A recombinant fusion protein and application thereof in preparation of anti-gastric cancer angiogenesis drugs
By recombining a gastric cancer vascular-targeting peptide with the Endostatin gene to construct a recombinant fusion protein, specific targeting of gastric cancer blood vessels was achieved, improving anti-tumor effects and reducing toxic side effects, thus solving the problem of poor targeting of existing drugs in gastric cancer.
Patent Information
- Application Number
- CN202510498990.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-21
- Publication Date
- 2026-06-23
- Estimated Expiration
- 2045-04-21
AI Technical Summary
Existing tumor angiogenesis-targeted therapies are not highly effective in gastric cancer, leading to toxic side effects on normal blood vessels and affecting the safety and efficacy of the drugs.
A recombinant fusion protein was designed by recombining the gastric cancer vascular targeting peptide CNTGSPYEC with the gene of the potent vascular inhibitor Endostatin. By utilizing the selective distribution ability of the targeting peptide, Endostatin is more specifically enriched in gastric cancer vascular endothelial cells, reducing its distribution in normal blood vessels and tissues.
It enhances anti-angiogenic and anti-tumor effects, reduces the toxic side effects of drugs on normal tissues, and improves the current status of anti-angiogenic therapy for gastric cancer.
Smart Images

Figure CN120349425B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to a recombinant fusion protein and its application in the preparation of anti-gastric cancer angiogenesis drugs. Background Technology
[0002] The concept that tumor growth and metastasis require the participation of new blood vessels, proposed by Professor Folkman in 1971, is now widely accepted and increasingly valued. Correspondingly, tumor angiogenesis-targeted therapy has become a new hot topic in anti-tumor research. Currently, various targeted drugs against tumor angiogenesis, including Bevacizumab, Endostatin, Sorafenib, Sunitinib, and interferon, are used for first- and second-line clinical treatment of various tumors such as colon cancer, lung cancer, breast cancer, liver cancer, and kidney cancer. However, the current status of anti-angiogenic therapy in gastric cancer is not ideal. Classic drugs like bevacizumab, sorafenib, and sunitinib have failed to demonstrate clinical benefit and have produced toxic side effects such as leukopenia and thrombocytopenia. While novel anti-VEGFR-2 drugs have been proven effective in phase III clinical trials, they only prolong overall survival (OS) and progression-free survival (PFS) by a little over two months. Ramucirumab and the EGFR-TKI apatinib have both caused side effects such as hypertension, proteinuria, hand-foot syndrome, and hematological toxicity, leading to dosage reduction or even discontinuation. Current tumor angiogenesis-targeted therapies all suffer from low specificity, resulting in toxic side effects on normal blood vessels while inhibiting tumor angiogenesis, severely impacting their clinical application. To overcome these problems, it is essential to improve the targeting of angiogenesis-inhibiting drugs to achieve "precision guidance." Therefore, developing highly selective targeted drugs for tumor angiogenesis is of great significance for improving the safety and efficacy of tumor angiogenesis-targeted therapy and reducing toxic side effects. Summary of the Invention
[0003] The purpose of this invention is to provide a recombinant fusion protein and its application in the preparation of anti-gastric cancer angiogenesis drugs, thereby solving the problems existing in the prior art. This recombinant fusion protein can effectively target gastric cancer vascular endothelial cells and exhibits good anti-angiogenic and anti-tumor effects.
[0004] To achieve the above objectives, the present invention provides the following solution:
[0005] This invention provides a recombinant fusion protein with targeted anti-angiogenic activity in gastric cancer, the amino acid sequence of which is shown in SEQ ID NO.1.
[0006] The present invention also provides a gene encoding the above-mentioned recombinant fusion protein.
[0007] Furthermore, the nucleotide sequence of the encoding gene is shown in SEQ ID NO.2.
[0008] The present invention also provides a recombinant plasmid comprising the above-described encoding gene.
[0009] The present invention also provides a recombinant host cell comprising the above-described recombinant plasmid.
[0010] The present invention also provides the use of the above-mentioned coding gene, recombinant plasmid or recombinant host cell in the preparation of the above-mentioned recombinant fusion protein.
[0011] The present invention also provides a method for preparing the above-mentioned recombinant fusion protein, comprising the steps of fermenting and culturing the above-mentioned recombinant host cells and then separating and purifying the recombinant fusion protein.
