Gastric cancer anaplasia early diagnosis kit based on exosome miRNA-4433-5p expression level
By detecting the expression of Hsa-miR-4433-5p in the exosomes of gastric cancer patients and using real-time quantitative PCR technology, the problem of early diagnosis of gastric cancer cachexia was solved, enabling accurate diagnosis of gastric cancer cachexia and reference for clinical medication.
Patent Information
- Application Number
- CN202210753426.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2021-06-29
- Filing Date
- 2022-06-29
- Publication Date
- 2026-04-14
- Estimated Expiration
- 2042-06-29
AI Technical Summary
Currently, there is a lack of effective means for early diagnosis of cachexia in gastric cancer. Existing serum marker tests have low predictive value for cachexia and cannot accurately predict its occurrence.
By detecting the expression level of Hsa-miR-4433-5p in plasma exosomes of gastric cancer patients, and using real-time quantitative PCR technology to calculate the difference ΔCT between the amplification cycle threshold Ct and the internal reference gene, an early diagnostic kit for gastric cancer cachexia was developed.
It enables convenient and accurate early diagnosis of gastric cancer cachexia, provides more accurate references for clinical medication and nutritional support, and is applicable to most gastric cancer patients.
Smart Images

Figure BDA0003721749030000081 
Figure BDA0003721749030000082 
Figure HDA0003721749040000011
Abstract
Description
Technical Field
[0001] This invention belongs to the field of oncology medicine and relates to the detection of Hsa-miR-4433-5p content in plasma exosomes, and a kit for early diagnosis of gastric cancer cachexia based on exosomal miRNA-4433-5p expression. Background Technology
[0002] Gastric cancer (GC) is one of the most common malignant tumors of the digestive tract, characterized by high incidence and mortality rates, both of which are increasing year by year. Although cancer treatments are constantly being researched and improved with the continuous development of medical technology, the high incidence and difficulty in early diagnosis of gastric cancer still pose significant challenges to improving the survival rate of patients. Cachexia is a multifactorial metabolic syndrome, clinically manifested primarily as weight loss and muscle atrophy (with or without fat loss). Cachexia caused by tumors is the most common, known as cancer cachexia. Studies show that over 20% of patients with cancer cachexia die directly from the disease. Cachexia is particularly common in gastrointestinal tumors, with 80% of gastric cancer patients developing it. Cancer patients with cachexia are more sensitive to the toxicity of chemotherapy drugs and experience a decline in quality of life, thus severely impacting their prognosis. Currently, there are no effective methods for diagnosing and treating cachexia, and much research focuses on biomarkers for predicting the occurrence of cancer cachexia. However, the detection of serum markers generally has low predictive value for cachexia. For example, tumor markers such as CEA, CA19-9, and CA724 can only predict the probability of developing a tumor, but not the occurrence of cachexia.
[0003] One of the functions of exosomes is as a medium for intercellular communication, closely related to tumor proliferation, apoptosis, drug resistance, and metastasis. Non-coding RNAs, as one of the main active substances, are the biological basis for these functions. Non-coding RNAs mainly include microRNAs (miRNAs), long non-coding RNAs (lncRNAs), and circular RNAs (ciRNAs). Among them, miRNAs are a class of endogenous single-stranded RNAs with a length of 19–25 nt. They exert a fine-tuning effect on downstream target mRNAs through post-transcriptional gene silencing mechanisms, influencing many malignant tumor phenotypes such as malignant transformation, anchorage-independent growth, epithelial-mesenchymal transition, angiogenesis, and drug resistance. Exosomes can carry miRNAs into the circulatory system, delivering the miRNAs contained in their vesicle structures (i.e., exosomal miRNAs) to specific target cells through autocrine, paracrine, and endocrine mechanisms. This allows the miRNAs in exosomes to not only evade degradation but also promote cell-cell and tissue-tissue communication.
