place the cryopreservation tubes at 4℃ for 1 h, then treat with a programmable gradient cooling of 1℃ / min to -80℃, and then transfer them to liquid nitrogen for long-term cryopreservation. 5) Resuscitation: After removing the cryovials from liquid nitrogen, thaw them quickly in a 40°C water bath. Inoculate the thawed cell suspension into culture flasks and add complete culture medium. Incubate at 27°C and 5% CO2. Replace the complete culture medium after 24 hours.
3. The method for establishing an osteoblast cell line from the operculum of a humpback perch according to claim 2, characterized in that... In step 2), the complete culture medium is based on L-15 culture medium, and the amounts of fetal bovine serum, β-mercaptoethanol, human basic fibroblast growth factor (Human FGF-basic), human epithelial growth factor (Human EGF), human hepatocyte growth factor (Human HGF), human leukemia inhibitory factor (Human LIF), penicillin, streptomycin, and grouper serum added are 15vol%~20vol%, 0.5vol‰, 10 μg / L, 5 μg / L, 1 μg / L, 100 IU / mL, 100 μg / mL, and 1vol%, respectively.
4. The method for establishing an osteoblast cell line from the operculum of a humpback perch according to claim 3, characterized in that... The method for preparing the grouper serum is as follows: 10 mL of syringe is moistened with 15% (w / v) EDTA, and blood is collected from the tail vein of the grouper into a 15 mL centrifuge tube placed on ice; the serum is centrifuged at 3,500 g for 15 min, and the supernatant is transferred to a 50 mL centrifuge tube and incubated overnight at 4 °C; the serum is then centrifuged again at 3,500 g for 30 min, and the supernatant is filtered through a 0.2 μm filter for sterilization. The supernatant is aliquoted into 15 mL centrifuge tubes and stored at -20 °C.
5. The application of the osteoblast cell line of the operculum tissue of humpback perch according to claim 1 in establishing a cell model related to skeletal development and operculum deformity of humpback perch.
6. The application of the osteoblast cell line of the operculum tissue of humpback perch according to claim 1 in a cell model for studying the differentiation mechanism of osteoblasts in humpback perch, abnormal cell morphology and function, and the regulatory mechanism of operculum development.
7. The application of the osteoblast cell line of the operculum tissue of humpback perch according to claim 1 in the study of skeletal development and causes of operculum malformation in humpback perch, and in screening reagents for improving skeletal developmental malformations.
8. The application of the osteoblast cell line from the operculum of the humpback perch according to claim 1 in a cell model for verifying osteoblast gene function, analyzing promoter activity, and studying gene interaction in humpback perch.
9. The application of the osteoblast cell line of operculum tissue of humpback perch according to claim 1 in the cell model for species tracing and verification and cytogenetic research of humpback perch-derived cell lines.