[0012] The present invention also provides the application of the above-mentioned recombinant fusion protein in the preparation of anti-gastric cancer angiogenesis drugs.
[0013] The present invention also provides an anti-gastric cancer angiogenesis drug, the active ingredient of which includes the above-mentioned recombinant fusion protein.
[0014] Furthermore, the anti-gastric cancer angiogenesis drug also includes pharmaceutically acceptable excipients.
[0015] The present invention discloses the following technical effects:
[0016] This invention recombinants the amino acid sequence of the gastric cancer vascular targeting peptide CNTGSPYEC with the gene of the potent vascular inhibitor Endostatin to construct a recombinant fusion protein. Utilizing the selective distribution capability of the targeting peptide, it can carry the anti-angiogenic drug Endostatin to more specifically accumulate in gastric cancer vascular endothelial cells, thereby enhancing anti-angiogenic and anti-tumor effects. At the same time, by reducing the distribution of Endostatin in normal blood vessels and tissues, it can reduce the corresponding toxic side effects, which is of great significance for improving the current status of anti-angiogenic therapy for gastric cancer. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0018] Figure 1 The results of SDS-PAGE electrophoresis of recombinant fusion protein 1 are shown; where M1: protein marker (Bio-Rayet); R: reducing conditions; NR: non-reducing conditions;
[0019] Figure 2The results are from Western blot analysis of recombinant fusion protein 1; where M2: protein marker (GenScript); P: multi-tag protein; R: reducing conditions; NR: non-reducing conditions.
[0020] Figure 3 The results show the purity of recombinant fusion protein 1.
[0021] Figure 4 The images show the results of in vitro immunofluorescence analysis of the targeting peptides; where A is the fluorescence staining image of Co-HUVEC cells; B is the fluorescence staining image of HUVEC cells; the scale bar is 50 μm; Control peptide represents the control peptide, and Targeting peptide represents the targeting peptide.
[0022] Figure 5 The images show the results of in vitro immunofluorescence analysis of the recombinant fusion proteins; where A is the fluorescence staining image of recombinant fusion protein 1; and B is the fluorescence staining image of recombinant fusion protein 2.
[0023] Figure 6 A statistical graph showing the viability of HUVEC cells treated with PBS, control peptide, and target peptide; Control peptide represents the control peptide, and Targeting peptide represents the target peptide.
[0024] Figure 7 This is a statistical graph showing the viability of Co-HUVEC cells treated with PBS, control peptide, and targeting peptide; control peptide represents the control peptide, and targeting peptide represents the targeting peptide.
[0025] Figure 8 A statistical graph showing the inhibition rates of the targeting peptide on HUVECs and Co-HUVECs at different concentrations;
[0026] Figure 9 A statistical graph showing the viability of HUVEC cells treated with Endostatin and recombinant fusion protein; rh-Endo represents Endostatin; peptide-Endo represents recombinant fusion protein;
[0027] Figure 10 A statistical graph showing the viability of Co-HUVEC cells treated with Endostatin and recombinant fusion protein; rh-Endo represents Endostatin; peptide-Endo represents recombinant fusion protein;
[0028] Figure 11This image shows the formation of tubular structures in cells in Matrigel after treatment with PBS, control peptide, and targeting peptide; control peptide represents the control peptide, and targeting peptide represents the targeting peptide; all scale bars are 200 μm.
[0029] Figure 12 This is a statistical graph showing the number of linkage sites under PBS, control peptide, and target peptide treatments; Control peptide represents the control peptide, and Targeting peptide represents the target peptide.
[0030] Figure 13 The diagram (A) shows the formation of tubular structures in Matrigel cells treated with control peptide, target peptide, recombinant fusion protein, and Endostatin, and the statistical diagram (B) shows the number of connection points. In A, peptide represents the target peptide, rh-Endo represents Endostatin, and peptide-Endo represents the recombinant fusion protein. In B, pep represents the target peptide, es represents Endostatin, and p-es represents the recombinant fusion protein.
[0031] Figure 14 The images show the results of transwell and cell scratch assays; A and B are the transwell assay results for HUVEC and Co-HUVEC, respectively; C and D are the cell scratch assay results for HUVEC and Co-HUVEC, respectively; Endo represents Endostatin; peptide-Endo represents the recombinant fusion protein; the scale bars in C and D are both 200 μm.
[0032] Figure 15 The results of the in vivo targeting identification experiment are shown in the figure; the scale bar is 100 μm.