[0004] With the discovery of miRNAs, numerous miRNAs have been shown to participate in inflammatory responses, induce metastasis, and mediate cancer invasion, and even participate in protein synthesis and degradation pathways in skeletal muscle. Tumor development can trigger communication between tumor cells and muscle cells, leading to protein degradation and metabolism in muscle. Changes in miRNA expression profiles during tumor development can influence the occurrence of muscle-related diseases. Altering miRNA levels can affect myogenesis, leading to skeletal muscle hypertrophy or atrophy, and consequently cachexia. The mechanism may involve inducing the activation of apoptosis-related signaling pathways or ubiquitin-protease systems within muscle cells, thereby promoting protein degradation in muscle cells.
[0005] Hsa-miR-4433-5p is a relatively rare miRNA, rarely reported in previous studies. A 2019 article published in the Journal of Cancer first reported its relationship with chronic myeloid leukemia. In this article, Hsa-miR-4433-5p was identified as a miRNA targeting Bcr-Abl, possibly epigenetically regulated by SAHA, a histone deacetylase inhibitor approved by the FDA for the treatment of cutaneous T-cell lymphoma. The article suggests that stable expression of Hsa-miR-4433-5p can inhibit the expression of Bcr-Abl and downstream genes, thereby suppressing cancer cell activity. However, the function and role of Hsa-miR-4433-5p in other tumors have not been reported.
[0006] Currently, there is no kit available that can predict gastric cancer cachexia by detecting miRNAs contained in plasma exosomes in peripheral blood, thereby enabling convenient and accurate early diagnosis of gastric cancer cachexia. Summary of the Invention
[0007] The purpose of this invention is to provide an early diagnostic kit for gastric cancer cachexia based on the expression level of exosomal miRNA-4433-5p. This kit can improve the accuracy of early diagnosis of gastric cancer cachexia and improve the prognosis of gastric cancer patients by real-time quantitative PCR detection of Hsa-miR-4433-5p in plasma exosomals.
[0008] To achieve the above objectives, the present invention adopts the following technical solution:
[0009] A method for detecting the content of exosomal miRNA-4433-5p in plasma includes the following steps:
[0010] 1) Extract exosomal RNA from the plasma of gastric cancer patients, and reverse transcribe the miRNA in the exosomal RNA to obtain the reverse transcripts of the exosomal miRNA;
[0011] 2) Using the reverse transcript of the exosomal miRNA (which is cDNA obtained by reverse transcription of miRNA extracted from total RNA of plasma exosomal tissue) as a template, the cDNA sequence corresponding to Hsa-miR-4433-5p (i.e., exosomal miRNA-4433-5p) in plasma exosomal tissue is amplified by real-time quantitative PCR. After the amplification is completed, the amplification cycle threshold Ct of the cDNA sequence corresponding to Hsa-miR-4433-5p in plasma exosomal tissue is determined (abbreviated as the amplification cycle threshold Ct of Hsa-miR-4433-5p);
[0012] 3) Calculate the difference ΔCT between the amplification cycle threshold Ct of Hsa-miR-4433-5p and the amplification cycle threshold Ct of the internal reference gene.
[0013] Preferably, in step 1), the peripheral blood collected from gastric cancer patients (diagnosed with gastric cancer through tissue or cytopathological diagnosis) is centrifuged to obtain plasma, and exosome RNA is extracted from the plasma.
[0014] Preferably, in step 2), the real-time quantitative PCR amplification primers for the cDNA sequence corresponding to Hsa-miR-4433-5p in plasma exosomes consist of an upstream primer and a downstream primer, wherein the downstream primer is a universal miRNA primer, and the sequence of the upstream primer is:
[0015] 5`-ATGTCCCACCCCCACTCCTGT-3`.
[0016] A diagnostic kit for early gastric cancer cachexia, comprising real-time quantitative PCR amplification primers for Hsa-miR-4433-5p (e.g., the upstream and downstream primers described above).
[0017] Preferably, the above-mentioned Hsa-miR-4433-5p is extracted from the peripheral blood of patients with gastric cancer.
[0018] Preferably, the above-mentioned Hsa-miR-4433-5p is extracted from plasma exosomes of gastric cancer patients.