[0033] Figure 16 The in vivo targeting identification results of Cy5 and Cy5-labeled targeting peptides are shown in the figure; where A is the fluorescence detection figure; B is the fluorescence intensity statistics at different times; C is the fluorescence tissue distribution figure; and D is the fluorescence intensity statistics of each tissue.
[0034] Figure 17 The images show the in vivo targeting identification results of Cy5 and Cy5-labeled recombinant fusion proteins; where A is the fluorescence detection image; B is the fluorescence intensity statistics at different times; C is the fluorescence tissue distribution image; and D is the fluorescence intensity statistics of each tissue; Cy5-peptide-Endo represents the Cy5-labeled recombinant fusion protein.
[0035] Figure 18The image shows the results of the cytotoxicity assay. In the figure, Endo293T represents the experimental group with Endostatin added to 293T cells; peptide-Endo293T represents the experimental group with peptide-Endo added to 293T cells; EndoL929 represents the experimental group with Endostatin added to L929 cells; and peptide-EndoL929 represents the experimental group with peptide-Endo added to L929 cells.
[0036] Figure 19 A statistical graph showing the tumor volume of tumor-bearing nude mice in different treatment groups; where peptide represents the targeting peptide; Endo represents Endostatin; and peptide-Endo represents the recombinant fusion protein.
[0037] Figure 20 CD31 staining map (A) and microvessel density statistical map (B) of tumor tissues from different treatment groups. Detailed Implementation
[0038] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0039] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0040] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0041] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0042] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0043] Example 1
[0044] Construction of recombinant fusion proteins:
[0045] A gastric cancer vascular targeting peptide was fused to the amino terminus of Endostatin using a gene recombination method to construct a pep-Endostatin transient protein expression vector for mammalian cells (PTT5 plasmid vector, purchased from Nanjing Genscript Biotech Co., Ltd.). The vector was expressed in CHO cells and labeled with a His-tag at the end.
[0046] 1. Recombinant fusion protein design
[0047] Sequence design: The amino acid sequence of the guide peptide is CNTGSPYEC, and the cloning site of the recombinant plasmid PTT5-Endostatin is EcoRI / HindIII. The cloning strategy and sequence are as follows:
[0048] Recombinant fusion protein 1: EcoRI-Kozak seguence-Artificial signal peptide-targeting peptide-GS Linker-Endostatin-His6tag-stop codon-HindIII; its amino acid sequence is shown in SEQ ID NO.1, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.2.
[0049] SEQ ID NO.1:
[0050]
[0051] SEQ ID NO.2:
[0052] ATGGGCTGGTCCTGTATTATCCTGTTCCTGGTCGCCACAGCCACCGGAGTGCACTCTTGTAATACCGGATCTCCTTACGAGTGCGGCGGAGGTGGCTCTGGAGGCGGTGGATCTGGTGGTGGCGGATCAGCTCACAGCCACCGGGACTTCCAACCAGTGCTGCACCTGGTGGCCCTGAACAGCCCCCTGAGCGGCGGAATGCGGGGCATCAGAGGCGCTGATTTCCAGTGCTTCCAGCAGGCCAGAGCCGTGGGTCTGGCCGGCACCTTCAGAGCCTTCCTGTCTAGCAGACTGCAGGACCTGTACAGCATCGTTAGACGGGCCGATAGAGCTGCTGTGCCTATCGTGAACCTGAAAGACGAGCTGCTCTTTCCATCTTGGGAAGCCCTGTTCAGCGGCAGTGAAGGCCCTCTGAAGCCCGGCGCCAGAATCTTCAGCTTCGACGGCAAGGACGTGCTGAGACACCCTACATGGCCCCAGAAGAGCGTGTGGCACGGCTCCGATCCTAACGGCCGGAGGCTTACAGAAAGCTACTGCGAGACATGGCGCACCGAGGCCCCTAGCGCCACCGGCCAGGCTAGCAGCCTGCTGGGAGGCAGACTGCTGGGCCAGAGCGCCGCCAGCTGCCACCACGCCTATATCGTGCTGTGCATCGAGAACAGCTTTATGACCGCCTCCAAGCACCACCACCACCATCATTGA. Recombinant fusion protein 2: EcoRI - Kozak seguence - Artificial signal peptide - Targeting peptide - EAAAK Linker - Endostatin - His6 tag - Stop codon - HindIII; its amino acid sequence is shown in SEQ ID NO.3, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.4.
[0053] SEQ ID NO.3:
[0054]
[0055] SEQ ID NO.4:
[0056] .
[0057] 2. Preparation of recombinant fusion proteins
[0058] Two recombinant fusion proteins were prepared using the following method:
[0059] (1) Construction of recombinant plasmids
[0060] ① Restriction enzyme digestion reaction: Pour melted 0.8% agarose into a small plate trough. After the gel solidifies, add 0.5×TBE electrophoresis buffer. Add the enzyme-digested DNA and sample loading solution (containing sucrose, bromophenol blue, and EDTA) to the sample wells. Turn on the power and perform electrophoresis at 50-75V.
[0061] ② Preparation of competent Escherichia coli: Single colonies were inoculated into ApLB-free culture medium and incubated overnight at 37°C with shaking. The next day, they were transferred at 2% to pre-warmed LB flasks and shaken for another 2-3 hours to allow the OD to adjust. 600 = 0.4, stop culturing, centrifuge at 4℃, collect the bacteria into a new centrifuge tube, suspend in cold 100mM CaCl2, incubate on ice for 40min, centrifuge at 4℃ for 5min at 5000rpm, discard the supernatant, add 1 / 15 volume of cold CaCl2, continue incubation on ice for 40min, add pure glycerol to the final volume concentration of 30%, dispense into EP tubes, and store at -70℃ for long-term use.
[0062] ③ DNA ligation: The enzyme digestion products were separated by 1.5% agarose gel electrophoresis and recovered. They were ligated into the PTT5 vector and identified by double digestion with HindIII. Simultaneously, a fragment of approximately 702 bp was excised from the clone containing the insert and recovered for later use. The synthesized nucleic acid fragment encoding the target peptide was denatured at 65°C for 5 min, annealed, and ligated with the above fragment and the EcoRI-treated PTT5 plasmid. The ligation product was transformed into competent E. coli cells, and the recombinant plasmid was obtained by enzyme digestion identification and DNA sequencing.
[0063] (2) Cell culture and transient transfection with CHO-Expression:
[0064] ①CHO-Expression cells (purchased from Pronosei) were grown in serum-free expression medium. Cells were maintained in Erlenmeyer flasks on a shaker at 37°C and 5% CO2.
[0065] ② On the day of transfection, heat the expression medium to 25℃-37℃. Add 50μM α-mannosidase II inhibitor to the medium 1 hour before transfection.
[0066] ③ Add the recombinant plasmid and PEI transfection reagent to the transfection buffer, mix thoroughly, and soak at room temperature.
[0067] ④ Add the DNA / reagent mixture to the cells and return the culture to the incubator.
[0068] ⑤ Add preheated culture medium to the cell culture.
[0069] ⑥ The cell culture supernatant collected on day 7 was used for purification.
[0070] (3) Purification and analysis:
[0071] ① Centrifuge the cell culture medium.
[0072] ② Add the cell culture supernatant to HisTrap TM FF stock solution.
[0073] ③ After washing and eluting with buffer solution, collect the eluted fractions and replace the buffer solution with the final formulation buffer solution.
[0074] Binding buffer: 25mM chloroform, 300mM sodium chloride, pH 8.0.
[0075] Elution buffer: 25mM Tris, 300mM NaCl, 1M imidazole, pH 8.0.
[0076] Final buffer: PBS, pH 7.2.
[0077] ④ The purified protein was analyzed by SDS-PAGE and SEC-HPLC (column: TSKgelG3000sWxl) to determine its molecular weight and purity.
[0078] ⑤ Use A 280 Measure the concentration.
[0079] (4) Recombinant protein SDS-PAGE electrophoresis and Western blot detection
[0080] Centrifuge 1 mL of induced or uninduced bacterial culture to collect the precipitate. Add 15 μL of H2O and 15 μL of 2× loading buffer (5% 8-mercaptoethanol, 4% SDS, 0.025% bromophenol blue), mix well, boil in water for 5 min, centrifuge at 12000 rpm for 2 min, and add 5 μL of the supernatant. Prepare a 12% separating gel and stacking gel using Leammi discontinuous PAGE. Then, add 1× running buffer to the electrophoresis tank, add the sample, and start electrophoresis at 120 V. After the sample reaches the separating gel, adjust the voltage to 160 V until the bromophenol blue runs off the gel. Immerse the gel in a staining solution prepared with Coomassie Brilliant Blue R-250 for at least 2 h. Destain overnight with a destaining solution (70 mL glacial acetic acid, 200 mL ethanol, diluted with distilled water to 1000 mL).