[0019] Preferably, when the difference ΔCT between the amplification cycle threshold Ct of Hsa-miR-4433-5p in the plasma exosomes of gastric cancer patients and the amplification cycle threshold Ct of the internal reference gene exceeds the limit (e.g., the difference ΔCT between the amplification cycle threshold of Hsa-miR-4433-5p and the amplification cycle threshold of the internal reference gene U6 satisfies: -2 < ΔCT ≤ 0), the closer the difference ΔCT is to the limit (e.g., -2), the higher the risk of cachexia in the patient.
[0020] The application of the above-mentioned Hsa-miR-4433-5p in the preparation of a diagnostic kit for early gastric cancer cachexia.
[0021] The application of the above-mentioned Hsa-miR-4433-5p reverse transcript in the preparation of a diagnostic kit for early gastric cachexia.
[0022] Application of the above-mentioned Hsa-miR-4433-5p amplification primers in the preparation of a diagnostic kit for early gastric cancer cachexia.
[0023] The beneficial effects of this invention are reflected in:
[0024] This invention develops a diagnostic kit based on miRNAs closely related to gastric cancer cachexia identified through high-throughput sequencing. This kit can predict the occurrence of cachexia in gastric cancer patients by detecting the expression of specific miRNAs in their plasma exosomes, and is less affected by other underlying diseases. This provides a more accurate and reliable reference standard for clinical medication and nutritional support in gastric cancer patients. The diagnostic kit can be developed based on mature technologies such as exosomal RNA extraction and miRNA detection, requiring only a small blood sample, making it suitable for most gastric cancer patients, and providing rapid and convenient diagnostic results.
[0025] Furthermore, this invention, through the sequence design of primers for real-time quantitative PCR amplification, enables rapid, accurate, and reliable detection of Hsa-miR-4433-5p expression in exosomes of gastric cancer patients' plasma. Attached Figure Description
[0026] Figure 1AThe extracted exosomes were identified by electron microscopy (TEM).
[0027] Figure 1B Nanoparticle tracking analysis (NTA) was performed on the extracted exosomes.
[0028] Figure 1C Western blotting identification of the extracted exosomes.
[0029] Figure 2A High-throughput sequencing analysis of plasma exosomes from 3 patients with gastric cancer cachexia and 2 patients with gastric cancer without cachexia (differential miRNA volcano plot).
[0030] Figure 2B High-throughput sequencing analysis of plasma exosomes from 3 patients with gastric cancer cachexia and 2 patients with gastric cancer without cachexia (differential miRNA clustering diagram).
[0031] Figure 3 The expression of Hsa-miR-4433-5p in plasma exosomes of gastric cancer patients was analyzed; where: Normal represents the non-cakexia group of gastric cancer; Cachexia represents the cachexia group of gastric cancer; ***P≤0.05 indicates statistical difference.
[0032] Figure 4 The ROC curve for Hsa-miR-4433-5p is shown. Detailed Implementation
[0033] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. The embodiments are explanations of the present invention and not limitations on the scope of protection of the present invention.
[0034] 1. Sample collection
[0035] Patient details were recorded. Peripheral blood was collected from gastric cancer patients using 5mL anticoagulant blood collection tubes. Within 30 minutes of collection, the peripheral blood samples were centrifuged at 4°C and 3000rpm for 15 minutes. The supernatant, which is plasma, was collected, labeled, and frozen at -80°C. Peripheral blood collection location: Digestive Diseases Hospital, First Affiliated Hospital of Air Force Medical University; Collection period: July 2020 to December 2020; peripheral blood was collected during surgery.
[0036] 2. Screening for miRNAs associated with gastric cancer cachexia in plasma exosomes of gastric cancer patients.
[0037] 2.1 Plasma exosome extraction and whole transcriptome sequencing
[0038] Plasma exosomes were randomly extracted from 3 patients with gastric cancer cachexia and 2 patients with gastric cancer without cachexia. The exosome samples were frozen at -80℃ and sent to Beijing Enzekangtai Biotechnology Co., Ltd. for whole transcriptome sequencing.
[0039] The extraction of plasma exosomes was performed using a rapid exosome extraction kit (the kit is used in two stages, the first stage of which involves the extraction of exosomes), including the following steps:
[0040] 1) Collect peripheral blood from gastric cancer patients using a 5mL anticoagulant blood collection tube, and centrifuge the sample at 4℃ and 3000r for 15min within 30min after collection. Take the supernatant, which is plasma.
[0041] 2) Filter the obtained plasma (1-2 mL) into a 5 mL EP tube using a 0.8 μm filter to remove cell debris and larger cell vesicles;
[0042] 3) Add an equal volume of XBP Buffer (the ratio of plasma to XBP Buffer in the previous step is 1:1) to the EP tube and immediately gently invert and mix 5 times.
[0043] 4) Transfer the mixture to an exoEasy spin column, centrifuge at 500g for 1 min, discard the liquid, and return the column to the collection tube (if there is still liquid on the column membrane, centrifuge again at 5000g for 1 min).
[0044] 5) Add 3.5 mL of XWP Buffer to the centrifuge column, centrifuge at 5000 g for 5 min, and discard the liquid and collection tube;
[0045] 6) Place the centrifuge column in a new collection tube, elute with 400 μL XE Buffer, centrifuge at 5000g for 5 min, and the resulting eluent is the exosome solution.
[0046] See Figure 1A , Figure 1B and Figure 1C The specific identification results of the extracted exosomes are as follows:
[0047] 1) Electron microscopy showed that the exosomes had intact morphology and structure and were evenly distributed;
[0048] 2) Nanoparticle tracking analysis (NTA) results showed that the particle size (diameter) of the exosomes was around 125 nm;
[0049] 3) Western blotting showed that exosomes expressed membrane markers CD9 and CD81, as well as intracapsular marker TSG-101.
[0050] 2.2 Screening for differentially expressed miRNAs associated with gastric cancer cachexia
[0051] Based on high-throughput sequencing of the whole transcriptome of plasma exosomes from 3 patients with gastric cancer cachexia and 2 patients without gastric cancer cachexia, the expression profiles of miRNAs in plasma exosomes from these two groups were analyzed. A total of 24 differentially expressed miRNAs were identified in the exosomes of patients with gastric cancer cachexia, of which 12 were upregulated and 12 were downregulated (see [link to relevant documentation]). Figure 2A , Figure 2B The three miRNAs with the largest fold change in expression were selected as candidate molecules and validated in clinical samples, showing consistency with the sequencing results.
[0052] 3. Verify the relationship between Hsa-miR-4433-5p and cachexia in gastric cancer.
[0053] 3.1 The candidate molecule Hsa-miR-4433-5p, which was screened by high-throughput sequencing and showed a differential expression fold of 10.61-fold associated with gastric cancer cachexia, was validated in exosomes of the plasma of gastric cancer patients by real-time quantitative PCR.
[0054] 3.1.1 Design of primers for Hsa-miR-4433-5p and internal reference gene U6 amplification
[0055] Hsa-miR-4433-5p amplification primers:
[0056] Upstream primer F1: 5`-ATGTCCCACCCCCACTCCTGT-3`
[0057] Downstream primer R1: QIAGEN miScript SYBR Green PCR Kit universal primer
[0058] Internal reference gene U6 amplification primers:
[0059] Upstream primer F2: 5`-AAAGCAAATCATCGGACGACC-3`
[0060] Downstream primer R2: QIAGEN miScript SYBR Green PCR Kit universal primer
[0061] 3.1.2 Extraction of exosomal RNA from plasma of gastric cancer patients
[0062] Exosomal RNA extraction was performed using a rapid exosomal extraction kit (the kit is used in two stages; the second stage involves the extraction of total exosomal RNA), including the following steps:
[0063] 1) Collect peripheral blood from gastric cancer patients using a 5mL anticoagulant blood collection tube, and centrifuge the sample at 4℃ and 3000g for 15 minutes within 30 minutes after collection. Collect the supernatant, which is plasma.