[0081] The sample protein was transferred to a nitrocellulose membrane by electrotransfer, and Western blot analysis was performed using mouse anti-human endostatin monoclonal antibody as the primary antibody and enzyme-labeled anti-mouse IgG as the secondary antibody.
[0082] The identification results showed that the molecular weights of the two recombinant fusion proteins were as expected, and the purity of both reached 98%. The identification results for recombinant fusion protein 1 are shown below. Figures 1-3 The results showed that the molecular weight of the recombinant fusion protein was between 18 and 32 kDa, and the purity was 98%.
[0083] 3. Identification of the targeting properties of vascular-targeting peptides in gastric cancer
[0084] HUVECs or Co-HUVECs were plated at an appropriate density on 24-well plate coverslips. The cell coverslips were incubated with normal goat serum for 30 minutes. The slides were washed three times with PBS (pH 7.2), 5 minutes each time. Two synthesized recombinant fusion proteins were incubated separately with the cell coverslips at a concentration of 100 μg / mL at room temperature for 1 hour. The binding affinity of the control peptide (CNKSPSGNC), the targeting peptide (CNTGSPYEC), the recombinant fusion protein, and the endothelial marker CD31 was assessed by co-localization. After washing away the recombinant fusion protein, the cell coverslips were stained with anti-CD31 antibody, followed by staining with FITC-conjugated anti-mouse IgG, anti-recombinant fusion protein His-tag fluorescent secondary antibody, and targeting peptide fluorescent secondary antibody. After washing three times with PBS (pH 7.2), the cell coverslips were observed under a fluorescence microscope (Nikon EZ-C1, Nikon, Tokyo, Japan).
[0085] In vitro immunofluorescence analysis of the targeting peptide showed that all cells were stained green by CD31, a biomarker for endothelial cells. Furthermore, all cell nuclei were stained blue. In the Co-HUVEC group, the peptide CNTGSPYEC, which binds to Co-HUVECs, showed red positive staining and co-localized with CD31 on the cell surface and in the perinuclear cytoplasm. In contrast, Co-HUVECs also showed negative results when stained with the control peptide or PBS instead of the targeting peptide CNTGSPYEC. Figure 4 (A). In the HUVEC group, the observed results were different. Regardless of whether the control peptide or the targeting peptide CNTGSPYEC was used for staining, no pale red positive staining was observed on the control HUVECs. Figure 4 (B) These results indicate that the targeting peptide can only bind to tumor vascular endothelial cells, but cannot bind nonspecifically to normal vascular endothelial cells.
[0086] In vitro immunofluorescence analysis of recombinant fusion protein ( Figure 5 The results showed that when recombinant fusion protein 2 was used, all cells were stained green by CD31, and all cell nuclei were stained blue. The red fluorescence of the recombinant fusion protein was almost entirely absent in both normal vascular endothelial cells and gastric cancer vascular endothelial cells. Figure 5 (B); When recombinant fusion protein 1 is used, weak red fluorescence is visible in normal vascular endothelial cells, but strong red fluorescence is visible in co-cultured gastric cancer vascular endothelial cells, and the position is consistent with the green fluorescence of CD31. Figure 5 (A). The results suggest that recombinant fusion protein 1 can specifically bind to Co-HUVECs and has vascular targeting in gastric cancer, while recombinant fusion protein 2 has insufficient targeting.
[0087] This invention hypothesizes that the function of the targeting peptide may be susceptible to steric hindrance from the recombinant fusion protein. Specifically, different linkers can significantly affect the spatial conformation of the fusion protein and its interaction with the target molecule. For recombinant fusion protein 2, there may be a significant steric hindrance effect, thus adversely affecting the targeting function of the targeting peptide. Based on these considerations, in subsequent studies, this invention selected recombinant fusion protein 1 (named peptide-Endo) for further experimental verification.
[0088] Example 2
[0089] 1. Establishment of cell culture and tumor endothelial cell co-culture model
[0090] Human gastric cancer cells (MKN45), human umbilical vein endothelial cells (HUVEC), and human microvascular endothelial cells (HMVEC) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and cultured in M200 basal medium (Gibco) supplemented with 10% heat-inactivated fetal bovine serum (FBS), low-serum growth supplement (Cascade Biologics, USA), 100 U / mL penicillin, and 10 mg / mL streptomycin. Cells were stored in a CO2 incubator (Forma Scientific).
[0091] MKN45 and HUVEC cells were co-cultured in transwell plates with a pore size of 0.4 μm. The two cell lines were separated by a semipermeable membrane in the transwell plate, in which the upper and lower chambers were interconnected. Therefore, HUVEC and MKN45 cells could interact through secreted soluble factors, thereby mimicking the tumor microenvironment and establishing an in vitro culture model of gastric cancer vascular endothelial cells (Co-HUVEC).
[0092] 2. Cell proliferation assay
[0093] Cell proliferation was measured using the CCK8 assay. 5 × 10⁵ cells in the logarithmic growth phase were collected. 3 HUVECs and Co-HUVECs were seeded into 96-well plates. Five replicates were performed for each group. After 8 hours, different concentrations of PBS, control peptide (CNKSPSGNC), target peptide (CNTGSPYEC), Endostatin, and recombinant fusion protein peptide-Endo were added to each well for 24 hours. Then, 10 μL of CCK8 solution was added to each well. After 2 hours of incubation, absorbance was measured at 450 nm using a microplate reader (Infinite M Nano, TECAN).
[0094] The CCK8 test results are shown below. Figures 5-9 .
[0095] The targeting peptide reproducibly inhibited the proliferation of Co-HUVECs in a dose-dependent manner. The relative cell number difference between cells treated with the targeting peptide and those treated with the control peptide was not significant for HUVECs. Figure 6 The concentrations at 10, 25, 50, 75, and 100 μM were significantly different for Co-HUVECs (P < 0.01). Figure 7 Furthermore, the inhibitory effect induced by the targeting peptide was more pronounced in Co-HUVECs than in HUVECs, with the inhibition rate increasing to 61.7%. Figure 8 ).
[0096] The recombinant fusion protein selectively inhibited the proliferation of gastric cancer vascular endothelial cells (Co-HUVECs). At concentrations of 12.5-200 μg / mL, the inhibition rate increased with increasing concentration (P<0.05), while no clear inhibitory effect was observed on the proliferation of normal vascular endothelial cells (HUVECs). Figure 9 As shown, both Endostatin and the recombinant fusion protein inhibited normal vascular endothelial cells to some extent, but the difference between the two was not significant. However, in the gastric cancer vascular endothelial cell (Co-HUVEC) group, compared to Endostatin, the recombinant fusion protein showed a dose-dependent inhibitory effect on gastric cancer vascular endothelial cells, significantly higher than the 15% inhibition rate of Endostatin on Co-HUVECs. Furthermore, compared to HUVECs, the recombinant fusion protein showed a more significant inhibitory effect on the proliferation of Co-HUVECs, with the highest inhibition rate reaching 35%. Figure 10 ).
[0097] 3. Endothelial cell tube formation experiment:
[0098] One day prior to the experiment, Matrigel stored at -20℃ was thawed at 4℃. An ice box was prepared, and the 96-well plates were pre-chilled. The experiment was repeated three times. Matrigel was diluted to 2.5 mg / mL with serum-free culture medium and coated into the 96-well plates (the entire process was performed on ice), 50 μL / well. The plates were incubated at 37℃ for 30 min until naturally solidified. Co-HUVECs in the logarithmic growth phase were harvested and the density was adjusted to 5 × 10⁻⁶. 4 Cells / mL. 100 μL (approximately 5000 cells) of cells were seeded into each well of a coated 96-well plate and incubated overnight at 37°C. After cell attachment, 20 μM of the targeting peptide (CNTGSPYEC), control peptide, recombinant fusion protein peptide-Endo, endostatin, or PBS were added, and the cells were incubated for another 48 h. The formation of tubular structures in the cells was observed under an inverted microscope.
[0099] like Figures 11-12As shown, both untreated HUVECs and Co-HUVECs began to aggregate, forming bundles and distinct long tubular structures on the Matricella matrix. The addition of both the control peptide and the targeting peptide had no significant effect on tube formation in HUVECs. However, in the Co-HUVEC group, the control peptide showed little anti-angiogenic activity, with cells forming discontinuous tube analogs, although they tended to connect; in contrast, the group containing the targeting peptide showed significant anti-angiogenic activity, with almost no visible cell network formation. The targeting peptide inhibited microtubule formation, reducing microvessel counts by 40%, suggesting that the targeting peptide has the ability to inhibit cancer angiogenesis.