[0064] 2) Filter the obtained plasma (1-2 mL) into a 5 mL EP tube using a 0.8 μm filter to remove cell debris and larger cell vesicles;
[0065] 3) Add an equal volume of XBP Buffer (the ratio of plasma to XBP Buffer in the previous step is 1:1) to the EP tube and immediately gently invert and mix 5 times.
[0066] 4) Transfer the mixture to an exoEasy spin column, centrifuge at 500g for 1 min, discard the liquid, and return the column to the collection tube (if there is still liquid on the column membrane, centrifuge again at 5000g for 1 min).
[0067] 5) Add 3.5 mL of XWP Buffer to the centrifuge column, centrifuge at 5000 g for 5 min, and discard the liquid and collection tube;
[0068] 6) Place the centrifuge column into a new collection tube;
[0069] 7) Add 700 μL of QIAzol to the membrane of the centrifuge column, centrifuge at 5000g for 5 min, obtain the lysis buffer and transfer it to a 2 mL EP tube;
[0070] 8) Brief Vortex oscillation, incubate at room temperature (15-25℃) for 5 min;
[0071] 9) Add 90 μL of chloroform to the EP tube, tighten the EP tube cap, and shake vigorously for 15 seconds;
[0072] 10) Incubate at room temperature (15-25℃) for 2-3 minutes;
[0073] 11) Centrifuge at 12000g, 4℃ for 15min;
[0074] 12) Transfer the top layer of water sample to a new 2mL EP tube, add twice the volume of anhydrous ethanol, and mix by pipetting several times.
[0075] 13) Place the RNeasy MinElute spin column into a 2mL collection tube, take 700μL of the mixture obtained in step 12), transfer it to the spin column, tighten the cap, centrifuge at 12000g at room temperature for 15s, and discard the liquid.
[0076] 14) Take the remaining mixture from step 12), repeat step 13) to transfer and centrifuge, and discard the liquid;
[0077] 15) Add 700 μL of RWT Buffer to the centrifuge column, cap it, centrifuge at 12000g for 15 seconds, and discard the liquid;
[0078] 16) Add 500 μL of RPE Buffer to the centrifuge column, cap it, centrifuge at 12000g for 15s, and discard the liquid;
[0079] 17) Add 500 μL of RWT Buffer to the centrifuge column, cap it, centrifuge at 12000g for 2 min, and discard the liquid;
[0080] 18) Place the centrifuge column into a new 2mL collection tube, open the cap, and centrifuge at the maximum speed of the centrifuge for 5 minutes to air dry the membrane of the centrifuge column. Discard the collection tube.
[0081] 19) Place the centrifuge column into a new 1.5 mL collection tube, add 14 μL of RNase-free water to the central membrane of the centrifuge column, tighten the cap, let stand for 1 min, and then centrifuge at full speed for 1 min to elute RNA, thereby obtaining the total exosome RNA solution for RNA concentration determination.
[0082] 3.1.3 Reverse transcription
[0083] Take 1 μg of total exosomal RNA and reverse transcribe it using the QIAGEN miScript II RT Kit (50). The reaction volume (20 μL) consisted of 4 μL of 5×Prime Script RT Master Mix and RNase-free dH2O added to 20 μL. The reaction conditions were: 37℃ for 90 min; 95℃ for 5 min; and 4℃ for 10 min.
[0084] Dilute the cDNA in the reaction system with ultrapure water (1:2).
[0085] 3.1.4 Real-time PCR
[0086] Real-time PCR was performed using TaKaRa's TB Green Premix Ex Taq II reagent, with three replicates for each sample.
[0087] The reaction system consisted of 20 μL: 10 μL of 2×TB Green Premix Ex Taq II, 0.5 μL of 10 μM upstream primer, 0.5 μL of 10 μM downstream primer, 2 μL of cDNA template, and deionized water to a final volume of 20 μL.