[0100] like Figure 13 As shown, in the normal vascular endothelial group, treatment with either Endostatin or the recombinant fusion protein significantly inhibited tubule formation in vascular endothelial cells, but there was no significant difference between the two. In the gastric cancer vascular endothelial group, treatment with either Endostatin or the recombinant protein significantly inhibited tubule formation in gastric cancer vascular endothelial cells, and the recombinant protein group showed a more pronounced inhibitory effect on gastric cancer vascular endothelial tubule formation, suggesting that the targeting peptide can enhance the ability of Endostatin to inhibit gastric cancer angiogenesis.
[0101] Furthermore, transwell and cell scratch assays showed that, compared to the control group, both Endostatin and recombinant fusion protein treatments significantly inhibited the migration of normal vascular endothelial cells (HUVECs), but there was no significant difference between the two. However, in the gastric cancer vascular endothelial cell Co-HUVEC group, treatment with either Endostatin or the recombinant fusion protein significantly inhibited the migration of gastric cancer vascular endothelial cells, with the recombinant fusion protein group showing a more pronounced inhibitory effect on gastric cancer vascular endothelial cell migration. Figure 14 ).
[0102] 4. Cytotoxicity test
[0103] The activities of Endostatin and the recombinant fusion protein peptide-Endo were measured in L929 and 293T cells. Briefly, 2 × 10⁻⁶ cells were used. 4 Cells were seeded per well in 96-well plates containing 100 μL of growth medium. After 24 hours, cells were treated with 100 μL of different concentrations of FBS1640-free, Edostatin, and peptide-Endo-free solutions, respectively. Cells were then cultured for another 24 hours. Finally, cell viability was measured using the CCK8 assay. Results are shown below. Figure 18 The results showed that even at high concentrations, the recombinant protein did not significantly affect the cell viability of these cell lines.
[0104] 5. In vivo targeting identification
[0105] In in vivo experiments, under general anesthesia, tumor-bearing mice (n=3) were administered 100 μL of PBS, a Cy3-labeled targeting peptide, a Cy3-labeled control peptide, a Cy3-labeled recombinant fusion protein, or Endostatin via the tail vein. Three hours after administration, the tissues were fixed by myocardial perfusion with 4% paraformaldehyde, and gastric cancer tissue and normal gastric tissue were separated. Sections of gastric cancer and normal gastric tissue were incubated overnight at 4°C with CD31. After washing away the primary antibody, the sections were incubated with FITC-conjugated anti-mouse IgG. The sections were observed under a fluorescence microscope (Nikon EZ-C1, Nikon, Tokyo, Japan).
[0106] In vivo immunofluorescence analysis results ( Figure 15 The results showed that the endothelial cell biomarker CD31 (green) could be visualized in both normal gastric tissue and the vascular system of cancer, while DAPI (blue) could be visualized at the nucleus. Simultaneously, the recombinant protein (red) was found to stain only in the vascular system of gastric cancer tissue, co-localizing with CD31, indicating that the peptide targets the vascular system of cancer. However, no Cy3-labeled targeting peptide was observed in control organs, including the heart, liver, spleen, lung, kidney, and normal gastric tissue, and no similar co-localization was observed in these pooled images. These results indicate that the recombinant protein selectively accumulates in the blood vessels of gastric cancer.
[0107] 6. Biological distribution of targeting peptides and recombinant fusion proteins in tumor-bearing nude mice.
[0108] Tumors bearing 100-300 mm in size and weighing 18-22g were collected from 4-6 week old infants. 3 Female nude mice were divided into two groups (n=3) and injected intravenously with Cy5, a Cy5-labeled targeting peptide, or a Cy5-labeled recombinant fusion protein (0.5 mg / kg), respectively. Fluorescence signals were acquired at 1, 3, 6, 12, and 24 hours post-injection using a live-in imaging system (Spectral Instruments Imaging Ami HTX, USA) (Ex=640 nm, Em=670 nm). The mice were sacrificed 24 hours after probe injection, and semi-quantitative analysis was performed on the heart, liver, spleen, lungs, kidneys, and tumors using Aura Imaging 4.0 software (Spectral Instruments Imaging, LLC, USA).
[0109] The experimental results are shown in Figures 16-17 .
[0110] like Figure 16 As shown in Figure A, using mice injected with Cy5 as a control, a stronger fluorescence signal was observed in the tumor tissue of mice injected with Cy5-CNTGSPYEC. The fluorescence signal reached its peak 3 hours after injection. Figure 16 (B) The in vitro tissue distribution of Cy5-CNTGSPYEC was examined 24 hours after injection. Figure 16 (C) as Figure 16 As shown in Figure D, a large amount of Cy5-CNTGSPYEC was detected in xenograft tumors, with small amounts of fluorescence signal in the lungs, kidneys, and liver, and very little in other tissues. Except for the lower accumulation in tumor tissues, the in vitro distribution of Cy5 in major organs did not differ significantly.
[0111] like Figure 17 As shown in Figure A, using mice injected with Cy5 as a control, the fluorescence intensity of tumor tissue in the peptide-Endo treatment group was higher than that of other organs, indicating good tumor targeting ability. The fluorescence signal reached its peak 6 hours after injection. Figure 17 (B) The in vitro tissue distribution of the Cy5-labeled recombinant fusion protein was examined 24 hours after injection. Figure 17 (C) For example Figure 17 As shown in Figure D, a large amount of Cy5-labeled recombinant fusion protein was detected in xenograft tumors, with a small amount of fluorescence signal in the lungs and kidneys, and very little in other tissues. Except for the low accumulation in tumor tissues, the in vitro distribution of Cy5 in major organs did not differ significantly.
[0112] 7. Tumor inhibition experiment in nude mice and detection of blood routine, liver and kidney function, myocardial enzyme spectrum, etc.:
[0113] Thirty-five tumor-bearing nude mice were randomly divided into four groups of five each. Gastric cancer cells were diluted to the required cell count (0.1 mL cell suspension, i.e., 1 × 10⁻⁶ cells). 6 Cells were subcutaneously inoculated into the backs of nude mice. The recombinant fusion protein group received a tail vein injection of peptide-Endo 5 mg / kg, the targeted peptide group received a tail vein injection of peptide 5 mg / kg, the negative control group received a tail vein injection of Endostatin 5 mg / kg, and the blank control group received an equal volume of physiological saline via tail vein injection. Injections were administered once daily for two weeks. Tumor volume was calculated after a fixed mass formed at the inoculation site following cell transplantation. Each group of nude mice was measured weekly, using calipers to measure the long axis (L) and short axis (D) of the tumor mass. The tumor volume was calculated using the formula: V = L × D. 2 / 2. Nude mice were killed 24 hours after the last administration, tumors were collected, their volume and weight were measured, and the microvascular density of the tumor tissue was determined by CD31 staining.
[0114] Statistical graphs of tumor volume in each group of tumor-bearing nude mice are shown below. Figure 19 The results of the tumor tissue microvessel density detection are shown in [the table below]. Figure 20 The results showed that the recombinant fusion protein could effectively slow tumor growth.
[0115] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A recombinant fusion protein with targeted anti-angiogenic activity in gastric cancer, characterized in that, The amino acid sequence is shown in SEQ ID NO.
1.
2. A gene encoding the recombinant fusion protein as described in claim 1.
3. The encoding gene according to claim 2, characterized in that, The nucleotide sequence of the encoding gene is shown in SEQ ID NO.
2.
4. A recombinant plasmid, characterized in that, Includes the coding gene as described in claim 2 or 3.
5. A recombinant host cell, characterized in that, Includes the recombinant plasmid as described in claim 4.
6. The use of the encoding gene as described in claim 2 or 3, the recombinant plasmid as described in claim 4, or the recombinant host cell as described in claim 5 in the preparation of the recombinant fusion protein as described in claim 1.
7. A method for preparing the recombinant fusion protein as described in claim 1, characterized in that, The method includes the step of fermenting and culturing the recombinant host cell according to claim 5, and then separating and purifying the recombinant fusion protein.
8. The use of the recombinant fusion protein as described in claim 1 in the preparation of an anti-gastric cancer angiogenesis drug.
9. An anti-angiogenic drug for gastric cancer, characterized in that, The active ingredient includes the recombinant fusion protein as described in claim 1.
10. The anti-gastric cancer angiogenesis drug according to claim 9, characterized in that, The anti-gastric cancer angiogenesis drug also includes pharmaceutically acceptable excipients.
Citation Information
Patent Citations
Recombinant fusion protein targeting CD47 and PCSK9 and application
CN116478299A