[0088] On the Bio-Rad CFX Manager real-time quantitative PCR instrument, the standard three-step amplification procedure for real-time quantitative PCR was performed:
[0089] 1) Pre-denaturation: 95℃ for 180s;
[0090] 2) PCR reaction: 95℃ for 10s, 56℃ for 15s, 72℃ for 15s, for a total of 54 cycles.
[0091] After the reaction was completed, data analysis was performed. After adjusting the baseline cycle and calculating the threshold, the Ct value automatically generated by the instrument was used, employing a 2... -ΔΔCt The relative expression levels of Hsa-miR-4433-5p and the internal reference gene U6 were calculated using the method.
[0092] 3.2 Results
[0093] Gene expression was detected in plasma samples from 66 gastric cancer patients using real-time PCR. Among them, 36 were non-cachexia gastric cancer patients and 30 were gastric cancer cachexia patients. The results showed ( Figure 3 Compared with the non-causewelled gastric cancer group, the expression level of Hsa-miR-4433-5p in plasma exosomes of patients in the cachexia group was significantly increased, and the difference was statistically significant.
[0094] 4. Early diagnosis of gastric cachexia
[0095] This invention utilizes high-throughput sequencing to discover the upregulated expression of Hsa-miR-4433-5p in exosomes from the plasma of patients with gastric cancer cachexia. Real-time quantitative PCR results showed high expression of Hsa-miR-4433-5p in the exosomes of patients with gastric cancer cachexia, consistent with the high-throughput sequencing results. Based on these findings, it is hypothesized that Hsa-miR-4433-5p plays a crucial role in the occurrence and development of gastric cancer cachexia. Therefore, Hsa-miR-4433-5p in plasma exosomes is a biomarker for the occurrence of gastric cancer cachexia, providing a novel target for the prediction and early diagnosis of gastric cancer cachexia. The following specific examples illustrate the design and development of a method directly targeting this target for the prediction and early diagnosis of gastric cancer cachexia.
[0096] 4.1 Design of Real-Time PCR Primers for Hsa-miR-4433-5p and Internal Reference Gene
[0097] Upstream primer F1: 5`-ATGTCCCACCCCCACTCCTGT-3`
[0098] Downstream primer R1: Universal primers from the QIAGEN miScript SYBR Green PCR Kit were used.
[0099] Upstream primer F2: 5`-AAAGCAAATCATCGGACGACC-3`
[0100] Downstream primer R2: Universal primers from the QIAGEN miScript SYBR Green PCR Kit were used.
[0101] 4.2 Sample Preprocessing
[0102] Peripheral blood was collected from gastric cancer patients (cachexia and non-cachexia) using a 5 mL anticoagulation blood collection tube (EDTA). The sample was centrifuged at 4°C and 3000 rpm for 15 minutes within 30 minutes after collection. The supernatant was collected as plasma, which was labeled and stored at -80°C for later use.
[0103] 4.3 Rapid and convenient detection of Hsa-miR-4433-5p gene expression in plasma exosomes using Real-Time PCR.
[0104] 1) Main reagents
[0105]
[0106] 2) Main instruments
[0107]
[0108] 3) Solution preparation
[0109] Primer storage solution preparation: Centrifuge the lyophilized primer powder at 12000 rpm for 1 min, and add the corresponding ddH2O / TE as shown on the primer tube wall to dissolve it, with a concentration of 100 μmol / L.
[0110] Primer working solution preparation: Add primer stock solution with a concentration of 100 μmol / L to ddH2O / TE and dilute 5 times to a concentration of 10 μmol / L.
[0111] 4.4 adopts 2 -ΔΔCt The relative expression level of Hsa-miR-4433-5p in plasma exosomes was calculated using this method.
[0112] After the Real-Time PCR amplification reaction program, the instrument automatically calculates the value representing the relative expression level based on the obtained Ct value.
[0113] Quantitative analysis revealed that the difference ΔCT between the amplification cycle threshold Ct of Hsa-miR-4433-5p in plasma exosomes and the amplification cycle threshold Ct of the internal reference gene U6 in patients with gastric cancer cachexia was not higher than -2 (ΔCT≤-2 indicates high expression level of Hsa-miR-4433-5p in plasma exosomes). In contrast, the difference ΔCT between the amplification cycle threshold Ct of Hsa-miR-4433-5p in plasma exosomes and the amplification cycle threshold Ct of the internal reference gene U6 in patients with gastric cancer non-cachexia was higher than -2 (ΔCT>-2 indicates low expression level of Hsa-miR-4433-5p in plasma exosomes). Based on the quantitative results of a large number of clinical samples, the ΔCT value of -2 was used as a limit to predict the occurrence of cachexia in gastric cancer patients. The closer the ΔCT (>-2) is to -2, the higher the risk of cachexia. When the ΔCT value of a gastric cancer patient who has not been diagnosed with cachexia drops to 0, it is determined that the gastric cancer patient will develop cachexia.
[0114] 4.5 Receiver Operating Curve (ROC) Correlation Analysis and Calculation of Biomarker Evaluation Indicators
[0115] Based on the levels of Hsa-miR-4433-5p in peripheral blood exosomes collected from patients and their clinical characteristics, the predictive ability of this screened miRNA (Hsa-miR-4433-5p), which is closely related to the occurrence of gastric cancer cachexia, was evaluated. ROC curve analysis results showed ( Figure 4 In independent plasma samples, the area under the curve (AUC) for peripheral blood exosome Hsa-miR-4433-5p was 0.7528, with a 95% confidence interval of (0.636, 0.869). This indicates that the method described above for detecting the relative expression level of this miRNA (Hsa-miR-4433-5p) demonstrates good discriminative ability and fitting performance in the development of gastric cancer cachexia. Furthermore, based on the ROC curve, the diagnostic sensitivity of this miRNA (Hsa-miR-4433-5p) is 0.8333, specificity is 0.6667, accuracy is 0.7424, positive predictive value is 0.6757, and negative predictive value is 0.8276.
[0116] In summary, this invention experimentally demonstrates that a specific exosomal miRNA, Hsa-miR-4433-5p, is closely related to the occurrence and development of gastric cancer cachexia. Therefore, using Hsa-miR-4433-5p as an important target in gastric cancer genomics, and by collecting a small amount of peripheral blood from gastric cancer patients and detecting and analyzing the expression of Hsa-miR-4433-5p in plasma exosomals, important references can be provided for the early diagnosis of gastric cancer cachexia and subsequent nutritional support. <110> Air Force Medical University of the Chinese People's Liberation Army <120> Early diagnostic kit for gastric cancer cachexia based on exosomal miRNA-4433-5p expression level <160> 2 <210> 1 <211> twenty one <212> DNA <213> Artificial synthesis <400> 1 atgtcccacc cccactcctg t 21 <210> 2 <211> twenty one <212> DNA <213> Artificial synthesis <400> 2 aaagcaaatc atcggacgac c 21
Claims
1. Application of real-time quantitative PCR detection reagent for reverse transcriptase of Hsa-miR-4433b-5p in the preparation of early diagnostic kit for gastric cancer cachexia.
2. The application according to claim 1, characterized in that: The real-time quantitative PCR detection reagent includes real-time quantitative PCR amplification primers for Hsa-miR-4433b-5p in plasma exosomes. These primers consist of an upstream primer and a downstream primer. The downstream primer is a universal miRNA primer, and the sequence of the upstream primer is as follows: 5`- ATGTCCCACCCCCACTCCTGT -3`.
3. Application of Hsa-miR-4433b-5p amplification primers in the preparation of a diagnostic kit for early gastric cancer cachexia.
4. The application according to claim 3, characterized in that: The amplification primers consist of an upstream primer and a downstream primer, wherein the downstream primer is a universal miRNA primer, and the sequence of the upstream primer is as follows: 5`- ATGTCCCACCCCCACTCCTGT -3`.
Citation Information
Patent Citations
Advanced assessment of risk of Kawasaki syndrome
CN110205377A
Analysis method, kit, and detection device
WO2024127723A1